HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Campylobacter showae (GCA_900573985.1)

Select a Genome:
BAKTA Annotations for GCA_900573985.1
Genome Selected: Campylobacter showae
ContigsBases CDSrRNA tmRNAtRNA
3 2502981 2393 9 1 49
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4920 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:9]    |    Number of Records Found: 4920 [10 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
4001 UWOK01000001.1 GCA900573985_02275 gene open 1968371-1969954
4002 UWOK01000001.1 GCA900573985_02276 gene open 1971260-1972114
4003 UWOK01000001.1 GCA900573985_02277 gene open 1972131-1974329
4004 UWOK01000001.1 GCA900573985_02278 gene open 1974314-1975024
4005 UWOK01000001.1 GCA900573985_02279 gene open 1975024-1977171
4006 UWOK01000001.1 GCA900573985_02280 gene open 1977187-1977636
4007 UWOK01000001.1 GCA900573985_02281 gene open 1977633-1978886
4008 UWOK01000001.1 GCA900573985_02282 gene open 1979118-1979750
4009 UWOK01000001.1 GCA900573985_02283 gene open 1979833-1981053
4010 UWOK01000001.1 GCA900573985_02284 gene open 1981092-1981736
4011 UWOK01000001.1 GCA900573985_02285 gene open 1981831-1982565
4012 UWOK01000001.1 GCA900573985_02286 gene open 1982633-1984165 guaA
4013 UWOK01000001.1 GCA900573985_02287 gene open 1984177-1985568 nhaD
4014 UWOK01000001.1 GCA900573985_02288 gene open 1985706-1986188
4015 UWOK01000001.1 GCA900573985_02289 gene open 1986253-1988067 uvrC
4016 UWOK01000001.1 GCA900573985_02290 gene open 1988323-1988916
4017 UWOK01000001.1 GCA900573985_02291 gene open 1989036-1990208 dnaJ
4018 UWOK01000001.1 GCA900573985_02292 gene open 1990369-1991040
4019 UWOK01000001.1 GCA900573985_02293 gene open 1991037-1992290 arsS
4020 UWOK01000001.1 GCA900573985_02294 gene open 1992274-1992846 recR
4021 UWOK01000001.1 GCA900573985_02295 gene open 1993093-1994148
4022 UWOK01000001.1 GCA900573985_02296 gene open 1994229-1995683 pyk
4023 UWOK01000001.1 GCA900573985_02297 gene open 1995659-1996474
4024 UWOK01000001.1 GCA900573985_02298 gene open 1996471-1997397
4025 UWOK01000001.1 GCA900573985_02299 gene open 1997407-1997949
4026 UWOK01000001.1 GCA900573985_02300 gene open 1997949-1999193 glyA
4027 UWOK01000001.1 GCA900573985_02301 gene open 1999193-2000698 lysS
4028 UWOK01000001.1 GCA900573985_02302 gene open 2000695-2001165
4029 UWOK01000001.1 GCA900573985_02303 gene open 2001165-2001758 cvpA
4030 UWOK01000001.1 GCA900573985_02304 gene open 2001758-2002873
4031 UWOK01000001.1 GCA900573985_02305 gene open 2002885-2003172 gatC
4032 UWOK01000001.1 GCA900573985_02306 gene open 2003296-2003862
4033 UWOK01000001.1 GCA900573985_02307 gene open 2003859-2004869 pgbB
4034 UWOK01000001.1 GCA900573985_02308 gene open 2004866-2005198
4035 UWOK01000001.1 GCA900573985_02309 gene open 2005185-2005814
4036 UWOK01000001.1 GCA900573985_02310 gene open 2005808-2006416 hisG
4037 UWOK01000001.1 GCA900573985_02311 gene open 2007040-2008965
4038 UWOK01000001.1 GCA900573985_02312 gene open 2009034-2009627 lysE
4039 UWOK01000001.1 GCA900573985_02313 gene open 2010190-2012544 mutS2
4040 UWOK01000001.1 GCA900573985_02314 gene open 2012545-2012892
4041 UWOK01000001.1 GCA900573985_02315 gene open 2012889-2014364 murC
4042 UWOK01000001.1 GCA900573985_02316 gene open 2014752-2015108
4043 UWOK01000001.1 GCA900573985_02317 gene open 2015108-2015710
4044 UWOK01000001.1 GCA900573985_02318 gene open 2016034-2017590
4045 UWOK01000001.1 GCA900573985_02319 gene open 2017969-2023233
4046 UWOK01000001.1 GCA900573985_02321 gene open 2023806-2025884 fusA
4047 UWOK01000001.1 GCA900573985_02322 gene open 2025897-2026367 rpsG
4048 UWOK01000001.1 GCA900573985_02323 gene open 2026443-2026850 rpsL
4049 UWOK01000001.1 GCA900573985_02324 gene open 2026950-2027339 doxX
4050 UWOK01000001.1 GCA900573985_02325 gene open 2027446-2031954 rpoC
4051 UWOK01000001.1 GCA900573985_02326 gene open 2031947-2036083 rpoB
4052 UWOK01000001.1 GCA900573985_02327 gene open 2036193-2036570 rplL
4053 UWOK01000001.1 GCA900573985_02328 gene open 2036587-2037069 rplJ
4054 UWOK01000001.1 GCA900573985_02329 gene open 2037180-2037884 rplA
4055 UWOK01000001.1 GCA900573985_02330 gene open 2038005-2038430 rplK
4056 UWOK01000001.1 GCA900573985_02331 gene open 2038441-2038971 nusG
4057 UWOK01000001.1 GCA900573985_02333 gene open 2039481-2040680 tuf
4058 UWOK01000001.1 GCA900573985_02338 gene open 2041373-2041813
4059 UWOK01000001.1 GCA900573985_02339 gene open 2041905-2043158
4060 UWOK01000001.1 GCA900573985_02340 gene open 2043168-2044529 hemN
4061 UWOK01000001.1 GCA900573985_02341 gene open 2044526-2045017
4062 UWOK01000001.1 GCA900573985_02342 gene open 2045031-2045960 argF
4063 UWOK01000001.1 GCA900573985_02343 gene open 2046125-2047096 hemB
4064 UWOK01000001.1 GCA900573985_02344 gene open 2047158-2047730
4065 UWOK01000001.1 GCA900573985_02345 gene open 2047720-2048277 rsmG
4066 UWOK01000001.1 GCA900573985_02346 gene open 2048267-2048491
4067 UWOK01000001.1 GCA900573985_02347 gene open 2048488-2048865
4068 UWOK01000001.1 GCA900573985_02348 gene open 2048862-2049197
4069 UWOK01000001.1 GCA900573985_02349 gene open 2049221-2050096 htpX
4070 UWOK01000001.1 GCA900573985_02350 gene open 2050248-2051084
4071 UWOK01000001.1 GCA900573985_02351 gene open 2051498-2052499
4072 UWOK01000001.1 GCA900573985_02352 gene open 2052492-2052734
4073 UWOK01000001.1 GCA900573985_02353 gene open 2052735-2053670
4074 UWOK01000001.1 GCA900573985_02354 gene open 2053803-2054282
4075 UWOK01000001.1 GCA900573985_02355 gene open 2054282-2054743
4076 UWOK01000001.1 GCA900573985_02356 gene open 2054772-2055302
