BAKTAGenome Explorer: Arcanobacterium haemolyticum (GCA_900475915.1)
Select a Genome:
|
BAKTA Annotations for GCA_900475915.1
|
Search & Sort all 3798 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 1 | LS483427.1 | GCA900475915_00820 | gene | open | 862097-862473 | ssrA | ||
| 2 | LS483427.1 | GCA900475915_00820 | tmRNA | open | 862097-862473 | ssrA | transfer-messenger RNA%2C SsrA | |
| 3 | LS483427.1 | rep_origin | open | 221135-221493 | ||||
| 4 | LS483427.1 | GCA900475915_00271 | gene | open | 323957-324026 | DUF3800-IX | ||
| 5 | LS483427.1 | GCA900475915_00341 | gene | open | 394531-396061 | rrs | ||
| 6 | LS483427.1 | GCA900475915_00342 | gene | open | 396297-399384 | rrl | ||
| 7 | LS483427.1 | GCA900475915_00343 | gene | open | 399466-399582 | rrf | ||
| 8 | LS483427.1 | GCA900475915_00371 | gene | open | 424558-424653 | Bacteria_small_SRP | ||
| 9 | LS483427.1 | GCA900475915_00567 | gene | open | 600457-601986 | rrs | ||
| 10 | LS483427.1 | GCA900475915_00568 | gene | open | 602222-605309 | rrl | ||
| 11 | LS483427.1 | GCA900475915_00569 | gene | open | 605391-605507 | rrf | ||
| 12 | LS483427.1 | GCA900475915_01095 | gene | open | 1137278-1138808 | rrs | ||
| 13 | LS483427.1 | GCA900475915_01096 | gene | open | 1139043-1142130 | rrl | ||
| 14 | LS483427.1 | GCA900475915_01097 | gene | open | 1142212-1142328 | rrf | ||
| 15 | LS483427.1 | GCA900475915_01328 | gene | open | 1388566-1388917 | RNaseP_bact_a | ||
| 16 | LS483427.1 | GCA900475915_01646 | gene | open | 1713272-1713388 | rrf | ||
| 17 | LS483427.1 | GCA900475915_01647 | gene | open | 1713470-1716557 | rrl | ||
| 18 | LS483427.1 | GCA900475915_01648 | gene | open | 1716792-1718322 | rrs | ||
| 19 | LS483427.1 | GCA900475915_00271 | ncRNA | open | 323957-324026 | DUF3800-IX RNA | ||
| 20 | LS483427.1 | GCA900475915_00371 | ncRNA | open | 424558-424653 | Bacterial small signal recognition particle RNA | ||
| 21 | LS483427.1 | GCA900475915_01328 | ncRNA | open | 1388566-1388917 | Bacterial RNase P class A | ||
| 22 | LS483427.1 | regulatory_region | open | 33194-33299 | TPP riboswitch aptamer (THI element) | |||
| 23 | LS483427.1 | regulatory_region | open | 430912-430970 | msiK RNA | |||
| 24 | LS483427.1 | regulatory_region | open | 796031-796121 | TPP riboswitch aptamer (THI element) | |||
| 25 | LS483427.1 | regulatory_region | open | 1076889-1076975 | SAM riboswitch aptamer (S box leader) | |||
| 26 | LS483427.1 | regulatory_region | open | 1235149-1235267 | FMN riboswitch aptamer (RFN element) | |||
| 27 | LS483427.1 | regulatory_region | open | 1316965-1317047 | ZMP/ZTP riboswitch aptamer (pfl RNA motif) | |||
| 28 | LS483427.1 | GCA900475915_00341 | rRNA | open | 394531-396061 | rrs | 16S ribosomal RNA | |
| 29 | LS483427.1 | GCA900475915_00342 | rRNA | open | 396297-399384 | rrl | 23S ribosomal RNA | |
| 30 | LS483427.1 | GCA900475915_00343 | rRNA | open | 399466-399582 | rrf | 5S ribosomal RNA | |
| 31 | LS483427.1 | GCA900475915_00567 | rRNA | open | 600457-601986 | rrs | 16S ribosomal RNA | |
| 32 | LS483427.1 | GCA900475915_00568 | rRNA | open | 602222-605309 | rrl | 23S ribosomal RNA | |
| 33 | LS483427.1 | GCA900475915_00569 | rRNA | open | 605391-605507 | rrf | 5S ribosomal RNA | |
| 34 | LS483427.1 | GCA900475915_01095 | rRNA | open | 1137278-1138808 | rrs | 16S ribosomal RNA | |
| 35 | LS483427.1 | GCA900475915_01096 | rRNA | open | 1139043-1142130 | rrl | 23S ribosomal RNA | |
| 36 | LS483427.1 | GCA900475915_01097 | rRNA | open | 1142212-1142328 | rrf | 5S ribosomal RNA | |
| 37 | LS483427.1 | GCA900475915_01646 | rRNA | open | 1713272-1713388 | rrf | 5S ribosomal RNA | |
| 38 | LS483427.1 | GCA900475915_01647 | rRNA | open | 1713470-1716557 | rrl | 23S ribosomal RNA | |
| 39 | LS483427.1 | GCA900475915_01648 | rRNA | open | 1716792-1718322 | rrs | 16S ribosomal RNA | |
| 40 | LS483427.1 | repeat_region | open | 294411-298537 | CRISPR array with 68 repeats of length 29%2C consensus sequence GGAAATACCCCCGCGTGTGCGGGGAAGAG and spacer length 32 | |||
| 41 | LS483427.1 | GCA900475915_00001 | CDS | open | 3-968 | _na 322_aa | hypothetical protein | |
| 42 | LS483427.1 | GCA900475915_00002 | CDS | open | 999-3608 | _na 869_aa | clpB | ATP-dependent chaperone ClpB |
| 43 | LS483427.1 | GCA900475915_00003 | CDS | open | 4367-4561 | _na 64_aa | Antitoxin | |
| 44 | LS483427.1 | GCA900475915_00004 | CDS | open | 5002-6060 | _na 352_aa | gluQRS | tRNA glutamyl-Q(34) synthetase GluQRS |
| 45 | LS483427.1 | GCA900475915_00005 | CDS | open | 6229-6744 | _na 171_aa | tspO | TspO and MBR like protein |
| 46 | LS483427.1 | GCA900475915_00006 | CDS | open | 6741-7196 | _na 151_aa | elaA | GCN5-related N-acetyltransferase |
| 47 | LS483427.1 | GCA900475915_00007 | CDS | open | 7211-7708 | _na 165_aa | ybaK | Cys-tRNA(Pro) deacylase |
| 48 | LS483427.1 | GCA900475915_00008 | CDS | open | 7777-10827 | _na 1016_aa | LPXTG-motif cell wall anchor domain protein | |
| 49 | LS483427.1 | GCA900475915_00009 | CDS | open | 11038-11439 | _na 133_aa | DUF3806 domain-containing protein | |
| 50 | LS483427.1 | GCA900475915_00010 | CDS | open | 11436-12083 | _na 215_aa | yjhB | NUDIX hydrolase |
| 51 | LS483427.1 | GCA900475915_00011 | CDS | open | 12083-12727 | _na 214_aa | hspR | heat shock protein transcriptional repressor HspR |
| 52 | LS483427.1 | GCA900475915_00012 | CDS | open | 12802-13797 | _na 331_aa | dnaJ | Heat shock protein DnaJ domain protein |
| 53 | LS483427.1 | GCA900475915_00013 | CDS | open | 13844-14413 | _na 189_aa | grpE | Protein GrpE |
| 54 | LS483427.1 | GCA900475915_00014 | CDS | open | 14502-16358 | _na 618_aa | dnaK | molecular chaperone DnaK |
| 55 | LS483427.1 | GCA900475915_00015 | CDS | open | 16563-18632 | _na 689_aa | preP | Prolyl oligopeptidase |
| 56 | LS483427.1 | GCA900475915_00016 | CDS | open | 18787-19218 | _na 143_aa | manC | Cupin 2 conserved barrel domain protein |
| 57 | LS483427.1 | GCA900475915_00017 | CDS | open | 19383-20561 | _na 392_aa | ATP-grasp domain-containing protein | |
| 58 | LS483427.1 | GCA900475915_00018 | CDS | open | 20561-21562 | _na 333_aa | fmhB | Methicillin resistance protein |
| 59 | LS483427.1 | GCA900475915_00019 | CDS | open | 21617-22918 | _na 433_aa | araJ | Major facilitator superfamily MFS_1 |
| 60 | LS483427.1 | GCA900475915_00020 | CDS | open | 23008-24339 | _na 443_aa | galT | DUF4921 domain-containing protein |
| 61 | LS483427.1 | GCA900475915_00021 | CDS | open | 24863-26152 | _na 429_aa | ugpB | Extracellular solute-binding protein family 1 |
| 62 | LS483427.1 | GCA900475915_00022 | CDS | open | 26184-27173 | _na 329_aa | ugpA | Binding-protein-dependent transport systems inner membrane component |
| 63 | LS483427.1 | GCA900475915_00023 | CDS | open | 27170-28081 | _na 303_aa | ugpE | Binding-protein-dependent transport systems inner membrane component |
| 64 | LS483427.1 | GCA900475915_00024 | CDS | open | 28081-29487 | _na 468_aa | chb | Glycoside hydrolase%2C family 20%2C catalytic core |
| 65 | LS483427.1 | GCA900475915_00025 | CDS | open | 29622-30269 | _na 215_aa | potA | ABC transporter related protein |
| 66 | LS483427.1 | GCA900475915_00026 | CDS | open | 30266-32077 | _na 603_aa | fbpB | Binding-protein-dependent transport systems inner membrane component |
| 67 | LS483427.1 | GCA900475915_00027 | CDS | open | 32074-33144 | _na 356_aa | tbpA | ABC transporter%2C periplasmic binding protein%2C thiB subfamily |
| 68 | LS483427.1 | GCA900475915_00028 | CDS | open | 33358-33609 | _na 83_aa | DUF4235 domain-containing protein | |
| 69 | LS483427.1 | GCA900475915_00029 | CDS | open | 33652-34011 | _na 119_aa | mnhG | monovalent cation/H(+) antiporter subunit G |
