HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Corynebacterium jeikeium (GCA_900461185.1)

Select a Genome:
BAKTA Annotations for GCA_900461185.1
Genome Selected: Corynebacterium jeikeium
ContigsBases CDSrRNA tmRNAtRNA
2 2,526,027 2220 9 1 52
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4574 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:1]    |    Number of Records Found: 4574 [10 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1 UFXO01000001.1 GCA900461185_02274 CDS open 41-199 _na     52_aa hypothetical protein
2 UFXO01000001.1 GCA900461185_02275 CDS open 262-1035 _na     257_aa Amidohydrolase
3 UFXO01000001.1 GCA900461185_02276 CDS open 1035-1385 _na     116_aa hypothetical protein
4 UFXO01000001.1 GCA900461185_02277 CDS open 1835-2488 _na     217_aa dITP/XTP pyrophosphatase
5 UFXO01000001.1 GCA900461185_02278 CDS open 2530-3300 _na     256_aa rph ribonuclease PH
6 UFXO01000001.1 GCA900461185_02279 CDS open 3397-4203 _na     268_aa MBL fold metallo-hydrolase
7 UFXO01000001.1 GCA900461185_02280 CDS open 4341-4457 _na     38_aa hypothetical protein
8 UFXO01000001.1 GCA900461185_02281 CDS open 4691-5485 _na     264_aa hypothetical protein
9 UFXO01000001.1 GCA900461185_02282 CDS open 5959-6096 _na     45_aa G5 domain-containing protein
10 UFXO01000001.1 GCA900461185_02283 CDS open 6216-6740 _na     174_aa hypothetical protein
11 UFXO01000001.1 GCA900461185_02284 CDS open 6737-7084 _na     115_aa hypothetical protein
12 UFXO01000001.1 GCA900461185_02285 CDS open 7394-7666 _na     90_aa YPDG domain-containing protein
13 UFXO01000001.1 GCA900461185_02286 CDS open 7632-7826 _na     64_aa hypothetical protein
14 UFXO01000001.1 GCA900461185_02287 CDS open 8022-8291 _na     89_aa hypothetical protein
15 UFXO01000001.1 GCA900461185_02288 CDS open 8560-9183 _na     207_aa Integrase catalytic domain-containing protein
16 UFXO01000001.1 GCA900461185_02274 gene open 41-199
17 UFXO01000001.1 GCA900461185_02275 gene open 262-1035
18 UFXO01000001.1 GCA900461185_02276 gene open 1035-1385
19 UFXO01000001.1 GCA900461185_02277 gene open 1835-2488
20 UFXO01000001.1 GCA900461185_02278 gene open 2530-3300 rph
21 UFXO01000001.1 GCA900461185_02279 gene open 3397-4203
22 UFXO01000001.1 GCA900461185_02280 gene open 4341-4457
23 UFXO01000001.1 GCA900461185_02281 gene open 4691-5485
24 UFXO01000001.1 GCA900461185_02282 gene open 5959-6096
25 UFXO01000001.1 GCA900461185_02283 gene open 6216-6740
26 UFXO01000001.1 GCA900461185_02284 gene open 6737-7084
27 UFXO01000001.1 GCA900461185_02285 gene open 7394-7666
28 UFXO01000001.1 GCA900461185_02286 gene open 7632-7826
29 UFXO01000001.1 GCA900461185_02287 gene open 8022-8291
30 UFXO01000001.1 GCA900461185_02288 gene open 8560-9183
31 UFXO01000002.1 GCA900461185_01524 gene open 1657876-1658256 ssrA
32 UFXO01000002.1 GCA900461185_01524 tmRNA open 1657876-1658256 ssrA transfer-messenger RNA%2C SsrA
33 UFXO01000002.1 rep_origin open 2219271-2219886
34 UFXO01000002.1 GCA900461185_01095 gene open 1176784-1176901 rrf
35 UFXO01000002.1 GCA900461185_01096 gene open 1177050-1180125 rrl
36 UFXO01000002.1 GCA900461185_01097 gene open 1180531-1182058 rrs
37 UFXO01000002.1 GCA900461185_01296 gene open 1411034-1411498 RNaseP_bact_a
38 UFXO01000002.1 GCA900461185_01597 gene open 1745937-1746054 rrf
39 UFXO01000002.1 GCA900461185_01598 gene open 1746208-1749283 rrl
40 UFXO01000002.1 GCA900461185_01599 gene open 1749689-1751216 rrs
41 UFXO01000002.1 GCA900461185_01912 gene open 2108289-2108406 rrf
42 UFXO01000002.1 GCA900461185_01913 gene open 2108560-2111635 rrl
43 UFXO01000002.1 GCA900461185_01914 gene open 2112041-2113568 rrs
44 UFXO01000002.1 GCA900461185_02100 gene open 2328104-2328198 Bacteria_small_SRP
45 UFXO01000002.1 GCA900461185_01296 ncRNA open 1411034-1411498 Bacterial RNase P class A
46 UFXO01000002.1 GCA900461185_02100 ncRNA open 2328104-2328198 Bacterial small signal recognition particle RNA
47 UFXO01000002.1 regulatory_region open 333961-334022 L31-Corynebacteriaceae ribosomal protein leader
48 UFXO01000002.1 regulatory_region open 596667-596801 atpB RNA
49 UFXO01000002.1 regulatory_region open 1323839-1323952 mraW RNA
50 UFXO01000002.1 regulatory_region open 1961322-1961431 Glycine riboswitch aptamer
51 UFXO01000002.1 GCA900461185_01095 rRNA open 1176784-1176901 rrf 5S ribosomal RNA
52 UFXO01000002.1 GCA900461185_01096 rRNA open 1177050-1180125 rrl 23S ribosomal RNA
53 UFXO01000002.1 GCA900461185_01097 rRNA open 1180531-1182058 rrs 16S ribosomal RNA
54 UFXO01000002.1 GCA900461185_01597 rRNA open 1745937-1746054 rrf 5S ribosomal RNA
55 UFXO01000002.1 GCA900461185_01598 rRNA open 1746208-1749283 rrl 23S ribosomal RNA
56 UFXO01000002.1 GCA900461185_01599 rRNA open 1749689-1751216 rrs 16S ribosomal RNA
57 UFXO01000002.1 GCA900461185_01912 rRNA open 2108289-2108406 rrf 5S ribosomal RNA
58 UFXO01000002.1 GCA900461185_01913 rRNA open 2108560-2111635 rrl 23S ribosomal RNA
59 UFXO01000002.1 GCA900461185_01914 rRNA open 2112041-2113568 rrs 16S ribosomal RNA
60 UFXO01000002.1 repeat_region open 1439146-1441647 CRISPR array with 41 repeats of length 28%2C consensus sequence GTGCTCCCCGCGCCAGCGGGGATGAGCC and spacer length 33
61 UFXO01000002.1 GCA900461185_00001 CDS open 103-2643 _na     846_aa Choice-of-anchor M domain-containing protein
62 UFXO01000002.1 GCA900461185_00002 CDS open 2640-3569 _na     309_aa Putative triacylglycerol lipase
63 UFXO01000002.1 GCA900461185_00003 CDS open 4038-4553 _na     171_aa rplJ 50S ribosomal protein L10
64 UFXO01000002.1 GCA900461185_00004 CDS open 4648-5034 _na     128_aa rplL 50S ribosomal protein L7/L12
65 UFXO01000002.1 GCA900461185_00005 CDS open 5239-6315 _na     358_aa Putative membrane protein
66 UFXO01000002.1 GCA900461185_00006 CDS open 6832-10131 _na     1099_aa DNA-directed RNA polymerase subunit beta
67 UFXO01000002.1 GCA900461185_00007 CDS open 10266-14237 _na     1323_aa rpoC DNA-directed RNA polymerase subunit beta'
68 UFXO01000002.1 GCA900461185_00008 CDS open 14330-14533 _na     67_aa DUF4236 domain-containing protein
69 UFXO01000002.1 GCA900461185_00009 CDS open 14557-16926 _na     789_aa hrpB ATP-dependent helicase HrpB
70 UFXO01000002.1 GCA900461185_00010 CDS open 17292-17663 _na     123_aa rpsL 30S ribosomal protein S12
71 UFXO01000002.1 GCA900461185_00011 CDS open 17667-18137 _na     156_aa rpsG 30S ribosomal protein S7
72 UFXO01000002.1 GCA900461185_00012 CDS open 18412-20526 _na     704_aa fusA elongation factor G
73 UFXO01000002.1 GCA900461185_00013 CDS open 21025-22215 _na     396_aa tuf elongation factor Tu
74 UFXO01000002.1 GCA900461185_00014 CDS open 22327-23085 _na     252_aa gntR GntR family transcriptional regulator
