BAKTAGenome Explorer: Campylobacter concisus clade-433 (GCA_902374575.1)
Select a Genome:
|
BAKTA Annotations for GCA_902374575.1
|
Search & Sort all 3911 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 1 | CABKQH010000001.1 | GCA902374575_00637 | gene | open | 630847-631206 | ssrA | ||
| 2 | CABKQH010000001.1 | GCA902374575_00637 | tmRNA | open | 630847-631206 | ssrA | transfer-messenger RNA%2C SsrA | |
| 3 | CABKQH010000001.1 | GCA902374575_00001 | gene | open | 259-1769 | rrs | ||
| 4 | CABKQH010000001.1 | GCA902374575_00004 | gene | open | 2462-5366 | rrl | ||
| 5 | CABKQH010000001.1 | GCA902374575_00005 | gene | open | 5500-5618 | rrf | ||
| 6 | CABKQH010000001.1 | GCA902374575_00128 | gene | open | 136480-136806 | RNaseP_bact_a | ||
| 7 | CABKQH010000001.1 | GCA902374575_00128 | ncRNA | open | 136480-136806 | Bacterial RNase P class A | ||
| 8 | CABKQH010000001.1 | regulatory_region | open | 681127-681255 | purD RNA motif | |||
| 9 | CABKQH010000001.1 | GCA902374575_00001 | rRNA | open | 259-1769 | rrs | 16S ribosomal RNA | |
| 10 | CABKQH010000001.1 | GCA902374575_00004 | rRNA | open | 2462-5366 | rrl | 23S ribosomal RNA | |
| 11 | CABKQH010000001.1 | GCA902374575_00005 | rRNA | open | 5500-5618 | rrf | 5S ribosomal RNA | |
| 12 | CABKQH010000001.1 | repeat_region | open | 399127-401408 | CRISPR array with 35 repeats of length 30%2C consensus sequence ATTAGAATTTACTCCGTTGGAGTTTGAAAC and spacer length 35 | |||
| 13 | CABKQH010000001.1 | GCA902374575_00006 | CDS | open | 5956-9471 | _na 1171_aa | ADP-Ribosyltransferase in polyvalent proteins | |
| 14 | CABKQH010000001.1 | GCA902374575_00007 | CDS | open | 10316-10702 | _na 128_aa | hypothetical protein | |
| 15 | CABKQH010000001.1 | GCA902374575_00008 | CDS | open | 10776-11597 | _na 273_aa | adenylosuccinate lyase | |
| 16 | CABKQH010000001.1 | GCA902374575_00009 | CDS | open | 11648-11833 | _na 61_aa | hypothetical protein | |
| 17 | CABKQH010000001.1 | GCA902374575_00011 | CDS | open | 12061-12792 | _na 243_aa | truA | tRNA pseudouridine(38-40) synthase TruA |
| 18 | CABKQH010000001.1 | GCA902374575_00012 | CDS | open | 12792-13820 | _na 342_aa | Lipooligosaccharide transport system%2C permease component (LptF family) | |
| 19 | CABKQH010000001.1 | GCA902374575_00013 | CDS | open | 13813-14622 | _na 269_aa | Prepilin peptidase | |
| 20 | CABKQH010000001.1 | GCA902374575_00014 | CDS | open | 14609-15280 | _na 223_aa | uppS | polyprenyl diphosphate synthase |
| 21 | CABKQH010000001.1 | GCA902374575_00015 | CDS | open | 15284-15970 | _na 228_aa | hypothetical protein | |
| 22 | CABKQH010000001.1 | GCA902374575_00016 | CDS | open | 15967-17151 | _na 394_aa | coaBC | bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC |
| 23 | CABKQH010000001.1 | GCA902374575_00017 | CDS | open | 17126-18436 | _na 436_aa | glmU | bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU |
| 24 | CABKQH010000001.1 | GCA902374575_00018 | CDS | open | 18573-19340 | _na 255_aa | Flagellar motor protein | |
| 25 | CABKQH010000001.1 | GCA902374575_00019 | CDS | open | 19340-20119 | _na 259_aa | OmpA-like domain-containing protein | |
| 26 | CABKQH010000001.1 | GCA902374575_00020 | CDS | open | 20122-20853 | _na 243_aa | fliP | flagellar type III secretion system pore protein FliP |
| 27 | CABKQH010000001.1 | GCA902374575_00021 | CDS | open | 20853-22118 | _na 421_aa | tolC | TolC family type I secretion outer membrane protein |
| 28 | CABKQH010000001.1 | GCA902374575_00022 | CDS | open | 22115-22858 | _na 247_aa | RND family efflux transporter%2C membrane fusion subunit | |
| 29 | CABKQH010000001.1 | GCA902374575_00023 | CDS | open | 22855-25881 | _na 1008_aa | RND family efflux transporter%2C membrane subunit | |
| 30 | CABKQH010000001.1 | GCA902374575_00024 | CDS | open | 25878-27113 | _na 411_aa | tolC | TolC family protein |
| 31 | CABKQH010000001.1 | GCA902374575_00025 | CDS | open | 27110-27973 | _na 287_aa | eamA | EamA domain-containing protein |
| 32 | CABKQH010000001.1 | GCA902374575_00026 | CDS | open | 28003-28374 | _na 123_aa | fliE | Flagellar hook-basal body complex protein FliE |
| 33 | CABKQH010000001.1 | GCA902374575_00027 | CDS | open | 28426-29673 | _na 415_aa | ComEC/Rec2-related protein domain-containing protein | |
| 34 | CABKQH010000001.1 | GCA902374575_00028 | CDS | open | 29676-31088 | _na 470_aa | replicative DNA helicase | |
| 35 | CABKQH010000001.1 | GCA902374575_00029 | CDS | open | 31093-32151 | _na 352_aa | ispG | flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase |
| 36 | CABKQH010000001.1 | GCA902374575_00030 | CDS | open | 32768-34618 | _na 616_aa | primosomal protein N' | |
| 37 | CABKQH010000001.1 | GCA902374575_00031 | CDS | open | 34618-35028 | _na 136_aa | Periplasmic protein | |
| 38 | CABKQH010000001.1 | GCA902374575_00032 | CDS | open | 35025-35261 | _na 78_aa | Barstar (barnase inhibitor) domain-containing protein | |