| 70 | LS483427.1 | GCA900475915_00030 | CDS | open | 34008-34268 | _na 86_aa | mnhF | Multisubunit sodium/proton antiporter%2C MrpF subunit |
| 71 | LS483427.1 | GCA900475915_00031 | CDS | open | 34265-34876 | _na 203_aa | mnhE | Na+/H+ antiporter subunit E |
| 72 | LS483427.1 | GCA900475915_00032 | CDS | open | 34869-36422 | _na 517_aa | hyfB | Na+/H+ antiporter subunit D |
| 73 | LS483427.1 | GCA900475915_00033 | CDS | open | 36419-36877 | _na 152_aa | mnhC | Na(+)/H(+) antiporter subunit C |
| 74 | LS483427.1 | GCA900475915_00034 | CDS | open | 36877-39723 | _na 948_aa | mnhB | Na+/H+ antiporter subunit A |
| 75 | LS483427.1 | GCA900475915_00035 | CDS | open | 39776-40357 | _na 193_aa | dcd | dCTP deaminase |
| 76 | LS483427.1 | GCA900475915_00036 | CDS | open | 40476-41153 | _na 225_aa | mntR | Manganese transport regulator |
| 77 | LS483427.1 | GCA900475915_00037 | CDS | open | 41103-41987 | _na 294_aa | znuB | ABC-3 protein |
| 78 | LS483427.1 | GCA900475915_00038 | CDS | open | 41984-42913 | _na 309_aa | znuB | ABC-3 protein |
| 79 | LS483427.1 | GCA900475915_00039 | CDS | open | 42910-43665 | _na 251_aa | znuC | ABC transporter related protein |
| 80 | LS483427.1 | GCA900475915_00040 | CDS | open | 43680-44618 | _na 312_aa | znuA | Periplasmic solute binding protein |
| 81 | LS483427.1 | GCA900475915_00041 | CDS | open | 44956-45459 | _na 167_aa | hpt1 | Phosphoribosyltransferase domain-containing protein |
| 82 | LS483427.1 | GCA900475915_00042 | CDS | open | 45876-46604 | _na 242_aa | aroD | 3-dehydroquinate dehydratase |
| 83 | LS483427.1 | GCA900475915_00043 | CDS | open | 46745-47677 | _na 310_aa | hypothetical protein | |
| 84 | LS483427.1 | GCA900475915_00044 | CDS | open | 47677-48441 | _na 254_aa | YwiC-like protein | |
| 85 | LS483427.1 | GCA900475915_00045 | CDS | open | 48460-48888 | _na 142_aa | yvlD | Phage holin family protein |
| 86 | LS483427.1 | GCA900475915_00046 | CDS | open | 48888-49547 | _na 219_aa | dedA | SNARE associated Golgi protein-like protein |
| 87 | LS483427.1 | GCA900475915_00047 | CDS | open | 49611-51080 | _na 489_aa | hypothetical protein | |
| 88 | LS483427.1 | GCA900475915_00048 | CDS | open | 51159-51386 | _na 75_aa | copZ | Heavy metal transport/detoxification protein |
| 89 | LS483427.1 | GCA900475915_00049 | CDS | open | 51383-53569 | _na 728_aa | zntA | Heavy metal translocating P-type ATPase |
| 90 | LS483427.1 | GCA900475915_00050 | CDS | open | 53643-56225 | _na 860_aa | aglD2 | Integral membrane protein |
| 91 | LS483427.1 | GCA900475915_00051 | CDS | open | 56251-57933 | _na 560_aa | pgm | phosphoglucomutase (alpha-D-glucose-1%2C6-bisphosphate-dependent) |
| 92 | LS483427.1 | GCA900475915_00052 | CDS | open | 57934-58689 | _na 251_aa | mngR | Transcriptional regulator%2C GntR family |
| 93 | LS483427.1 | GCA900475915_00053 | CDS | open | 58890-59999 | _na 369_aa | app1 | Phosphatidate phosphatase APP1 catalytic domain-containing protein |
| 94 | LS483427.1 | GCA900475915_00054 | CDS | open | 60130-61149 | _na 339_aa | yafD | Endonuclease/exonuclease/phosphatase |
| 95 | LS483427.1 | GCA900475915_00055 | CDS | open | 61288-65376 | _na 1362_aa | hrpA | ATP-dependent RNA helicase HrpA |
| 96 | LS483427.1 | GCA900475915_00056 | CDS | open | 65512-66417 | _na 301_aa | hisJ | Extracellular solute-binding protein family 3 |
| 97 | LS483427.1 | GCA900475915_00057 | CDS | open | 66423-67394 | _na 323_aa | hisM | Polar amino acid ABC transporter%2C inner membrane subunit |
| 98 | LS483427.1 | GCA900475915_00058 | CDS | open | 67408-68181 | _na 257_aa | glnQ | ABC transporter related protein |
| 99 | LS483427.1 | GCA900475915_00059 | CDS | open | 68668-69339 | _na 223_aa | Integral membrane protein | |
| 100 | LS483427.1 | GCA900475915_00060 | CDS | open | 69396-69860 | _na 154_aa | SprT-like domain-containing protein | |
| 101 | LS483427.1 | GCA900475915_00061 | CDS | open | 69886-70458 | _na 190_aa | wzb | protein-tyrosine-phosphatase |
| 102 | LS483427.1 | GCA900475915_00062 | CDS | open | 70515-70745 | _na 76_aa | hypothetical protein | |
| 103 | LS483427.1 | GCA900475915_00063 | CDS | open | 70696-71670 | _na 324_aa | nrdF | class 1b ribonucleoside-diphosphate reductase subunit beta |
| 104 | LS483427.1 | GCA900475915_00064 | CDS | open | 71757-71912 | _na 51_aa | hypothetical protein | |
| 105 | LS483427.1 | GCA900475915_00065 | CDS | open | 71997-72419 | _na 140_aa | hypothetical protein | |
| 106 | LS483427.1 | GCA900475915_00066 | CDS | open | 72255-74405 | _na 716_aa | nrdE | class 1b ribonucleoside-diphosphate reductase subunit alpha |
| 107 | LS483427.1 | GCA900475915_00067 | CDS | open | 74387-74788 | _na 133_aa | nrdI | class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI |
| 108 | LS483427.1 | GCA900475915_00068 | CDS | open | 74823-75074 | _na 83_aa | nrdH | Glutaredoxin-like protein NrdH |
| 109 | LS483427.1 | GCA900475915_00069 | CDS | open | 75314-75775 | _na 153_aa | luxS | S-ribosylhomocysteine lyase |
| 110 | LS483427.1 | GCA900475915_00070 | CDS | open | 75772-77109 | _na 445_aa | mtnN | 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase |
| 111 | LS483427.1 | GCA900475915_00071 | CDS | open | 77136-77600 | _na 154_aa | hypothetical protein | |
| 112 | LS483427.1 | GCA900475915_00072 | CDS | open | 77528-78469 | _na 313_aa | Restriction endonuclease type II-like domain-containing protein | |
| 113 | LS483427.1 | GCA900475915_00073 | CDS | open | 78600-80777 | _na 725_aa | ptrB | Oligopeptidase B |
| 114 | LS483427.1 | GCA900475915_00074 | CDS | open | 80820-81404 | _na 194_aa | rnhA | Ribonuclease H |
| 115 | LS483427.1 | GCA900475915_00075 | CDS | open | 81475-82383 | _na 302_aa | ymdB | Appr-1-p processing domain protein |
| 116 | LS483427.1 | GCA900475915_00076 | CDS | open | 82409-83215 | _na 268_aa | yadS | Glycine transporter domain-containing protein |
| 117 | LS483427.1 | GCA900475915_00078 | CDS | open | 83727-84425 | _na 232_aa | fHA | FHA domain containing protein |
| 118 | LS483427.1 | GCA900475915_00079 | CDS | open | 84422-84886 | _na 154_aa | fHA | FHA domain containing protein |
| 119 | LS483427.1 | GCA900475915_00080 | CDS | open | 84883-86202 | _na 439_aa | pTC1 | Protein serine/threonine phosphatase |
| 120 | LS483427.1 | GCA900475915_00081 | CDS | open | 86199-87692 | _na 497_aa | ftsW | Cell cycle protein |
| 121 | LS483427.1 | GCA900475915_00082 | CDS | open | 87689-89134 | _na 481_aa | ftsI | Penicillin-binding protein transpeptidase |
| 122 | LS483427.1 | GCA900475915_00083 | CDS | open | 89219-91120 | _na 633_aa | pknB | Stk1 family PASTA domain-containing Ser/Thr kinase |
| 123 | LS483427.1 | GCA900475915_00084 | CDS | open | 91421-92620 | _na 399_aa | IS110 family transposase | |
| 124 | LS483427.1 | GCA900475915_00085 | CDS | open | 92893-93048 | _na 51_aa | ABC transporter permease | |
| 125 | LS483427.1 | GCA900475915_00086 | CDS | open | 93051-93992 | _na 313_aa | srtA | Sortase family protein |
| 126 | LS483427.1 | GCA900475915_00087 | CDS | open | 94117-94386 | _na 89_aa | crgA | Cell division protein CrgA |
| 127 | LS483427.1 | GCA900475915_00088 | CDS | open | 94437-95069 | _na 210_aa | glpG | Rhomboid family protein |
| 128 | LS483427.1 | GCA900475915_00089 | CDS | open | 95087-95617 | _na 176_aa | ppiB | Peptidyl-prolyl cis-trans isomerase |
| 129 | LS483427.1 | GCA900475915_00090 | CDS | open | 95823-96692 | _na 289_aa | hypothetical protein | |
| 130 | LS483427.1 | GCA900475915_00091 | CDS | open | 96818-97780 | _na 320_aa | eamA | EamA domain-containing protein |
| 131 | LS483427.1 | GCA900475915_00092 | CDS | open | 97866-98741 | _na 291_aa | rfbA | glucose-1-phosphate thymidylyltransferase RfbA |