75 UFXO01000002.1 GCA900461185_00015 CDS open 23082-23432 _na     116_aa dnaJ Molecular chaperone DnaJ
76 UFXO01000002.1 GCA900461185_00016 CDS open 23744-24883 _na     379_aa tnp IS256-like element IS1249 family transposase
77 UFXO01000002.1 GCA900461185_00017 CDS open 25030-25872 _na     280_aa Secreted protein
78 UFXO01000002.1 GCA900461185_00018 CDS open 26079-27020 _na     313_aa sortase
79 UFXO01000002.1 GCA900461185_00019 CDS open 27096-27293 _na     65_aa hypothetical protein
80 UFXO01000002.1 GCA900461185_00020 CDS open 27782-28087 _na     101_aa rpsJ 30S ribosomal protein S10
81 UFXO01000002.1 GCA900461185_00021 CDS open 28134-28790 _na     218_aa rplC 50S ribosomal protein L3
82 UFXO01000002.1 GCA900461185_00022 CDS open 28787-29440 _na     217_aa rplD 50S ribosomal protein L4
83 UFXO01000002.1 GCA900461185_00023 CDS open 29437-29742 _na     101_aa rplW 50S ribosomal protein L23
84 UFXO01000002.1 GCA900461185_00024 CDS open 29782-30624 _na     280_aa rplB 50S ribosomal protein L2
85 UFXO01000002.1 GCA900461185_00025 CDS open 30641-30919 _na     92_aa rpsS 30S ribosomal protein S19
86 UFXO01000002.1 GCA900461185_00026 CDS open 30922-31284 _na     120_aa rplV 50S ribosomal protein L22
87 UFXO01000002.1 GCA900461185_00027 CDS open 31284-32027 _na     247_aa rpsC 30S ribosomal protein S3
88 UFXO01000002.1 GCA900461185_00028 CDS open 32033-32449 _na     138_aa rplP 50S ribosomal protein L16
89 UFXO01000002.1 GCA900461185_00029 CDS open 32449-32682 _na     77_aa rpmC 50S ribosomal protein L29
90 UFXO01000002.1 GCA900461185_00030 CDS open 32679-32972 _na     97_aa rpsQ 30S ribosomal protein S17
91 UFXO01000002.1 GCA900461185_00031 CDS open 33786-34742 _na     318_aa Putative iron ABC transport system%2C solute-binding protein
92 UFXO01000002.1 GCA900461185_00032 CDS open 34779-35810 _na     343_aa Iron ABC transporter permease
93 UFXO01000002.1 GCA900461185_00033 CDS open 35807-36868 _na     353_aa Putative iron ABC transport system%2C permease protein
94 UFXO01000002.1 GCA900461185_00034 CDS open 36865-37674 _na     269_aa Putative iron ABC transport system%2C ATP-binding protein
95 UFXO01000002.1 GCA900461185_00035 CDS open 37684-38607 _na     307_aa Putative iron utilization protein
96 UFXO01000002.1 GCA900461185_00036 CDS open 38744-39088 _na     114_aa Putative membrane protein
97 UFXO01000002.1 GCA900461185_00037 CDS open 39686-40057 _na     123_aa rplN 50S ribosomal protein L14
98 UFXO01000002.1 GCA900461185_00038 CDS open 40058-40372 _na     104_aa rplX 50S ribosomal protein L24
99 UFXO01000002.1 GCA900461185_00039 CDS open 40375-40944 _na     189_aa rplE 50S ribosomal protein L5
100 UFXO01000002.1 GCA900461185_00040 CDS open 41075-41746 _na     223_aa IS3 family transposase
101 UFXO01000002.1 GCA900461185_00041 CDS open 41935-42417 _na     160_aa Transposase for IS3516a
102 UFXO01000002.1 GCA900461185_00042 CDS open 42558-42992 _na     144_aa Secreted protein
103 UFXO01000002.1 GCA900461185_00043 CDS open 43640-44848 _na     402_aa IS110 family transposase
104 UFXO01000002.1 GCA900461185_00044 CDS open 45010-45555 _na     181_aa hypothetical protein
105 UFXO01000002.1 GCA900461185_00045 CDS open 45840-46238 _na     132_aa rpsH 30S ribosomal protein S8
106 UFXO01000002.1 GCA900461185_00046 CDS open 46257-46793 _na     178_aa rplF 50S ribosomal protein L6
107 UFXO01000002.1 GCA900461185_00047 CDS open 46793-47197 _na     134_aa rplR 50S ribosomal protein L18
108 UFXO01000002.1 GCA900461185_00048 CDS open 47238-47888 _na     216_aa rpsE 30S ribosomal protein S5
109 UFXO01000002.1 GCA900461185_00049 CDS open 47892-48077 _na     61_aa rpmD 50S ribosomal protein L30
110 UFXO01000002.1 GCA900461185_00050 CDS open 48080-48529 _na     149_aa rplO 50S ribosomal protein L15
111 UFXO01000002.1 GCA900461185_00051 CDS open 48682-49170 _na     162_aa hypothetical protein
112 UFXO01000002.1 GCA900461185_00052 CDS open 49740-51089 _na     449_aa iS285 IS256 family transposase
113 UFXO01000002.1 GCA900461185_00053 CDS open 51095-51319 _na     74_aa hypothetical protein
114 UFXO01000002.1 GCA900461185_00054 CDS open 51316-52212 _na     298_aa IS3 family transposase
115 UFXO01000002.1 GCA900461185_00055 CDS open 52393-53064 _na     223_aa response regulator transcription factor
116 UFXO01000002.1 GCA900461185_00056 CDS open 53061-54455 _na     464_aa sensor histidine kinase
117 UFXO01000002.1 GCA900461185_00057 CDS open 54655-55290 _na     211_aa phosphatase PAP2 family protein
118 UFXO01000002.1 GCA900461185_00058 CDS open 55287-56204 _na     305_aa ATP-binding cassette domain-containing protein
119 UFXO01000002.1 GCA900461185_00059 CDS open 56201-56932 _na     243_aa ABC transporter permease
120 UFXO01000002.1 GCA900461185_00060 CDS open 57311-57610 _na     99_aa Transposase
121 UFXO01000002.1 GCA900461185_00061 CDS open 57607-58503 _na     298_aa IS3 family transposase
122 UFXO01000002.1 GCA900461185_00062 CDS open 58410-58913 _na     167_aa hypothetical protein
123 UFXO01000002.1 GCA900461185_00063 CDS open 59074-60417 _na     447_aa IS256 family transposase
124 UFXO01000002.1 GCA900461185_00064 CDS open 60626-60853 _na     75_aa MbtH-like domain-containing protein
125 UFXO01000002.1 GCA900461185_00065 CDS open 60854-62671 _na     605_aa Putative ABC transport system
126 UFXO01000002.1 GCA900461185_00066 CDS open 62643-64391 _na     582_aa ABC transporter ATP-binding protein
127 UFXO01000002.1 GCA900461185_00067 CDS open 64471-65889 _na     472_aa mbtG L-lysine N6-monooxygenase MbtG
128 UFXO01000002.1 GCA900461185_00068 CDS open 65990-76846 _na     3618_aa dltA D-alanine--poly(phosphoribitol) ligase subunit DltA
129 UFXO01000002.1 GCA900461185_00069 CDS open 76849-77853 _na     334_aa fes Alpha/beta hydrolase fold domain-containing protein
130 UFXO01000002.1 GCA900461185_00070 CDS open 78036-78857 _na     273_aa fmt Putative formyltransferase
131 UFXO01000002.1 GCA900461185_00071 CDS open 78923-79939 _na     338_aa fepB Fe/B12 periplasmic-binding domain-containing protein
132 UFXO01000002.1 GCA900461185_00072 CDS open 80113-80751 _na     212_aa dedA DedA family protein
133 UFXO01000002.1 GCA900461185_00073 CDS open 80762-81544 _na     260_aa fepC Putative iron ABC transport system%2C ATP-binding protein
134 UFXO01000002.1 GCA900461185_00074 CDS open 81595-82689 _na     364_aa fepG Iron ABC transporter
135 UFXO01000002.1 GCA900461185_00075 CDS open 82689-83807 _na     372_aa fepD Iron ABC transporter permease
136 UFXO01000002.1 GCA900461185_00076 CDS open 83908-85092 _na     394_aa tnp IS256 family IS3503 transposase
137 UFXO01000002.1 GCA900461185_00077 CDS open 85423-86757 _na     444_aa secY preprotein translocase subunit SecY