| 39 | CABKQH010000001.1 | GCA902374575_00033 | CDS | open | 35285-35518 | _na 77_aa | ABC transporter | |
| 40 | CABKQH010000001.1 | GCA902374575_00034 | CDS | open | 35647-37623 | _na 658_aa | uvrB | excinuclease ABC subunit UvrB |
| 41 | CABKQH010000001.1 | GCA902374575_00035 | CDS | open | 38138-39298 | _na 386_aa | Major facilitator superfamily (MFS) profile domain-containing protein | |
| 42 | CABKQH010000001.1 | GCA902374575_00036 | CDS | open | 39299-41839 | _na 846_aa | Tryptophanyl-tRNA synthetase | |
| 43 | CABKQH010000001.1 | GCA902374575_00037 | CDS | open | 42008-42268 | _na 86_aa | groES | co-chaperone GroES |
| 44 | CABKQH010000001.1 | GCA902374575_00038 | CDS | open | 42286-43920 | _na 544_aa | groL | chaperonin GroEL |
| 45 | CABKQH010000001.1 | GCA902374575_00039 | CDS | open | 44051-45418 | _na 455_aa | Phospho-sugar mutase | |
| 46 | CABKQH010000001.1 | GCA902374575_00040 | CDS | open | 45486-45800 | _na 104_aa | tfoX | TfoX N-terminal domain-containing protein |
| 47 | CABKQH010000001.1 | GCA902374575_00041 | CDS | open | 45821-46678 | _na 285_aa | Amino acid ABC transporter%2C periplasmic cysteine-binding protein | |
| 48 | CABKQH010000001.1 | GCA902374575_00042 | CDS | open | 46770-47507 | _na 245_aa | ABC transporter domain-containing protein | |
| 49 | CABKQH010000001.1 | GCA902374575_00043 | CDS | open | 47509-48177 | _na 222_aa | ABC transmembrane type-1 domain-containing protein | |
| 50 | CABKQH010000001.1 | GCA902374575_00044 | CDS | open | 48164-48817 | _na 217_aa | Pathogenesis-associated glutamine ABC transporter%2C permease protein | |
| 51 | CABKQH010000001.1 | GCA902374575_00045 | CDS | open | 48927-49172 | _na 81_aa | Permease | |
| 52 | CABKQH010000001.1 | GCA902374575_00046 | CDS | open | 49169-50137 | _na 322_aa | Agmatine deiminase | |
| 53 | CABKQH010000001.1 | GCA902374575_00047 | CDS | open | 50140-51066 | _na 308_aa | Cation diffusion facilitator family transporter | |
| 54 | CABKQH010000001.1 | GCA902374575_00048 | CDS | open | 51068-51940 | _na 290_aa | Apolipoprotein acyltransferase | |
| 55 | CABKQH010000001.1 | GCA902374575_00049 | CDS | open | 52145-53086 | _na 313_aa | TRAP transporter solute receptor%2C TAXI family | |
| 56 | CABKQH010000001.1 | GCA902374575_00050 | CDS | open | 53174-55240 | _na 688_aa | TRAP transporter%2C 4TM/12TM fusion protein | |
| 57 | CABKQH010000001.1 | GCA902374575_00051 | CDS | open | 55339-55824 | _na 161_aa | beta-lactamase | |
| 58 | CABKQH010000001.1 | GCA902374575_00052 | CDS | open | 55895-56578 | _na 227_aa | YgjP-like metallopeptidase domain-containing protein | |
| 59 | CABKQH010000001.1 | GCA902374575_00053 | CDS | open | 56533-57852 | _na 439_aa | matE | MatE efflux family protein |
| 60 | CABKQH010000001.1 | GCA902374575_00054 | CDS | open | 57949-59880 | _na 643_aa | abc-f | ribosomal protection-like ABC-F family protein |
| 61 | CABKQH010000001.1 | GCA902374575_00055 | CDS | open | 59882-60316 | _na 144_aa | Integral membrane protein | |
| 62 | CABKQH010000001.1 | GCA902374575_00056 | CDS | open | 60393-61904 | _na 503_aa | Fusobacterium membrane protein | |
| 63 | CABKQH010000001.1 | GCA902374575_00057 | CDS | open | 61904-63349 | _na 481_aa | Fusobacterium membrane protein | |
| 64 | CABKQH010000001.1 | GCA902374575_00058 | CDS | open | 63475-65415 | _na 646_aa | BCCT (Betaine/carnitine/choline) family transporter | |
| 65 | CABKQH010000001.1 | GCA902374575_00059 | CDS | open | 66004-67377 | _na 457_aa | Transporter | |
| 66 | CABKQH010000001.1 | GCA902374575_00060 | CDS | open | 67381-68493 | _na 370_aa | WD40 repeat domain-containing protein | |
| 67 | CABKQH010000001.1 | GCA902374575_00061 | CDS | open | 68502-69704 | _na 400_aa | Peptidase M48 domain-containing protein | |
| 68 | CABKQH010000001.1 | GCA902374575_00062 | CDS | open | 69694-70506 | _na 270_aa | prmC | peptide chain release factor N(5)-glutamine methyltransferase |
| 69 | CABKQH010000001.1 | GCA902374575_00063 | CDS | open | 70517-70996 | _na 159_aa | TMEM205-like domain-containing protein | |
| 70 | CABKQH010000001.1 | GCA902374575_00064 | CDS | open | 70980-71762 | _na 260_aa | Threonine/serine exporter-like N-terminal domain-containing protein | |
| 71 | CABKQH010000001.1 | GCA902374575_00065 | CDS | open | 71755-72270 | _na 171_aa | thrE | Threonine/Serine exporter ThrE domain-containing protein |
| 72 | CABKQH010000001.1 | GCA902374575_00066 | CDS | open | 72290-72679 | _na 129_aa | YbgC/FadM family acyl-CoA thioesterase | |
| 73 | CABKQH010000001.1 | GCA902374575_00067 | CDS | open | 72692-73972 | _na 426_aa | Periplasmic protein | |
| 74 | CABKQH010000001.1 | GCA902374575_00068 | CDS | open | 73969-74622 | _na 217_aa | Uracil-DNA glycosylase-like domain-containing protein | |
| 75 | CABKQH010000001.1 | GCA902374575_00069 | CDS | open | 74746-74880 | _na 44_aa | rpmH | 50S ribosomal protein L34 |