| 132 | LS483427.1 | GCA900475915_00093 | CDS | open | 98741-99607 | _na 288_aa | wcaE | Rhamnosyltransferase |
| 133 | LS483427.1 | GCA900475915_00094 | CDS | open | 99630-100118 | _na 162_aa | DUF4143 domain-containing protein | |
| 134 | LS483427.1 | GCA900475915_00095 | CDS | open | 100508-101329 | _na 273_aa | IS3 family transposase | |
| 135 | LS483427.1 | GCA900475915_00096 | CDS | open | 101383-101664 | _na 93_aa | IS3 family transposase | |
| 136 | LS483427.1 | GCA900475915_00097 | CDS | open | 102069-102686 | _na 205_aa | rfbC | dTDP-4-dehydrorhamnose 3%2C5-epimerase |
| 137 | LS483427.1 | GCA900475915_00098 | CDS | open | 102794-104110 | _na 438_aa | ATPase AAA-type core domain-containing protein | |
| 138 | LS483427.1 | GCA900475915_00099 | CDS | open | 104123-104290 | _na 55_aa | hypothetical protein | |
| 139 | LS483427.1 | GCA900475915_00100 | CDS | open | 104493-105341 | _na 282_aa | rfbD | dTDP-4-dehydrorhamnose reductase |
| 140 | LS483427.1 | GCA900475915_00101 | CDS | open | 105410-106675 | _na 421_aa | rfbX | Polysaccharide biosynthesis protein |
| 141 | LS483427.1 | GCA900475915_00102 | CDS | open | 106829-107923 | _na 364_aa | rfaB | Glycosyl transferase group 1 |
| 142 | LS483427.1 | GCA900475915_00103 | CDS | open | 108041-109852 | _na 603_aa | licC | Transcriptional regulator%2C MarR family |
| 143 | LS483427.1 | GCA900475915_00104 | CDS | open | 109849-110796 | _na 315_aa | rhaT | EamA domain-containing protein |
| 144 | LS483427.1 | GCA900475915_00105 | CDS | open | 110806-111666 | _na 286_aa | licD | LicD family protein |
| 145 | LS483427.1 | GCA900475915_00106 | CDS | open | 111681-112682 | _na 333_aa | wcaA | Glycosyl transferase family 2 |
| 146 | LS483427.1 | GCA900475915_00107 | CDS | open | 112810-113679 | _na 289_aa | wcaA | Glycosyl transferase family 2 |
| 147 | LS483427.1 | GCA900475915_00108 | CDS | open | 113733-114968 | _na 411_aa | Integral membrane protein | |
| 148 | LS483427.1 | GCA900475915_00109 | CDS | open | 114945-116471 | _na 508_aa | DUF2142 domain-containing protein | |
| 149 | LS483427.1 | GCA900475915_00110 | CDS | open | 116597-117325 | _na 242_aa | Glycosyl transferase family 2 | |
| 150 | LS483427.1 | GCA900475915_00111 | CDS | open | 117328-117687 | _na 119_aa | DUF2304 domain-containing protein | |
| 151 | LS483427.1 | GCA900475915_00112 | CDS | open | 117691-119037 | _na 448_aa | Glycosyltransferase RgtA/B/C/D-like domain-containing protein | |
| 152 | LS483427.1 | GCA900475915_00113 | CDS | open | 119044-119412 | _na 122_aa | DUF2304 domain-containing protein | |
| 153 | LS483427.1 | GCA900475915_00114 | CDS | open | 119421-120164 | _na 247_aa | wcaA | Glycosyl transferase family 2 |
| 154 | LS483427.1 | GCA900475915_00115 | CDS | open | 120165-122603 | _na 812_aa | wcaE | Glycosyl transferase family 2 |
| 155 | LS483427.1 | GCA900475915_00116 | CDS | open | 122600-124123 | _na 507_aa | hypothetical protein | |
| 156 | LS483427.1 | GCA900475915_00117 | CDS | open | 124314-125249 | _na 311_aa | tagG | Transport permease protein |
| 157 | LS483427.1 | GCA900475915_00118 | CDS | open | 125252-126478 | _na 408_aa | tagH | ABC transporter related protein |
| 158 | LS483427.1 | GCA900475915_00119 | CDS | open | 126508-127500 | _na 330_aa | rfbB | dTDP-glucose 4%2C6-dehydratase |
| 159 | LS483427.1 | GCA900475915_00120 | CDS | open | 127808-128080 | _na 90_aa | hypothetical protein | |
| 160 | LS483427.1 | GCA900475915_00121 | CDS | open | 128353-129306 | _na 317_aa | DUF418 domain-containing protein | |
| 161 | LS483427.1 | GCA900475915_00122 | CDS | open | 129309-130316 | _na 335_aa | Peptidase S1 domain-containing protein | |
| 162 | LS483427.1 | GCA900475915_00123 | CDS | open | 130641-130838 | _na 65_aa | hypothetical protein | |
| 163 | LS483427.1 | GCA900475915_00124 | CDS | open | 131265-131783 | _na 172_aa | DUF3800 domain-containing protein | |
| 164 | LS483427.1 | GCA900475915_00125 | CDS | open | 131970-133382 | _na 470_aa | Major facilitator superfamily MFS_1 | |
| 165 | LS483427.1 | GCA900475915_00126 | CDS | open | 133502-134245 | _na 247_aa | ugpQ | Glycerophosphoryl diester phosphodiesterase |
| 166 | LS483427.1 | GCA900475915_00127 | CDS | open | 134368-135246 | _na 292_aa | wcaE | Glycosyl transferase family 2 |
| 167 | LS483427.1 | GCA900475915_00128 | CDS | open | 135383-136042 | _na 219_aa | cutC | Copper homeostasis cutC-like protein |
| 168 | LS483427.1 | GCA900475915_00129 | CDS | open | 136469-137740 | _na 423_aa | afuC | Alpha-L-fucosidase |
| 169 | LS483427.1 | GCA900475915_00130 | CDS | open | 137734-138501 | _na 255_aa | nagC | ROK family protein |
| 170 | LS483427.1 | GCA900475915_00131 | CDS | open | 138642-140633 | _na 663_aa | oppF | murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF |
| 171 | LS483427.1 | GCA900475915_00132 | CDS | open | 140642-141499 | _na 285_aa | dppC | Binding-protein-dependent transport systems inner membrane component |
| 172 | LS483427.1 | GCA900475915_00133 | CDS | open | 141496-142458 | _na 320_aa | dppB | Binding-protein-dependent transport systems inner membrane component |
| 173 | LS483427.1 | GCA900475915_00134 | CDS | open | 142538-144346 | _na 602_aa | ddpA | Extracellular solute-binding protein family 5 |
| 174 | LS483427.1 | GCA900475915_00135 | CDS | open | 144533-145702 | _na 389_aa | nagC | ROK family protein |
| 175 | LS483427.1 | GCA900475915_00136 | CDS | open | 145728-147245 | _na 505_aa | mlrC | Microcystin LR degradation protein MlrC |
| 176 | LS483427.1 | GCA900475915_00137 | CDS | open | 147454-148947 | _na 497_aa | adhE | Methylmalonate-semialdehyde dehydrogenase |
| 177 | LS483427.1 | GCA900475915_00138 | CDS | open | 149145-151028 | _na 627_aa | iolD | 3D-(3%2C5/4)-trihydroxycyclohexane-1%2C2-dione acylhydrolase (decyclizing) |
| 178 | LS483427.1 | GCA900475915_00139 | CDS | open | 151025-151921 | _na 298_aa | iolB | 5-deoxy-glucuronate isomerase |
| 179 | LS483427.1 | GCA900475915_00140 | CDS | open | 151918-152781 | _na 287_aa | Cgl0159-like domain-containing protein | |
| 180 | LS483427.1 | GCA900475915_00141 | CDS | open | 152778-153767 | _na 329_aa | rbsK | PfkB domain protein |
| 181 | LS483427.1 | GCA900475915_00142 | CDS | open | 153938-154714 | _na 258_aa | mngR | Transcriptional regulator%2C GntR family |
| 182 | LS483427.1 | GCA900475915_00143 | CDS | open | 154947-156026 | _na 359_aa | talA | Transaldolase |
| 183 | LS483427.1 | GCA900475915_00144 | CDS | open | 156063-157049 | _na 328_aa | iolG | inositol 2-dehydrogenase |
| 184 | LS483427.1 | GCA900475915_00145 | CDS | open | 157090-157953 | _na 287_aa | ycjR | Myo-inosose-2 dehydratase |
| 185 | LS483427.1 | GCA900475915_00146 | CDS | open | 158389-158649 | _na 86_aa | hypothetical protein | |
| 186 | LS483427.1 | GCA900475915_00147 | CDS | open | 158708-160375 | _na 555_aa | Sugar transporter | |
| 187 | LS483427.1 | GCA900475915_00148 | CDS | open | 160770-161903 | _na 377_aa | frmA | Alcohol dehydrogenase zinc-binding domain protein |
| 188 | LS483427.1 | GCA900475915_00149 | CDS | open | 162593-163870 | _na 425_aa | yihS | N-acylglucosamine 2-epimerase |
| 189 | LS483427.1 | GCA900475915_00150 | CDS | open | 164002-164952 | _na 316_aa | rbsK | PfkB domain protein |
| 190 | LS483427.1 | GCA900475915_00151 | CDS | open | 165003-166031 | _na 342_aa | purR | Transcriptional regulator%2C LacI family |
| 191 | LS483427.1 | GCA900475915_00152 | CDS | open | 166182-169229 | _na 1015_aa | mngB | Glycoside hydrolase family 38 |
| 192 | LS483427.1 | GCA900475915_00153 | CDS | open | 169226-170464 | _na 412_aa | Endo-1%2C4-beta-mannosidase | |
| 193 | LS483427.1 | GCA900475915_00154 | CDS | open | 170589-171464 | _na 291_aa | srtA | Sortase family protein |