138 UFXO01000002.1 GCA900461185_00078 CDS open 86754-87299 _na     181_aa adk adenylate kinase
139 UFXO01000002.1 GCA900461185_00079 CDS open 87428-88222 _na     264_aa map type I methionyl aminopeptidase
140 UFXO01000002.1 GCA900461185_00080 CDS open 88423-89616 _na     397_aa Putative Na+/H+-dicarboxylate symporter
141 UFXO01000002.1 GCA900461185_00081 CDS open 89843-90061 _na     72_aa infA translation initiation factor IF-1
142 UFXO01000002.1 GCA900461185_00082 CDS open 90306-90674 _na     122_aa rpsM 30S ribosomal protein S13
143 UFXO01000002.1 GCA900461185_00083 CDS open 90678-91082 _na     134_aa rpsK 30S ribosomal protein S11
144 UFXO01000002.1 GCA900461185_00084 CDS open 91109-91714 _na     201_aa rpsD 30S ribosomal protein S4
145 UFXO01000002.1 GCA900461185_00085 CDS open 91859-92872 _na     337_aa rpoA DNA-directed RNA polymerase subunit alpha
146 UFXO01000002.1 GCA900461185_00086 CDS open 92928-93467 _na     179_aa rplQ 50S ribosomal protein L17
147 UFXO01000002.1 GCA900461185_00087 CDS open 93859-94473 _na     204_aa Putative Co/Zn/Cd efflux system component
148 UFXO01000002.1 GCA900461185_00088 CDS open 94578-95564 _na     328_aa truA tRNA pseudouridine(38-40) synthase TruA
149 UFXO01000002.1 GCA900461185_00089 CDS open 95426-96709 _na     427_aa Secreted protein
150 UFXO01000002.1 GCA900461185_00090 CDS open 96846-98141 _na     431_aa eccB type VII secretion protein EccB
151 UFXO01000002.1 GCA900461185_00091 CDS open 98018-99199 _na     393_aa Putative subtilisin-like serine protease
152 UFXO01000002.1 GCA900461185_00092 CDS open 99199-100350 _na     383_aa eccD Type VII secretion integral membrane protein EccD
153 UFXO01000002.1 GCA900461185_00093 CDS open 100537-103758 _na     1073_aa ftsK Cell division protein FtsK
154 UFXO01000002.1 GCA900461185_00094 CDS open 103783-105123 _na     446_aa type VII secretion-associated protein
155 UFXO01000002.1 GCA900461185_00095 CDS open 105243-105530 _na     95_aa ESAT-6-like protein
156 UFXO01000002.1 GCA900461185_00096 CDS open 105591-105872 _na     93_aa ESAT-6-like protein
157 UFXO01000002.1 GCA900461185_00097 CDS open 106254-107198 _na     314_aa DUF2382 domain-containing protein
158 UFXO01000002.1 GCA900461185_00098 CDS open 107473-107916 _na     147_aa rplM 50S ribosomal protein L13
159 UFXO01000002.1 GCA900461185_00099 CDS open 107916-108476 _na     186_aa rpsI 30S ribosomal protein S9
160 UFXO01000002.1 GCA900461185_00100 CDS open 108637-109980 _na     447_aa glmM phosphoglucosamine mutase
161 UFXO01000002.1 GCA900461185_00101 CDS open 110164-110817 _na     217_aa NAD(P)-binding domain-containing protein
162 UFXO01000002.1 GCA900461185_00102 CDS open 110814-111713 _na     299_aa eamA EamA domain-containing protein
163 UFXO01000002.1 GCA900461185_00103 CDS open 111772-112686 _na     304_aa lysR LysR family transcriptional regulator
164 UFXO01000002.1 GCA900461185_00104 CDS open 112897-113205 _na     102_aa WXG100 family type VII secretion target
165 UFXO01000002.1 GCA900461185_00105 CDS open 113202-114734 _na     510_aa Zinc metalloprotease
166 UFXO01000002.1 GCA900461185_00106 CDS open 114731-114964 _na     77_aa hypothetical protein
167 UFXO01000002.1 GCA900461185_00107 CDS open 114993-115868 _na     291_aa Alpha/beta hydrolase
168 UFXO01000002.1 GCA900461185_00108 CDS open 115930-117792 _na     620_aa glmS glutamine--fructose-6-phosphate transaminase (isomerizing)
169 UFXO01000002.1 GCA900461185_00109 CDS open 117865-119583 _na     572_aa alr alanine racemase
170 UFXO01000002.1 GCA900461185_00110 CDS open 120069-120797 _na     242_aa Secreted protein
171 UFXO01000002.1 GCA900461185_00111 CDS open 120804-121487 _na     227_aa AbiEi antitoxin C-terminal domain-containing protein
172 UFXO01000002.1 GCA900461185_00112 CDS open 121602-122921 _na     439_aa non-specific serine/threonine protein kinase
173 UFXO01000002.1 GCA900461185_00113 CDS open 123034-125556 _na     840_aa tsaD tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD
174 UFXO01000002.1 GCA900461185_00114 CDS open 125631-126059 _na     142_aa GAF domain-containing protein
175 UFXO01000002.1 GCA900461185_00115 CDS open 126251-126550 _na     99_aa groES co-chaperone GroES
176 UFXO01000002.1 GCA900461185_00116 CDS open 126563-128182 _na     539_aa groL chaperonin GroEL
177 UFXO01000002.1 GCA900461185_00117 CDS open 128275-128580 _na     101_aa whiB Transcriptional regulator WhiB
178 UFXO01000002.1 GCA900461185_00118 CDS open 129070-129639 _na     189_aa ECF-family sigma factor D
179 UFXO01000002.1 GCA900461185_00119 CDS open 129685-130587 _na     300_aa hypothetical protein
180 UFXO01000002.1 GCA900461185_00120 CDS open 130588-131007 _na     139_aa DUF5319 domain-containing protein
181 UFXO01000002.1 GCA900461185_00121 CDS open 131188-132417 _na     409_aa DUF4143 domain-containing protein
182 UFXO01000002.1 GCA900461185_00122 CDS open 132589-134124 _na     511_aa guaB IMP dehydrogenase
183 UFXO01000002.1 GCA900461185_00123 CDS open 134186-135349 _na     387_aa guaB3 GuaB3 family IMP dehydrogenase-related protein
184 UFXO01000002.1 GCA900461185_00124 CDS open 135392-135823 _na     143_aa Putative membrane protein
185 UFXO01000002.1 GCA900461185_00125 CDS open 135921-137462 _na     513_aa guaA glutamine-hydrolyzing GMP synthase
186 UFXO01000002.1 GCA900461185_00126 CDS open 137598-138296 _na     232_aa Secreted protein
187 UFXO01000002.1 GCA900461185_00127 CDS open 138382-138804 _na     140_aa Putative membrane protein
188 UFXO01000002.1 GCA900461185_00128 CDS open 139012-139854 _na     280_aa hypothetical protein
189 UFXO01000002.1 GCA900461185_00129 CDS open 139838-141670 _na     610_aa DNA polymerase Y family protein
190 UFXO01000002.1 GCA900461185_00130 CDS open 141708-142748 _na     346_aa Sucrase ferredoxin
191 UFXO01000002.1 GCA900461185_00131 CDS open 142826-143506 _na     226_aa Putative ABC transport system%2C permease protein
192 UFXO01000002.1 GCA900461185_00132 CDS open 143503-144606 _na     367_aa metN Methionine import ATP-binding protein MetN
193 UFXO01000002.1 GCA900461185_00133 CDS open 144651-145511 _na     286_aa Putative ABC transport system%2C solute-binding protein
194 UFXO01000002.1 GCA900461185_00134 CDS open 145531-149133 _na     1200_aa dnaE2 Error-prone DNA polymerase
195 UFXO01000002.1 GCA900461185_00135 CDS open 149230-150669 _na     479_aa Peptidase S9 prolyl oligopeptidase catalytic domain-containing protein
196 UFXO01000002.1 GCA900461185_00136 CDS open 150695-151885 _na     396_aa DUF4272 domain-containing protein
197 UFXO01000002.1 GCA900461185_00137 CDS open 151987-153780 _na     597_aa Putative acylamino-acid-releasing enzyme