| 76 | CABKQH010000001.1 | GCA902374575_00070 | CDS | open | 75200-75541 | _na 113_aa | yidD | membrane protein insertion efficiency factor YidD |
| 77 | CABKQH010000001.1 | GCA902374575_00071 | CDS | open | 75542-77098 | _na 518_aa | yidC | membrane protein insertase YidC |
| 78 | CABKQH010000001.1 | GCA902374575_00072 | CDS | open | 77095-78186 | _na 363_aa | khpB | RNA-binding protein KhpB N-terminal domain-containing protein |
| 79 | CABKQH010000001.1 | GCA902374575_00073 | CDS | open | 78183-79508 | _na 441_aa | mnmE | tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE |
| 80 | CABKQH010000001.1 | GCA902374575_00074 | CDS | open | 79550-80131 | _na 193_aa | Flavodoxin-like fold domain-containing protein | |
| 81 | CABKQH010000001.1 | GCA902374575_00075 | CDS | open | 80204-80923 | _na 239_aa | Lipoprotein | |
| 82 | CABKQH010000001.1 | GCA902374575_00076 | CDS | open | 80980-83169 | _na 729_aa | purL | phosphoribosylformylglycinamidine synthase subunit PurL |
| 83 | CABKQH010000001.1 | GCA902374575_00077 | CDS | open | 83173-84222 | _na 349_aa | Serine dehydrogenase proteinase | |
| 84 | CABKQH010000001.1 | GCA902374575_00078 | CDS | open | 84224-84955 | _na 243_aa | J domain-containing protein | |
| 85 | CABKQH010000001.1 | GCA902374575_00079 | CDS | open | 84956-85522 | _na 188_aa | Lipid/polyisoprenoid-binding YceI-like domain-containing protein | |
| 86 | CABKQH010000001.1 | GCA902374575_00080 | CDS | open | 85553-87085 | _na 510_aa | purH | bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase |
| 87 | CABKQH010000001.1 | GCA902374575_00081 | CDS | open | 87163-88203 | _na 346_aa | Multifunctional fusion protein | |
| 88 | CABKQH010000001.1 | GCA902374575_00082 | CDS | open | 88277-88615 | _na 112_aa | DUF2249 domain-containing protein | |
| 89 | CABKQH010000001.1 | GCA902374575_00083 | CDS | open | 88617-89807 | _na 396_aa | Peptidase M50 | |
| 90 | CABKQH010000001.1 | GCA902374575_00084 | CDS | open | 89811-90107 | _na 98_aa | MIP18 family-like domain-containing protein | |
| 91 | CABKQH010000001.1 | GCA902374575_00085 | CDS | open | 90395-91534 | _na 379_aa | ftsZ | cell division protein FtsZ |
| 92 | CABKQH010000001.1 | GCA902374575_00086 | CDS | open | 91549-92967 | _na 472_aa | ftsA | cell division protein FtsA |
| 93 | CABKQH010000001.1 | GCA902374575_00087 | CDS | open | 92973-94430 | _na 485_aa | ppiC | PpiC domain-containing protein |
| 94 | CABKQH010000001.1 | GCA902374575_00088 | CDS | open | 94570-95157 | _na 195_aa | Class II aldolase/adducin N-terminal domain-containing protein | |
| 95 | CABKQH010000001.1 | GCA902374575_00089 | CDS | open | 95284-96207 | _na 307_aa | rsmH | 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH |
| 96 | CABKQH010000001.1 | GCA902374575_00090 | CDS | open | 96210-96503 | _na 97_aa | ftsL | Cell division protein FtsL |
| 97 | CABKQH010000001.1 | GCA902374575_00091 | CDS | open | 96494-98443 | _na 649_aa | Integral membrane bound transporter domain-containing protein | |
| 98 | CABKQH010000001.1 | GCA902374575_00092 | CDS | open | 98422-98928 | _na 168_aa | DUF4231 domain-containing protein | |
| 99 | CABKQH010000001.1 | GCA902374575_00093 | CDS | open | 99033-99899 | _na 288_aa | D-alanine aminotransferase | |
| 100 | CABKQH010000001.1 | GCA902374575_00094 | CDS | open | 99896-100339 | _na 147_aa | Purine nucleoside phosphorylase | |
| 101 | CABKQH010000001.1 | GCA902374575_00095 | CDS | open | 100332-100826 | _na 164_aa | Chemotaxis protein | |
| 102 | CABKQH010000001.1 | GCA902374575_00096 | CDS | open | 100823-102838 | _na 671_aa | Peptidase M15C domain-containing protein | |
| 103 | CABKQH010000001.1 | GCA902374575_00097 | CDS | open | 102839-104158 | _na 439_aa | Putative helicase | |
| 104 | CABKQH010000001.1 | GCA902374575_00098 | CDS | open | 104155-104694 | _na 179_aa | Periplasmic protein | |
| 105 | CABKQH010000001.1 | GCA902374575_00099 | CDS | open | 104722-105234 | _na 170_aa | lolA | LolA-like outer membrane lipoprotein chaperone |
| 106 | CABKQH010000001.1 | GCA902374575_00100 | CDS | open | 105332-107938 | _na 868_aa | secA | preprotein translocase subunit SecA |
| 107 | CABKQH010000001.1 | GCA902374575_00101 | CDS | open | 107990-109189 | _na 399_aa | ABC3 transporter permease C-terminal domain-containing protein | |
| 108 | CABKQH010000001.1 | GCA902374575_00102 | CDS | open | 109455-111080 | _na 541_aa | kefB | Glutathione-regulated potassium-efflux system protein KefB |
| 109 | CABKQH010000001.1 | GCA902374575_00103 | CDS | open | 111084-111458 | _na 124_aa | hspR | heat shock protein transcriptional repressor HspR |
| 110 | CABKQH010000001.1 | GCA902374575_00104 | CDS | open | 111462-112358 | _na 298_aa | Co-chaperone-curved DNA binding protein A | |
| 111 | CABKQH010000001.1 | GCA902374575_00105 | CDS | open | 112514-113917 | _na 467_aa | Periplasmic heat shock serine protease HtrA%2C Do family | |