| 194 | LS483427.1 | GCA900475915_00155 | CDS | open | 171567-173033 | _na 488_aa | LPXTG-motif cell wall anchor domain protein | |
| 195 | LS483427.1 | GCA900475915_00156 | CDS | open | 173263-175701 | _na 812_aa | clfA | Clumping factor A-related surface protein%2C MSCRAMM (microbial surface components recognizing adhesive matrix molecules) family%2C DEv-IgG fold |
| 196 | LS483427.1 | GCA900475915_00157 | CDS | open | 175958-176956 | _na 332_aa | rarD | EamA family transporter RarD |
| 197 | LS483427.1 | GCA900475915_00158 | CDS | open | 177262-179106 | _na 614_aa | betT | Choline/carnitine/betaine transporter |
| 198 | LS483427.1 | GCA900475915_00159 | CDS | open | 179340-179609 | _na 89_aa | hypothetical protein | |
| 199 | LS483427.1 | GCA900475915_00160 | CDS | open | 179745-182402 | _na 885_aa | nanH | exo-alpha-sialidase |
| 200 | LS483427.1 | GCA900475915_00161 | CDS | open | 182579-184294 | _na 571_aa | ushA | 5'-Nucleotidase domain protein |
| 201 | LS483427.1 | GCA900475915_00162 | CDS | open | 184490-185965 | _na 491_aa | LPXTG-motif cell wall anchor domain protein | |
| 202 | LS483427.1 | GCA900475915_00163 | CDS | open | 185990-188443 | _na 817_aa | clfA | LPXTG-motif cell wall anchor domain protein |
| 203 | LS483427.1 | GCA900475915_00164 | CDS | open | 189202-189855 | _na 217_aa | lutC | LUD domain-containing protein |
| 204 | LS483427.1 | GCA900475915_00165 | CDS | open | 189852-191378 | _na 508_aa | lutB | LutB/LldF family L-lactate oxidation iron-sulfur protein |
| 205 | LS483427.1 | GCA900475915_00166 | CDS | open | 191378-192166 | _na 262_aa | glpC | Cysteine-rich domain-containing protein |
| 206 | LS483427.1 | GCA900475915_00167 | CDS | open | 192230-193897 | _na 555_aa | lldP | L-lactate permease |
| 207 | LS483427.1 | GCA900475915_00168 | CDS | open | 194104-197028 | _na 974_aa | yhgE | YhgE/Pip C-terminal domain protein |
| 208 | LS483427.1 | GCA900475915_00169 | CDS | open | 197148-197855 | _na 235_aa | acrR | Transcriptional regulator%2C TetR family |
| 209 | LS483427.1 | GCA900475915_00170 | CDS | open | 197833-198438 | _na 201_aa | N-acetyltransferase domain-containing protein | |
| 210 | LS483427.1 | GCA900475915_00171 | CDS | open | 198478-199800 | _na 440_aa | gltS | Sodium/glutamate symporter |
| 211 | LS483427.1 | GCA900475915_00172 | CDS | open | 199787-200959 | _na 390_aa | nagC | ROK family protein |
| 212 | LS483427.1 | GCA900475915_00173 | CDS | open | 201143-203374 | _na 743_aa | gnpA | 1%2C3-beta-galactosyl-N-acetylhexosamine phosphorylase |
| 213 | LS483427.1 | GCA900475915_00174 | CDS | open | 203374-204450 | _na 358_aa | srkA | Aminoglycoside phosphotransferase |
| 214 | LS483427.1 | GCA900475915_00175 | CDS | open | 204525-206342 | _na 605_aa | mdoB | Sulfatase |
| 215 | LS483427.1 | GCA900475915_00176 | CDS | open | 206894-209842 | _na 982_aa | smc | Coagulation factor 5/8 type domain protein |
| 216 | LS483427.1 | GCA900475915_00177 | CDS | open | 210096-211832 | _na 578_aa | Transcriptional regulator | |
| 217 | LS483427.1 | GCA900475915_00179 | CDS | open | 212486-212605 | _na 39_aa | DLW-39 family protein | |
| 218 | LS483427.1 | GCA900475915_00181 | CDS | open | 212907-213341 | _na 144_aa | DUF3566 domain-containing protein | |
| 219 | LS483427.1 | GCA900475915_00182 | CDS | open | 213377-215941 | _na 854_aa | gyrA | DNA gyrase subunit A |
| 220 | LS483427.1 | GCA900475915_00183 | CDS | open | 215966-218014 | _na 682_aa | gyrB | DNA topoisomerase (ATP-hydrolyzing) subunit B |
| 221 | LS483427.1 | GCA900475915_00184 | CDS | open | 218197-218781 | _na 194_aa | DUF721 domain-containing protein | |
| 222 | LS483427.1 | GCA900475915_00185 | CDS | open | 218778-220010 | _na 410_aa | recF | DNA replication/repair protein RecF |
| 223 | LS483427.1 | GCA900475915_00186 | CDS | open | 220016-221134 | _na 372_aa | dnaN | DNA polymerase III subunit beta |
| 224 | LS483427.1 | GCA900475915_00187 | CDS | open | 221494-223128 | _na 544_aa | dnaA | chromosomal replication initiator protein DnaA |
| 225 | LS483427.1 | GCA900475915_00188 | CDS | open | 223458-223598 | _na 46_aa | rpmH | 50S ribosomal protein L34 |
| 226 | LS483427.1 | GCA900475915_00189 | CDS | open | 223599-223961 | _na 120_aa | rnpA | ribonuclease P protein component |
| 227 | LS483427.1 | GCA900475915_00190 | CDS | open | 223958-224290 | _na 110_aa | yidD | membrane protein insertion efficiency factor YidD |
| 228 | LS483427.1 | GCA900475915_00191 | CDS | open | 224305-225438 | _na 377_aa | yidC | membrane protein insertase YidC |
| 229 | LS483427.1 | GCA900475915_00192 | CDS | open | 225479-226036 | _na 185_aa | jag | Single-stranded nucleic acid binding R3H domain protein |
| 230 | LS483427.1 | GCA900475915_00193 | CDS | open | 226143-227342 | _na 399_aa | IS110 family transposase | |
| 231 | LS483427.1 | GCA900475915_00194 | CDS | open | 228121-228771 | _na 216_aa | rsmG | 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG |
| 232 | LS483427.1 | GCA900475915_00195 | CDS | open | 229067-230020 | _na 317_aa | Cobyrinic acid ac-diamide synthase | |
| 233 | LS483427.1 | GCA900475915_00196 | CDS | open | 230031-231425 | _na 464_aa | spo0J | ParB-like partition protein |
| 234 | LS483427.1 | GCA900475915_00197 | CDS | open | 231709-233067 | _na 452_aa | aRO8 | Transcriptional regulator%2C GntR family |
| 235 | LS483427.1 | GCA900475915_00198 | CDS | open | 233253-233423 | _na 56_aa | hypothetical protein | |
| 236 | LS483427.1 | GCA900475915_00199 | CDS | open | 233420-234367 | _na 315_aa | trxB | thioredoxin-disulfide reductase |
| 237 | LS483427.1 | GCA900475915_00200 | CDS | open | 234414-236402 | _na 662_aa | Serine/threonine protein kinase | |
| 238 | LS483427.1 | GCA900475915_00201 | CDS | open | 236450-238441 | _na 663_aa | DUF6049 domain-containing protein | |
| 239 | LS483427.1 | GCA900475915_00202 | CDS | open | 238441-238869 | _na 142_aa | yjhB | NUDIX hydrolase |
| 240 | LS483427.1 | GCA900475915_00203 | CDS | open | 238871-240505 | _na 544_aa | pcnB | CCA tRNA nucleotidyltransferase |
| 241 | LS483427.1 | GCA900475915_00204 | CDS | open | 240591-241916 | _na 441_aa | Major facilitator superfamily MFS_1 | |
| 242 | LS483427.1 | GCA900475915_00205 | CDS | open | 241985-243229 | _na 414_aa | perM | Permease |
| 243 | LS483427.1 | GCA900475915_00206 | CDS | open | 243337-245400 | _na 687_aa | mrcB | peptidoglycan glycosyltransferase |
| 244 | LS483427.1 | GCA900475915_00207 | CDS | open | 245564-245869 | _na 101_aa | rpsF | 30S ribosomal protein S6 |
| 245 | LS483427.1 | GCA900475915_00208 | CDS | open | 245888-246415 | _na 175_aa | ssb | Single-stranded DNA-binding protein |
| 246 | LS483427.1 | GCA900475915_00209 | CDS | open | 246476-246712 | _na 78_aa | rpsR | 30S ribosomal protein S18 |
| 247 | LS483427.1 | GCA900475915_00210 | CDS | open | 246736-247182 | _na 148_aa | rplI | 50S ribosomal protein L9 |
| 248 | LS483427.1 | GCA900475915_00211 | CDS | open | 247443-250817 | _na 1124_aa | Glycoside hydrolase family 85 | |
| 249 | LS483427.1 | GCA900475915_00212 | CDS | open | 251592-251933 | _na 113_aa | hypothetical protein | |
| 250 | LS483427.1 | GCA900475915_00213 | CDS | open | 252248-252523 | _na 91_aa | transposase | |
| 251 | LS483427.1 | GCA900475915_00214 | CDS | open | 252943-257265 | _na 1440_aa | spaA | SpaA isopeptide-forming pilin-related protein |
| 252 | LS483427.1 | GCA900475915_00215 | CDS | open | 257552-258886 | _na 444_aa | norM | MATE efflux family protein |
| 253 | LS483427.1 | GCA900475915_00216 | CDS | open | 259573-260928 | _na 451_aa | dnaB | replicative DNA helicase |
| 254 | LS483427.1 | GCA900475915_00217 | CDS | open | 260953-261672 | _na 239_aa | rnaY | Metal dependent phosphohydrolase |
