HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Porphyromonas gingivalis (GCA_900157325.1)

Select a Genome:
BAKTA Annotations for GCA_900157325.1
Genome Selected: Porphyromonas gingivalis
ContigsBases CDSrRNA tmRNAtRNA
56 2343280 2002 3 1 47
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4129 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:4]    |    Number of Records Found: 4129 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1501 FUFC01000017.1 GCA900157325_00715 gene open 15719-16069 mazG
1502 FUFC01000017.1 GCA900157325_00716 gene open 16074-16526 dtd
1503 FUFC01000017.1 GCA900157325_00717 gene open 16533-18335 uvrC
1504 FUFC01000017.1 GCA900157325_00718 gene open 18366-20243 mnmG
1505 FUFC01000017.1 GCA900157325_00719 gene open 20981-22564
1506 FUFC01000017.1 GCA900157325_00720 gene open 22566-22802
1507 FUFC01000017.1 GCA900157325_00721 gene open 22815-24113
1508 FUFC01000017.1 GCA900157325_00722 gene open 24113-25720 cas10
1509 FUFC01000017.1 GCA900157325_00723 gene open 25722-26936 cmr3
1510 FUFC01000017.1 GCA900157325_00724 gene open 26950-27675 cmr4
1511 FUFC01000017.1 GCA900157325_00725 gene open 27672-28112
1512 FUFC01000017.1 GCA900157325_00726 gene open 28109-28870 cmr6
1513 FUFC01000017.1 GCA900157325_00727 gene open 28932-32027 cas1
1514 FUFC01000017.1 GCA900157325_00728 gene open 32047-32337 cas2
1515 FUFC01000017.1 GCA900157325_00729 gene open 34213-36219
1516 FUFC01000017.1 GCA900157325_00730 gene open 36585-37640 hagC
1517 FUFC01000017.1 GCA900157325_00731 gene open 37919-38944
1518 FUFC01000017.1 GCA900157325_00732 gene open 38956-39591
1519 FUFC01000017.1 GCA900157325_00733 gene open 39735-40787 hagC
1520 FUFC01000017.1 GCA900157325_00734 gene open 41340-42296 cTD-A
1521 FUFC01000017.1 GCA900157325_00735 gene open 42389-43276 bepA
1522 FUFC01000017.1 GCA900157325_00736 gene open 43378-44376 mscS
1523 FUFC01000017.1 GCA900157325_00737 gene open 44337-46133
1524 FUFC01000017.1 GCA900157325_00738 gene open 46130-47536 wcaJ
1525 FUFC01000017.1 GCA900157325_00739 gene open 47533-48108 tsaC
1526 FUFC01000017.1 GCA900157325_00740 gene open 48234-49646
1527 FUFC01000017.1 GCA900157325_00741 gene open 49942-50553
1528 FUFC01000017.1 GCA900157325_00742 gene open 50750-53017 pitA
1529 FUFC01000017.1 GCA900157325_00743 gene open 53240-53479 rpmB
1530 FUFC01000017.1 GCA900157325_00744 gene open 53499-53687 rpmG
1531 FUFC01000017.1 GCA900157325_00745 gene open 53706-53855
1532 FUFC01000017.1 GCA900157325_00746 gene open 53975-54112
1533 FUFC01000017.1 GCA900157325_00747 gene open 54254-54349
1534 FUFC01000017.1 GCA900157325_00748 gene open 54394-55689 aCH1
1535 FUFC01000017.1 GCA900157325_00749 gene open 55834-55935
1536 FUFC01000017.1 GCA900157325_00750 gene open 56279-57298 wcaG
1537 FUFC01000017.1 GCA900157325_00751 gene open 57302-58237 yitT
1538 FUFC01000017.1 GCA900157325_00752 gene open 58295-58942 dedA
1539 FUFC01000017.1 GCA900157325_00753 gene open 58970-60670 glnS
1540 FUFC01000017.1 GCA900157325_00754 gene open 61052-62212 perM
1541 FUFC01000017.1 GCA900157325_00755 gene open 62674-63678 mdh
1542 FUFC01000017.1 GCA900157325_00756 gene open 63954-65375 pldB
1543 FUFC01000017.1 GCA900157325_00757 gene open 65400-68882 porW
1544 FUFC01000017.1 GCA900157325_00758 gene open 68875-69681 znuB
1545 FUFC01000017.1 GCA900157325_00759 gene open 69674-70117
1546 FUFC01000017.1 GCA900157325_00760 gene open 70139-71446 aroA
1547 FUFC01000017.1 GCA900157325_00761 gene open 71604-72890
1548 FUFC01000017.1 GCA900157325_00762 gene open 72806-73165
1549 FUFC01000017.1 GCA900157325_00763 gene open 73484-73888 rpsL
1550 FUFC01000017.1 GCA900157325_00764 gene open 74124-74600 rpsG
1551 FUFC01000017.1 GCA900157325_00765 gene open 74613-76736 fusA
1552 FUFC01000017.1 GCA900157325_00766 gene open 76752-77057 rpsJ
1553 FUFC01000017.1 GCA900157325_00767 gene open 77080-77697 rplC
1554 FUFC01000017.1 GCA900157325_00768 gene open 77697-78326 rplD
1555 FUFC01000017.1 GCA900157325_00769 gene open 78341-78634 rplW
1556 FUFC01000017.1 GCA900157325_00770 gene open 78641-79465 rplB
1557 FUFC01000017.1 GCA900157325_00771 gene open 79488-79757 rpsS
1558 FUFC01000017.1 GCA900157325_00772 gene open 79812-80216 rplV
1559 FUFC01000017.1 GCA900157325_00773 gene open 80223-80963 rpsC
1560 FUFC01000017.1 GCA900157325_00774 gene open 80984-81418 rplP
1561 FUFC01000017.1 GCA900157325_00775 gene open 81424-81618 rpmC
1562 FUFC01000017.1 GCA900157325_00776 gene open 81632-81886 rpsQ
1563 FUFC01000017.1 GCA900157325_00777 gene open 81888-82253 rplN
1564 FUFC01000017.1 GCA900157325_00778 gene open 82312-82596 rplX
1565 FUFC01000017.1 GCA900157325_00779 gene open 82596-83156 rplE
1566 FUFC01000017.1 GCA900157325_00780 gene open 83158-83427 rpsN
1567 FUFC01000017.1 GCA900157325_00781 gene open 83478-83873 rpsH
1568 FUFC01000017.1 GCA900157325_00782 gene open 83892-84443 rplF
1569 FUFC01000017.1 GCA900157325_00783 gene open 84462-84806 rplR
1570 FUFC01000017.1 GCA900157325_00784 gene open 84812-85330 rpsE
1571 FUFC01000017.1 GCA900157325_00785 gene open 85552-85998 rplO
1572 FUFC01000017.1 GCA900157325_00786 gene open 86003-87343 secY
1573 FUFC01000017.1 GCA900157325_00787 gene open 87343-88128 map
1574 FUFC01000017.1 GCA900157325_00788 gene open 88131-88349 infA
1575 FUFC01000017.1 GCA900157325_00789 gene open 88366-88482 ykgO
1576 FUFC01000017.1 GCA900157325_00790 gene open 88515-88895 rpsM
1577 FUFC01000017.1 GCA900157325_00791 gene open 88907-89293 rpsK