| 112 | CABKQH010000001.1 | GCA902374575_00106 | CDS | open | 114015-114692 | _na 225_aa | Two-component system response regulator | |
| 113 | CABKQH010000001.1 | GCA902374575_00107 | CDS | open | 114692-115933 | _na 413_aa | arsS | ArsS family sensor histidine kinase |
| 114 | CABKQH010000001.1 | GCA902374575_00108 | CDS | open | 115961-116398 | _na 145_aa | Pyridoxal-5'-phosphate-dependent protein | |
| 115 | CABKQH010000001.1 | GCA902374575_00109 | CDS | open | 116419-117861 | _na 480_aa | potassium/proton antiporter | |
| 116 | CABKQH010000001.1 | GCA902374575_00110 | CDS | open | 118363-118542 | _na 59_aa | Transformation system protein | |
| 117 | CABKQH010000001.1 | GCA902374575_00111 | CDS | open | 118581-119852 | _na 423_aa | O-acetylhomoserine sulfhydrylase | |
| 118 | CABKQH010000001.1 | GCA902374575_00112 | CDS | open | 119959-120291 | _na 110_aa | hypothetical protein | |
| 119 | CABKQH010000001.1 | GCA902374575_00113 | CDS | open | 120288-120962 | _na 224_aa | Haloacid dehalogenase | |
| 120 | CABKQH010000001.1 | GCA902374575_00114 | CDS | open | 120959-121213 | _na 84_aa | DUF2018 domain-containing protein | |
| 121 | CABKQH010000001.1 | GCA902374575_00115 | CDS | open | 121206-121637 | _na 143_aa | Periplasmic protein | |
| 122 | CABKQH010000001.1 | GCA902374575_00116 | CDS | open | 121648-122541 | _na 297_aa | Octaprenyl diphosphate synthase | |
| 123 | CABKQH010000001.1 | GCA902374575_00117 | CDS | open | 122541-123824 | _na 427_aa | hemA | glutamyl-tRNA reductase |
| 124 | CABKQH010000001.1 | GCA902374575_00118 | CDS | open | 123814-125514 | _na 566_aa | proS | proline--tRNA ligase |
| 125 | CABKQH010000001.1 | GCA902374575_00119 | CDS | open | 125511-125942 | _na 143_aa | fxsA | FxsA cytoplasmic membrane protein |
| 126 | CABKQH010000001.1 | GCA902374575_00120 | CDS | open | 125951-126886 | _na 311_aa | hemC | hydroxymethylbilane synthase |
| 127 | CABKQH010000001.1 | GCA902374575_00121 | CDS | open | 126883-127605 | _na 240_aa | DUF4252 domain-containing protein | |
| 128 | CABKQH010000001.1 | GCA902374575_00122 | CDS | open | 127890-129698 | _na 602_aa | menaquinone biosynthesis decarboxylase | |
| 129 | CABKQH010000001.1 | GCA902374575_00123 | CDS | open | 129855-130199 | _na 114_aa | 3-octaprenyl-4-hydroxybenzoate carboxy-lyase-like C-terminal domain-containing protein | |
| 130 | CABKQH010000001.1 | GCA902374575_00124 | CDS | open | 131405-132424 | _na 339_aa | HdrB-like C-terminal domain-containing protein | |
| 131 | CABKQH010000001.1 | GCA902374575_00125 | CDS | open | 132488-133309 | _na 273_aa | thiamine-phosphate kinase | |
| 132 | CABKQH010000001.1 | GCA902374575_00126 | CDS | open | 133287-134411 | _na 374_aa | truD | tRNA pseudouridine(13) synthase TruD |
| 133 | CABKQH010000001.1 | GCA902374575_00127 | CDS | open | 134523-134816 | _na 97_aa | Methyl-accepting chemotaxis protein | |
| 134 | CABKQH010000001.1 | GCA902374575_00129 | CDS | open | 136908-137135 | _na 75_aa | hypothetical protein | |
| 135 | CABKQH010000001.1 | GCA902374575_00130 | CDS | open | 137128-137499 | _na 123_aa | fliS | flagellar export chaperone FliS |
| 136 | CABKQH010000001.1 | GCA902374575_00131 | CDS | open | 137509-139269 | _na 586_aa | fliD | flagellar filament capping protein FliD |
| 137 | CABKQH010000001.1 | GCA902374575_00132 | CDS | open | 139272-139667 | _na 131_aa | flaG | FlaG family protein |
| 138 | CABKQH010000001.1 | GCA902374575_00133 | CDS | open | 139787-140131 | _na 114_aa | Ornithine carbamoyltransferase | |
| 139 | CABKQH010000001.1 | GCA902374575_00134 | CDS | open | 140128-140694 | _na 188_aa | rsmD | 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD |
| 140 | CABKQH010000001.1 | GCA902374575_00135 | CDS | open | 140752-141804 | _na 350_aa | Flagellar P-ring protein | |
| 141 | CABKQH010000001.1 | GCA902374575_00136 | CDS | open | 141804-142103 | _na 99_aa | flgJ | Flagellar protein FlgJ N-terminal domain-containing protein |
| 142 | CABKQH010000001.1 | GCA902374575_00137 | CDS | open | 142162-142365 | _na 67_aa | flgM | Anti-sigma-28 factor%2C FlgM |
| 143 | CABKQH010000001.1 | GCA902374575_00138 | CDS | open | 142382-142813 | _na 143_aa | flgN | Flagellar biosynthesis protein FlgN |
| 144 | CABKQH010000001.1 | GCA902374575_00139 | CDS | open | 142817-144688 | _na 623_aa | flgK | flagellar hook-associated protein FlgK |
| 145 | CABKQH010000001.1 | GCA902374575_00140 | CDS | open | 144685-145452 | _na 255_aa | TIGR02757 family protein | |
| 146 | CABKQH010000001.1 | GCA902374575_00141 | CDS | open | 145519-146055 | _na 178_aa | Superoxide dismutase (Cu/Zn) | |
| 147 | CABKQH010000001.1 | GCA902374575_00142 | CDS | open | 146198-146959 | _na 253_aa | putative membrane transporter protein | |
| 148 | CABKQH010000001.1 | GCA902374575_00143 | CDS | open | 147025-147705 | _na 226_aa | atpB | F0F1 ATP synthase subunit A |