| 255 | LS483427.1 | GCA900475915_00218 | CDS | open | 261672-262502 | _na 276_aa | aRA1 | 2%2C5-didehydrogluconate reductase |
| 256 | LS483427.1 | GCA900475915_00219 | CDS | open | 262499-263086 | _na 195_aa | plsC | Phospholipid/glycerol acyltransferase |
| 257 | LS483427.1 | GCA900475915_00220 | CDS | open | 263099-263854 | _na 251_aa | dsbG | DSBA oxidoreductase |
| 258 | LS483427.1 | GCA900475915_00221 | CDS | open | 263862-264782 | _na 306_aa | UDP-N-acetylglucosamine diphosphorylase | |
| 259 | LS483427.1 | GCA900475915_00222 | CDS | open | 264898-265428 | _na 176_aa | GerMN domain-containing protein | |
| 260 | LS483427.1 | GCA900475915_00223 | CDS | open | 265453-266280 | _na 275_aa | DUF4261 domain-containing protein | |
| 261 | LS483427.1 | GCA900475915_00224 | CDS | open | 266300-267523 | _na 407_aa | tgt | tRNA guanosine(34) transglycosylase Tgt |
| 262 | LS483427.1 | GCA900475915_00225 | CDS | open | 267573-268907 | _na 444_aa | DUF1444 domain-containing protein | |
| 263 | LS483427.1 | GCA900475915_00226 | CDS | open | 269068-269667 | _na 199_aa | acrR | Transcriptional regulator%2C TetR family |
| 264 | LS483427.1 | GCA900475915_00227 | CDS | open | 269664-272087 | _na 807_aa | hrpB | ATP-dependent helicase HrpB |
| 265 | LS483427.1 | GCA900475915_00228 | CDS | open | 272640-272921 | _na 93_aa | IS3 family transposase | |
| 266 | LS483427.1 | GCA900475915_00229 | CDS | open | 272975-273796 | _na 273_aa | IS3 family transposase | |
| 267 | LS483427.1 | GCA900475915_00230 | CDS | open | 273916-274083 | _na 55_aa | hypothetical protein | |
| 268 | LS483427.1 | GCA900475915_00231 | CDS | open | 274345-274590 | _na 81_aa | hypothetical protein | |
| 269 | LS483427.1 | GCA900475915_00232 | CDS | open | 274744-275388 | _na 214_aa | yigB | Haloacid dehalogenase domain protein hydrolase |
| 270 | LS483427.1 | GCA900475915_00233 | CDS | open | 275406-276593 | _na 395_aa | rlmC | 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC |
| 271 | LS483427.1 | GCA900475915_00234 | CDS | open | 277090-277911 | _na 273_aa | gatD | Lipid II isoglutaminyl synthase (glutamine-hydrolyzing) subunit GatD |
| 272 | LS483427.1 | GCA900475915_00235 | CDS | open | 277908-279347 | _na 479_aa | murT | Lipid II isoglutaminyl synthase (glutamine-hydrolyzing) subunit MurT |
| 273 | LS483427.1 | GCA900475915_00236 | CDS | open | 279497-279667 | _na 56_aa | hypothetical protein | |
| 274 | LS483427.1 | GCA900475915_00237 | CDS | open | 279694-280830 | _na 378_aa | thioester domain-containing protein | |
| 275 | LS483427.1 | GCA900475915_00238 | CDS | open | 280899-284582 | _na 1227_aa | LPXTG-motif cell wall anchor domain protein | |
| 276 | LS483427.1 | GCA900475915_00240 | CDS | open | 284951-286522 | _na 523_aa | citT | Anion transporter |
| 277 | LS483427.1 | GCA900475915_00241 | CDS | open | 287010-288392 | _na 460_aa | uhpC | Major facilitator superfamily MFS_1 |
| 278 | LS483427.1 | GCA900475915_00242 | CDS | open | 288619-290313 | _na 564_aa | pldB | Alpha/beta hydrolase fold-3 domain protein |
| 279 | LS483427.1 | GCA900475915_00243 | CDS | open | 290345-291748 | _na 467_aa | araJ | Sugar transporter |
| 280 | LS483427.1 | GCA900475915_00244 | CDS | open | 291826-292509 | _na 227_aa | mngR | Transcriptional regulator%2C GntR family |
| 281 | LS483427.1 | GCA900475915_00245 | CDS | open | 293285-293530 | _na 81_aa | hypothetical protein | |
| 282 | LS483427.1 | GCA900475915_00246 | CDS | open | 293553-293852 | _na 99_aa | hypothetical protein | |
| 283 | LS483427.1 | GCA900475915_00247 | CDS | open | 298549-298863 | _na 104_aa | cas2e | type I-E CRISPR-associated endoribonuclease Cas2e |
| 284 | LS483427.1 | GCA900475915_00248 | CDS | open | 298829-299812 | _na 327_aa | cas1e | type I-E CRISPR-associated endonuclease Cas1e |
| 285 | LS483427.1 | GCA900475915_00249 | CDS | open | 299809-302454 | _na 881_aa | cas3 | CRISPR-associated helicase Cas3 |
| 286 | LS483427.1 | GCA900475915_00250 | CDS | open | 302451-303149 | _na 232_aa | cas6e | type I-E CRISPR-associated protein Cas6/Cse3/CasE |
| 287 | LS483427.1 | GCA900475915_00251 | CDS | open | 303399-305039 | _na 546_aa | cas8e | CRISPR-associated protein%2C Cse1 family |
| 288 | LS483427.1 | GCA900475915_00252 | CDS | open | 305041-305667 | _na 208_aa | cse2gr11 | CRISPR-associated protein%2C Cse2 family |
| 289 | LS483427.1 | GCA900475915_00253 | CDS | open | 305681-306736 | _na 351_aa | cas7e | type I-E CRISPR-associated protein Cas7/Cse4/CasC |
| 290 | LS483427.1 | GCA900475915_00254 | CDS | open | 306733-307464 | _na 243_aa | cas5e | type I-E CRISPR-associated protein Cas5/CasD |
| 291 | LS483427.1 | GCA900475915_00255 | CDS | open | 307835-308311 | _na 158_aa | yciW | Alkylhydroperoxidase like protein%2C AhpD family |
| 292 | LS483427.1 | GCA900475915_00258 | CDS | open | 309237-311543 | _na 768_aa | hypothetical protein | |
| 293 | LS483427.1 | GCA900475915_00259 | CDS | open | 311433-312377 | _na 314_aa | cof | HAD-superfamily hydrolase%2C subfamily IIB |
| 294 | LS483427.1 | GCA900475915_00260 | CDS | open | 312374-313651 | _na 425_aa | serS | serine--tRNA ligase |
| 295 | LS483427.1 | GCA900475915_00261 | CDS | open | 313757-314917 | _na 386_aa | lCB5 | Diacylglycerol kinase catalytic region |
| 296 | LS483427.1 | GCA900475915_00262 | CDS | open | 314917-317157 | _na 746_aa | SGNH hydrolase-type esterase domain-containing protein | |
| 297 | LS483427.1 | GCA900475915_00263 | CDS | open | 317299-318225 | _na 308_aa | citB | Transcriptional regulator%2C LuxR family |
| 298 | LS483427.1 | GCA900475915_00264 | CDS | open | 318366-319139 | _na 257_aa | wcaA | Glucosyl-3-phosphoglycerate synthase |
| 299 | LS483427.1 | GCA900475915_00265 | CDS | open | 319413-320270 | _na 285_aa | DUF5926 domain-containing protein | |
| 300 | LS483427.1 | GCA900475915_00266 | CDS | open | 320356-321354 | _na 332_aa | pldB | Alpha/beta hydrolase fold protein |
| 301 | LS483427.1 | GCA900475915_00267 | CDS | open | 321357-321995 | _na 212_aa | upp | uracil phosphoribosyltransferase |
| 302 | LS483427.1 | GCA900475915_00268 | CDS | open | 322070-322501 | _na 143_aa | tadA | tRNA adenosine(34) deaminase TadA |
| 303 | LS483427.1 | GCA900475915_00270 | CDS | open | 323320-323958 | _na 212_aa | DUF3800 domain-containing protein | |
| 304 | LS483427.1 | GCA900475915_00272 | CDS | open | 324192-325301 | _na 369_aa | Acyltransferase 3 domain-containing protein | |
| 305 | LS483427.1 | GCA900475915_00273 | CDS | open | 325416-325706 | _na 96_aa | hypothetical protein | |
| 306 | LS483427.1 | GCA900475915_00274 | CDS | open | 325733-326407 | _na 224_aa | def | peptide deformylase |
| 307 | LS483427.1 | GCA900475915_00275 | CDS | open | 326632-328125 | _na 497_aa | UPF0371 protein Arch_1739 | |
| 308 | LS483427.1 | GCA900475915_00276 | CDS | open | 328151-330511 | _na 786_aa | mgtA | ATPase%2C P-type (Transporting)%2C HAD superfamily%2C subfamily IC |
| 309 | LS483427.1 | GCA900475915_00277 | CDS | open | 330966-331220 | _na 84_aa | Membrane protein | |
| 310 | LS483427.1 | GCA900475915_00278 | CDS | open | 331292-332017 | _na 241_aa | LPXTG-motif cell wall anchor domain protein | |
| 311 | LS483427.1 | GCA900475915_00279 | CDS | open | 332346-335987 | _na 1213_aa | FG-GAP repeat protein | |
| 312 | LS483427.1 | GCA900475915_00280 | CDS | open | 336165-337106 | _na 313_aa | deoR | Transcriptional regulator%2C DeoR family |
| 313 | LS483427.1 | GCA900475915_00281 | CDS | open | 337176-337655 | _na 159_aa | Abi-like protein | |
| 314 | LS483427.1 | GCA900475915_00282 | CDS | open | 338136-339497 | _na 453_aa | fucP | L-fucose:H+ symporter permease |