198 UFXO01000002.1 GCA900461185_00138 CDS open 153952-155229 _na     425_aa L-lactate dehydrogenase
199 UFXO01000002.1 GCA900461185_00139 CDS open 155226-156521 _na     431_aa Saccharopine dehydrogenase NADP-binding domain-containing protein
200 UFXO01000002.1 GCA900461185_00140 CDS open 156552-157067 _na     171_aa Putative tRNA (cytidine(34)-2'-O)-methyltransferase
201 UFXO01000002.1 GCA900461185_00141 CDS open 157306-160536 _na     1076_aa Putative surface-anchored protein
202 UFXO01000002.1 GCA900461185_00142 CDS open 160784-162274 _na     496_aa Putative surface-anchored protein
203 UFXO01000002.1 GCA900461185_00143 CDS open 162308-163228 _na     306_aa Putative fimbrial associated sortase-like protein
204 UFXO01000002.1 GCA900461185_00144 CDS open 163232-164158 _na     308_aa Putative surface-anchored protein
205 UFXO01000002.1 GCA900461185_00145 CDS open 164334-164963 _na     209_aa Putative membrane protein
206 UFXO01000002.1 GCA900461185_00146 CDS open 165038-165895 _na     285_aa folD bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase
207 UFXO01000002.1 GCA900461185_00147 CDS open 165888-166247 _na     119_aa Putative membrane protein
208 UFXO01000002.1 GCA900461185_00148 CDS open 166244-167422 _na     392_aa metXA homoserine O-acetyltransferase
209 UFXO01000002.1 GCA900461185_00149 CDS open 167457-168788 _na     443_aa O-acetylhomoserine/O-acetylserine sulfhydrylase
210 UFXO01000002.1 GCA900461185_00150 CDS open 169595-171823 _na     742_aa NADP-dependent isocitrate dehydrogenase
211 UFXO01000002.1 GCA900461185_00151 CDS open 172070-173314 _na     414_aa Putative permease of the major facilitator superfamily
212 UFXO01000002.1 GCA900461185_00152 CDS open 173374-174384 _na     336_aa exodeoxyribonuclease III
213 UFXO01000002.1 GCA900461185_00153 CDS open 174378-175235 _na     285_aa Putative membrane protein
214 UFXO01000002.1 GCA900461185_00154 CDS open 175247-176278 _na     343_aa trpS tryptophan--tRNA ligase
215 UFXO01000002.1 GCA900461185_00155 CDS open 176394-177476 _na     360_aa Putative membrane protein
216 UFXO01000002.1 GCA900461185_00156 CDS open 177524-178843 _na     439_aa adenosine deaminase
217 UFXO01000002.1 GCA900461185_00157 CDS open 178916-179932 _na     338_aa Periplasmic binding protein domain-containing protein
218 UFXO01000002.1 GCA900461185_00158 CDS open 179929-180924 _na     331_aa xylH Xylose transport system permease protein XylH
219 UFXO01000002.1 GCA900461185_00159 CDS open 180925-181710 _na     261_aa Putative ABC transport system%2C ATP-binding protein
220 UFXO01000002.1 GCA900461185_00160 CDS open 181761-182561 _na     266_aa J domain-containing protein
221 UFXO01000002.1 GCA900461185_00161 CDS open 182577-183245 _na     222_aa Secreted protein
222 UFXO01000002.1 GCA900461185_00162 CDS open 183350-184189 _na     279_aa Putative membrane protein
223 UFXO01000002.1 GCA900461185_00163 CDS open 184284-184925 _na     213_aa TIGR02234 family membrane protein
224 UFXO01000002.1 GCA900461185_00164 CDS open 184922-186184 _na     420_aa Primosomal protein
225 UFXO01000002.1 GCA900461185_00165 CDS open 186225-186395 _na     56_aa hypothetical protein
226 UFXO01000002.1 GCA900461185_00166 CDS open 186428-187348 _na     306_aa Putative secreted protein
227 UFXO01000002.1 GCA900461185_00167 CDS open 187350-187661 _na     103_aa ESX-1 secretion-associated protein
228 UFXO01000002.1 GCA900461185_00168 CDS open 187751-188389 _na     212_aa upp uracil phosphoribosyltransferase
229 UFXO01000002.1 GCA900461185_00169 CDS open 188360-189655 _na     431_aa pmmB PmmB protein
230 UFXO01000002.1 GCA900461185_00170 CDS open 189854-190171 _na     105_aa Transposase
231 UFXO01000002.1 GCA900461185_00171 CDS open 190171-191070 _na     299_aa IS3 family transposase
232 UFXO01000002.1 GCA900461185_00173 CDS open 191307-192482 _na     391_aa cmx chloramphenicol efflux MFS transporter Cmx
233 UFXO01000002.1 GCA900461185_00174 CDS open 192482-193471 _na     329_aa tnp IS481 family IS5564 transposase
234 UFXO01000002.1 GCA900461185_00175 CDS open 193346-193666 _na     106_aa hypothetical protein
235 UFXO01000002.1 GCA900461185_00176 CDS open 193663-194475 _na     270_aa purine-nucleoside phosphorylase
236 UFXO01000002.1 GCA900461185_00177 CDS open 194545-195765 _na     406_aa amiA AmiA protein
237 UFXO01000002.1 GCA900461185_00178 CDS open 195746-196087 _na     113_aa hypothetical protein
238 UFXO01000002.1 GCA900461185_00179 CDS open 196170-196841 _na     223_aa IS3 family transposase
239 UFXO01000002.1 GCA900461185_00180 CDS open 197030-197512 _na     160_aa Transposase for IS3516a
240 UFXO01000002.1 GCA900461185_00181 CDS open 197572-197769 _na     65_aa DUF1707 domain-containing protein
241 UFXO01000002.1 GCA900461185_00182 CDS open 197793-199379 _na     528_aa glpK glycerol kinase GlpK
242 UFXO01000002.1 GCA900461185_00183 CDS open 199380-200012 _na     210_aa Secreted protein
243 UFXO01000002.1 GCA900461185_00184 CDS open 200034-201827 _na     597_aa biotin carboxylase
244 UFXO01000002.1 GCA900461185_00185 CDS open 201884-202750 _na     288_aa Sulfurtransferase
245 UFXO01000002.1 GCA900461185_00186 CDS open 202902-203966 _na     354_aa DUF6815 domain-containing protein
246 UFXO01000002.1 GCA900461185_00187 CDS open 204034-205176 _na     380_aa NERD domain-containing protein
247 UFXO01000002.1 GCA900461185_00188 CDS open 205295-206791 _na     498_aa prpD 2-methylcitrate dehydratase PrpD
248 UFXO01000002.1 GCA900461185_00189 CDS open 206811-208043 _na     410_aa bifunctional 2-methylcitrate synthase/citrate synthase
249 UFXO01000002.1 GCA900461185_00190 CDS open 208040-208624 _na     194_aa Nucleoside triphosphate pyrophosphatase
250 UFXO01000002.1 GCA900461185_00191 CDS open 208628-208822 _na     64_aa Acyl-CoA carboxylase subunit epsilon
251 UFXO01000002.1 GCA900461185_00192 CDS open 208833-210197 _na     454_aa Acyl-CoA carboxylase%2C beta subunit
252 UFXO01000002.1 GCA900461185_00193 CDS open 210283-211125 _na     280_aa biotin--[biotin carboxyl-carrier protein] ligase
253 UFXO01000002.1 GCA900461185_00194 CDS open 211122-211625 _na     167_aa DUF304 domain-containing protein
254 UFXO01000002.1 GCA900461185_00195 CDS open 211631-212866 _na     411_aa 5-(carboxyamino)imidazole ribonucleotide synthase
255 UFXO01000002.1 GCA900461185_00196 CDS open 212870-213382 _na     170_aa N5-carboxyaminoimidazole ribonucleotide mutase
256 UFXO01000002.1 GCA900461185_00197 CDS open 213911-214693 _na     260_aa SDR family oxidoreductase
257 UFXO01000002.1 GCA900461185_00198 CDS open 214736-215926 _na     396_aa histidine kinase
258 UFXO01000002.1 GCA900461185_00199 CDS open 215927-216610 _na     227_aa tcsR7 Two-component system response regulator TcsR7