| 149 | CABKQH010000001.1 | GCA902374575_00144 | CDS | open | 147869-149290 | _na 473_aa | gatB | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB |
| 150 | CABKQH010000001.1 | GCA902374575_00145 | CDS | open | 149303-150193 | _na 296_aa | NAD(P)H-dependent glycerol-3-phosphate dehydrogenase | |
| 151 | CABKQH010000001.1 | GCA902374575_00146 | CDS | open | 150190-151245 | _na 351_aa | beta-N-acetylhexosaminidase | |
| 152 | CABKQH010000001.1 | GCA902374575_00147 | CDS | open | 151261-152034 | _na 257_aa | Restriction endonuclease | |
| 153 | CABKQH010000001.1 | GCA902374575_00148 | CDS | open | 152427-154565 | _na 712_aa | ATPase dynein-related AAA domain-containing protein | |
| 154 | CABKQH010000001.1 | GCA902374575_00149 | CDS | open | 154620-155072 | _na 150_aa | Aryl-sulfate sulfotransferase | |
| 155 | CABKQH010000001.1 | GCA902374575_00150 | CDS | open | 155065-155895 | _na 276_aa | rarD | EamA family transporter RarD |
| 156 | CABKQH010000001.1 | GCA902374575_00151 | CDS | open | 155936-156823 | _na 295_aa | rarD | EamA family transporter RarD |
| 157 | CABKQH010000001.1 | GCA902374575_00152 | CDS | open | 156966-158306 | _na 446_aa | class II 3-deoxy-7-phosphoheptulonate synthase | |
| 158 | CABKQH010000001.1 | GCA902374575_00153 | CDS | open | 158331-159293 | _na 320_aa | ccoS | Cbb3-type cytochrome oxidase assembly protein CcoS |
| 159 | CABKQH010000001.1 | GCA902374575_00154 | CDS | open | 159290-161542 | _na 750_aa | Cell division initiation protein DivIVA | |
| 160 | CABKQH010000001.1 | GCA902374575_00155 | CDS | open | 161539-162246 | _na 235_aa | Methyltransferase small domain-containing protein | |
| 161 | CABKQH010000001.1 | GCA902374575_00156 | CDS | open | 162243-162608 | _na 121_aa | Zinc/iron-chelating domain-containing protein | |
| 162 | CABKQH010000001.1 | GCA902374575_00157 | CDS | open | 162587-163849 | _na 420_aa | ATP-dependent nuclease subunit B | |
| 163 | CABKQH010000001.1 | GCA902374575_00158 | CDS | open | 163846-164631 | _na 261_aa | trpC | indole-3-glycerol phosphate synthase TrpC |
| 164 | CABKQH010000001.1 | GCA902374575_00159 | CDS | open | 164631-165116 | _na 161_aa | HIT domain-containing protein | |
| 165 | CABKQH010000001.1 | GCA902374575_00160 | CDS | open | 165103-166110 | _na 335_aa | mnmH | tRNA 2-selenouridine(34) synthase MnmH |
| 166 | CABKQH010000001.1 | GCA902374575_00161 | CDS | open | 166553-168250 | _na 565_aa | acetolactate synthase large subunit | |
| 167 | CABKQH010000001.1 | GCA902374575_00162 | CDS | open | 168247-168714 | _na 155_aa | ilvN | acetolactate synthase small subunit |
| 168 | CABKQH010000001.1 | GCA902374575_00163 | CDS | open | 168714-169700 | _na 328_aa | lpxD | UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase |
| 169 | CABKQH010000001.1 | GCA902374575_00164 | CDS | open | 169762-170460 | _na 232_aa | corA | Magnesium transporter CorA family protein |
| 170 | CABKQH010000001.1 | GCA902374575_00165 | CDS | open | 170450-171580 | _na 376_aa | tgt | tRNA guanosine(34) transglycosylase Tgt |
| 171 | CABKQH010000001.1 | GCA902374575_00166 | CDS | open | 171660-172766 | _na 368_aa | mlaE | Lipid asymmetry ABC transporter MlaABCDEF%2C permease component MlaE |
| 172 | CABKQH010000001.1 | GCA902374575_00167 | CDS | open | 172763-173503 | _na 246_aa | mlaF | Lipid asymmetry ABC transporter MlaABCDEF%2C ATPase component MlaF |
| 173 | CABKQH010000001.1 | GCA902374575_00168 | CDS | open | 173504-174436 | _na 310_aa | Mce/MlaD domain-containing protein | |
| 174 | CABKQH010000001.1 | GCA902374575_00169 | CDS | open | 174433-174993 | _na 186_aa | ABC-type transport auxiliary lipoprotein component domain-containing protein | |
| 175 | CABKQH010000001.1 | GCA902374575_00170 | CDS | open | 175097-176515 | _na 472_aa | RCK C-terminal domain-containing protein | |
| 176 | CABKQH010000001.1 | GCA902374575_00171 | CDS | open | 176519-177556 | _na 345_aa | aroB | 3-dehydroquinate synthase |
| 177 | CABKQH010000001.1 | GCA902374575_00172 | CDS | open | 177553-179142 | _na 529_aa | Mechanosensitive ion channel | |
| 178 | CABKQH010000001.1 | GCA902374575_00173 | CDS | open | 179142-180380 | _na 412_aa | mtaB | tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB |
| 179 | CABKQH010000001.1 | GCA902374575_00174 | CDS | open | 180343-182019 | _na 558_aa | Integral membrane ATP-dependent zinc metallopeptidase | |
| 180 | CABKQH010000001.1 | GCA902374575_00175 | CDS | open | 182033-182572 | _na 179_aa | mog | molybdopterin adenylyltransferase |
| 181 | CABKQH010000001.1 | GCA902374575_00176 | CDS | open | 182886-183140 | _na 84_aa | hypothetical protein | |
| 182 | CABKQH010000001.1 | GCA902374575_00177 | CDS | open | 183177-183791 | _na 204_aa | Thiamin-phosphate pyrophosphorylase | |
| 183 | CABKQH010000001.1 | GCA902374575_00178 | CDS | open | 183778-184932 | _na 384_aa | thiH | 2-iminoacetate synthase ThiH |