1578 FUFC01000017.1 GCA900157325_00792 gene open 89453-90058 rpsD
1579 FUFC01000017.1 GCA900157325_00793 gene open 90071-91063 rpoA
1580 FUFC01000017.1 GCA900157325_00794 gene open 91069-91551 rplQ
1581 FUFC01000017.1 GCA900157325_00795 gene open 91838-92074
1582 FUFC01000018.1 GCA900157325_00398 gene open 27606-27712 Bacteroidales_small_SRP
1583 FUFC01000018.1 GCA900157325_00468 gene open 112144-112542 RNaseP_bact_a
1584 FUFC01000018.1 GCA900157325_00398 ncRNA open 27606-27712 Bacteroidales small SRP
1585 FUFC01000018.1 GCA900157325_00468 ncRNA open 112144-112542 Bacterial RNase P class A
1586 FUFC01000018.1 repeat_region open 5870-6056 CRISPR array with 3 repeats of length 39%2C consensus sequence ATAGTTGTCTCCACCCTTCTAACTAAGGGTATTCCCAAC and spacer length 27
1587 FUFC01000018.1 repeat_region open 6203-6446 CRISPR array with 4 repeats of length 37%2C consensus sequence GTTGTCTCCACCCTTCTAACTAAGGGTATTCCCAACA and spacer length 29
1588 FUFC01000018.1 GCA900157325_00375 CDS open 227-1276 _na     349_aa cbiB adenosylcobinamide-phosphate synthase CbiB
1589 FUFC01000018.1 GCA900157325_00376 CDS open 1251-2258 _na     335_aa cobD threonine-phosphate decarboxylase CobD
1590 FUFC01000018.1 GCA900157325_00377 CDS open 2251-3717 _na     488_aa cobyric acid synthase
1591 FUFC01000018.1 GCA900157325_00378 CDS open 3744-4310 _na     188_aa pduO Corrinoid adenosyltransferase
1592 FUFC01000018.1 GCA900157325_00379 CDS open 4333-5652 _na     439_aa cobB cobyrinate a%2Cc-diamide synthase
1593 FUFC01000018.1 GCA900157325_00380 CDS open 9848-10294 _na     148_aa csx27 CRISPR-associated protein Csx27
1594 FUFC01000018.1 GCA900157325_00381 CDS open 10635-10856 _na     73_aa 30S ribosomal protein S21 domain protein
1595 FUFC01000018.1 GCA900157325_00382 CDS open 11551-12423 _na     290_aa serB phosphoserine phosphatase SerB
1596 FUFC01000018.1 GCA900157325_00383 CDS open 12743-13483 _na     246_aa glpC Oxidoreductase%2C putative
1597 FUFC01000018.1 GCA900157325_00384 CDS open 13480-14847 _na     455_aa lutB Putative electron transport protein
1598 FUFC01000018.1 GCA900157325_00385 CDS open 14853-15437 _na     194_aa lutC LUD domain-containing protein
1599 FUFC01000018.1 GCA900157325_00386 CDS open 15548-16021 _na     157_aa paaI Thioesterase family protein
1600 FUFC01000018.1 GCA900157325_00387 CDS open 16357-18375 _na     672_aa ompA OmpA family protein
1601 FUFC01000018.1 GCA900157325_00388 CDS open 18397-18990 _na     197_aa queE 7-carboxy-7-deazaguanine synthase
1602 FUFC01000018.1 GCA900157325_00389 CDS open 19010-19429 _na     139_aa queD 6-carboxy-5%2C6%2C7%2C8-tetrahydropterin synthase
1603 FUFC01000018.1 GCA900157325_00390 CDS open 19812-21245 _na     477_aa C2 family cysteine protease
1604 FUFC01000018.1 GCA900157325_00391 CDS open 21743-22429 _na     228_aa crp Transcriptional regulator%2C putative
1605 FUFC01000018.1 GCA900157325_00392 CDS open 22446-22802 _na     118_aa soxR Transcriptional regulator%2C putative
1606 FUFC01000018.1 GCA900157325_00393 CDS open 22867-24282 _na     471_aa O-antigen ligase-related domain-containing protein
1607 FUFC01000018.1 GCA900157325_00394 CDS open 24324-25181 _na     285_aa Lipoprotein
1608 FUFC01000018.1 GCA900157325_00395 CDS open 25227-26105 _na     292_aa mlaD Mce/MlaD domain-containing protein
1609 FUFC01000018.1 GCA900157325_00396 CDS open 26146-27336 _na     396_aa amiC N-acetylmuramoyl-L-alanine amidase%2C family 3
1610 FUFC01000018.1 GCA900157325_00399 CDS open 28682-29614 _na     310_aa feoA Iron dependent repressor%2C putative
1611 FUFC01000018.1 GCA900157325_00400 CDS open 29723-31825 _na     700_aa feoB ferrous iron transport protein B
1612 FUFC01000018.1 GCA900157325_00401 CDS open 31862-33508 _na     548_aa rfaB Glycosyltransferase
1613 FUFC01000018.1 GCA900157325_00402 CDS open 33577-34530 _na     317_aa eCM27 K+-dependent Na+/Ca+ exchanger related-protein
1614 FUFC01000018.1 GCA900157325_00403 CDS open 34551-35015 _na     154_aa argR Arginine repressor
1615 FUFC01000018.1 GCA900157325_00404 CDS open 35448-37175 _na     575_aa opgE Sulfatase N-terminal domain-containing protein
1616 FUFC01000018.1 GCA900157325_00405 CDS open 37409-39706 _na     765_aa uvrD DNA 3'-5' helicase
1617 FUFC01000018.1 GCA900157325_00406 CDS open 39706-41085 _na     459_aa SWIM-type domain-containing protein
1618 FUFC01000018.1 GCA900157325_00407 CDS open 41111-44014 _na     967_aa uvrA excinuclease ABC subunit UvrA
1619 FUFC01000018.1 GCA900157325_00408 CDS open 44085-45458 _na     457_aa cTD-B PKD domain protein
1620 FUFC01000018.1 GCA900157325_00409 CDS open 45553-46287 _na     244_aa mlaF Putative ABC transporter ATP-binding protein
1621 FUFC01000018.1 GCA900157325_00410 CDS open 46306-47052 _na     248_aa mlaE ABC transporter permease
1622 FUFC01000018.1 GCA900157325_00411 CDS open 47289-48629 _na     446_aa cTD-A T9SS C-terminal target domain-containing protein
1623 FUFC01000018.1 GCA900157325_00412 CDS open 49013-50710 _na     565_aa pilF Tetratricopeptide repeat protein
1624 FUFC01000018.1 GCA900157325_00413 CDS open 51121-51822 _na     233_aa DUF4276 domain-containing protein
1625 FUFC01000018.1 GCA900157325_00414 CDS open 51800-52888 _na     362_aa Conserved domain protein
1626 FUFC01000018.1 GCA900157325_00415 CDS open 53349-54362 _na     337_aa trpE aminodeoxychorismate synthase component I
1627 FUFC01000018.1 GCA900157325_00416 CDS open 54369-54968 _na     199_aa ilvE Aminotransferase%2C class IV