259 UFXO01000002.1 GCA900461185_00200 CDS open 216780-217940 _na     386_aa HNH nuclease domain-containing protein
260 UFXO01000002.1 GCA900461185_00201 CDS open 218000-218935 _na     311_aa Putative ABC transport system%2C ATP-binding protein
261 UFXO01000002.1 GCA900461185_00202 CDS open 218964-219704 _na     246_aa Putative ABC transport system%2C permease protein
262 UFXO01000002.1 GCA900461185_00203 CDS open 219724-220656 _na     310_aa Putative ABC transport system%2C ATP-binding protein
263 UFXO01000002.1 GCA900461185_00204 CDS open 220656-221390 _na     244_aa Putative ABC transport system%2C permease protein
264 UFXO01000002.1 GCA900461185_00205 CDS open 221383-221964 _na     193_aa TIGR03089 family protein
265 UFXO01000002.1 GCA900461185_00206 CDS open 221964-223631 _na     555_aa lytR LytR family transcriptional regulator
266 UFXO01000002.1 GCA900461185_00207 CDS open 223679-224503 _na     274_aa dTDP-4-dehydrorhamnose reductase
267 UFXO01000002.1 GCA900461185_00208 CDS open 224515-225384 _na     289_aa Putative glycosyltransferase
268 UFXO01000002.1 GCA900461185_00209 CDS open 225460-226542 _na     360_aa Putative mannose-1-phosphate guanyltransferase
269 UFXO01000002.1 GCA900461185_00210 CDS open 226840-227205 _na     121_aa whiB Transcriptional regulator WhiB
270 UFXO01000002.1 GCA900461185_00211 CDS open 227202-227639 _na     145_aa Metallopeptidase family protein
271 UFXO01000002.1 GCA900461185_00212 CDS open 227734-228168 _na     144_aa DUF3499 domain-containing protein
272 UFXO01000002.1 GCA900461185_00213 CDS open 228184-229560 _na     458_aa phosphomannomutase/phosphoglucomutase
273 UFXO01000002.1 GCA900461185_00214 CDS open 229570-230652 _na     360_aa manA mannose-6-phosphate isomerase%2C class I
274 UFXO01000002.1 GCA900461185_00215 CDS open 230630-231442 _na     270_aa Zinc metalloprotease
275 UFXO01000002.1 GCA900461185_00216 CDS open 231600-231980 _na     126_aa DUF4259 domain-containing protein
276 UFXO01000002.1 GCA900461185_00217 CDS open 232083-233522 _na     479_aa ahcY adenosylhomocysteinase
277 UFXO01000002.1 GCA900461185_00218 CDS open 233525-234175 _na     216_aa dTMP kinase
278 UFXO01000002.1 GCA900461185_00219 CDS open 234172-234858 _na     228_aa mtrA MtrAB system response regulator MtrA
279 UFXO01000002.1 GCA900461185_00220 CDS open 234865-236601 _na     578_aa mtrB MtrAB system histidine kinase MtrB
280 UFXO01000002.1 GCA900461185_00221 CDS open 236594-238345 _na     583_aa lpqB MtrAB system accessory lipoprotein LpqB
281 UFXO01000002.1 GCA900461185_00222 CDS open 238552-239034 _na     160_aa comF ComF family protein
282 UFXO01000002.1 GCA900461185_00223 CDS open 239193-239885 _na     230_aa hpf ribosome hibernation-promoting factor%2C HPF/YfiA family
283 UFXO01000002.1 GCA900461185_00224 CDS open 240084-242687 _na     867_aa secA preprotein translocase subunit SecA
284 UFXO01000002.1 GCA900461185_00225 CDS open 242691-243191 _na     166_aa DUF6459 domain-containing protein
285 UFXO01000002.1 GCA900461185_00226 CDS open 243371-243751 _na     126_aa HAD family hydrolase
286 UFXO01000002.1 GCA900461185_00227 CDS open 243755-244261 _na     168_aa DUF6912 domain-containing protein
287 UFXO01000002.1 GCA900461185_00228 CDS open 244270-245277 _na     335_aa rsgA ribosome small subunit-dependent GTPase A
288 UFXO01000002.1 GCA900461185_00229 CDS open 245278-246579 _na     433_aa aroA 3-phosphoshikimate 1-carboxyvinyltransferase
289 UFXO01000002.1 GCA900461185_00230 CDS open 246640-247272 _na     210_aa Abasic site processing protein
290 UFXO01000002.1 GCA900461185_00231 CDS open 247306-247935 _na     209_aa ECF-family sigma factor H
291 UFXO01000002.1 GCA900461185_00232 CDS open 247942-248205 _na     87_aa rsrA mycothiol system anti-sigma-R factor
292 UFXO01000002.1 GCA900461185_00233 CDS open 248339-248710 _na     123_aa Bacterial Pleckstrin-like y domain-containing protein
293 UFXO01000002.1 GCA900461185_00235 CDS open 248952-249218 _na     88_aa whiB Transcriptional regulator WhiB
294 UFXO01000002.1 GCA900461185_00236 CDS open 249730-250869 _na     379_aa tnp IS256-like element IS1249 family transposase
295 UFXO01000002.1 GCA900461185_00237 CDS open 250984-252288 _na     434_aa Putative secreted protein
296 UFXO01000002.1 GCA900461185_00238 CDS open 252285-253646 _na     453_aa Putative ATP-dependent RNA helicase
297 UFXO01000002.1 GCA900461185_00239 CDS open 253745-253990 _na     81_aa DUF3107 domain-containing protein
298 UFXO01000002.1 GCA900461185_00240 CDS open 254021-254974 _na     317_aa DUF3152 domain-containing protein
299 UFXO01000002.1 GCA900461185_00241 CDS open 254983-255882 _na     299_aa TIGR02569 family protein
300 UFXO01000002.1 GCA900461185_00242 CDS open 255956-259366 _na     1136_aa DNA 3'-5' helicase
301 UFXO01000002.1 GCA900461185_00243 CDS open 259367-262984 _na     1205_aa DNA 3'-5' helicase
302 UFXO01000002.1 GCA900461185_00244 CDS open 262998-264080 _na     360_aa Potassium channel family protein
303 UFXO01000002.1 GCA900461185_00245 CDS open 264092-266182 _na     696_aa DNA 3'-5' helicase
304 UFXO01000002.1 GCA900461185_00246 CDS open 266183-267064 _na     293_aa Bacteriocin biosynthesis cyclodehydratase domain-containing protein
305 UFXO01000002.1 GCA900461185_00247 CDS open 267208-267807 _na     199_aa YgjP-like metallopeptidase domain-containing protein
306 UFXO01000002.1 GCA900461185_00248 CDS open 267804-269294 _na     496_aa Hydrolase
307 UFXO01000002.1 GCA900461185_00249 CDS open 269438-270517 _na     359_aa endopeptidase La
308 UFXO01000002.1 GCA900461185_00250 CDS open 270534-271094 _na     186_aa DUF4262 domain-containing protein
309 UFXO01000002.1 GCA900461185_00251 CDS open 271322-274294 _na     990_aa UPF0182 protein jk1603
310 UFXO01000002.1 GCA900461185_00253 CDS open 274584-275720 _na     378_aa tnp IS256 family IS3509 transposase
311 UFXO01000002.1 GCA900461185_00254 CDS open 276079-277218 _na     379_aa Putative permease of the major facilitator superfamily
312 UFXO01000002.1 GCA900461185_00255 CDS open 278160-279143 _na     327_aa moaA GTP 3'%2C8-cyclase MoaA
313 UFXO01000002.1 GCA900461185_00256 CDS open 279667-279816 _na     49_aa hypothetical protein
314 UFXO01000002.1 GCA900461185_00257 CDS open 279930-280694 _na     254_aa Molybdenum cofactor biosynthesis protein
315 UFXO01000002.1 GCA900461185_00258 CDS open 280691-281929 _na     412_aa glp gephyrin-like molybdotransferase Glp
316 UFXO01000002.1 GCA900461185_00259 CDS open 281926-282396 _na     156_aa moaC cyclic pyranopterin monophosphate synthase MoaC
317 UFXO01000002.1 GCA900461185_00260 CDS open 282471-282986 _na     171_aa MogA/MoaB family molybdenum cofactor biosynthesis protein