| 315 | LS483427.1 | GCA900475915_00283 | CDS | open | 339507-340526 | _na 339_aa | DUF4432 domain-containing protein | |
| 316 | LS483427.1 | GCA900475915_00284 | CDS | open | 340529-341431 | _na 300_aa | rbsK | ribokinase |
| 317 | LS483427.1 | GCA900475915_00286 | CDS | open | 342517-343812 | _na 431_aa | yaeI | Metallophosphoesterase |
| 318 | LS483427.1 | GCA900475915_00287 | CDS | open | 343809-346211 | _na 800_aa | mrcB | peptidoglycan glycosyltransferase |
| 319 | LS483427.1 | GCA900475915_00288 | CDS | open | 346368-346688 | _na 106_aa | whiB | Transcriptional regulator WhiB |
| 320 | LS483427.1 | GCA900475915_00289 | CDS | open | 346734-346892 | _na 52_aa | DUF4177 domain-containing protein | |
| 321 | LS483427.1 | GCA900475915_00290 | CDS | open | 346889-347356 | _na 155_aa | ridA | Endoribonuclease L-PSP |
| 322 | LS483427.1 | GCA900475915_00291 | CDS | open | 347661-348038 | _na 125_aa | hypothetical protein | |
| 323 | LS483427.1 | GCA900475915_00292 | CDS | open | 348341-349018 | _na 225_aa | crp | cAMP-binding domain of CRP or a regulatory subunit of cAMP-dependent protein kinases |
| 324 | LS483427.1 | GCA900475915_00293 | CDS | open | 349233-349913 | _na 226_aa | nth | endonuclease III |
| 325 | LS483427.1 | GCA900475915_00294 | CDS | open | 350205-351044 | _na 279_aa | DUF559 domain-containing protein | |
| 326 | LS483427.1 | GCA900475915_00295 | CDS | open | 351197-352093 | _na 298_aa | menH | Alpha/beta hydrolase fold protein |
| 327 | LS483427.1 | GCA900475915_00296 | CDS | open | 352195-353232 | _na 345_aa | hypothetical protein | |
| 328 | LS483427.1 | GCA900475915_00297 | CDS | open | 353415-354431 | _na 338_aa | CobQ/CobB/MinD/ParA nucleotide binding domain-containing protein | |
| 329 | LS483427.1 | GCA900475915_00298 | CDS | open | 354431-355591 | _na 386_aa | tadA | Type II secretion system protein E |
| 330 | LS483427.1 | GCA900475915_00299 | CDS | open | 355576-356247 | _na 223_aa | tadB | Type II secretion system F domain protein |
| 331 | LS483427.1 | GCA900475915_00300 | CDS | open | 356340-356771 | _na 143_aa | Type II secretion system protein | |
| 332 | LS483427.1 | GCA900475915_00301 | CDS | open | 357234-357791 | _na 185_aa | hypothetical protein | |
| 333 | LS483427.1 | GCA900475915_00302 | CDS | open | 358123-358305 | _na 60_aa | hypothetical protein | |
| 334 | LS483427.1 | GCA900475915_00303 | CDS | open | 358582-358776 | _na 64_aa | DUF4244 domain-containing protein | |
| 335 | LS483427.1 | GCA900475915_00304 | CDS | open | 358964-359377 | _na 137_aa | tadE | TadE family protein |
| 336 | LS483427.1 | GCA900475915_00305 | CDS | open | 359367-359765 | _na 132_aa | Putative Flp pilus-assembly TadG-like N-terminal domain-containing protein | |
| 337 | LS483427.1 | GCA900475915_00306 | CDS | open | 359671-362007 | _na 778_aa | yprA | DEAD/DEAH box helicase domain protein |
| 338 | LS483427.1 | GCA900475915_00307 | CDS | open | 362271-364073 | _na 600_aa | nrdD | ribonucleoside triphosphate reductase |
| 339 | LS483427.1 | GCA900475915_00308 | CDS | open | 364079-364843 | _na 254_aa | pflA | anaerobic ribonucleoside-triphosphate reductase activating protein |
| 340 | LS483427.1 | GCA900475915_00309 | CDS | open | 365158-366648 | _na 496_aa | hemK | Methyltransferase small |
| 341 | LS483427.1 | GCA900475915_00310 | CDS | open | 366719-369478 | _na 919_aa | topA | type I DNA topoisomerase |
| 342 | LS483427.1 | GCA900475915_00311 | CDS | open | 369482-370141 | _na 219_aa | tmk | dTMP kinase |
| 343 | LS483427.1 | GCA900475915_00312 | CDS | open | 370138-371340 | _na 400_aa | holB | DNA polymerase III subunit delta' |
| 344 | LS483427.1 | GCA900475915_00313 | CDS | open | 371367-372929 | _na 520_aa | TAP domain protein | |
| 345 | LS483427.1 | GCA900475915_00315 | CDS | open | 373621-373878 | _na 85_aa | Helix-turn-helix domain-containing protein | |
| 346 | LS483427.1 | GCA900475915_00316 | CDS | open | 373881-374855 | _na 324_aa | Helix-turn-helix domain-containing protein | |
| 347 | LS483427.1 | GCA900475915_00317 | CDS | open | 374855-375661 | _na 268_aa | hypothetical protein | |
| 348 | LS483427.1 | GCA900475915_00318 | CDS | open | 375869-376066 | _na 65_aa | MFS transporter | |
| 349 | LS483427.1 | GCA900475915_00319 | CDS | open | 376078-376443 | _na 121_aa | prgI | PrgI family protein |
| 350 | LS483427.1 | GCA900475915_00320 | CDS | open | 376391-378793 | _na 800_aa | virB4 | VirB4-like conjugal transfer ATPase%2C CD1110 family |
| 351 | LS483427.1 | GCA900475915_00321 | CDS | open | 378848-380491 | _na 547_aa | Lytic transglycosylase catalytic | |
| 352 | LS483427.1 | GCA900475915_00322 | CDS | open | 380496-381308 | _na 270_aa | TrbL/VirB6 plasmid conjugal transfer protein | |
| 353 | LS483427.1 | GCA900475915_00323 | CDS | open | 381496-382143 | _na 215_aa | DUF2335 domain-containing protein | |
| 354 | LS483427.1 | GCA900475915_00324 | CDS | open | 382145-383827 | _na 560_aa | virD4 | VirD4-like conjugal transfer protein%2C CD1115 family |
| 355 | LS483427.1 | GCA900475915_00325 | CDS | open | 383824-384294 | _na 156_aa | hypothetical protein | |
| 356 | LS483427.1 | GCA900475915_00326 | CDS | open | 384303-384551 | _na 82_aa | hypothetical protein | |
| 357 | LS483427.1 | GCA900475915_00327 | CDS | open | 384548-385423 | _na 291_aa | Phage MuF C-terminal domain-containing protein | |
| 358 | LS483427.1 | GCA900475915_00328 | CDS | open | 385420-385968 | _na 182_aa | pcfB | PcfB family protein |
| 359 | LS483427.1 | GCA900475915_00329 | CDS | open | 385968-387335 | _na 455_aa | Relaxase/mobilization nuclease family protein | |
| 360 | LS483427.1 | GCA900475915_00330 | CDS | open | 387292-387678 | _na 128_aa | Mobilisation protein | |
| 361 | LS483427.1 | GCA900475915_00331 | CDS | open | 387930-388244 | _na 104_aa | hypothetical protein | |
| 362 | LS483427.1 | GCA900475915_00332 | CDS | open | 388459-388953 | _na 164_aa | hypothetical protein | |
| 363 | LS483427.1 | GCA900475915_00333 | CDS | open | 389292-389681 | _na 129_aa | hypothetical protein | |
| 364 | LS483427.1 | GCA900475915_00334 | CDS | open | 390450-390791 | _na 113_aa | hypothetical protein | |
| 365 | LS483427.1 | GCA900475915_00335 | CDS | open | 390820-391596 | _na 258_aa | parA | Cobyrinic acid ac-diamide synthase |
| 366 | LS483427.1 | GCA900475915_00336 | CDS | open | 391599-392381 | _na 260_aa | xerD | Integrase family protein |
| 367 | LS483427.1 | GCA900475915_00337 | CDS | open | 393001-393264 | _na 87_aa | hypothetical protein | |
| 368 | LS483427.1 | GCA900475915_00338 | CDS | open | 393277-393516 | _na 79_aa | hypothetical protein | |
| 369 | LS483427.1 | GCA900475915_00339 | CDS | open | 393590-393898 | _na 102_aa | arsR | Transcriptional regulator%2C ArsR family |
| 370 | LS483427.1 | GCA900475915_00340 | CDS | open | 394196-394450 | _na 84_aa | hypothetical protein | |
| 371 | LS483427.1 | GCA900475915_00344 | CDS | open | 399886-401745 | _na 619_aa | pucL | Xanthine permease |
| 372 | LS483427.1 | GCA900475915_00345 | CDS | open | 401977-403473 | _na 498_aa | codB | Permease for cytosine/purines uracil thiamine allantoin |
| 373 | LS483427.1 | GCA900475915_00346 | CDS | open | 403574-403828 | _na 84_aa | frmR | Cytoplasmic protein |
| 374 | LS483427.1 | GCA900475915_00347 | CDS | open | 403860-405476 | _na 538_aa | pspE | FAD-dependent pyridine nucleotide-disulfide oxidoreductase |
| 375 | LS483427.1 | GCA900475915_00348 | CDS | open | 405483-405653 | _na 56_aa | Bacteriocin-type signal sequence-containing protein | |
| 376 | LS483427.1 | GCA900475915_00349 | CDS | open | 405788-406150 | _na 120_aa | yccF | YccF domain-containing protein |