4077 UWOK01000001.1 GCA900573985_02357 gene open 2055459-2056538
4078 UWOK01000001.1 GCA900573985_02358 gene open 2056554-2059148
4079 UWOK01000001.1 GCA900573985_02359 gene open 2059284-2060045
4080 UWOK01000001.1 GCA900573985_02360 gene open 2060042-2061277 nosD
4081 UWOK01000001.1 GCA900573985_02361 gene open 2061274-2061954 nosG
4082 UWOK01000001.1 GCA900573985_02362 gene open 2061957-2062529
4083 UWOK01000001.1 GCA900573985_02363 gene open 2062539-2062994
4084 UWOK01000001.1 GCA900573985_02364 gene open 2062998-2063903 nosH
4085 UWOK01000001.1 GCA900573985_02365 gene open 2063914-2064573
4086 UWOK01000001.1 GCA900573985_02366 gene open 2064566-2065393 nosY
4087 UWOK01000001.1 GCA900573985_02367 gene open 2065537-2069019
4088 UWOK01000001.1 GCA900573985_02368 gene open 2069016-2069666 merR
4089 UWOK01000001.1 GCA900573985_02369 gene open 2069797-2071188
4090 UWOK01000001.1 GCA900573985_02370 gene open 2071312-2071920
4091 UWOK01000001.1 GCA900573985_02371 gene open 2072039-2072995
4092 UWOK01000001.1 GCA900573985_02372 gene open 2073153-2074184
4093 UWOK01000001.1 GCA900573985_02373 gene open 2074341-2075297
4094 UWOK01000001.1 GCA900573985_02374 gene open 2075316-2075909 lemA
4095 UWOK01000001.1 GCA900573985_02375 gene open 2076172-2076594 fdhF
4096 UWOK01000001.1 GCA900573985_02376 gene open 2076643-2078415
4097 UWOK01000001.1 GCA900573985_02377 gene open 2078675-2079316 fdh3B
4098 UWOK01000001.1 GCA900573985_02378 gene open 2079318-2081540
4099 UWOK01000001.1 GCA900573985_02379 gene open 2081589-2082152
4100 UWOK01000001.1 GCA900573985_02380 gene open 2082176-2082352
4101 UWOK01000001.1 GCA900573985_02381 gene open 2082339-2083064
4102 UWOK01000001.1 GCA900573985_02382 gene open 2083365-2084318 tupC
4103 UWOK01000001.1 GCA900573985_02383 gene open 2084315-2084416
4104 UWOK01000001.1 GCA900573985_02384 gene open 2084413-2085105 tupB
4105 UWOK01000001.1 GCA900573985_02385 gene open 2085181-2085999 tupA
4106 UWOK01000001.1 GCA900573985_02386 gene open 2086226-2087551
4107 UWOK01000001.1 GCA900573985_02387 gene open 2088108-2088296
4108 UWOK01000001.1 GCA900573985_02388 gene open 2088287-2089090
4109 UWOK01000001.1 GCA900573985_02389 gene open 2089083-2089865 fdhD
4110 UWOK01000001.1 GCA900573985_02390 gene open 2090332-2090751 modE
4111 UWOK01000001.1 GCA900573985_02391 gene open 2090851-2091654
4112 UWOK01000001.1 GCA900573985_02392 gene open 2091694-2092131
4113 UWOK01000001.1 GCA900573985_02393 gene open 2092754-2093911
4114 UWOK01000001.1 GCA900573985_02394 gene open 2094011-2094340
4115 UWOK01000001.1 GCA900573985_02395 gene open 2094327-2094599
4116 UWOK01000001.1 GCA900573985_02396 gene open 2095773-2096882
4117 UWOK01000001.1 GCA900573985_02397 gene open 2096905-2098563
4118 UWOK01000001.1 GCA900573985_02398 gene open 2098681-2099250
4119 UWOK01000001.1 GCA900573985_02399 gene open 2099266-2100141
4120 UWOK01000001.1 GCA900573985_02400 gene open 2100220-2100450
4121 UWOK01000001.1 GCA900573985_02401 gene open 2100477-2101598
4122 UWOK01000001.1 GCA900573985_02402 gene open 2101674-2102543
4123 UWOK01000001.1 GCA900573985_02403 gene open 2102770-2103636 araC
4124 UWOK01000001.1 GCA900573985_02404 gene open 2103720-2105405
4125 UWOK01000001.1 GCA900573985_02405 gene open 2105440-2105706
4126 UWOK01000001.1 GCA900573985_02407 gene open 2106224-2107129
4127 UWOK01000001.1 GCA900573985_02408 gene open 2107489-2109441
4128 UWOK01000001.1 GCA900573985_02409 gene open 2109452-2110474 hemE
4129 UWOK01000001.1 GCA900573985_02410 gene open 2110523-2111821
4130 UWOK01000001.1 GCA900573985_02411 gene open 2111941-2112363
4131 UWOK01000001.1 GCA900573985_02412 gene open 2112445-2112741
4132 UWOK01000001.1 GCA900573985_02413 gene open 2113123-2113497
4133 UWOK01000001.1 GCA900573985_02414 gene open 2113666-2114541
4134 UWOK01000001.1 GCA900573985_02415 gene open 2114594-2115550
4135 UWOK01000001.1 GCA900573985_02416 gene open 2115638-2116021
4136 UWOK01000001.1 GCA900573985_02417 gene open 2116157-2117947 lepA
4137 UWOK01000001.1 GCA900573985_02418 gene open 2118304-2119233
4138 UWOK01000001.1 GCA900573985_02419 gene open 2119728-2120231 arcD
4139 UWOK01000001.1 GCA900573985_02420 gene open 2120342-2124196
4140 UWOK01000001.1 GCA900573985_02421 gene open 2124660-2125685
4141 UWOK01000001.1 GCA900573985_02422 gene open 2126043-2127212
4142 UWOK01000001.1 GCA900573985_02423 gene open 2127216-2127614 flgQ
4143 UWOK01000001.1 GCA900573985_02424 gene open 2127590-2128096
4144 UWOK01000001.1 GCA900573985_02425 gene open 2128170-2130791 gyrA
4145 UWOK01000001.1 GCA900573985_02426 gene open 2130977-2131549 ctsW
4146 UWOK01000001.1 GCA900573985_02427 gene open 2131549-2132109
4147 UWOK01000001.1 GCA900573985_02428 gene open 2132119-2132808 mapA
4148 UWOK01000001.1 GCA900573985_02429 gene open 2133091-2136498 asmA
4149 UWOK01000001.1 GCA900573985_02430 gene open 2136768-2137130
4150 UWOK01000001.1 GCA900573985_02431 gene open 2137462-2141736
4151 UWOK01000001.1 GCA900573985_02432 gene open 2142187-2143203 mnmA
4152 UWOK01000001.1 GCA900573985_02433 gene open 2143728-2143943
4153 UWOK01000001.1 GCA900573985_02434 gene open 2143983-2144579
4154 UWOK01000001.1 GCA900573985_02435 gene open 2144732-2145565 fliY
4155 UWOK01000001.1 GCA900573985_02436 gene open 2145558-2146520 fliM
4156 UWOK01000001.1 GCA900573985_02437 gene open 2146550-2146663
4157 UWOK01000001.1 GCA900573985_02438 gene open 2146663-2147370
4158 UWOK01000001.1 GCA900573985_02439 gene open 2147342-2147695
4159 UWOK01000001.1 GCA900573985_02440 gene open 2147711-2148577 fleN