318 UFXO01000002.1 GCA900461185_00261 CDS open 283030-284103 _na     357_aa Putative molybdate ABC transport system%2C ATP-binding protein
319 UFXO01000002.1 GCA900461185_00262 CDS open 284100-284927 _na     275_aa modB molybdate ABC transporter permease subunit
320 UFXO01000002.1 GCA900461185_00263 CDS open 284896-285657 _na     253_aa modA molybdate ABC transporter substrate-binding protein
321 UFXO01000002.1 GCA900461185_00264 CDS open 286051-286317 _na     88_aa BCCT%2C betaine/carnitine/choline family transporter
322 UFXO01000002.1 GCA900461185_00265 CDS open 287050-287751 _na     233_aa IS30 family transposase
323 UFXO01000002.1 GCA900461185_00266 CDS open 289569-289754 _na     61_aa hypothetical protein
324 UFXO01000002.1 GCA900461185_00268 CDS open 290871-291275 _na     134_aa merR MerR family transcriptional regulator
325 UFXO01000002.1 GCA900461185_00269 CDS open 291445-293004 _na     519_aa Sulfate permease
326 UFXO01000002.1 GCA900461185_00270 CDS open 293174-294208 _na     344_aa hypothetical protein
327 UFXO01000002.1 GCA900461185_00271 CDS open 295279-295641 _na     120_aa Bacterial mobilisation domain-containing protein
328 UFXO01000002.1 GCA900461185_00272 CDS open 295844-296374 _na     176_aa Tyr recombinase domain-containing protein
329 UFXO01000002.1 GCA900461185_00274 CDS open 296566-297558 _na     330_aa DUF1963 domain-containing protein
330 UFXO01000002.1 GCA900461185_00275 CDS open 297606-298049 _na     147_aa DUF1990 domain-containing protein
331 UFXO01000002.1 GCA900461185_00276 CDS open 298063-299184 _na     373_aa M48 family metalloprotease
332 UFXO01000002.1 GCA900461185_00277 CDS open 299297-299857 _na     186_aa lemA LemA family protein
333 UFXO01000002.1 GCA900461185_00278 CDS open 300031-300786 _na     251_aa Putative oxygen-insensitive NADPH nitroreductase
334 UFXO01000002.1 GCA900461185_00279 CDS open 300965-302224 _na     419_aa Putative phosphatase
335 UFXO01000002.1 GCA900461185_00280 CDS open 302337-303194 _na     285_aa S1 family peptidase
336 UFXO01000002.1 GCA900461185_00281 CDS open 303229-303555 _na     108_aa chorismate mutase
337 UFXO01000002.1 GCA900461185_00282 CDS open 303662-306352 _na     896_aa DNA 3'-5' helicase
338 UFXO01000002.1 GCA900461185_00283 CDS open 306492-308192 _na     566_aa Acyl-CoA synthetase
339 UFXO01000002.1 GCA900461185_00284 CDS open 308253-309053 _na     266_aa Putative secreted protein
340 UFXO01000002.1 GCA900461185_00285 CDS open 309196-309678 _na     160_aa Transposase for IS3516a
341 UFXO01000002.1 GCA900461185_00286 CDS open 309867-310538 _na     223_aa IS3 family transposase
342 UFXO01000002.1 GCA900461185_00287 CDS open 310616-311374 _na     252_aa Putative secreted metallopeptidase
343 UFXO01000002.1 GCA900461185_00288 CDS open 312067-313584 _na     505_aa Membrane protein related to de Novo purine biosynthesis
344 UFXO01000002.1 GCA900461185_00289 CDS open 313529-314095 _na     188_aa purN phosphoribosylglycinamide formyltransferase
345 UFXO01000002.1 GCA900461185_00290 CDS open 314122-315744 _na     540_aa purH bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase
346 UFXO01000002.1 GCA900461185_00291 CDS open 315864-316712 _na     282_aa Secreted protein
347 UFXO01000002.1 GCA900461185_00292 CDS open 316690-317607 _na     305_aa Putative secreted protein
348 UFXO01000002.1 GCA900461185_00293 CDS open 317658-318272 _na     204_aa Putative transcriptional regulator (TetR family)
349 UFXO01000002.1 GCA900461185_00294 CDS open 318491-320104 _na     537_aa Acyl-CoA carboxylase%2C beta subunit
350 UFXO01000002.1 GCA900461185_00295 CDS open 320153-322261 _na     702_aa biotin carboxylase
351 UFXO01000002.1 GCA900461185_00296 CDS open 322350-323519 _na     389_aa Acyl-CoA dehydrogenase
352 UFXO01000002.1 GCA900461185_00297 CDS open 323604-324104 _na     166_aa MaoC-like domain-containing protein
353 UFXO01000002.1 GCA900461185_00298 CDS open 324097-324993 _na     298_aa Putative citrate lyase beta subunit
354 UFXO01000002.1 GCA900461185_00299 CDS open 325084-326778 _na     564_aa Acyl-CoA synthetase
355 UFXO01000002.1 GCA900461185_00300 CDS open 326808-327584 _na     258_aa Acyl-CoA:3-ketoacid CoA-transferase%2C subunit A
356 UFXO01000002.1 GCA900461185_00301 CDS open 327581-328222 _na     213_aa Acyl-CoA:3-ketoacid CoA-transferase%2C subunit B
357 UFXO01000002.1 GCA900461185_00302 CDS open 328329-329522 _na     397_aa putative acetyl-CoA acetyltransferase
358 UFXO01000002.1 GCA900461185_00303 CDS open 329726-329971 _na     81_aa DUF2752 domain-containing protein
359 UFXO01000002.1 GCA900461185_00304 CDS open 330066-330539 _na     157_aa Interferon-induced transmembrane protein
360 UFXO01000002.1 GCA900461185_00305 CDS open 330528-331472 _na     314_aa Putative membrane protein
361 UFXO01000002.1 GCA900461185_00306 CDS open 331518-332330 _na     270_aa Putative membrane protein
362 UFXO01000002.1 GCA900461185_00307 CDS open 332596-332844 _na     82_aa rpsR 30S ribosomal protein S18
363 UFXO01000002.1 GCA900461185_00308 CDS open 332860-333165 _na     101_aa rpsN 30S ribosomal protein S14
364 UFXO01000002.1 GCA900461185_00309 CDS open 333169-333333 _na     54_aa rpmG 50S ribosomal protein L33
365 UFXO01000002.1 GCA900461185_00310 CDS open 333336-333572 _na     78_aa rpmB 50S ribosomal protein L28
366 UFXO01000002.1 GCA900461185_00311 CDS open 334036-334299 _na     87_aa rpmE2 type B 50S ribosomal protein L31
367 UFXO01000002.1 GCA900461185_00312 CDS open 334375-334542 _na     55_aa rpmF 50S ribosomal protein L32
368 UFXO01000002.1 GCA900461185_00313 CDS open 334686-335381 _na     231_aa tcsR5 Two-component system response regulator TcsR5
369 UFXO01000002.1 GCA900461185_00314 CDS open 335378-336931 _na     517_aa histidine kinase
370 UFXO01000002.1 GCA900461185_00315 CDS open 337044-338498 _na     484_aa Putative serine protease
371 UFXO01000002.1 GCA900461185_00316 CDS open 338584-339237 _na     217_aa Molybdenum cofactor biosynthesis protein
372 UFXO01000002.1 GCA900461185_00317 CDS open 339492-339926 _na     144_aa mscL large conductance mechanosensitive channel protein MscL
373 UFXO01000002.1 GCA900461185_00318 CDS open 339978-340592 _na     204_aa 5-formyltetrahydrofolate cyclo-ligase
374 UFXO01000002.1 GCA900461185_00319 CDS open 340607-341602 _na     331_aa UTP--glucose-1-phosphate uridylyltransferase
375 UFXO01000002.1 GCA900461185_00320 CDS open 341612-342925 _na     437_aa glp gephyrin-like molybdotransferase Glp
376 UFXO01000002.1 GCA900461185_00321 CDS open 342933-343643 _na     236_aa [ribosomal protein uS5]-alanine N-acetyltransferase
377 UFXO01000002.1 GCA900461185_00322 CDS open 343753-345132 _na     459_aa glpR gephyrin-like molybdotransferase receptor GlpR