1628 FUFC01000018.1 GCA900157325_00417 CDS open 55011-56654 _na     547_aa DUF6850 domain-containing protein
1629 FUFC01000018.1 GCA900157325_00418 CDS open 56651-59461 _na     936_aa cirA TonB-dependent receptor
1630 FUFC01000018.1 GCA900157325_00419 CDS open 59633-60814 _na     393_aa DUF4876 domain-containing protein
1631 FUFC01000018.1 GCA900157325_00420 CDS open 61165-63891 _na     908_aa ppdK pyruvate%2C phosphate dikinase
1632 FUFC01000018.1 GCA900157325_00421 CDS open 64059-64202 _na     47_aa hypothetical protein
1633 FUFC01000018.1 GCA900157325_00422 CDS open 64257-66263 _na     668_aa SIR2-like domain-containing protein
1634 FUFC01000018.1 GCA900157325_00423 CDS open 66795-68291 _na     498_aa aCH1 Acetyl-CoA hydrolase/transferase family protein
1635 FUFC01000018.1 GCA900157325_00424 CDS open 68595-69986 _na     463_aa miaB tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB
1636 FUFC01000018.1 GCA900157325_00425 CDS open 70898-71725 _na     275_aa rbbA ABC transporter%2C ATP-binding protein
1637 FUFC01000018.1 GCA900157325_00426 CDS open 71739-72593 _na     284_aa ABC transporter permease
1638 FUFC01000018.1 GCA900157325_00427 CDS open 72590-73348 _na     252_aa ABC transporter permease
1639 FUFC01000018.1 GCA900157325_00428 CDS open 73345-73716 _na     123_aa yhcF Putative transcriptional regulator
1640 FUFC01000018.1 GCA900157325_00429 CDS open 73722-73820 _na     32_aa hypothetical protein
1641 FUFC01000018.1 GCA900157325_00430 CDS open 73936-76440 _na     834_aa cirA TonB-dependent receptor
1642 FUFC01000018.1 GCA900157325_00431 CDS open 76471-77211 _na     246_aa Putative auto-transporter adhesin head GIN domain-containing protein
1643 FUFC01000018.1 GCA900157325_00432 CDS open 77501-79780 _na     759_aa dAP2 Prolyl oligopeptidase family protein
1644 FUFC01000018.1 GCA900157325_00433 CDS open 79939-80931 _na     330_aa Nitroreductase domain-containing protein
1645 FUFC01000018.1 GCA900157325_00434 CDS open 81245-81415 _na     56_aa hypothetical protein
1646 FUFC01000018.1 GCA900157325_00435 CDS open 81420-81956 _na     178_aa dfsB ClbS/DfsB family four-helix bundle protein
1647 FUFC01000018.1 GCA900157325_00436 CDS open 81960-82592 _na     210_aa alkC DNA alkylation repair enzyme
1648 FUFC01000018.1 GCA900157325_00437 CDS open 82615-83157 _na     180_aa HXXEE domain-containing protein
1649 FUFC01000018.1 GCA900157325_00438 CDS open 83162-83257 _na     31_aa hypothetical protein
1650 FUFC01000018.1 GCA900157325_00439 CDS open 83254-83568 _na     104_aa HTH cro/C1-type domain-containing protein
1651 FUFC01000018.1 GCA900157325_00440 CDS open 84778-85158 _na     126_aa transposase family protein
1652 FUFC01000018.1 GCA900157325_00441 CDS open 85539-87500 _na     653_aa thrS threonine--tRNA ligase
1653 FUFC01000018.1 GCA900157325_00442 CDS open 87605-88210 _na     201_aa infC translation initiation factor IF-3
1654 FUFC01000018.1 GCA900157325_00443 CDS open 88288-88485 _na     65_aa rpmI 50S ribosomal protein L35
1655 FUFC01000018.1 GCA900157325_00444 CDS open 88598-88945 _na     115_aa rplT 50S ribosomal protein L20
1656 FUFC01000018.1 GCA900157325_00445 CDS open 88820-89173 _na     117_aa hypothetical protein
1657 FUFC01000018.1 GCA900157325_00446 CDS open 89407-89976 _na     189_aa iS5 Partial transposase in ISPg1
1658 FUFC01000018.1 GCA900157325_00447 CDS open 90312-90491 _na     59_aa transposase
1659 FUFC01000018.1 GCA900157325_00448 CDS open 90448-90687 _na     79_aa hypothetical protein
1660 FUFC01000018.1 GCA900157325_00449 CDS open 90817-91593 _na     258_aa DUF4252 domain-containing protein
1661 FUFC01000018.1 GCA900157325_00450 CDS open 91609-92166 _na     185_aa hypothetical protein
1662 FUFC01000018.1 GCA900157325_00452 CDS open 93717-96041 _na     774_aa bamA Bacterial surface antigen (D15) domain-containing protein
1663 FUFC01000018.1 GCA900157325_00453 CDS open 96069-96818 _na     249_aa aroE Shikimate dehydrogenase
1664 FUFC01000018.1 GCA900157325_00454 CDS open 96815-97552 _na     245_aa ubiE bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1%2C4-benzoquinol methylase UbiE
1665 FUFC01000018.1 GCA900157325_00455 CDS open 97584-98525 _na     313_aa purC phosphoribosylaminoimidazolesuccinocarboxamide synthase
1666 FUFC01000018.1 GCA900157325_00456 CDS open 98582-99574 _na     330_aa phoH PhoH-like protein
1667 FUFC01000018.1 GCA900157325_00457 CDS open 100198-102513 _na     771_aa GH92 family glycosyl hydrolase
1668 FUFC01000018.1 GCA900157325_00458 CDS open 102652-103869 _na     405_aa queA tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA
1669 FUFC01000018.1 GCA900157325_00460 CDS open 104275-105192 _na     305_aa mrr Mrr restriction system protein
1670 FUFC01000018.1 GCA900157325_00461 CDS open 106362-107027 _na     221_aa psd phosphatidylserine decarboxylase family protein
1671 FUFC01000018.1 GCA900157325_00462 CDS open 107029-107739 _na     236_aa pssA CDP-diacylglycerol--serine O-phosphatidyltransferase
1672 FUFC01000018.1 GCA900157325_00463 CDS open 107806-108051 _na     81_aa DUF4834 domain-containing protein
1673 FUFC01000018.1 GCA900157325_00464 CDS open 108332-109813 _na     493_aa proS proline--tRNA ligase
1674 FUFC01000018.1 GCA900157325_00465 CDS open 109868-110197 _na     109_aa Self-protective colicin-like immunity protein
1675 FUFC01000018.1 GCA900157325_00466 CDS open 110212-110979 _na     255_aa trmB tRNA (guanosine(46)-N7)-methyltransferase TrmB