| 184 | CABKQH010000001.1 | GCA902374575_00179 | CDS | open | 184932-185696 | _na 254_aa | thiazole synthase | |
| 185 | CABKQH010000001.1 | GCA902374575_00180 | CDS | open | 185697-186548 | _na 283_aa | thiF | sulfur carrier protein ThiS adenylyltransferase ThiF |
| 186 | CABKQH010000001.1 | GCA902374575_00181 | CDS | open | 186556-186759 | _na 67_aa | thiS | sulfur carrier protein ThiS |
| 187 | CABKQH010000001.1 | GCA902374575_00182 | CDS | open | 186759-187937 | _na 392_aa | Aspartate aminotransferase%2C aminotransferase%2C classes I and II | |
| 188 | CABKQH010000001.1 | GCA902374575_00183 | CDS | open | 187949-189784 | _na 611_aa | speA | biosynthetic arginine decarboxylase |
| 189 | CABKQH010000001.1 | GCA902374575_00184 | CDS | open | 189781-191007 | _na 408_aa | hisS | histidine--tRNA ligase |
| 190 | CABKQH010000001.1 | GCA902374575_00185 | CDS | open | 191036-191623 | _na 195_aa | tmk | dTMP kinase |
| 191 | CABKQH010000001.1 | GCA902374575_00186 | CDS | open | 191625-192095 | _na 156_aa | coaD | pantetheine-phosphate adenylyltransferase |
| 192 | CABKQH010000001.1 | GCA902374575_00187 | CDS | open | 192092-192643 | _na 183_aa | ubiX | Flavin prenyltransferase UbiX |
| 193 | CABKQH010000001.1 | GCA902374575_00189 | CDS | open | 193637-194797 | _na 386_aa | Molybdopterin molybdenumtransferase | |
| 194 | CABKQH010000001.1 | GCA902374575_00190 | CDS | open | 194800-196068 | _na 422_aa | murA | UDP-N-acetylglucosamine 1-carboxyvinyltransferase |
| 195 | CABKQH010000001.1 | GCA902374575_00191 | CDS | open | 196207-196887 | _na 226_aa | NlpC/P60 domain-containing protein | |
| 196 | CABKQH010000001.1 | GCA902374575_00192 | CDS | open | 196871-197446 | _na 191_aa | Peptidase S54 rhomboid domain-containing protein | |
| 197 | CABKQH010000001.1 | GCA902374575_00193 | CDS | open | 197433-198245 | _na 270_aa | Ferritin | |
| 198 | CABKQH010000001.1 | GCA902374575_00194 | CDS | open | 198242-198739 | _na 165_aa | Phosphohistidine phosphatase | |
| 199 | CABKQH010000001.1 | GCA902374575_00195 | CDS | open | 199364-199852 | _na 162_aa | Flagellar protein | |
| 200 | CABKQH010000001.1 | GCA902374575_00196 | CDS | open | 199857-201203 | _na 448_aa | TolC-like outer membrane efflux protein | |
| 201 | CABKQH010000001.1 | GCA902374575_00197 | CDS | open | 201205-203133 | _na 642_aa | pvdT | Pyoverdine export ATP-binding/permease protein PvdT |
| 202 | CABKQH010000001.1 | GCA902374575_00198 | CDS | open | 203134-204330 | _na 398_aa | Efflux transporter periplasmic adaptor subunit | |
| 203 | CABKQH010000001.1 | GCA902374575_00199 | CDS | open | 204384-206417 | _na 677_aa | DNA 3'-5' helicase | |
| 204 | CABKQH010000001.1 | GCA902374575_00200 | CDS | open | 206483-208651 | _na 722_aa | pbpC | penicillin-binding protein 1C |
| 205 | CABKQH010000001.1 | GCA902374575_00201 | CDS | open | 208653-213776 | _na 1707_aa | Alpha-2-macroglobulin | |
| 206 | CABKQH010000001.1 | GCA902374575_00202 | CDS | open | 213896-216520 | _na 874_aa | valine--tRNA ligase | |
| 207 | CABKQH010000001.1 | GCA902374575_00203 | CDS | open | 216520-217476 | _na 318_aa | DL-methionine ABC transporter MetINQ%2C ATP-binding protein | |
| 208 | CABKQH010000001.1 | GCA902374575_00204 | CDS | open | 217476-218150 | _na 224_aa | ABC transmembrane type-1 domain-containing protein | |
| 209 | CABKQH010000001.1 | GCA902374575_00205 | CDS | open | 218409-219191 | _na 260_aa | DL-methionine ABC transporter MetINQ%2C substrate-binding protein | |
| 210 | CABKQH010000001.1 | GCA902374575_00206 | CDS | open | 219267-220046 | _na 259_aa | DL-methionine ABC transporter MetINQ%2C substrate-binding protein | |
| 211 | CABKQH010000001.1 | GCA902374575_00207 | CDS | open | 220203-220793 | _na 196_aa | VTT domain-containing protein | |
| 212 | CABKQH010000001.1 | GCA902374575_00208 | CDS | open | 220862-221650 | _na 262_aa | murI | glutamate racemase |
| 213 | CABKQH010000001.1 | GCA902374575_00209 | CDS | open | 221742-222902 | _na 386_aa | ftsW | putative peptidoglycan glycosyltransferase FtsW |
| 214 | CABKQH010000001.1 | GCA902374575_00210 | CDS | open | 222899-223921 | _na 340_aa | murG | undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase |
| 215 | CABKQH010000001.1 | GCA902374575_00211 | CDS | open | 223913-224647 | _na 244_aa | Imidazole glycerol phosphate synthase | |
| 216 | CABKQH010000001.1 | GCA902374575_00212 | CDS | open | 224765-225523 | _na 252_aa | hypothetical protein | |
| 217 | CABKQH010000001.1 | GCA902374575_00213 | CDS | open | 225524-226774 | _na 416_aa | RNA polymerase factor sigma-54 | |
| 218 | CABKQH010000001.1 | GCA902374575_00214 | CDS | open | 226778-227506 | _na 242_aa | lptB | LPS export ABC transporter ATP-binding protein |
| 219 | CABKQH010000001.1 | GCA902374575_00215 | CDS | open | 227499-227897 | _na 132_aa | tsaE | tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE |
| 220 | CABKQH010000001.1 | GCA902374575_00216 | CDS | open | 227897-228142 | _na 81_aa | RNA-binding S4 domain-containing protein | |