4160 UWOK01000001.1 GCA900573985_02441 gene open 2148570-2149979 flhF
4161 UWOK01000001.1 GCA900573985_02442 gene open 2150092-2150592 folK
4162 UWOK01000001.1 GCA900573985_02443 gene open 2150589-2151614
4163 UWOK01000001.1 GCA900573985_02444 gene open 2151628-2152116 aroQ
4164 UWOK01000001.1 GCA900573985_02445 gene open 2152209-2153435
4165 UWOK01000001.1 GCA900573985_02446 gene open 2153599-2154468
4166 UWOK01000001.1 GCA900573985_02447 gene open 2154748-2155236
4167 UWOK01000001.1 GCA900573985_02448 gene open 2155561-2156415 thiF
4168 UWOK01000001.1 GCA900573985_02449 gene open 2156462-2157553 ribD
4169 UWOK01000001.1 GCA900573985_02450 gene open 2157770-2158228
4170 UWOK01000001.1 GCA900573985_02451 gene open 2158376-2159302
4171 UWOK01000001.1 GCA900573985_02452 gene open 2159299-2160528 bamA
4172 UWOK01000001.1 GCA900573985_02453 gene open 2160725-2160877
4173 UWOK01000001.1 GCA900573985_02454 gene open 2161068-2161616
4174 UWOK01000001.1 GCA900573985_02455 gene open 2161963-2162169
4175 UWOK01000001.1 GCA900573985_00516 gene open 189104-189180 trnM
4176 UWOK01000001.1 GCA900573985_00565 gene open 233968-234052 trnL
4177 UWOK01000001.1 GCA900573985_00566 gene open 234068-234144 trnR
4178 UWOK01000001.1 GCA900573985_00567 gene open 234157-234233 trnR
4179 UWOK01000001.1 GCA900573985_00568 gene open 234239-234315 trnH
4180 UWOK01000001.1 GCA900573985_00569 gene open 234327-234404 trnP
4181 UWOK01000001.1 GCA900573985_00573 gene open 237693-237767 trnE
4182 UWOK01000001.1 GCA900573985_00654 gene open 323094-323169 trnV
4183 UWOK01000001.1 GCA900573985_00682 gene open 349776-349865 trnS
4184 UWOK01000001.1 GCA900573985_00684 gene open 350071-350144 trnC
4185 UWOK01000001.1 GCA900573985_00685 gene open 350155-350241 trnL
4186 UWOK01000001.1 GCA900573985_00686 gene open 350267-350341 trnG
4187 UWOK01000001.1 GCA900573985_00687 gene open 350460-350535 trnA
4188 UWOK01000001.1 GCA900573985_00835 gene open 491957-492044 trnS
4189 UWOK01000001.1 GCA900573985_00877 gene open 533926-534002 trnI
4190 UWOK01000001.1 GCA900573985_00878 gene open 534015-534090 trnA
4191 UWOK01000001.1 GCA900573985_01032 gene open 719583-719680 trnU
4192 UWOK01000001.1 GCA900573985_01095 gene open 785375-785450 trnF
4193 UWOK01000001.1 GCA900573985_01272 gene open 960192-960282 trnS
4194 UWOK01000001.1 GCA900573985_01427 gene open 1113918-1113994 trnI
4195 UWOK01000001.1 GCA900573985_01428 gene open 1114007-1114082 trnA
4196 UWOK01000001.1 GCA900573985_01485 gene open 1166550-1166626 trnI
4197 UWOK01000001.1 GCA900573985_01486 gene open 1166639-1166714 trnA
4198 UWOK01000001.1 GCA900573985_01755 gene open 1434147-1434221 trnQ
4199 UWOK01000001.1 GCA900573985_01756 gene open 1434234-1434308 trnfM
4200 UWOK01000001.1 GCA900573985_01810 gene open 1489346-1489422 trnR
4201 UWOK01000001.1 GCA900573985_01817 gene open 1495243-1495317 trnG
4202 UWOK01000001.1 GCA900573985_01960 gene open 1661176-1661262 trnL
4203 UWOK01000001.1 GCA900573985_02012 gene open 1712723-1712796 trnQ
4204 UWOK01000001.1 GCA900573985_02120 gene open 1826258-1826333 trnK
4205 UWOK01000001.1 GCA900573985_02121 gene open 1826346-1826421 trnE
4206 UWOK01000001.1 GCA900573985_02122 gene open 1826437-1826512 trnV
4207 UWOK01000001.1 GCA900573985_02123 gene open 1826521-1826597 trnD
4208 UWOK01000001.1 GCA900573985_02124 gene open 1826601-1826676 trnK
4209 UWOK01000001.1 GCA900573985_02125 gene open 1826696-1826771 trnV
4210 UWOK01000001.1 GCA900573985_02126 gene open 1826780-1826856 trnD
4211 UWOK01000001.1 GCA900573985_02127 gene open 1826860-1826935 trnK
4212 UWOK01000001.1 GCA900573985_02128 gene open 1826956-1827030 trnE
4213 UWOK01000001.1 GCA900573985_02210 gene open 1901661-1901737 trnI
4214 UWOK01000001.1 GCA900573985_02271 gene open 1964873-1964956 trnL
4215 UWOK01000001.1 GCA900573985_02320 gene open 2023634-2023707 trnR
4216 UWOK01000001.1 GCA900573985_02332 gene open 2039175-2039250 trnW
4217 UWOK01000001.1 GCA900573985_02334 gene open 2040744-2040818 trnT
4218 UWOK01000001.1 GCA900573985_02335 gene open 2040951-2041027 trnG
4219 UWOK01000001.1 GCA900573985_02336 gene open 2041036-2041120 trnY
4220 UWOK01000001.1 GCA900573985_02337 gene open 2041178-2041253 trnT
4221 UWOK01000001.1 GCA900573985_02406 gene open 2106033-2106107 trnN
4222 UWOK01000001.1 GCA900573985_00516 tRNA open 189104-189180 trnM tRNA-Met(cat)
4223 UWOK01000001.1 GCA900573985_00565 tRNA open 233968-234052 trnL tRNA-Leu(tag)
4224 UWOK01000001.1 GCA900573985_00566 tRNA open 234068-234144 trnR tRNA-Arg(tct)
4225 UWOK01000001.1 GCA900573985_00567 tRNA open 234157-234233 trnR tRNA-Arg(tcg)
4226 UWOK01000001.1 GCA900573985_00568 tRNA open 234239-234315 trnH tRNA-His(gtg)
4227 UWOK01000001.1 GCA900573985_00569 tRNA open 234327-234404 trnP tRNA-Pro(tgg)
4228 UWOK01000001.1 GCA900573985_00573 tRNA open 237693-237767 trnE tRNA-Glu(ttc)
4229 UWOK01000001.1 GCA900573985_00654 tRNA open 323094-323169 trnV tRNA-Val(gac)
4230 UWOK01000001.1 GCA900573985_00682 tRNA open 349776-349865 trnS tRNA-Ser(tga)
4231 UWOK01000001.1 GCA900573985_00684 tRNA open 350071-350144 trnC tRNA-Cys(gca)
4232 UWOK01000001.1 GCA900573985_00685 tRNA open 350155-350241 trnL tRNA-Leu(taa)
4233 UWOK01000001.1 GCA900573985_00686 tRNA open 350267-350341 trnG tRNA-Gly(gcc)
4234 UWOK01000001.1 GCA900573985_00687 tRNA open 350460-350535 trnA tRNA-Ala(ggc)
4235 UWOK01000001.1 GCA900573985_00835 tRNA open 491957-492044 trnS tRNA-Ser(gga)
4236 UWOK01000001.1 GCA900573985_00877 tRNA open 533926-534002 trnI tRNA-Ile(gat)