1676 FUFC01000018.1 GCA900157325_00467 CDS open 110999-112117 _na     372_aa mrp Iron-sulfur cluster carrier protein
1677 FUFC01000018.1 GCA900157325_00469 CDS open 112578-114005 _na     475_aa brkB Ribonuclease BN%2C putative
1678 FUFC01000018.1 GCA900157325_00470 CDS open 114039-115010 _na     323_aa ribF riboflavin biosynthesis protein RibF
1679 FUFC01000018.1 GCA900157325_00471 CDS open 114998-116293 _na     431_aa envC Peptidase M24
1680 FUFC01000018.1 GCA900157325_00472 CDS open 116305-117168 _na     287_aa DUF4292 domain-containing protein
1681 FUFC01000018.1 GCA900157325_00473 CDS open 117165-118904 _na     579_aa tadD TPR domain protein
1682 FUFC01000018.1 GCA900157325_00474 CDS open 118932-119366 _na     144_aa dut dUTP diphosphatase
1683 FUFC01000018.1 GCA900157325_00475 CDS open 119423-121168 _na     581_aa ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase
1684 FUFC01000018.1 GCA900157325_00476 CDS open 121343-121849 _na     168_aa purE N5-carboxyaminoimidazole ribonucleotide mutase
1685 FUFC01000018.1 GCA900157325_00477 CDS open 121850-122230 _na     126_aa gcvH glycine cleavage system protein GcvH
1686 FUFC01000018.1 GCA900157325_00478 CDS open 122399-123406 _na     335_aa holA DNA polymerase III subunit delta
1687 FUFC01000018.1 GCA900157325_00479 CDS open 123425-124201 _na     258_aa mtnN AMP nucleosidase
1688 FUFC01000018.1 GCA900157325_00480 CDS open 124269-124742 _na     157_aa Type I restriction enzyme R protein N-terminal domain-containing protein
1689 FUFC01000018.1 GCA900157325_00481 CDS open 124745-125704 _na     319_aa yhaQ ABC transporter%2C ATP-binding protein
1690 FUFC01000018.1 GCA900157325_00482 CDS open 125709-127037 _na     442_aa natB ABC transporter%2C permease protein%2C putative
1691 FUFC01000018.1 GCA900157325_00483 CDS open 126903-127499 _na     198_aa hypothetical protein
1692 FUFC01000018.1 GCA900157325_00484 CDS open 127690-130446 _na     918_aa mgtA calcium-translocating P-type ATPase%2C PMCA-type
1693 FUFC01000018.1 GCA900157325_00485 CDS open 130446-131168 _na     240_aa DUF5020 domain-containing protein
1694 FUFC01000018.1 GCA900157325_00486 CDS open 131189-132490 _na     433_aa nCS2 Xanthine/uracil permease family protein
1695 FUFC01000018.1 GCA900157325_00487 CDS open 132519-133343 _na     274_aa ispE 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase
1696 FUFC01000018.1 GCA900157325_00488 CDS open 133373-135226 _na     617_aa ygiQ YgiQ family radical SAM protein
1697 FUFC01000018.1 GCA900157325_00489 CDS open 135434-137593 _na     719_aa fusA Tetracycline resistance protein TetQ
1698 FUFC01000018.1 GCA900157325_00490 CDS open 137838-138983 _na     381_aa dnaX DNA polymerase III subunit delta
1699 FUFC01000018.1 GCA900157325_00491 CDS open 139449-140090 _na     213_aa HU domain-containing protein
1700 FUFC01000018.1 GCA900157325_00492 CDS open 140098-140391 _na     97_aa hypothetical protein
1701 FUFC01000018.1 GCA900157325_00493 CDS open 140573-141703 _na     376_aa ATP-binding protein
1702 FUFC01000018.1 GCA900157325_00494 CDS open 141793-143349 _na     518_aa porX Response regulator
1703 FUFC01000018.1 GCA900157325_00495 CDS open 143361-143777 _na     138_aa tsaE tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE
1704 FUFC01000018.1 GCA900157325_00496 CDS open 143777-144004 _na     75_aa Immunity protein 17
1705 FUFC01000018.1 GCA900157325_00497 CDS open 144132-144746 _na     204_aa tdk thymidine kinase
1706 FUFC01000018.1 GCA900157325_00498 CDS open 144743-145558 _na     271_aa 5'-nucleotidase%2C lipoprotein e(P4) family
1707 FUFC01000018.1 GCA900157325_00499 CDS open 145597-145932 _na     111_aa rbfA 30S ribosome-binding factor RbfA
1708 FUFC01000018.1 GCA900157325_00500 CDS open 145960-147183 _na     407_aa lolE ABC3 transporter permease C-terminal domain-containing protein
1709 FUFC01000018.1 GCA900157325_00501 CDS open 147329-148066 _na     245_aa wcaA Glycosyl transferase family 2
1710 FUFC01000018.1 GCA900157325_00502 CDS open 148077-149426 _na     449_aa allB dihydroorotase
1711 FUFC01000018.1 GCA900157325_00503 CDS open 149593-150348 _na     251_aa hypothetical protein
1712 FUFC01000018.1 GCA900157325_00504 CDS open 150314-150709 _na     131_aa gtrA GtrA family protein
1713 FUFC01000018.1 GCA900157325_00506 CDS open 151275-151742 _na     155_aa hypothetical protein
1714 FUFC01000018.1 GCA900157325_00507 CDS open 151972-152685 _na     237_aa Histidine kinase
1715 FUFC01000018.1 GCA900157325_00508 CDS open 153033-154598 _na     521_aa Polysaccharide biosynthesis protein
1716 FUFC01000018.1 GCA900157325_00509 CDS open 154723-155295 _na     190_aa FHA domain protein
1717 FUFC01000018.1 GCA900157325_00510 CDS open 155350-156651 _na     433_aa cdsB UPF0597 protein PG_0909
1718 FUFC01000018.1 GCA900157325_00511 CDS open 156668-157159 _na     163_aa mug DNA-deoxyinosine glycosylase
1719 FUFC01000018.1 GCA900157325_00512 CDS open 157194-157295 _na     33_aa hypothetical protein
1720 FUFC01000018.1 GCA900157325_00513 CDS open 157271-157723 _na     150_aa cutF Lipoprotein
1721 FUFC01000018.1 GCA900157325_00514 CDS open 157784-158128 _na     114_aa hypothetical protein
1722 FUFC01000018.1 GCA900157325_00515 CDS open 158747-159289 _na     180_aa pdaD Pyruvoyl-dependent arginine decarboxylase AaxB
1723 FUFC01000018.1 GCA900157325_00516 CDS open 159416-161641 _na     741_aa GH92 family glycosyl hydrolase