378 UFXO01000002.1 GCA900461185_00323 CDS open 345148-345570 _na     140_aa Putative membrane protein
379 UFXO01000002.1 GCA900461185_00324 CDS open 345634-346389 _na     251_aa Zf-HC2 domain-containing protein
380 UFXO01000002.1 GCA900461185_00325 CDS open 346400-347977 _na     525_aa Dolichyl-phosphate-mannose--protein mannosyltransferase
381 UFXO01000002.1 GCA900461185_00326 CDS open 348009-349004 _na     331_aa rsmI 16S rRNA (cytidine(1402)-2'-O)-methyltransferase
382 UFXO01000002.1 GCA900461185_00327 CDS open 349177-350865 _na     562_aa betP BetP protein
383 UFXO01000002.1 GCA900461185_00328 CDS open 350914-352752 _na     612_aa metG Methionine--tRNA ligase
384 UFXO01000002.1 GCA900461185_00329 CDS open 352757-353437 _na     226_aa HAD family phosphatase
385 UFXO01000002.1 GCA900461185_00330 CDS open 353574-354848 _na     424_aa Putative permease of the major facilitator superfamily
386 UFXO01000002.1 GCA900461185_00331 CDS open 354894-355811 _na     305_aa Putative deoxyribonuclease
387 UFXO01000002.1 GCA900461185_00332 CDS open 356113-357294 _na     393_aa rpfB Resuscitation-promoting factor RpfB
388 UFXO01000002.1 GCA900461185_00333 CDS open 357390-358325 _na     311_aa rsmA 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA
389 UFXO01000002.1 GCA900461185_00334 CDS open 358322-359389 _na     355_aa ispE 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase
390 UFXO01000002.1 GCA900461185_00335 CDS open 359382-361244 _na     620_aa abc-f ribosomal protection-like ABC-F family protein
391 UFXO01000002.1 GCA900461185_00336 CDS open 361231-363084 _na     617_aa Alpha/beta hydrolase
392 UFXO01000002.1 GCA900461185_00337 CDS open 363235-364410 _na     391_aa site-specific integrase
393 UFXO01000002.1 GCA900461185_00338 CDS open 364420-365136 _na     238_aa hypothetical protein
394 UFXO01000002.1 GCA900461185_00339 CDS open 365149-365535 _na     128_aa ImmA/IrrE family metallo-endopeptidase
395 UFXO01000002.1 GCA900461185_00340 CDS open 365532-365927 _na     131_aa hypothetical protein
396 UFXO01000002.1 GCA900461185_00341 CDS open 366070-366303 _na     77_aa hypothetical protein
397 UFXO01000002.1 GCA900461185_00342 CDS open 366358-367269 _na     303_aa parB ParB N-terminal domain-containing protein
398 UFXO01000002.1 GCA900461185_00343 CDS open 367266-367772 _na     168_aa hypothetical protein
399 UFXO01000002.1 GCA900461185_00344 CDS open 367840-368010 _na     56_aa hypothetical protein
400 UFXO01000002.1 GCA900461185_00345 CDS open 368596-368772 _na     58_aa helix-turn-helix domain-containing protein
401 UFXO01000002.1 GCA900461185_00346 CDS open 368769-369035 _na     88_aa hypothetical protein
402 UFXO01000002.1 GCA900461185_00347 CDS open 369035-369154 _na     39_aa hypothetical protein
403 UFXO01000002.1 GCA900461185_00348 CDS open 369196-369459 _na     87_aa hypothetical protein
404 UFXO01000002.1 GCA900461185_00349 CDS open 369465-369752 _na     95_aa hypothetical protein
405 UFXO01000002.1 GCA900461185_00350 CDS open 369737-370627 _na     296_aa yqaJ YqaJ viral recombinase family protein
406 UFXO01000002.1 GCA900461185_00351 CDS open 370620-371195 _na     191_aa ERF family protein
407 UFXO01000002.1 GCA900461185_00352 CDS open 371182-371535 _na     117_aa Cell division protein
408 UFXO01000002.1 GCA900461185_00353 CDS open 371522-371851 _na     109_aa HNH endonuclease signature motif containing protein
409 UFXO01000002.1 GCA900461185_00354 CDS open 371829-372713 _na     294_aa hypothetical protein
410 UFXO01000002.1 GCA900461185_00355 CDS open 372695-373234 _na     179_aa hypothetical protein
411 UFXO01000002.1 GCA900461185_00356 CDS open 373240-373731 _na     163_aa single-stranded DNA-binding protein
412 UFXO01000002.1 GCA900461185_00357 CDS open 373712-374143 _na     143_aa rusA RusA family crossover junction endodeoxyribonuclease
413 UFXO01000002.1 GCA900461185_00358 CDS open 374140-374355 _na     71_aa hypothetical protein
414 UFXO01000002.1 GCA900461185_00359 CDS open 374352-374618 _na     88_aa hypothetical protein
415 UFXO01000002.1 GCA900461185_00360 CDS open 374615-375292 _na     225_aa hypothetical protein
416 UFXO01000002.1 GCA900461185_00361 CDS open 375384-375560 _na     58_aa hypothetical protein
417 UFXO01000002.1 GCA900461185_00362 CDS open 375741-376127 _na     128_aa hypothetical protein
418 UFXO01000002.1 GCA900461185_00363 CDS open 376124-376411 _na     95_aa hypothetical protein
419 UFXO01000002.1 GCA900461185_00364 CDS open 376411-376602 _na     63_aa hypothetical protein
420 UFXO01000002.1 GCA900461185_00365 CDS open 376909-377079 _na     56_aa hypothetical protein
421 UFXO01000002.1 GCA900461185_00366 CDS open 377359-377907 _na     182_aa helix-turn-helix domain-containing protein
422 UFXO01000002.1 GCA900461185_00367 CDS open 378512-378835 _na     107_aa P27 family phage terminase small subunit
423 UFXO01000002.1 GCA900461185_00368 CDS open 378861-380414 _na     517_aa Terminase
424 UFXO01000002.1 GCA900461185_00369 CDS open 380427-381953 _na     508_aa Portal protein
425 UFXO01000002.1 GCA900461185_00370 CDS open 381950-383371 _na     473_aa head maturation protease%2C ClpP-related
426 UFXO01000002.1 GCA900461185_00371 CDS open 383384-383800 _na     138_aa capsid cement protein
427 UFXO01000002.1 GCA900461185_00372 CDS open 383831-384775 _na     314_aa Major capsid protein
428 UFXO01000002.1 GCA900461185_00373 CDS open 384775-385104 _na     109_aa hypothetical protein
429 UFXO01000002.1 GCA900461185_00374 CDS open 385125-385550 _na     141_aa Phage Gp19/Gp15/Gp42 family protein
430 UFXO01000002.1 GCA900461185_00375 CDS open 385661-385915 _na     84_aa hypothetical protein
431 UFXO01000002.1 GCA900461185_00376 CDS open 385905-386210 _na     101_aa hypothetical protein
432 UFXO01000002.1 GCA900461185_00377 CDS open 386200-386616 _na     138_aa Tail terminator
433 UFXO01000002.1 GCA900461185_00378 CDS open 386694-387440 _na     248_aa Phage tail protein
434 UFXO01000002.1 GCA900461185_00379 CDS open 387724-388077 _na     117_aa hypothetical protein
435 UFXO01000002.1 GCA900461185_00380 CDS open 388077-388691 _na     204_aa hypothetical protein
436 UFXO01000002.1 GCA900461185_00381 CDS open 388713-395150 _na     2145_aa phage tail tape measure protein
437 UFXO01000002.1 GCA900461185_00382 CDS open 395152-395886 _na     244_aa Phage tail protein
438 UFXO01000002.1 GCA900461185_00383 CDS open 396710-397684 _na     324_aa Phage tail protein
439 UFXO01000002.1 GCA900461185_00384 CDS open 397677-398972 _na     431_aa hypothetical protein
440 UFXO01000002.1 GCA900461185_00385 CDS open 398984-400444 _na     486_aa collagen-like protein