| 377 | LS483427.1 | GCA900475915_00350 | CDS | open | 406385-407125 | _na 246_aa | gpmA | phosphoglyceromutase |
| 378 | LS483427.1 | GCA900475915_00351 | CDS | open | 407226-407870 | _na 214_aa | phoU | phosphate signaling complex protein PhoU |
| 379 | LS483427.1 | GCA900475915_00352 | CDS | open | 408014-409195 | _na 393_aa | walK | Sensor-like histidine kinase SenX3 |
| 380 | LS483427.1 | GCA900475915_00353 | CDS | open | 409192-409881 | _na 229_aa | ompR | Sensory transduction protein RegX3 |
| 381 | LS483427.1 | GCA900475915_00354 | CDS | open | 409956-410501 | _na 181_aa | cdnL | Transcriptional regulator%2C CarD family |
| 382 | LS483427.1 | GCA900475915_00355 | CDS | open | 410574-411272 | _na 232_aa | ispD | 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase |
| 383 | LS483427.1 | GCA900475915_00356 | CDS | open | 411276-411767 | _na 163_aa | 2-C-methyl-D-erythritol 2%2C4-cyclodiphosphate synthase | |
| 384 | LS483427.1 | GCA900475915_00357 | CDS | open | 411793-413184 | _na 463_aa | btlA | Major facilitator superfamily MFS_1 |
| 385 | LS483427.1 | GCA900475915_00358 | CDS | open | 413383-414810 | _na 475_aa | cysS | cysteine--tRNA ligase |
| 386 | LS483427.1 | GCA900475915_00359 | CDS | open | 414810-415793 | _na 327_aa | rlmB | 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB |
| 387 | LS483427.1 | GCA900475915_00360 | CDS | open | 415800-417065 | _na 421_aa | hypothetical protein | |
| 388 | LS483427.1 | GCA900475915_00361 | CDS | open | 417068-417589 | _na 173_aa | yhfF | ASCH domain-containing protein |
| 389 | LS483427.1 | GCA900475915_00362 | CDS | open | 417690-419054 | _na 454_aa | uraA | Uracil-xanthine permease |
| 390 | LS483427.1 | GCA900475915_00363 | CDS | open | 419059-419631 | _na 190_aa | LytR/CpsA/Psr regulator C-terminal domain-containing protein | |
| 391 | LS483427.1 | GCA900475915_00364 | CDS | open | 419733-420182 | _na 149_aa | hypothetical protein | |
| 392 | LS483427.1 | GCA900475915_00365 | CDS | open | 420376-420702 | _na 108_aa | hypothetical protein | |
| 393 | LS483427.1 | GCA900475915_00366 | CDS | open | 420753-421160 | _na 135_aa | hypothetical protein | |
| 394 | LS483427.1 | GCA900475915_00367 | CDS | open | 421572-421853 | _na 93_aa | IS3 family transposase | |
| 395 | LS483427.1 | GCA900475915_00368 | CDS | open | 421907-422728 | _na 273_aa | IS3 family transposase | |
| 396 | LS483427.1 | GCA900475915_00369 | CDS | open | 422910-424214 | _na 434_aa | araJ | Major facilitator superfamily MFS_1 |
| 397 | LS483427.1 | GCA900475915_00372 | CDS | open | 425116-427662 | _na 848_aa | dnaX | DNA polymerase III subunit gamma and tau |
| 398 | LS483427.1 | GCA900475915_00373 | CDS | open | 427662-428288 | _na 208_aa | recR | recombination mediator RecR |
| 399 | LS483427.1 | GCA900475915_00374 | CDS | open | 428388-429638 | _na 416_aa | DUF4032 domain-containing protein | |
| 400 | LS483427.1 | GCA900475915_00375 | CDS | open | 429784-430911 | _na 375_aa | malK | sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC |
| 401 | LS483427.1 | GCA900475915_00376 | CDS | open | 431137-432768 | _na 543_aa | sPS1 | non-specific serine/threonine protein kinase |
| 402 | LS483427.1 | GCA900475915_00377 | CDS | open | 432823-433671 | _na 282_aa | dsbG | DSBA oxidoreductase |
| 403 | LS483427.1 | GCA900475915_00379 | CDS | open | 434098-435540 | _na 480_aa | alsT | Amino acid carrier protein |
| 404 | LS483427.1 | GCA900475915_00380 | CDS | open | 435733-436401 | _na 222_aa | trkA | TrkA-N domain protein |
| 405 | LS483427.1 | GCA900475915_00381 | CDS | open | 436417-437787 | _na 456_aa | trkG | H(+)-transporting two-sector ATPase |
| 406 | LS483427.1 | GCA900475915_00382 | CDS | open | 437910-438968 | _na 352_aa | tdh | L-threonine 3-dehydrogenase |
| 407 | LS483427.1 | GCA900475915_00383 | CDS | open | 438968-440158 | _na 396_aa | bioF | glycine C-acetyltransferase |
| 408 | LS483427.1 | GCA900475915_00384 | CDS | open | 440270-441556 | _na 428_aa | Thioester domain-containing protein | |
| 409 | LS483427.1 | GCA900475915_00385 | CDS | open | 441564-442235 | _na 223_aa | ung | uracil-DNA glycosylase |
| 410 | LS483427.1 | GCA900475915_00386 | CDS | open | 442285-442548 | _na 87_aa | DUF3263 domain-containing protein | |
| 411 | LS483427.1 | GCA900475915_00387 | CDS | open | 442605-443234 | _na 209_aa | LytR/CpsA/Psr regulator C-terminal domain-containing protein | |
| 412 | LS483427.1 | GCA900475915_00388 | CDS | open | 443502-445124 | _na 540_aa | groL | chaperonin GroEL |
| 413 | LS483427.1 | GCA900475915_00389 | CDS | open | 445382-446587 | _na 401_aa | putative metal-dependent phosphohydrolase%2C HD superfamily | |
| 414 | LS483427.1 | GCA900475915_00390 | CDS | open | 446796-447527 | _na 243_aa | yqjQ | Short-chain dehydrogenase/reductase SDR |
| 415 | LS483427.1 | GCA900475915_00391 | CDS | open | 447524-448237 | _na 237_aa | plsC | Phospholipid/glycerol acyltransferase |
| 416 | LS483427.1 | GCA900475915_00392 | CDS | open | 448158-449687 | _na 509_aa | walK | histidine kinase |
| 417 | LS483427.1 | GCA900475915_00393 | CDS | open | 449690-450436 | _na 248_aa | Two component transcriptional regulator%2C winged helix family | |
| 418 | LS483427.1 | GCA900475915_00394 | CDS | open | 450478-451074 | _na 198_aa | NYN domain-containing protein | |
| 419 | LS483427.1 | GCA900475915_00395 | CDS | open | 451227-451964 | _na 245_aa | pspA | Phage shock protein A%2C PspA |
| 420 | LS483427.1 | GCA900475915_00396 | CDS | open | 452046-453965 | _na 639_aa | Chromogranin/secretogranin | |
| 421 | LS483427.1 | GCA900475915_00397 | CDS | open | 454114-454545 | _na 143_aa | cspC | Cold-shock DNA-binding domain protein |
| 422 | LS483427.1 | GCA900475915_00398 | CDS | open | 454529-455326 | _na 265_aa | DUF3027 domain-containing protein | |
| 423 | LS483427.1 | GCA900475915_00399 | CDS | open | 455330-456574 | _na 414_aa | manA | mannose-6-phosphate isomerase%2C class I |
| 424 | LS483427.1 | GCA900475915_00400 | CDS | open | 456667-458139 | _na 490_aa | Xanthine/uracil/vitamin C permease | |
| 425 | LS483427.1 | GCA900475915_00401 | CDS | open | 458377-459054 | _na 225_aa | mntR | Iron (Metal) dependent repressor%2C DtxR family |
| 426 | LS483427.1 | GCA900475915_00402 | CDS | open | 459281-460003 | _na 240_aa | nlpC | NLP/P60 protein |
| 427 | LS483427.1 | GCA900475915_00403 | CDS | open | 460163-461095 | _na 310_aa | uspA | UspA domain protein |
| 428 | LS483427.1 | GCA900475915_00405 | CDS | open | 461560-462468 | _na 302_aa | trhO | rhodanese-related sulfurtransferase |
| 429 | LS483427.1 | GCA900475915_00406 | CDS | open | 462504-466709 | _na 1401_aa | DNA helicase | |
| 430 | LS483427.1 | GCA900475915_00407 | CDS | open | 466702-466920 | _na 72_aa | hypothetical protein | |
| 431 | LS483427.1 | GCA900475915_00408 | CDS | open | 466978-467352 | _na 124_aa | mscL | large conductance mechanosensitive channel protein MscL |
| 432 | LS483427.1 | GCA900475915_00409 | CDS | open | 467400-468011 | _na 203_aa | cpaB | SAF domain protein |
| 433 | LS483427.1 | GCA900475915_00410 | CDS | open | 468142-468759 | _na 205_aa | fAU1 | 5-formyltetrahydrofolate cyclo-ligase |
| 434 | LS483427.1 | GCA900475915_00411 | CDS | open | 468852-470063 | _na 403_aa | glp | gephyrin-like molybdotransferase Glp |
| 435 | LS483427.1 | GCA900475915_00412 | CDS | open | 470170-471093 | _na 307_aa | Transmembrane protein | |
| 436 | LS483427.1 | GCA900475915_00413 | CDS | open | 471097-471561 | _na 154_aa | Alpha/beta hydrolase | |
| 437 | LS483427.1 | GCA900475915_00414 | CDS | open | 471565-471942 | _na 125_aa | DUF2314 domain-containing protein | |
| 438 | LS483427.1 | GCA900475915_00415 | CDS | open | 471987-473093 | _na 368_aa | rsmC | rRNA (Guanine-N(2)-)-methyltransferase |