1724 FUFC01000018.1 GCA900157325_00517 CDS open 161821-162069 _na     82_aa DUF4492 domain-containing protein
1725 FUFC01000018.1 GCA900157325_00518 CDS open 162089-163678 _na     529_aa appC Cytochrome d ubiquinol oxidase%2C subunit I
1726 FUFC01000018.1 GCA900157325_00519 CDS open 163724-164887 _na     387_aa appB Cytochrome d ubiquinol oxidase%2C subunit II
1727 FUFC01000018.1 GCA900157325_00520 CDS open 165034-165825 _na     263_aa rssA PNPLA domain-containing protein
1728 FUFC01000018.1 GCA900157325_00521 CDS open 165840-167516 _na     558_aa amyA Alpha-amylase
1729 FUFC01000018.1 GCA900157325_00522 CDS open 168054-171260 _na     1068_aa lacZ Beta-galactosidase
1730 FUFC01000018.1 GCA900157325_00524 CDS open 171633-172325 _na     230_aa radC DNA repair protein RadC
1731 FUFC01000018.1 GCA900157325_00525 CDS open 172561-174201 _na     546_aa hcp hydroxylamine reductase
1732 FUFC01000018.1 GCA900157325_00526 CDS open 174588-174761 _na     57_aa hypothetical protein
1733 FUFC01000018.1 GCA900157325_00527 CDS open 175122-175766 _na     214_aa transposase
1734 FUFC01000018.1 GCA900157325_00375 gene open 227-1276 cbiB
1735 FUFC01000018.1 GCA900157325_00376 gene open 1251-2258 cobD
1736 FUFC01000018.1 GCA900157325_00377 gene open 2251-3717
1737 FUFC01000018.1 GCA900157325_00378 gene open 3744-4310 pduO
1738 FUFC01000018.1 GCA900157325_00379 gene open 4333-5652 cobB
1739 FUFC01000018.1 GCA900157325_00380 gene open 9848-10294 csx27
1740 FUFC01000018.1 GCA900157325_00381 gene open 10635-10856
1741 FUFC01000018.1 GCA900157325_00382 gene open 11551-12423 serB
1742 FUFC01000018.1 GCA900157325_00383 gene open 12743-13483 glpC
1743 FUFC01000018.1 GCA900157325_00384 gene open 13480-14847 lutB
1744 FUFC01000018.1 GCA900157325_00385 gene open 14853-15437 lutC
1745 FUFC01000018.1 GCA900157325_00386 gene open 15548-16021 paaI
1746 FUFC01000018.1 GCA900157325_00387 gene open 16357-18375 ompA
1747 FUFC01000018.1 GCA900157325_00388 gene open 18397-18990 queE
1748 FUFC01000018.1 GCA900157325_00389 gene open 19010-19429 queD
1749 FUFC01000018.1 GCA900157325_00390 gene open 19812-21245
1750 FUFC01000018.1 GCA900157325_00391 gene open 21743-22429 crp
1751 FUFC01000018.1 GCA900157325_00392 gene open 22446-22802 soxR
1752 FUFC01000018.1 GCA900157325_00393 gene open 22867-24282
1753 FUFC01000018.1 GCA900157325_00394 gene open 24324-25181
1754 FUFC01000018.1 GCA900157325_00395 gene open 25227-26105 mlaD
1755 FUFC01000018.1 GCA900157325_00396 gene open 26146-27336 amiC
1756 FUFC01000018.1 GCA900157325_00399 gene open 28682-29614 feoA
1757 FUFC01000018.1 GCA900157325_00400 gene open 29723-31825 feoB
1758 FUFC01000018.1 GCA900157325_00401 gene open 31862-33508 rfaB
1759 FUFC01000018.1 GCA900157325_00402 gene open 33577-34530 eCM27
1760 FUFC01000018.1 GCA900157325_00403 gene open 34551-35015 argR
1761 FUFC01000018.1 GCA900157325_00404 gene open 35448-37175 opgE
1762 FUFC01000018.1 GCA900157325_00405 gene open 37409-39706 uvrD
1763 FUFC01000018.1 GCA900157325_00406 gene open 39706-41085
1764 FUFC01000018.1 GCA900157325_00407 gene open 41111-44014 uvrA
1765 FUFC01000018.1 GCA900157325_00408 gene open 44085-45458 cTD-B
1766 FUFC01000018.1 GCA900157325_00409 gene open 45553-46287 mlaF
1767 FUFC01000018.1 GCA900157325_00410 gene open 46306-47052 mlaE
1768 FUFC01000018.1 GCA900157325_00411 gene open 47289-48629 cTD-A
1769 FUFC01000018.1 GCA900157325_00412 gene open 49013-50710 pilF
1770 FUFC01000018.1 GCA900157325_00413 gene open 51121-51822
1771 FUFC01000018.1 GCA900157325_00414 gene open 51800-52888
1772 FUFC01000018.1 GCA900157325_00415 gene open 53349-54362 trpE
1773 FUFC01000018.1 GCA900157325_00416 gene open 54369-54968 ilvE
1774 FUFC01000018.1 GCA900157325_00417 gene open 55011-56654
1775 FUFC01000018.1 GCA900157325_00418 gene open 56651-59461 cirA
1776 FUFC01000018.1 GCA900157325_00419 gene open 59633-60814
1777 FUFC01000018.1 GCA900157325_00420 gene open 61165-63891 ppdK
1778 FUFC01000018.1 GCA900157325_00421 gene open 64059-64202
1779 FUFC01000018.1 GCA900157325_00422 gene open 64257-66263
1780 FUFC01000018.1 GCA900157325_00423 gene open 66795-68291 aCH1
1781 FUFC01000018.1 GCA900157325_00424 gene open 68595-69986 miaB
1782 FUFC01000018.1 GCA900157325_00425 gene open 70898-71725 rbbA
1783 FUFC01000018.1 GCA900157325_00426 gene open 71739-72593
1784 FUFC01000018.1 GCA900157325_00427 gene open 72590-73348
1785 FUFC01000018.1 GCA900157325_00428 gene open 73345-73716 yhcF
1786 FUFC01000018.1 GCA900157325_00429 gene open 73722-73820
1787 FUFC01000018.1 GCA900157325_00430 gene open 73936-76440 cirA
1788 FUFC01000018.1 GCA900157325_00431 gene open 76471-77211
1789 FUFC01000018.1 GCA900157325_00432 gene open 77501-79780 dAP2
1790 FUFC01000018.1 GCA900157325_00433 gene open 79939-80931
1791 FUFC01000018.1 GCA900157325_00434 gene open 81245-81415
1792 FUFC01000018.1 GCA900157325_00435 gene open 81420-81956 dfsB
1793 FUFC01000018.1 GCA900157325_00436 gene open 81960-82592 alkC
1794 FUFC01000018.1 GCA900157325_00437 gene open 82615-83157
1795 FUFC01000018.1 GCA900157325_00438 gene open 83162-83257
1796 FUFC01000018.1 GCA900157325_00439 gene open 83254-83568
1797 FUFC01000018.1 GCA900157325_00440 gene open 84778-85158
1798 FUFC01000018.1 GCA900157325_00441 gene open 85539-87500 thrS
1799 FUFC01000018.1 GCA900157325_00442 gene open 87605-88210 infC
1800 FUFC01000018.1 GCA900157325_00443 gene open 88288-88485 rpmI
1801 FUFC01000018.1 GCA900157325_00444 gene open 88598-88945 rplT