4237 UWOK01000001.1 GCA900573985_00878 tRNA open 534015-534090 trnA tRNA-Ala(tgc)
4238 UWOK01000001.1 GCA900573985_01032 tRNA open 719583-719680 trnU tRNA-SeC(tca)
4239 UWOK01000001.1 GCA900573985_01095 tRNA open 785375-785450 trnF tRNA-Phe(gaa)
4240 UWOK01000001.1 GCA900573985_01272 tRNA open 960192-960282 trnS tRNA-Ser(gct)
4241 UWOK01000001.1 GCA900573985_01427 tRNA open 1113918-1113994 trnI tRNA-Ile(gat)
4242 UWOK01000001.1 GCA900573985_01428 tRNA open 1114007-1114082 trnA tRNA-Ala(tgc)
4243 UWOK01000001.1 GCA900573985_01485 tRNA open 1166550-1166626 trnI tRNA-Ile(gat)
4244 UWOK01000001.1 GCA900573985_01486 tRNA open 1166639-1166714 trnA tRNA-Ala(tgc)
4245 UWOK01000001.1 GCA900573985_01755 tRNA open 1434147-1434221 trnQ tRNA-Gln(ttg)
4246 UWOK01000001.1 GCA900573985_01756 tRNA open 1434234-1434308 trnfM tRNA-fMet(cat)
4247 UWOK01000001.1 GCA900573985_01810 tRNA open 1489346-1489422 trnR tRNA-Arg(gcg)
4248 UWOK01000001.1 GCA900573985_01817 tRNA open 1495243-1495317 trnG tRNA-Gly(gcc)
4249 UWOK01000001.1 GCA900573985_01960 tRNA open 1661176-1661262 trnL tRNA-Leu(caa)
4250 UWOK01000001.1 GCA900573985_02012 tRNA open 1712723-1712796 trnQ tRNA-Gln(ctg)
4251 UWOK01000001.1 GCA900573985_02120 tRNA open 1826258-1826333 trnK tRNA-Lys(ttt)
4252 UWOK01000001.1 GCA900573985_02121 tRNA open 1826346-1826421 trnE tRNA-Glu(ctc)
4253 UWOK01000001.1 GCA900573985_02122 tRNA open 1826437-1826512 trnV tRNA-Val(tac)
4254 UWOK01000001.1 GCA900573985_02123 tRNA open 1826521-1826597 trnD tRNA-Asp(gtc)
4255 UWOK01000001.1 GCA900573985_02124 tRNA open 1826601-1826676 trnK tRNA-Lys(ttt)
4256 UWOK01000001.1 GCA900573985_02125 tRNA open 1826696-1826771 trnV tRNA-Val(tac)
4257 UWOK01000001.1 GCA900573985_02126 tRNA open 1826780-1826856 trnD tRNA-Asp(gtc)
4258 UWOK01000001.1 GCA900573985_02127 tRNA open 1826860-1826935 trnK tRNA-Lys(ctt)
4259 UWOK01000001.1 GCA900573985_02128 tRNA open 1826956-1827030 trnE tRNA-Glu(ctc)
4260 UWOK01000001.1 GCA900573985_02210 tRNA open 1901661-1901737 trnI tRNA-Ile2(cat)
4261 UWOK01000001.1 GCA900573985_02271 tRNA open 1964873-1964956 trnL tRNA-Leu(gag)
4262 UWOK01000001.1 GCA900573985_02320 tRNA open 2023634-2023707 trnR tRNA-Arg(cct)
4263 UWOK01000001.1 GCA900573985_02332 tRNA open 2039175-2039250 trnW tRNA-Trp(cca)
4264 UWOK01000001.1 GCA900573985_02334 tRNA open 2040744-2040818 trnT tRNA-Thr(ggt)
4265 UWOK01000001.1 GCA900573985_02335 tRNA open 2040951-2041027 trnG tRNA-Gly(tcc)
4266 UWOK01000001.1 GCA900573985_02336 tRNA open 2041036-2041120 trnY tRNA-Tyr(gta)
4267 UWOK01000001.1 GCA900573985_02337 tRNA open 2041178-2041253 trnT tRNA-Thr(tgt)
4268 UWOK01000001.1 GCA900573985_02406 tRNA open 2106033-2106107 trnN tRNA-Asn(gtt)
4269 UWOK01000002.1 repeat_region open 56461-56663 CRISPR array with 3 repeats of length 38%2C consensus sequence GTTTCAATCCCCTAGATCGGGGAGATTTGAATCAAATA and spacer length 39
4270 UWOK01000002.1 repeat_region open 104406-106539 CRISPR array with 28 repeats of length 37%2C consensus sequence ATTTGAACAAATTTGACCCGATCTAGGGGATTGAAAC and spacer length 39
4271 UWOK01000002.1 repeat_region open 135579-136315 CRISPR array with 10 repeats of length 37%2C consensus sequence ATTTGATTCAAATTTCCCCGATCTAGGGGATTGAAAC and spacer length 39
4272 UWOK01000002.1 repeat_region open 191804-195802 CRISPR array with 61 repeats of length 30%2C consensus sequence GTTCTAAACTTCCAATACTTTATTTAAAAC and spacer length 35
4273 UWOK01000002.1 GCA900573985_00057 CDS open 845-1222 _na     125_aa hypothetical protein
4274 UWOK01000002.1 GCA900573985_00058 CDS open 1206-1604 _na     132_aa hypothetical protein
4275 UWOK01000002.1 GCA900573985_00059 CDS open 1912-2064 _na     50_aa ABC transporter ATP-binding protein/permease
4276 UWOK01000002.1 GCA900573985_00060 CDS open 2061-2150 _na     29_aa hypothetical protein
4277 UWOK01000002.1 GCA900573985_00061 CDS open 2147-2557 _na     136_aa ABC transporter ATP-binding protein/permease
4278 UWOK01000002.1 GCA900573985_00062 CDS open 2655-3359 _na     234_aa ABC transporter transmembrane domain-containing protein
4279 UWOK01000002.1 GCA900573985_00063 CDS open 3349-5097 _na     582_aa ABC transporter ATP-binding protein
4280 UWOK01000002.1 GCA900573985_00064 CDS open 5129-7225 _na     698_aa TonB-dependent receptor
4281 UWOK01000002.1 GCA900573985_00065 CDS open 7340-8287 _na     315_aa araC AraC family transcriptional regulator
4282 UWOK01000002.1 GCA900573985_00067 CDS open 8955-9701 _na     248_aa CAAX protease
4283 UWOK01000002.1 GCA900573985_00068 CDS open 9932-11032 _na     366_aa hypothetical protein
4284 UWOK01000002.1 GCA900573985_00069 CDS open 11043-12245 _na     400_aa Flagellar hook-associated protein 2 C-terminal domain-containing protein
4285 UWOK01000002.1 GCA900573985_00070 CDS open 12255-13073 _na     272_aa Cell surface protein
4286 UWOK01000002.1 GCA900573985_00071 CDS open 13159-14226 _na     355_aa Cj0814 family flagellar-dependent secreted protein
4287 UWOK01000002.1 GCA900573985_00072 CDS open 14571-15740 _na     389_aa Glutamyl-tRNA synthetase
4288 UWOK01000002.1 GCA900573985_00073 CDS open 16503-16787 _na     94_aa Plasmid stabilization system protein
4289 UWOK01000002.1 GCA900573985_00074 CDS open 16789-17028 _na     79_aa hypothetical protein
4290 UWOK01000002.1 GCA900573985_00075 CDS open 17329-19302 _na     657_aa response regulator
4291 UWOK01000002.1 GCA900573985_00076 CDS open 19448-19672 _na     74_aa hicA Type II toxin-antitoxin system HicA family toxin
4292 UWOK01000002.1 GCA900573985_00077 CDS open 19672-20028 _na     118_aa hicB Type II toxin-antitoxin system HicB family antitoxin