441 UFXO01000002.1 GCA900461185_00386 CDS open 400448-401620 _na     390_aa hypothetical protein
442 UFXO01000002.1 GCA900461185_00387 CDS open 401668-402270 _na     200_aa carbohydrate-binding protein
443 UFXO01000002.1 GCA900461185_00388 CDS open 402321-403685 _na     454_aa peptidoglycan DD-metalloendopeptidase family protein
444 UFXO01000002.1 GCA900461185_00389 CDS open 403686-404048 _na     120_aa Holin
445 UFXO01000002.1 GCA900461185_00390 CDS open 404045-404452 _na     135_aa hypothetical protein
446 UFXO01000002.1 GCA900461185_00391 CDS open 404458-404820 _na     120_aa Secreted protein
447 UFXO01000002.1 GCA900461185_00392 CDS open 405130-405459 _na     109_aa ABM domain-containing protein
448 UFXO01000002.1 GCA900461185_00393 CDS open 405504-406985 _na     493_aa L-serine ammonia-lyase
449 UFXO01000002.1 GCA900461185_00394 CDS open 407006-408277 _na     423_aa Putative membrane protein
450 UFXO01000002.1 GCA900461185_00395 CDS open 408388-409368 _na     326_aa ppk2 polyphosphate kinase 2
451 UFXO01000002.1 GCA900461185_00396 CDS open 409423-410502 _na     359_aa 3-hydroxyisobutyryl-CoA hydrolase
452 UFXO01000002.1 GCA900461185_00397 CDS open 410499-411218 _na     239_aa pnuC nicotinamide riboside transporter PnuC
453 UFXO01000002.1 GCA900461185_00398 CDS open 411273-412022 _na     249_aa TetR/AcrR family transcriptional regulator
454 UFXO01000002.1 GCA900461185_00399 CDS open 412149-412817 _na     222_aa TetR/AcrR family transcriptional regulator
455 UFXO01000002.1 GCA900461185_00400 CDS open 412838-415264 _na     808_aa Putative drug exporter of the RND superfamily
456 UFXO01000002.1 GCA900461185_00401 CDS open 415349-416995 _na     548_aa peptide chain release factor 3
457 UFXO01000002.1 GCA900461185_00402 CDS open 417023-420034 _na     1003_aa Putative membrane protein
458 UFXO01000002.1 GCA900461185_00403 CDS open 420149-420871 _na     240_aa pth aminoacyl-tRNA hydrolase
459 UFXO01000002.1 GCA900461185_00404 CDS open 420871-421452 _na     193_aa pth aminoacyl-tRNA hydrolase
460 UFXO01000002.1 GCA900461185_00405 CDS open 421610-422254 _na     214_aa rplY 50S ribosomal protein L25/general stress protein Ctc
461 UFXO01000002.1 GCA900461185_00406 CDS open 422534-423505 _na     323_aa ribose-phosphate diphosphokinase
462 UFXO01000002.1 GCA900461185_00407 CDS open 423617-425134 _na     505_aa glmU bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU
463 UFXO01000002.1 GCA900461185_00408 CDS open 425223-426605 _na     460_aa Putative membrane protein
464 UFXO01000002.1 GCA900461185_00410 CDS open 426797-430528 _na     1243_aa mfd transcription-repair coupling factor
465 UFXO01000002.1 GCA900461185_00411 CDS open 430554-431888 _na     444_aa mazG MazG nucleotide pyrophosphohydrolase domain-containing protein
466 UFXO01000002.1 GCA900461185_00412 CDS open 431885-432742 _na     285_aa Manganese ABC transport system%2C permease protein
467 UFXO01000002.1 GCA900461185_00413 CDS open 432739-433548 _na     269_aa Manganese ABC transport system%2C ATP-binding protein
468 UFXO01000002.1 GCA900461185_00414 CDS open 433549-434463 _na     304_aa Manganese ABC transport system%2C solute-binding protein
469 UFXO01000002.1 GCA900461185_00415 CDS open 434587-435303 _na     238_aa Diphtheria toxin repressor
470 UFXO01000002.1 GCA900461185_00416 CDS open 435328-436197 _na     289_aa Transglycosylase SLT domain-containing protein
471 UFXO01000002.1 GCA900461185_00417 CDS open 436411-437688 _na     425_aa eno phosphopyruvate hydratase
472 UFXO01000002.1 GCA900461185_00418 CDS open 437806-438516 _na     236_aa Septum formation initiator
473 UFXO01000002.1 GCA900461185_00419 CDS open 438578-439144 _na     188_aa DUF501 domain-containing protein
474 UFXO01000002.1 GCA900461185_00421 CDS open 440375-441538 _na     387_aa mbtN Acyl-[acyl-carrier-protein] dehydrogenase MbtN
475 UFXO01000002.1 GCA900461185_00422 CDS open 441557-442783 _na     408_aa VCBS repeat-containing protein
476 UFXO01000002.1 GCA900461185_00423 CDS open 442909-444993 _na     694_aa Putative acyltransferase
477 UFXO01000002.1 GCA900461185_00424 CDS open 445185-446867 _na     560_aa ADP-dependent (S)-NAD(P)H-hydrate dehydratase
478 UFXO01000002.1 GCA900461185_00425 CDS open 446973-447671 _na     232_aa SDR family oxidoreductase
479 UFXO01000002.1 GCA900461185_00426 CDS open 447661-448752 _na     363_aa NAD(P)-binding domain-containing protein
480 UFXO01000002.1 GCA900461185_00427 CDS open 448787-450388 _na     533_aa succinic semialdehyde dehydrogenase
481 UFXO01000002.1 GCA900461185_00428 CDS open 450689-451594 _na     301_aa Putative membrane protein
482 UFXO01000002.1 GCA900461185_00429 CDS open 451730-451858 _na     42_aa hypothetical protein
483 UFXO01000002.1 GCA900461185_00430 CDS open 452313-452516 _na     67_aa hypothetical protein
484 UFXO01000002.1 GCA900461185_00431 CDS open 452510-453031 _na     173_aa greA transcription elongation factor GreA
485 UFXO01000002.1 GCA900461185_00432 CDS open 453166-453600 _na     144_aa Putative secreted protein
486 UFXO01000002.1 GCA900461185_00433 CDS open 453806-454618 _na     270_aa mca mycothiol conjugate amidase Mca
487 UFXO01000002.1 GCA900461185_00434 CDS open 454715-455134 _na     139_aa Secreted protein
488 UFXO01000002.1 GCA900461185_00435 CDS open 455145-455915 _na     256_aa isoprenyl transferase
489 UFXO01000002.1 GCA900461185_00436 CDS open 455976-456893 _na     305_aa coaA type I pantothenate kinase
490 UFXO01000002.1 GCA900461185_00437 CDS open 457125-458435 _na     436_aa glyA Serine hydroxymethyltransferase
491 UFXO01000002.1 GCA900461185_00438 CDS open 458502-459134 _na     210_aa isochorismatase family protein
492 UFXO01000002.1 GCA900461185_00439 CDS open 459161-460165 _na     334_aa TDT family transporter
493 UFXO01000002.1 GCA900461185_00440 CDS open 460350-461240 _na     296_aa lysR LysR family transcriptional regulator
494 UFXO01000002.1 GCA900461185_00441 CDS open 461251-462102 _na     283_aa enoyl-CoA hydratase/isomerase family protein
495 UFXO01000002.1 GCA900461185_00442 CDS open 462137-463312 _na     391_aa mbtN Acyl-[acyl-carrier-protein] dehydrogenase MbtN
496 UFXO01000002.1 GCA900461185_00443 CDS open 464045-464422 _na     125_aa Transcriptional regulator
497 UFXO01000002.1 GCA900461185_00444 CDS open 464427-465167 _na     246_aa lysR LysR substrate-binding domain-containing protein
498 UFXO01000002.1 GCA900461185_00445 CDS open 465299-465955 _na     218_aa Secreted protein
499 UFXO01000002.1 GCA900461185_00446 CDS open 466210-467601 _na     463_aa phoH Putative phosphate starvation-inducible protein PhoH
500 UFXO01000002.1 GCA900461185_00447 CDS open 467665-468402 _na     245_aa Putative acetyltransferase