1802 FUFC01000018.1 GCA900157325_00445 gene open 88820-89173
1803 FUFC01000018.1 GCA900157325_00446 gene open 89407-89976 iS5
1804 FUFC01000018.1 GCA900157325_00447 gene open 90312-90491
1805 FUFC01000018.1 GCA900157325_00448 gene open 90448-90687
1806 FUFC01000018.1 GCA900157325_00449 gene open 90817-91593
1807 FUFC01000018.1 GCA900157325_00450 gene open 91609-92166
1808 FUFC01000018.1 GCA900157325_00452 gene open 93717-96041 bamA
1809 FUFC01000018.1 GCA900157325_00453 gene open 96069-96818 aroE
1810 FUFC01000018.1 GCA900157325_00454 gene open 96815-97552 ubiE
1811 FUFC01000018.1 GCA900157325_00455 gene open 97584-98525 purC
1812 FUFC01000018.1 GCA900157325_00456 gene open 98582-99574 phoH
1813 FUFC01000018.1 GCA900157325_00457 gene open 100198-102513
1814 FUFC01000018.1 GCA900157325_00458 gene open 102652-103869 queA
1815 FUFC01000018.1 GCA900157325_00460 gene open 104275-105192 mrr
1816 FUFC01000018.1 GCA900157325_00461 gene open 106362-107027 psd
1817 FUFC01000018.1 GCA900157325_00462 gene open 107029-107739 pssA
1818 FUFC01000018.1 GCA900157325_00463 gene open 107806-108051
1819 FUFC01000018.1 GCA900157325_00464 gene open 108332-109813 proS
1820 FUFC01000018.1 GCA900157325_00465 gene open 109868-110197
1821 FUFC01000018.1 GCA900157325_00466 gene open 110212-110979 trmB
1822 FUFC01000018.1 GCA900157325_00467 gene open 110999-112117 mrp
1823 FUFC01000018.1 GCA900157325_00469 gene open 112578-114005 brkB
1824 FUFC01000018.1 GCA900157325_00470 gene open 114039-115010 ribF
1825 FUFC01000018.1 GCA900157325_00471 gene open 114998-116293 envC
1826 FUFC01000018.1 GCA900157325_00472 gene open 116305-117168
1827 FUFC01000018.1 GCA900157325_00473 gene open 117165-118904 tadD
1828 FUFC01000018.1 GCA900157325_00474 gene open 118932-119366 dut
1829 FUFC01000018.1 GCA900157325_00475 gene open 119423-121168 ispG
1830 FUFC01000018.1 GCA900157325_00476 gene open 121343-121849 purE
1831 FUFC01000018.1 GCA900157325_00477 gene open 121850-122230 gcvH
1832 FUFC01000018.1 GCA900157325_00478 gene open 122399-123406 holA
1833 FUFC01000018.1 GCA900157325_00479 gene open 123425-124201 mtnN
1834 FUFC01000018.1 GCA900157325_00480 gene open 124269-124742
1835 FUFC01000018.1 GCA900157325_00481 gene open 124745-125704 yhaQ
1836 FUFC01000018.1 GCA900157325_00482 gene open 125709-127037 natB
1837 FUFC01000018.1 GCA900157325_00483 gene open 126903-127499
1838 FUFC01000018.1 GCA900157325_00484 gene open 127690-130446 mgtA
1839 FUFC01000018.1 GCA900157325_00485 gene open 130446-131168
1840 FUFC01000018.1 GCA900157325_00486 gene open 131189-132490 nCS2
1841 FUFC01000018.1 GCA900157325_00487 gene open 132519-133343 ispE
1842 FUFC01000018.1 GCA900157325_00488 gene open 133373-135226 ygiQ
1843 FUFC01000018.1 GCA900157325_00489 gene open 135434-137593 fusA
1844 FUFC01000018.1 GCA900157325_00490 gene open 137838-138983 dnaX
1845 FUFC01000018.1 GCA900157325_00491 gene open 139449-140090
1846 FUFC01000018.1 GCA900157325_00492 gene open 140098-140391
1847 FUFC01000018.1 GCA900157325_00493 gene open 140573-141703
1848 FUFC01000018.1 GCA900157325_00494 gene open 141793-143349 porX
1849 FUFC01000018.1 GCA900157325_00495 gene open 143361-143777 tsaE
1850 FUFC01000018.1 GCA900157325_00496 gene open 143777-144004
1851 FUFC01000018.1 GCA900157325_00497 gene open 144132-144746 tdk
1852 FUFC01000018.1 GCA900157325_00498 gene open 144743-145558
1853 FUFC01000018.1 GCA900157325_00499 gene open 145597-145932 rbfA
1854 FUFC01000018.1 GCA900157325_00500 gene open 145960-147183 lolE
1855 FUFC01000018.1 GCA900157325_00501 gene open 147329-148066 wcaA
1856 FUFC01000018.1 GCA900157325_00502 gene open 148077-149426 allB
1857 FUFC01000018.1 GCA900157325_00503 gene open 149593-150348
1858 FUFC01000018.1 GCA900157325_00504 gene open 150314-150709 gtrA
1859 FUFC01000018.1 GCA900157325_00506 gene open 151275-151742
1860 FUFC01000018.1 GCA900157325_00507 gene open 151972-152685
1861 FUFC01000018.1 GCA900157325_00508 gene open 153033-154598
1862 FUFC01000018.1 GCA900157325_00509 gene open 154723-155295
1863 FUFC01000018.1 GCA900157325_00510 gene open 155350-156651 cdsB
1864 FUFC01000018.1 GCA900157325_00511 gene open 156668-157159 mug
1865 FUFC01000018.1 GCA900157325_00512 gene open 157194-157295
1866 FUFC01000018.1 GCA900157325_00513 gene open 157271-157723 cutF
1867 FUFC01000018.1 GCA900157325_00514 gene open 157784-158128
1868 FUFC01000018.1 GCA900157325_00515 gene open 158747-159289 pdaD
1869 FUFC01000018.1 GCA900157325_00516 gene open 159416-161641
1870 FUFC01000018.1 GCA900157325_00517 gene open 161821-162069
1871 FUFC01000018.1 GCA900157325_00518 gene open 162089-163678 appC
1872 FUFC01000018.1 GCA900157325_00519 gene open 163724-164887 appB
1873 FUFC01000018.1 GCA900157325_00520 gene open 165034-165825 rssA
1874 FUFC01000018.1 GCA900157325_00521 gene open 165840-167516 amyA
1875 FUFC01000018.1 GCA900157325_00522 gene open 168054-171260 lacZ
1876 FUFC01000018.1 GCA900157325_00524 gene open 171633-172325 radC
1877 FUFC01000018.1 GCA900157325_00525 gene open 172561-174201 hcp
1878 FUFC01000018.1 GCA900157325_00526 gene open 174588-174761
1879 FUFC01000018.1 GCA900157325_00527 gene open 175122-175766
1880 FUFC01000018.1 GCA900157325_00397 gene open 27532-27605 trnT
1881 FUFC01000018.1 GCA900157325_00451 gene open 92982-93054 trnF
1882 FUFC01000018.1 GCA900157325_00459 gene open 104056-104137 trnL
1883 FUFC01000018.1 GCA900157325_00505 gene open 150765-150838 trnA