4293 UWOK01000002.1 GCA900573985_00078 CDS open 20073-21200 _na     375_aa Cj0814 family flagellar-dependent secreted protein
4294 UWOK01000002.1 GCA900573985_00079 CDS open 21321-21887 _na     188_aa hypothetical protein
4295 UWOK01000002.1 GCA900573985_00080 CDS open 22586-24115 _na     509_aa relaxase/mobilization nuclease domain-containing protein
4296 UWOK01000002.1 GCA900573985_00081 CDS open 24188-24559 _na     123_aa plasmid mobilization protein
4297 UWOK01000002.1 GCA900573985_00082 CDS open 24790-26703 _na     637_aa site-specific integrase
4298 UWOK01000002.1 GCA900573985_00083 CDS open 27157-27930 _na     257_aa ABC transporter ATP-binding protein
4299 UWOK01000002.1 GCA900573985_00084 CDS open 27921-28883 _na     320_aa Iron ABC transporter permease
4300 UWOK01000002.1 GCA900573985_00085 CDS open 28883-29917 _na     344_aa Fe/B12 periplasmic-binding domain-containing protein
4301 UWOK01000002.1 GCA900573985_00086 CDS open 29992-32073 _na     693_aa TonB-dependent receptor
4302 UWOK01000002.1 GCA900573985_00087 CDS open 32714-32932 _na     72_aa hypothetical protein
4303 UWOK01000002.1 GCA900573985_00088 CDS open 32922-33389 _na     155_aa PIN domain-containing protein
4304 UWOK01000002.1 GCA900573985_00089 CDS open 33393-33581 _na     62_aa XRE family transcriptional regulator
4305 UWOK01000002.1 GCA900573985_00090 CDS open 33699-34241 _na     180_aa hypothetical protein
4306 UWOK01000002.1 GCA900573985_00091 CDS open 34269-34373 _na     34_aa hypothetical protein
4307 UWOK01000002.1 GCA900573985_00092 CDS open 34566-34754 _na     62_aa hypothetical protein
4308 UWOK01000002.1 GCA900573985_00093 CDS open 34742-34834 _na     30_aa hypothetical protein
4309 UWOK01000002.1 GCA900573985_00094 CDS open 35439-38528 _na     1029_aa hypothetical protein
4310 UWOK01000002.1 GCA900573985_00095 CDS open 38860-39045 _na     61_aa hypothetical protein
4311 UWOK01000002.1 GCA900573985_00096 CDS open 39061-39273 _na     70_aa hypothetical protein
4312 UWOK01000002.1 GCA900573985_00097 CDS open 39453-40049 _na     198_aa phage minor head protein
4313 UWOK01000002.1 GCA900573985_00098 CDS open 40142-40570 _na     142_aa hypothetical protein
4314 UWOK01000002.1 GCA900573985_00099 CDS open 40732-41193 _na     153_aa hypothetical protein
4315 UWOK01000002.1 GCA900573985_00100 CDS open 42483-43013 _na     176_aa hypothetical protein
4316 UWOK01000002.1 GCA900573985_00101 CDS open 43608-43847 _na     79_aa hypothetical protein
4317 UWOK01000002.1 GCA900573985_00102 CDS open 44349-44672 _na     107_aa Cpp29
4318 UWOK01000002.1 GCA900573985_00103 CDS open 44669-44887 _na     72_aa hypothetical protein
4319 UWOK01000002.1 GCA900573985_00104 CDS open 45928-46416 _na     162_aa hypothetical protein
4320 UWOK01000002.1 GCA900573985_00105 CDS open 46486-46809 _na     107_aa Cpp29
4321 UWOK01000002.1 GCA900573985_00106 CDS open 46950-47405 _na     151_aa hypothetical protein
4322 UWOK01000002.1 GCA900573985_00107 CDS open 48028-49881 _na     617_aa site-specific DNA-methyltransferase (adenine-specific)
4323 UWOK01000002.1 GCA900573985_00108 CDS open 49878-51149 _na     423_aa restriction endonuclease subunit S
4324 UWOK01000002.1 GCA900573985_00109 CDS open 51160-54303 _na     1047_aa Type I restriction enzyme endonuclease subunit
4325 UWOK01000002.1 GCA900573985_00110 CDS open 54384-54713 _na     109_aa 4Fe-4S single cluster domain-containing protein
4326 UWOK01000002.1 GCA900573985_00111 CDS open 54958-55272 _na     104_aa Fic/DOC family N-terminal domain-containing protein
4327 UWOK01000002.1 GCA900573985_00112 CDS open 55263-56039 _na     258_aa Fic family protein
4328 UWOK01000002.1 GCA900573985_00113 CDS open 56985-57257 _na     90_aa cas2 CRISPR-associated endonuclease Cas2
4329 UWOK01000002.1 GCA900573985_00114 CDS open 57254-57760 _na     168_aa cas1 CRISPR-associated endonuclease Cas1
4330 UWOK01000002.1 GCA900573985_00115 CDS open 57702-59450 _na     582_aa cas1 CRISPR-associated endonuclease Cas1
4331 UWOK01000002.1 GCA900573985_00116 CDS open 59492-60142 _na     216_aa CRISPR system precrRNA processing endoribonuclease RAMP protein Cas6
4332 UWOK01000002.1 GCA900573985_00117 CDS open 60792-64517 _na     1241_aa AAA domain-containing protein
4333 UWOK01000002.1 GCA900573985_00118 CDS open 64498-66270 _na     590_aa hypothetical protein
4334 UWOK01000002.1 GCA900573985_00119 CDS open 66267-67379 _na     370_aa hypothetical protein
4335 UWOK01000002.1 GCA900573985_00120 CDS open 67381-69186 _na     601_aa AAA family ATPase
4336 UWOK01000002.1 GCA900573985_00121 CDS open 69186-69746 _na     186_aa 4Fe-4S single cluster domain-containing protein
4337 UWOK01000002.1 GCA900573985_00122 CDS open 70244-70456 _na     70_aa hypothetical protein
4338 UWOK01000002.1 GCA900573985_00123 CDS open 70775-70966 _na     63_aa hypothetical protein
4339 UWOK01000002.1 GCA900573985_00124 CDS open 71168-72103 _na     311_aa WYL domain-containing protein
4340 UWOK01000002.1 GCA900573985_00125 CDS open 72153-73946 _na     597_aa DUF262 domain-containing protein
4341 UWOK01000002.1 GCA900573985_00126 CDS open 73943-75184 _na     413_aa DUF262 domain-containing protein
4342 UWOK01000002.1 GCA900573985_00127 CDS open 75504-76862 _na     452_aa HAMP domain-containing sensor histidine kinase
4343 UWOK01000002.1 GCA900573985_00128 CDS open 76846-77505 _na     219_aa response regulator transcription factor
4344 UWOK01000002.1 GCA900573985_00129 CDS open 77545-78111 _na     188_aa hypothetical protein
4345 UWOK01000002.1 GCA900573985_00130 CDS open 78162-78647 _na     161_aa Peptidase