| 221 | CABKQH010000001.1 | GCA902374575_00217 | CDS | open | 228176-229003 | _na 275_aa | iroE | IroE protein |
| 222 | CABKQH010000001.1 | GCA902374575_00218 | CDS | open | 228997-229995 | _na 332_aa | TonB-dependent receptor-like beta-barrel domain-containing protein | |
| 223 | CABKQH010000001.1 | GCA902374575_00219 | CDS | open | 230203-231102 | _na 299_aa | TonB-dependent receptor plug domain-containing protein | |
| 224 | CABKQH010000001.1 | GCA902374575_00220 | CDS | open | 231324-232547 | _na 407_aa | argG | argininosuccinate synthase |
| 225 | CABKQH010000001.1 | GCA902374575_00221 | CDS | open | 232572-233018 | _na 148_aa | rplI | 50S ribosomal protein L9 |
| 226 | CABKQH010000001.1 | GCA902374575_00222 | CDS | open | 233019-233552 | _na 177_aa | hslV | ATP-dependent protease subunit HslV |
| 227 | CABKQH010000001.1 | GCA902374575_00223 | CDS | open | 233561-234883 | _na 440_aa | hslU | HslU--HslV peptidase ATPase subunit |
| 228 | CABKQH010000001.1 | GCA902374575_00224 | CDS | open | 234880-235749 | _na 289_aa | era | GTPase Era |
| 229 | CABKQH010000001.1 | GCA902374575_00225 | CDS | open | 235808-237331 | _na 507_aa | C4-dicarboxylate ABC transporter | |
| 230 | CABKQH010000001.1 | GCA902374575_00226 | CDS | open | 237328-237975 | _na 215_aa | pilO | Pilus assembly protein PilO |
| 231 | CABKQH010000001.1 | GCA902374575_00227 | CDS | open | 237975-238331 | _na 118_aa | hypothetical protein | |
| 232 | CABKQH010000001.1 | GCA902374575_00228 | CDS | open | 238353-239879 | _na 508_aa | mshL | pilus (MSHA type) biogenesis protein MshL |
| 233 | CABKQH010000001.1 | GCA902374575_00229 | CDS | open | 239872-240699 | _na 275_aa | AAA+ ATPase domain-containing protein | |
| 234 | CABKQH010000001.1 | GCA902374575_00230 | CDS | open | 240692-241567 | _na 291_aa | Transformation system protein | |
| 235 | CABKQH010000001.1 | GCA902374575_00231 | CDS | open | 241564-242103 | _na 179_aa | Periplasmic protein | |
| 236 | CABKQH010000001.1 | GCA902374575_00232 | CDS | open | 242103-243854 | _na 583_aa | Bacterial type II secretion system protein E domain-containing protein | |
| 237 | CABKQH010000001.1 | GCA902374575_00233 | CDS | open | 243851-245086 | _na 411_aa | gspF | Type II secretion system protein GspF domain-containing protein |
| 238 | CABKQH010000001.1 | GCA902374575_00234 | CDS | open | 245114-245614 | _na 166_aa | Signal transduction protein CetB%2C mediates an energy taxis response | |
| 239 | CABKQH010000001.1 | GCA902374575_00235 | CDS | open | 245616-246872 | _na 418_aa | Signal transduction protein CetA%2C mediates an energy taxis response | |
| 240 | CABKQH010000001.1 | GCA902374575_00236 | CDS | open | 247658-248089 | _na 143_aa | Glutamyl-tRNA amidotransferase | |
| 241 | CABKQH010000001.1 | GCA902374575_00237 | CDS | open | 248120-249022 | _na 300_aa | Ppx/GppA phosphatase N-terminal domain-containing protein | |
| 242 | CABKQH010000001.1 | GCA902374575_00238 | CDS | open | 249153-250691 | _na 512_aa | Phosphate transporter | |
| 243 | CABKQH010000001.1 | GCA902374575_00239 | CDS | open | 250795-253368 | _na 857_aa | clpB | Chaperone protein ClpB |
| 244 | CABKQH010000001.1 | GCA902374575_00240 | CDS | open | 253588-254895 | _na 435_aa | ilvN | acetolactate synthase small subunit |
| 245 | CABKQH010000001.1 | GCA902374575_00241 | CDS | open | 254912-255622 | _na 236_aa | purC | phosphoribosylaminoimidazolesuccinocarboxamide synthase |
| 246 | CABKQH010000001.1 | GCA902374575_00242 | CDS | open | 255631-255867 | _na 78_aa | purS | phosphoribosylformylglycinamidine synthase subunit PurS |
| 247 | CABKQH010000001.1 | GCA902374575_00243 | CDS | open | 255864-256529 | _na 221_aa | purQ | phosphoribosylformylglycinamidine synthase I |
| 248 | CABKQH010000001.1 | GCA902374575_00244 | CDS | open | 256523-257830 | _na 435_aa | Periplasmic protein | |
| 249 | CABKQH010000001.1 | GCA902374575_00245 | CDS | open | 257817-258485 | _na 222_aa | 1-acyl-sn-glycerol-3-phosphate acyltransferase | |
| 250 | CABKQH010000001.1 | GCA902374575_00246 | CDS | open | 258627-258920 | _na 97_aa | Methyl-accepting chemotaxis protein | |
| 251 | CABKQH010000001.1 | GCA902374575_00247 | CDS | open | 260504-262360 | _na 618_aa | htpG | molecular chaperone HtpG |
| 252 | CABKQH010000001.1 | GCA902374575_00248 | CDS | open | 262499-263356 | _na 285_aa | sdhE | 8-methylmenaquinol:fumarate reductase membrane anchor subunit |
| 253 | CABKQH010000001.1 | GCA902374575_00249 | CDS | open | 263359-264228 | _na 289_aa | sdhB | 8-methylmenaquinol:fumarate reductase iron-sulfur subunit |
| 254 | CABKQH010000001.1 | GCA902374575_00250 | CDS | open | 264334-266172 | _na 612_aa | sdhA | 8-methylmenaquinol:fumarate reductase flavoprotein subunit |
| 255 | CABKQH010000001.1 | GCA902374575_00251 | CDS | open | 266603-267025 | _na 140_aa | Knr4/Smi1-like domain-containing protein | |