| 439 | LS483427.1 | GCA900475915_00416 | CDS | open | 473103-473708 | _na 201_aa | citB | Two component transcriptional regulator%2C LuxR family |
| 440 | LS483427.1 | GCA900475915_00417 | CDS | open | 473705-474784 | _na 359_aa | comP | Integral membrane sensor signal transduction histidine kinase |
| 441 | LS483427.1 | GCA900475915_00418 | CDS | open | 474831-475586 | _na 251_aa | ABC-2 type transporter | |
| 442 | LS483427.1 | GCA900475915_00419 | CDS | open | 475588-476505 | _na 305_aa | rbbA | ABC transporter related protein |
| 443 | LS483427.1 | GCA900475915_00420 | CDS | open | 476574-476924 | _na 116_aa | Intracellular sulfur oxidation protein%2C DsrE/DsrF family | |
| 444 | LS483427.1 | GCA900475915_00421 | CDS | open | 477069-477422 | _na 117_aa | Metallopeptidase family protein | |
| 445 | LS483427.1 | GCA900475915_00422 | CDS | open | 477424-478257 | _na 277_aa | rsmI | 16S rRNA (cytidine(1402)-2'-O)-methyltransferase |
| 446 | LS483427.1 | GCA900475915_00423 | CDS | open | 478269-480530 | _na 753_aa | ydfJ | MMPL domain protein |
| 447 | LS483427.1 | GCA900475915_00424 | CDS | open | 480539-480943 | _na 134_aa | fra | YdhG-like domain-containing protein |
| 448 | LS483427.1 | GCA900475915_00425 | CDS | open | 481058-482092 | _na 344_aa | nicotinamidase | |
| 449 | LS483427.1 | GCA900475915_00426 | CDS | open | 482221-484026 | _na 601_aa | metG | Methionine--tRNA ligase |
| 450 | LS483427.1 | GCA900475915_00427 | CDS | open | 484037-484990 | _na 317_aa | tatD | TatD-related deoxyribonuclease |
| 451 | LS483427.1 | GCA900475915_00428 | CDS | open | 485106-486281 | _na 391_aa | yabE | G5 domain protein |
| 452 | LS483427.1 | GCA900475915_00429 | CDS | open | 486282-487187 | _na 301_aa | rsmA | 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA |
| 453 | LS483427.1 | GCA900475915_00430 | CDS | open | 487315-488157 | _na 280_aa | bglG | Transcriptional antiterminator%2C BglG |
| 454 | LS483427.1 | GCA900475915_00431 | CDS | open | 488174-489769 | _na 531_aa | ptsG2 | PTS system%2C N-acetylglucosamine-specific IIBC subunit |
| 455 | LS483427.1 | GCA900475915_00432 | CDS | open | 489769-490254 | _na 161_aa | nagE | PTS system%2C glucose subfamily%2C IIA subunit |
| 456 | LS483427.1 | GCA900475915_00433 | CDS | open | 490344-491294 | _na 316_aa | ispE | 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase |
| 457 | LS483427.1 | GCA900475915_00434 | CDS | open | 491408-493249 | _na 613_aa | ccmA | heme ABC exporter ATP-binding protein CcmA |
| 458 | LS483427.1 | GCA900475915_00435 | CDS | open | 493503-494033 | _na 176_aa | marR | Transcriptional regulator%2C MarR family |
| 459 | LS483427.1 | GCA900475915_00436 | CDS | open | 494403-494720 | _na 105_aa | hypothetical protein | |
| 460 | LS483427.1 | GCA900475915_00437 | CDS | open | 494758-495162 | _na 134_aa | Site-specific DNA-methyltransferase (Adenine-specific) | |
| 461 | LS483427.1 | GCA900475915_00438 | CDS | open | 495506-495712 | _na 68_aa | Antitoxin | |
| 462 | LS483427.1 | GCA900475915_00439 | CDS | open | 495702-496397 | _na 231_aa | hsdM | site-specific DNA-methyltransferase (adenine-specific) |
| 463 | LS483427.1 | GCA900475915_00440 | CDS | open | 496432-497196 | _na 254_aa | ecsC | EcsC family protein |
| 464 | LS483427.1 | GCA900475915_00441 | CDS | open | 497118-498794 | _na 558_aa | spoIVCA | Resolvase domain protein |
| 465 | LS483427.1 | GCA900475915_00442 | CDS | open | 498795-500009 | _na 404_aa | spoIVCA | Recombinase family protein |
| 466 | LS483427.1 | GCA900475915_00443 | CDS | open | 500129-500722 | _na 197_aa | ABC transporter permease | |
| 467 | LS483427.1 | GCA900475915_00444 | CDS | open | 500715-503042 | _na 775_aa | ccmA | heme ABC exporter ATP-binding protein CcmA |
| 468 | LS483427.1 | GCA900475915_00445 | CDS | open | 503078-504820 | _na 580_aa | mdlB | ABC transporter ATP-binding protein |
| 469 | LS483427.1 | GCA900475915_00446 | CDS | open | 504835-506577 | _na 580_aa | mdlB | ABC transport system ATP-binding/permease protein |
| 470 | LS483427.1 | GCA900475915_00447 | CDS | open | 506918-508078 | _na 386_aa | IS256 family transposase | |
| 471 | LS483427.1 | GCA900475915_00448 | CDS | open | 508169-508399 | _na 76_aa | hypothetical protein | |
| 472 | LS483427.1 | GCA900475915_00449 | CDS | open | 508425-509246 | _na 273_aa | IS3 family transposase | |
| 473 | LS483427.1 | GCA900475915_00450 | CDS | open | 509675-510034 | _na 119_aa | hypothetical protein | |
| 474 | LS483427.1 | GCA900475915_00451 | CDS | open | 510004-510705 | _na 233_aa | Methyltransferase | |
| 475 | LS483427.1 | GCA900475915_00452 | CDS | open | 510851-511036 | _na 61_aa | Cell division protein | |
| 476 | LS483427.1 | GCA900475915_00453 | CDS | open | 511033-511683 | _na 216_aa | Phage-associated protein | |
| 477 | LS483427.1 | GCA900475915_00454 | CDS | open | 511686-511865 | _na 59_aa | DUF4314 domain-containing protein | |
| 478 | LS483427.1 | GCA900475915_00455 | CDS | open | 511981-512328 | _na 115_aa | hypothetical protein | |
| 479 | LS483427.1 | GCA900475915_00456 | CDS | open | 512493-512675 | _na 60_aa | hypothetical protein | |
| 480 | LS483427.1 | GCA900475915_00457 | CDS | open | 512802-513092 | _na 96_aa | Pseudouridine synthase | |
| 481 | LS483427.1 | GCA900475915_00458 | CDS | open | 513401-514600 | _na 399_aa | IS110 family transposase | |
| 482 | LS483427.1 | GCA900475915_00459 | CDS | open | 514626-515003 | _na 125_aa | hypothetical protein | |
| 483 | LS483427.1 | GCA900475915_00460 | CDS | open | 514866-515357 | _na 163_aa | Transposase DDE domain-containing protein | |
| 484 | LS483427.1 | GCA900475915_00461 | CDS | open | 515354-516682 | _na 442_aa | hypothetical protein | |
| 485 | LS483427.1 | GCA900475915_00462 | CDS | open | 516816-517169 | _na 117_aa | Lipoprotein | |
| 486 | LS483427.1 | GCA900475915_00463 | CDS | open | 517353-517955 | _na 200_aa | cadD | Cadmium resistance transporter |
| 487 | LS483427.1 | GCA900475915_00464 | CDS | open | 517952-518341 | _na 129_aa | arsR | HTH-type transcriptional regulator CmtR |
| 488 | LS483427.1 | GCA900475915_00465 | CDS | open | 518537-518878 | _na 113_aa | DUF4263 domain-containing protein | |
| 489 | LS483427.1 | GCA900475915_00466 | CDS | open | 519597-521195 | _na 532_aa | ymfN | Phage terminase%2C large subunit |
| 490 | LS483427.1 | GCA900475915_00467 | CDS | open | 521201-521437 | _na 78_aa | Redox-active disulfide protein 2 | |
| 491 | LS483427.1 | GCA900475915_00468 | CDS | open | 521456-521851 | _na 131_aa | wzb | Protein-tyrosine phosphatase%2C low molecular weight |
| 492 | LS483427.1 | GCA900475915_00469 | CDS | open | 521862-523040 | _na 392_aa | yraQ | Permease |
| 493 | LS483427.1 | GCA900475915_00470 | CDS | open | 523037-523339 | _na 100_aa | arsR | Transcriptional regulator%2C ArsR family |
| 494 | LS483427.1 | GCA900475915_00471 | CDS | open | 523459-524769 | _na 436_aa | beeE | phage portal protein |
| 495 | LS483427.1 | GCA900475915_00472 | CDS | open | 524766-525599 | _na 277_aa | clpP | ATP-dependent Clp protease proteolytic subunit |
| 496 | LS483427.1 | GCA900475915_00473 | CDS | open | 525621-526646 | _na 341_aa | gp36 | phage major capsid protein |
| 497 | LS483427.1 | GCA900475915_00474 | CDS | open | 526689-527018 | _na 109_aa | head-tail connector protein | |
| 498 | LS483427.1 | GCA900475915_00475 | CDS | open | 527018-527347 | _na 109_aa | Phage head-tail adaptor%2C putative | |
| 499 | LS483427.1 | GCA900475915_00476 | CDS | open | 527354-527791 | _na 145_aa | Phage protein%2C HK97 gp10 family | |
| 500 | LS483427.1 | GCA900475915_00477 | CDS | open | 527788-528132 | _na 114_aa | DUF3168 domain-containing protein |