4346 UWOK01000002.1 GCA900573985_00131 CDS open 78814-79425 _na     203_aa hypothetical protein
4347 UWOK01000002.1 GCA900573985_00132 CDS open 79475-80779 _na     434_aa PD-(D/E)XK endonuclease-like domain-containing protein
4348 UWOK01000002.1 GCA900573985_00133 CDS open 80800-82047 _na     415_aa HEAT repeat domain-containing protein
4349 UWOK01000002.1 GCA900573985_00134 CDS open 82044-82877 _na     277_aa hypothetical protein
4350 UWOK01000002.1 GCA900573985_00135 CDS open 82874-83461 _na     195_aa hypothetical protein
4351 UWOK01000002.1 GCA900573985_00136 CDS open 83509-83805 _na     98_aa hypothetical protein
4352 UWOK01000002.1 GCA900573985_00137 CDS open 83953-85950 _na     665_aa ATP-binding protein
4353 UWOK01000002.1 GCA900573985_00138 CDS open 86036-86593 _na     185_aa metallophosphoesterase
4354 UWOK01000002.1 GCA900573985_00139 CDS open 86630-86938 _na     102_aa hypothetical protein
4355 UWOK01000002.1 GCA900573985_00140 CDS open 86935-87780 _na     281_aa NAD-dependent deacetylase
4356 UWOK01000002.1 GCA900573985_00141 CDS open 87954-89333 _na     459_aa DUF2779 domain-containing protein
4357 UWOK01000002.1 GCA900573985_00142 CDS open 89517-90275 _na     252_aa hypothetical protein
4358 UWOK01000002.1 GCA900573985_00143 CDS open 90970-91317 _na     115_aa Phage protein
4359 UWOK01000002.1 GCA900573985_00144 CDS open 91814-92611 _na     265_aa agmatine deiminase family protein
4360 UWOK01000002.1 GCA900573985_00145 CDS open 92626-93564 _na     312_aa HNH endonuclease
4361 UWOK01000002.1 GCA900573985_00146 CDS open 93668-95125 _na     485_aa hypothetical protein
4362 UWOK01000002.1 GCA900573985_00147 CDS open 95338-96381 _na     347_aa csm5 type III-A CRISPR-associated RAMP protein Csm5
4363 UWOK01000002.1 GCA900573985_00148 CDS open 96371-97258 _na     295_aa csm4 type III-A CRISPR-associated RAMP protein Csm4
4364 UWOK01000002.1 GCA900573985_00149 CDS open 97258-97893 _na     211_aa csm3 type III-A CRISPR-associated RAMP protein Csm3
4365 UWOK01000002.1 GCA900573985_00150 CDS open 97903-98307 _na     134_aa type III-A CRISPR-associated protein Csm2
4366 UWOK01000002.1 GCA900573985_00151 CDS open 98304-99821 _na     505_aa cas10 type III-A CRISPR-associated protein Cas10/Csm1
4367 UWOK01000002.1 GCA900573985_00152 CDS open 99814-100644 _na     276_aa CRISPR system precrRNA processing endoribonuclease RAMP protein Cas6
4368 UWOK01000002.1 GCA900573985_00153 CDS open 100625-100846 _na     73_aa hypothetical protein
4369 UWOK01000002.1 GCA900573985_00154 CDS open 101319-101435 _na     38_aa hypothetical protein
4370 UWOK01000002.1 GCA900573985_00155 CDS open 101450-103684 _na     744_aa cas1 CRISPR-associated endonuclease Cas1
4371 UWOK01000002.1 GCA900573985_00156 CDS open 103684-103959 _na     91_aa cas2 CRISPR-associated endonuclease Cas2
4372 UWOK01000002.1 GCA900573985_00157 CDS open 107316-108275 _na     319_aa WYL domain-containing protein
4373 UWOK01000002.1 GCA900573985_00158 CDS open 108276-108959 _na     227_aa Macro domain-containing protein
4374 UWOK01000002.1 GCA900573985_00159 CDS open 108968-109588 _na     206_aa DUF4433 domain-containing protein
4375 UWOK01000002.1 GCA900573985_00160 CDS open 109658-110980 _na     440_aa CRISPR-associated DxTHG motif protein
4376 UWOK01000002.1 GCA900573985_00161 CDS open 111083-111457 _na     124_aa csx20 CRISPR-associated protein Csx20
4377 UWOK01000002.1 GCA900573985_00162 CDS open 111741-111884 _na     47_aa hypothetical protein
4378 UWOK01000002.1 GCA900573985_00163 CDS open 111865-112026 _na     53_aa hypothetical protein
4379 UWOK01000002.1 GCA900573985_00164 CDS open 113149-113340 _na     63_aa hypothetical protein
4380 UWOK01000002.1 GCA900573985_00165 CDS open 113341-114489 _na     382_aa radical SAM/SPASM domain-containing protein
4381 UWOK01000002.1 GCA900573985_00166 CDS open 114617-115345 _na     242_aa radical SAM protein
4382 UWOK01000002.1 GCA900573985_00167 CDS open 115342-115962 _na     206_aa class I SAM-dependent methyltransferase
4383 UWOK01000002.1 GCA900573985_00168 CDS open 117007-117918 _na     303_aa hypothetical protein
4384 UWOK01000002.1 GCA900573985_00169 CDS open 117971-118165 _na     64_aa hypothetical protein
4385 UWOK01000002.1 GCA900573985_00170 CDS open 118828-120045 _na     405_aa PD-(D/E)XK nuclease family protein
4386 UWOK01000002.1 GCA900573985_00171 CDS open 120087-120413 _na     108_aa hypothetical protein
4387 UWOK01000002.1 GCA900573985_00172 CDS open 120426-121268 _na     280_aa Sir2 family NAD-dependent protein deacetylase
4388 UWOK01000002.1 GCA900573985_00173 CDS open 121332-122810 _na     492_aa DUF2779 domain-containing protein
4389 UWOK01000002.1 GCA900573985_00174 CDS open 122807-124879 _na     690_aa DUF262 domain-containing protein
4390 UWOK01000002.1 GCA900573985_00175 CDS open 124869-126587 _na     572_aa DUF262 domain-containing protein
4391 UWOK01000002.1 GCA900573985_00176 CDS open 126655-128682 _na     675_aa AAA family ATPase
4392 UWOK01000002.1 GCA900573985_00177 CDS open 129000-129224 _na     74_aa hypothetical protein
4393 UWOK01000002.1 GCA900573985_00178 CDS open 129280-130755 _na     491_aa mcrB McrB family protein
4394 UWOK01000002.1 GCA900573985_00179 CDS open 130727-131959 _na     410_aa mcrC McrC family protein
4395 UWOK01000002.1 GCA900573985_00180 CDS open 132181-133929 _na     582_aa hypothetical protein
4396 UWOK01000002.1 GCA900573985_00181 CDS open 133972-134340 _na     122_aa sigma factor-like helix-turn-helix DNA-binding protein
4397 UWOK01000002.1 GCA900573985_00182 CDS open 134483-135028 _na     181_aa Fic family protein