1884 FUFC01000018.1 GCA900157325_00523 gene open 171387-171460 trnI
1885 FUFC01000018.1 GCA900157325_00397 tRNA open 27532-27605 trnT tRNA-Thr(tgt)
1886 FUFC01000018.1 GCA900157325_00451 tRNA open 92982-93054 trnF tRNA-Phe(gaa)
1887 FUFC01000018.1 GCA900157325_00459 tRNA open 104056-104137 trnL tRNA-Leu(tag)
1888 FUFC01000018.1 GCA900157325_00505 tRNA open 150765-150838 trnA tRNA-Ala(ggc)
1889 FUFC01000018.1 GCA900157325_00523 tRNA open 171387-171460 trnI tRNA-Ile2(cat)
1890 FUFC01000019.1 GCA900157325_00338 CDS open 8-205 _na     65_aa hypothetical protein
1891 FUFC01000019.1 GCA900157325_00339 CDS open 548-844 _na     98_aa helix-turn-helix domain-containing protein
1892 FUFC01000019.1 GCA900157325_00340 CDS open 933-2036 _na     367_aa xerD Tyrosine recombinase XerD
1893 FUFC01000019.1 GCA900157325_00341 CDS open 2138-2836 _na     232_aa mobilization protein
1894 FUFC01000019.1 GCA900157325_00342 CDS open 2940-3302 _na     120_aa Excisionase
1895 FUFC01000019.1 GCA900157325_00343 CDS open 3309-4685 _na     458_aa DUF3987 domain-containing protein
1896 FUFC01000019.1 GCA900157325_00344 CDS open 4783-5841 _na     352_aa Topoisomerase
1897 FUFC01000019.1 GCA900157325_00345 CDS open 6291-7214 _na     307_aa Mobilization protein
1898 FUFC01000019.1 GCA900157325_00346 CDS open 7211-7906 _na     231_aa Viral A-type inclusion protein
1899 FUFC01000019.1 GCA900157325_00347 CDS open 8114-11254 _na     1046_aa SIR2-like domain-containing protein
1900 FUFC01000019.1 GCA900157325_00348 CDS open 11353-14280 _na     975_aa Type I restriction enzyme endonuclease subunit
1901 FUFC01000019.1 GCA900157325_00349 CDS open 14255-14632 _na     125_aa type I restriction endonuclease
1902 FUFC01000019.1 GCA900157325_00350 CDS open 14645-15763 _na     372_aa restriction endonuclease subunit S
1903 FUFC01000019.1 GCA900157325_00351 CDS open 15747-17051 _na     434_aa site-specific DNA-methyltransferase (adenine-specific)
1904 FUFC01000019.1 GCA900157325_00352 CDS open 17061-17339 _na     92_aa hypothetical protein
1905 FUFC01000019.1 GCA900157325_00353 CDS open 17341-18294 _na     317_aa hipA Serine/threonine-protein kinase HipA
1906 FUFC01000019.1 GCA900157325_00354 CDS open 18284-18619 _na     111_aa hipA Serine/threonine-protein kinase HipA
1907 FUFC01000019.1 GCA900157325_00355 CDS open 18616-18843 _na     75_aa aF2118 Transcriptional regulator%2C y4mF family
1908 FUFC01000019.1 GCA900157325_00356 CDS open 19066-20325 _na     419_aa hipA type II toxin-antitoxin system HipA family toxin
1909 FUFC01000019.1 GCA900157325_00357 CDS open 20329-20634 _na     101_aa DNA-binding helix-turn-helix protein
1910 FUFC01000019.1 GCA900157325_00358 CDS open 20979-21569 _na     196_aa serine hydrolase
1911 FUFC01000019.1 GCA900157325_00359 CDS open 21608-22513 _na     301_aa DUF6268 domain-containing protein
1912 FUFC01000019.1 GCA900157325_00360 CDS open 22636-22995 _na     119_aa Lipoprotein
1913 FUFC01000019.1 GCA900157325_00361 CDS open 23002-24204 _na     400_aa xerD Tyr recombinase domain-containing protein
1914 FUFC01000019.1 GCA900157325_00362 CDS open 24230-25480 _na     416_aa xerD Tyr recombinase domain-containing protein
1915 FUFC01000019.1 GCA900157325_00363 CDS open 25734-25997 _na     87_aa Tyr recombinase domain-containing protein
1916 FUFC01000019.1 GCA900157325_00364 CDS open 26038-26490 _na     150_aa DUF1896 domain-containing protein
1917 FUFC01000019.1 GCA900157325_00365 CDS open 26804-27133 _na     109_aa hypothetical protein
1918 FUFC01000019.1 GCA900157325_00338 gene open 8-205
1919 FUFC01000019.1 GCA900157325_00339 gene open 548-844
1920 FUFC01000019.1 GCA900157325_00340 gene open 933-2036 xerD
1921 FUFC01000019.1 GCA900157325_00341 gene open 2138-2836
1922 FUFC01000019.1 GCA900157325_00342 gene open 2940-3302
1923 FUFC01000019.1 GCA900157325_00343 gene open 3309-4685
1924 FUFC01000019.1 GCA900157325_00344 gene open 4783-5841
1925 FUFC01000019.1 GCA900157325_00345 gene open 6291-7214
1926 FUFC01000019.1 GCA900157325_00346 gene open 7211-7906
1927 FUFC01000019.1 GCA900157325_00347 gene open 8114-11254
1928 FUFC01000019.1 GCA900157325_00348 gene open 11353-14280
1929 FUFC01000019.1 GCA900157325_00349 gene open 14255-14632
1930 FUFC01000019.1 GCA900157325_00350 gene open 14645-15763
1931 FUFC01000019.1 GCA900157325_00351 gene open 15747-17051
1932 FUFC01000019.1 GCA900157325_00352 gene open 17061-17339
1933 FUFC01000019.1 GCA900157325_00353 gene open 17341-18294 hipA
1934 FUFC01000019.1 GCA900157325_00354 gene open 18284-18619 hipA
1935 FUFC01000019.1 GCA900157325_00355 gene open 18616-18843 aF2118
1936 FUFC01000019.1 GCA900157325_00356 gene open 19066-20325 hipA
1937 FUFC01000019.1 GCA900157325_00357 gene open 20329-20634
1938 FUFC01000019.1 GCA900157325_00358 gene open 20979-21569
1939 FUFC01000019.1 GCA900157325_00359 gene open 21608-22513
1940 FUFC01000019.1 GCA900157325_00360 gene open 22636-22995
1941 FUFC01000019.1 GCA900157325_00361 gene open 23002-24204 xerD
1942 FUFC01000019.1 GCA900157325_00362 gene open 24230-25480 xerD
1943 FUFC01000019.1 GCA900157325_00363 gene open 25734-25997
1944 FUFC01000019.1 GCA900157325_00364 gene open 26038-26490
1945 FUFC01000019.1 GCA900157325_00365 gene open 26804-27133
1946 FUFC01000020.1 GCA900157325_00988 CDS open 198-1733 _na     511_aa dltB Alginate O-acetyltransferase%2C putative
1947 FUFC01000020.1 GCA900157325_00989 CDS open 1755-2585 _na     276_aa tesA SGNH hydrolase-type esterase domain-containing protein