4398 UWOK01000002.1 GCA900573985_00183 CDS open 136530-136970 _na     146_aa hypothetical protein
4399 UWOK01000002.1 GCA900573985_00184 CDS open 136967-137479 _na     170_aa hypothetical protein
4400 UWOK01000002.1 GCA900573985_00185 CDS open 138207-138428 _na     73_aa Mobilization protein
4401 UWOK01000002.1 GCA900573985_00186 CDS open 138430-139116 _na     228_aa Para protein
4402 UWOK01000002.1 GCA900573985_00187 CDS open 139537-139761 _na     74_aa hicA Type II toxin-antitoxin system HicA family toxin
4403 UWOK01000002.1 GCA900573985_00188 CDS open 139761-140114 _na     117_aa hicB Type II toxin-antitoxin system HicB family antitoxin
4404 UWOK01000002.1 GCA900573985_00189 CDS open 141790-143124 _na     444_aa DUF5710 domain-containing protein
4405 UWOK01000002.1 GCA900573985_00190 CDS open 143357-144754 _na     465_aa PBECR2 nuclease fold domain-containing protein
4406 UWOK01000002.1 GCA900573985_00191 CDS open 144726-145553 _na     275_aa hypothetical protein
4407 UWOK01000002.1 GCA900573985_00192 CDS open 146170-146415 _na     81_aa hypothetical protein
4408 UWOK01000002.1 GCA900573985_00193 CDS open 146627-150943 _na     1438_aa LPD23 domain-containing protein
4409 UWOK01000002.1 GCA900573985_00194 CDS open 152107-152511 _na     134_aa PIN domain-containing protein
4410 UWOK01000002.1 GCA900573985_00195 CDS open 152508-153380 _na     290_aa repL Plasmid replication protein RepL domain-containing protein
4411 UWOK01000002.1 GCA900573985_00196 CDS open 153764-154477 _na     237_aa Periplasmic protein
4412 UWOK01000002.1 GCA900573985_00197 CDS open 154471-154608 _na     45_aa hypothetical protein
4413 UWOK01000002.1 GCA900573985_00198 CDS open 154702-155841 _na     379_aa ycjF YcjF family protein
4414 UWOK01000002.1 GCA900573985_00199 CDS open 155964-156206 _na     80_aa hypothetical protein
4415 UWOK01000002.1 GCA900573985_00200 CDS open 156244-156642 _na     132_aa hypothetical protein
4416 UWOK01000002.1 GCA900573985_00201 CDS open 156647-157747 _na     366_aa HP0729 family protein
4417 UWOK01000002.1 GCA900573985_00202 CDS open 157787-158236 _na     149_aa hypothetical protein
4418 UWOK01000002.1 GCA900573985_00203 CDS open 158236-158910 _na     224_aa hypothetical protein
4419 UWOK01000002.1 GCA900573985_00204 CDS open 158925-161945 _na     1006_aa ATP-binding protein
4420 UWOK01000002.1 GCA900573985_00205 CDS open 161942-164701 _na     919_aa dnaK molecular chaperone DnaK
4421 UWOK01000002.1 GCA900573985_00206 CDS open 164711-165469 _na     252_aa hypothetical protein
4422 UWOK01000002.1 GCA900573985_00207 CDS open 165633-166250 _na     205_aa hypothetical protein
4423 UWOK01000002.1 GCA900573985_00208 CDS open 166216-166509 _na     97_aa hypothetical protein
4424 UWOK01000002.1 GCA900573985_00209 CDS open 166479-166886 _na     135_aa hypothetical protein
4425 UWOK01000002.1 GCA900573985_00210 CDS open 166926-167261 _na     111_aa hypothetical protein
4426 UWOK01000002.1 GCA900573985_00211 CDS open 167412-167789 _na     125_aa hypothetical protein
4427 UWOK01000002.1 GCA900573985_00212 CDS open 168086-168952 _na     288_aa HTH domain protein
4428 UWOK01000002.1 GCA900573985_00213 CDS open 169011-170555 _na     514_aa AAA family ATPase
4429 UWOK01000002.1 GCA900573985_00214 CDS open 170548-171873 _na     441_aa hypothetical protein
4430 UWOK01000002.1 GCA900573985_00215 CDS open 171846-172277 _na     143_aa hypothetical protein
4431 UWOK01000002.1 GCA900573985_00216 CDS open 174165-175292 _na     375_aa GTPase
4432 UWOK01000002.1 GCA900573985_00217 CDS open 175296-176873 _na     525_aa GTPase domain-containing protein
4433 UWOK01000002.1 GCA900573985_00218 CDS open 176940-177827 _na     295_aa hypothetical protein
4434 UWOK01000002.1 GCA900573985_00219 CDS open 178019-180208 _na     729_aa WG repeat-containing protein
4435 UWOK01000002.1 GCA900573985_00220 CDS open 180592-182715 _na     707_aa GTPase
4436 UWOK01000002.1 GCA900573985_00221 CDS open 182708-184411 _na     567_aa Labile enterotoxin output A
4437 UWOK01000002.1 GCA900573985_00222 CDS open 184873-185364 _na     163_aa hypothetical protein
4438 UWOK01000002.1 GCA900573985_00223 CDS open 186483-186779 _na     98_aa hypothetical protein
4439 UWOK01000002.1 GCA900573985_00224 CDS open 186717-187484 _na     255_aa IS1595 family transposase
4440 UWOK01000002.1 GCA900573985_00225 CDS open 187591-187938 _na     115_aa XRE family transcriptional regulator
4441 UWOK01000002.1 GCA900573985_00226 CDS open 187947-188981 _na     344_aa Methyltransferase
4442 UWOK01000002.1 GCA900573985_00227 CDS open 188971-189876 _na     301_aa Restriction endonuclease
4443 UWOK01000002.1 GCA900573985_00228 CDS open 189869-190030 _na     53_aa hypothetical protein
4444 UWOK01000002.1 GCA900573985_00229 CDS open 190747-191541 _na     264_aa ISXO2-like transposase domain protein
4445 UWOK01000002.1 GCA900573985_00230 CDS open 196104-197114 _na     336_aa RAMP superfamily CRISPR-associated protein
4446 UWOK01000002.1 GCA900573985_00231 CDS open 197133-197804 _na     223_aa hypothetical protein
4447 UWOK01000002.1 GCA900573985_00232 CDS open 197804-199240 _na     478_aa CRISPR-associated protein
4448 UWOK01000002.1 GCA900573985_00233 CDS open 199344-201167 _na     607_aa helicase C-terminal domain-containing protein
4449 UWOK01000002.1 GCA900573985_00234 CDS open 202370-203581 _na     403_aa AAA family ATPase
4450 UWOK01000002.1 GCA900573985_00235 CDS open 204885-205241 _na     118_aa hicB Toxin-antitoxin system%2C antitoxin component%2C HicB family