1948 FUFC01000020.1 GCA900157325_00990 CDS open 2566-3957 _na     463_aa Lipase
1949 FUFC01000020.1 GCA900157325_00991 CDS open 4370-4618 _na     82_aa hypothetical protein
1950 FUFC01000020.1 GCA900157325_00992 CDS open 5183-6727 _na     514_aa DUF349 domain-containing protein
1951 FUFC01000020.1 GCA900157325_00993 CDS open 6910-7293 _na     127_aa histidinol phosphate phosphatase
1952 FUFC01000020.1 GCA900157325_00994 CDS open 7350-7928 _na     192_aa hypothetical protein
1953 FUFC01000020.1 GCA900157325_00995 CDS open 7931-8605 _na     224_aa hypothetical protein
1954 FUFC01000020.1 GCA900157325_00988 gene open 198-1733 dltB
1955 FUFC01000020.1 GCA900157325_00989 gene open 1755-2585 tesA
1956 FUFC01000020.1 GCA900157325_00990 gene open 2566-3957
1957 FUFC01000020.1 GCA900157325_00991 gene open 4370-4618
1958 FUFC01000020.1 GCA900157325_00992 gene open 5183-6727
1959 FUFC01000020.1 GCA900157325_00993 gene open 6910-7293
1960 FUFC01000020.1 GCA900157325_00994 gene open 7350-7928
1961 FUFC01000020.1 GCA900157325_00995 gene open 7931-8605
1962 FUFC01000021.1 GCA900157325_00101 CDS open 36-320 _na     94_aa hypothetical protein
1963 FUFC01000021.1 GCA900157325_00102 CDS open 472-1689 _na     405_aa pqqL Putative peptidase
1964 FUFC01000021.1 GCA900157325_00103 CDS open 1868-2509 _na     213_aa gutQ putative sugar isomerase
1965 FUFC01000021.1 GCA900157325_00104 CDS open 2655-4469 _na     604_aa srmB RNA helicase
1966 FUFC01000021.1 GCA900157325_00105 CDS open 4488-5933 _na     481_aa Alpha-galactosidase
1967 FUFC01000021.1 GCA900157325_00106 CDS open 5933-7132 _na     399_aa sdaA L-serine ammonia-lyase
1968 FUFC01000021.1 GCA900157325_00107 CDS open 7227-8012 _na     261_aa porT Outer membrane protein beta-barrel domain-containing protein
1969 FUFC01000021.1 GCA900157325_00108 CDS open 8018-8920 _na     300_aa Putative carbohydrate metabolism domain-containing protein
1970 FUFC01000021.1 GCA900157325_00109 CDS open 8982-10967 _na     661_aa sbsA SbsA Ig-like domain-containing protein
1971 FUFC01000021.1 GCA900157325_00110 CDS open 11704-12645 _na     313_aa flgJ Peptidoglycan hydrolase
1972 FUFC01000021.1 GCA900157325_00111 CDS open 12674-13840 _na     388_aa purM Phosphoribosylformylglycinamidine cyclo-ligase
1973 FUFC01000021.1 GCA900157325_00112 CDS open 13865-14950 _na     361_aa prfA peptide chain release factor 1
1974 FUFC01000021.1 GCA900157325_00113 CDS open 14967-15797 _na     276_aa pyrF orotidine-5'-phosphate decarboxylase
1975 FUFC01000021.1 GCA900157325_00114 CDS open 15890-16939 _na     349_aa lpxD UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase
1976 FUFC01000021.1 GCA900157325_00115 CDS open 16918-18306 _na     462_aa lpxC bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase
1977 FUFC01000021.1 GCA900157325_00116 CDS open 18306-19097 _na     263_aa lpxA acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase
1978 FUFC01000021.1 GCA900157325_00117 CDS open 19075-20616 _na     513_aa nnr2 Bifunctional NAD(P)H-hydrate repair enzyme
1979 FUFC01000021.1 GCA900157325_00118 CDS open 20613-20951 _na     112_aa hypothetical protein
1980 FUFC01000021.1 GCA900157325_00119 CDS open 21044-21151 _na     35_aa hypothetical protein
1981 FUFC01000021.1 GCA900157325_00120 CDS open 21646-22824 _na     392_aa acrA Cation efflux system protein
1982 FUFC01000021.1 GCA900157325_00121 CDS open 22844-25981 _na     1045_aa cusA Heavy metal efflux pump%2C CzcA family
1983 FUFC01000021.1 GCA900157325_00122 CDS open 25978-27156 _na     392_aa tolC Outer membrane efflux protein
1984 FUFC01000021.1 GCA900157325_00123 CDS open 27254-29296 _na     680_aa recD TPR domain protein
1985 FUFC01000021.1 GCA900157325_00124 CDS open 29301-30839 _na     512_aa digH Glycosyl hydrolase-like 10 domain-containing protein
1986 FUFC01000021.1 GCA900157325_00125 CDS open 30886-31068 _na     60_aa hypothetical protein
1987 FUFC01000021.1 GCA900157325_00126 CDS open 31075-31458 _na     127_aa DUF2007 domain-containing protein
1988 FUFC01000021.1 GCA900157325_00127 CDS open 31472-32065 _na     197_aa nadD nicotinate (nicotinamide) nucleotide adenylyltransferase
1989 FUFC01000021.1 GCA900157325_00128 CDS open 32065-33249 _na     394_aa pncB nicotinate phosphoribosyltransferase
1990 FUFC01000021.1 GCA900157325_00129 CDS open 33282-34982 _na     566_aa Chain length determinant protein
1991 FUFC01000021.1 GCA900157325_00130 CDS open 35113-36168 _na     351_aa pspC Phage shock protein PspC N-terminal domain-containing protein
1992 FUFC01000021.1 GCA900157325_00131 CDS open 36165-37919 _na     584_aa recJ single-stranded-DNA-specific exonuclease RecJ
1993 FUFC01000021.1 GCA900157325_00132 CDS open 38378-39565 _na     395_aa histidine kinase
1994 FUFC01000021.1 GCA900157325_00133 CDS open 39662-39988 _na     108_aa hypothetical protein
1995 FUFC01000021.1 GCA900157325_00134 CDS open 40126-40263 _na     45_aa hypothetical protein
1996 FUFC01000021.1 GCA900157325_00136 CDS open 40541-40684 _na     47_aa hypothetical protein
1997 FUFC01000021.1 GCA900157325_00137 CDS open 41612-42592 _na     326_aa pyrD Putative dihydroorotate dehydrogenase
1998 FUFC01000021.1 GCA900157325_00138 CDS open 42658-43329 _na     223_aa ompA Lipoprotein PG3
1999 FUFC01000021.1 GCA900157325_00139 CDS open 43432-44085 _na     217_aa bioD dethiobiotin synthase
2000 FUFC01000021.1 GCA900157325_00140 CDS open 44114-45007 _na     297_aa dapA 4-hydroxy-tetrahydrodipicolinate synthase