4451 UWOK01000002.1 GCA900573985_00236 CDS open 205569-206084 _na     171_aa tetratricopeptide repeat protein
4452 UWOK01000002.1 GCA900573985_00237 CDS open 206918-208099 _na     393_aa AAA+ ATPase domain-containing protein
4453 UWOK01000002.1 GCA900573985_00238 CDS open 208915-209226 _na     103_aa Cpp29
4454 UWOK01000002.1 GCA900573985_00239 CDS open 209682-211265 _na     527_aa HipA-like protein-like protein
4455 UWOK01000002.1 GCA900573985_00240 CDS open 211309-212610 _na     433_aa Adenylyl/Guanylyl and SMODS C-terminal sensor domain-containing protein
4456 UWOK01000002.1 GCA900573985_00241 CDS open 212614-213234 _na     206_aa SMODS and SLOG-associating 2TM effector domain-containing protein
4457 UWOK01000002.1 GCA900573985_00242 CDS open 213729-213899 _na     56_aa hypothetical protein
4458 UWOK01000002.1 GCA900573985_00243 CDS open 213903-214160 _na     85_aa Phage protein
4459 UWOK01000002.1 GCA900573985_00244 CDS open 214198-214815 _na     205_aa Putative ATPase
4460 UWOK01000002.1 GCA900573985_00245 CDS open 214894-215688 _na     264_aa Putative Cytosolic Protein
4461 UWOK01000002.1 GCA900573985_00246 CDS open 215742-216755 _na     337_aa Fic family protein
4462 UWOK01000002.1 GCA900573985_00247 CDS open 216808-217017 _na     69_aa hypothetical protein
4463 UWOK01000002.1 GCA900573985_00248 CDS open 217275-218264 _na     329_aa tyrosine-type recombinase/integrase
4464 UWOK01000002.1 GCA900573985_00249 CDS open 218347-218586 _na     79_aa ycfA YcfA family protein
4465 UWOK01000002.1 GCA900573985_00250 CDS open 218583-218954 _na     123_aa hicB HicB family protein
4466 UWOK01000002.1 GCA900573985_00251 CDS open 219158-219298 _na     46_aa hypothetical protein
4467 UWOK01000002.1 GCA900573985_00252 CDS open 219295-219936 _na     213_aa icmH type IVB secretion system protein IcmH/DotU
4468 UWOK01000002.1 GCA900573985_00253 CDS open 219955-221349 _na     464_aa tssK type VI secretion system baseplate subunit TssK
4469 UWOK01000002.1 GCA900573985_00254 CDS open 221368-221823 _na     151_aa tssJ type VI secretion system lipoprotein TssJ
4470 UWOK01000002.1 GCA900573985_00255 CDS open 221951-223252 _na     433_aa Nucleobase:cation symporter
4471 UWOK01000002.1 GCA900573985_00256 CDS open 223344-223829 _na     161_aa tssB type VI secretion system contractile sheath small subunit
4472 UWOK01000002.1 GCA900573985_00257 CDS open 223839-225290 _na     483_aa tssC type VI secretion system contractile sheath large subunit
4473 UWOK01000002.1 GCA900573985_00258 CDS open 225304-225696 _na     130_aa Type VI secretion system%2C baseplate protein
4474 UWOK01000002.1 GCA900573985_00259 CDS open 225696-227414 _na     572_aa tssF type VI secretion system baseplate subunit TssF
4475 UWOK01000002.1 GCA900573985_00260 CDS open 227411-228316 _na     301_aa Type VI secretion system protein
4476 UWOK01000002.1 GCA900573985_00261 CDS open 228413-231919 _na     1168_aa tssM type VI secretion system membrane subunit TssM
4477 UWOK01000002.1 GCA900573985_00262 CDS open 231928-232833 _na     301_aa FHA domain-containing protein
4478 UWOK01000002.1 GCA900573985_00263 CDS open 232880-234232 _na     450_aa thioredoxin reductase
4479 UWOK01000002.1 GCA900573985_00264 CDS open 234236-234628 _na     130_aa hypothetical protein
4480 UWOK01000002.1 GCA900573985_00265 CDS open 234634-235995 _na     453_aa Thioredoxin reductase
4481 UWOK01000002.1 GCA900573985_00266 CDS open 235999-239889 _na     1296_aa hypothetical protein
4482 UWOK01000002.1 GCA900573985_00267 CDS open 239911-243597 _na     1228_aa Fungal lipase-like domain-containing protein
4483 UWOK01000002.1 GCA900573985_00268 CDS open 243608-244225 _na     205_aa tRNA 2-selenouridine synthase
4484 UWOK01000002.1 GCA900573985_00269 CDS open 244310-244495 _na     61_aa Diadenosine tetraphosphate hydrolase
4485 UWOK01000002.1 GCA900573985_00270 CDS open 244515-245102 _na     195_aa tRNA 2-selenouridine synthase
4486 UWOK01000002.1 GCA900573985_00271 CDS open 245172-245384 _na     70_aa hypothetical protein
4487 UWOK01000002.1 GCA900573985_00272 CDS open 245395-246129 _na     244_aa tRNA 2-selenouridine synthase
4488 UWOK01000002.1 GCA900573985_00273 CDS open 246218-246400 _na     60_aa Diadenosine tetraphosphate hydrolase
4489 UWOK01000002.1 GCA900573985_00274 CDS open 246405-247013 _na     202_aa tRNA 2-selenouridine synthase
4490 UWOK01000002.1 GCA900573985_00275 CDS open 247150-247668 _na     172_aa Type VI secretion system%2C secreted hemolysin co-regulated protein (Hcp)
4491 UWOK01000002.1 GCA900573985_00276 CDS open 247922-250366 _na     814_aa vgrG Type VI secretion system tip protein VgrG
4492 UWOK01000002.1 GCA900573985_00277 CDS open 250628-251428 _na     266_aa hypothetical protein
4493 UWOK01000002.1 GCA900573985_00278 CDS open 251490-252047 _na     185_aa Lipoprotein
4494 UWOK01000002.1 GCA900573985_00279 CDS open 252051-252530 _na     159_aa hypothetical protein
4495 UWOK01000002.1 GCA900573985_00280 CDS open 252808-253362 _na     184_aa Ubiquitin-like domain-containing protein
4496 UWOK01000002.1 GCA900573985_00281 CDS open 253355-253690 _na     111_aa hypothetical protein
4497 UWOK01000002.1 GCA900573985_00282 CDS open 253733-254065 _na     110_aa Organic solvent tolerance-like N-terminal domain-containing protein
4498 UWOK01000002.1 GCA900573985_00283 CDS open 254186-254341 _na     51_aa hypothetical protein
4499 UWOK01000002.1 GCA900573985_00284 CDS open 254477-254842 _na     121_aa Lysozyme inhibitor
4500 UWOK01000002.1 GCA900573985_00285 CDS open 254893-255384 _na     163_aa hypothetical protein