| 256 | CABKQH010000001.1 | GCA902374575_00252 | CDS | open | 267066-267617 | _na 183_aa | 2-oxoglutarate:acceptor oxidoreductase%2C gamma subunit | |
| 257 | CABKQH010000001.1 | GCA902374575_00253 | CDS | open | 267614-268459 | _na 281_aa | 2-oxoglutarate ferredoxin oxidoreductase subunit beta | |
| 258 | CABKQH010000001.1 | GCA902374575_00254 | CDS | open | 268449-269579 | _na 376_aa | 2-oxoglutarate synthase subunit alpha | |
| 259 | CABKQH010000001.1 | GCA902374575_00255 | CDS | open | 269576-269887 | _na 103_aa | 2-oxoglutarate:acceptor oxidoreductase%2C delta subunit | |
| 260 | CABKQH010000001.1 | GCA902374575_00256 | CDS | open | 269896-270789 | _na 297_aa | Malate dehydrogenase%2C NAD-dependent | |
| 261 | CABKQH010000001.1 | GCA902374575_00257 | CDS | open | 270793-272967 | _na 724_aa | isocitrate dehydrogenase (NADP(+)) | |
| 262 | CABKQH010000001.1 | GCA902374575_00258 | CDS | open | 273031-273975 | _na 314_aa | Endolytic murein transglycosylase | |
| 263 | CABKQH010000001.1 | GCA902374575_00259 | CDS | open | 273995-276514 | _na 839_aa | DUF3971 domain-containing protein | |
| 264 | CABKQH010000001.1 | GCA902374575_00260 | CDS | open | 276739-277080 | _na 113_aa | hypA | hydrogenase maturation nickel metallochaperone HypA |
| 265 | CABKQH010000001.1 | GCA902374575_00261 | CDS | open | 277080-278072 | _na 330_aa | hypE | hydrogenase expression/formation protein HypE |
| 266 | CABKQH010000001.1 | GCA902374575_00262 | CDS | open | 278081-279169 | _na 362_aa | hypD | hydrogenase formation protein HypD |
| 267 | CABKQH010000001.1 | GCA902374575_00263 | CDS | open | 279169-279408 | _na 79_aa | hypC | Hydrogenase assembly chaperone HypC |
| 268 | CABKQH010000001.1 | GCA902374575_00264 | CDS | open | 279408-280214 | _na 268_aa | hypB | hydrogenase nickel incorporation protein HypB |
| 269 | CABKQH010000001.1 | GCA902374575_00265 | CDS | open | 280338-280979 | _na 213_aa | GDYXXLXY protein | |
| 270 | CABKQH010000001.1 | GCA902374575_00266 | CDS | open | 280976-282238 | _na 420_aa | DUF2157 domain-containing protein | |
| 271 | CABKQH010000001.1 | GCA902374575_00267 | CDS | open | 282600-283013 | _na 137_aa | nikR | nickel-responsive transcriptional regulator NikR |
| 272 | CABKQH010000001.1 | GCA902374575_00268 | CDS | open | 283059-285284 | _na 741_aa | hypF | carbamoyltransferase HypF |
| 273 | CABKQH010000001.1 | GCA902374575_00269 | CDS | open | 285268-286740 | _na 490_aa | hydE | Protein hydE |
| 274 | CABKQH010000001.1 | GCA902374575_00270 | CDS | open | 286737-287282 | _na 181_aa | Hydrogenase maturation protease | |
| 275 | CABKQH010000001.1 | GCA902374575_00271 | CDS | open | 287282-287962 | _na 226_aa | cybH | Ni/Fe-hydrogenase%2C b-type cytochrome subunit |
| 276 | CABKQH010000001.1 | GCA902374575_00272 | CDS | open | 287972-289690 | _na 572_aa | [NiFe] hydrogenase%2C large subunit | |
| 277 | CABKQH010000001.1 | GCA902374575_00273 | CDS | open | 289700-290845 | _na 381_aa | [NiFe] hydrogenase%2C small subunit | |
| 278 | CABKQH010000001.1 | GCA902374575_00274 | CDS | open | 291189-291896 | _na 235_aa | flgH | flagellar basal body L-ring protein FlgH |
| 279 | CABKQH010000001.1 | GCA902374575_00275 | CDS | open | 291963-292115 | _na 50_aa | pta | phosphate acetyltransferase |
| 280 | CABKQH010000001.1 | GCA902374575_00276 | CDS | open | 292412-293329 | _na 305_aa | pta | phosphate acetyltransferase |
| 281 | CABKQH010000001.1 | GCA902374575_00277 | CDS | open | 293331-294524 | _na 397_aa | ackA | Acetate kinase |
| 282 | CABKQH010000001.1 | GCA902374575_00278 | CDS | open | 294527-295591 | _na 354_aa | xerH | Tyrosine recombinase XerH |
| 283 | CABKQH010000001.1 | GCA902374575_00279 | CDS | open | 296318-296767 | _na 149_aa | Beta-lactamase | |
| 284 | CABKQH010000001.1 | GCA902374575_00280 | CDS | open | 296764-298188 | _na 474_aa | UDP-N-acetylmuramoylalanyl-D-glutamyl-2%2C6-diaminopimelate--D-alanyl-D-alanine ligase | |
| 285 | CABKQH010000001.1 | GCA902374575_00281 | CDS | open | 298185-298970 | _na 261_aa | AB hydrolase-1 domain-containing protein | |
| 286 | CABKQH010000001.1 | GCA902374575_00282 | CDS | open | 298960-299190 | _na 76_aa | Antitoxin | |
| 287 | CABKQH010000001.1 | GCA902374575_00283 | CDS | open | 299255-300295 | _na 346_aa | ddl | D-alanine--D-alanine ligase |
| 288 | CABKQH010000001.1 | GCA902374575_00284 | CDS | open | 300307-300861 | _na 184_aa | ruvA | Holliday junction branch migration protein RuvA |
| 289 | CABKQH010000001.1 | GCA902374575_00285 | CDS | open | 300861-302792 | _na 643_aa | Flagellar Assembly Protein A N-terminal region domain-containing protein | |
| 290 | CABKQH010000001.1 | GCA902374575_00286 | CDS | open | 302915-304315 | _na 466_aa | murJ | murein biosynthesis integral membrane protein MurJ |
| 291 | CABKQH010000001.1 | GCA902374575_00287 | CDS | open | 304302-305696 | _na 464_aa | cysS | cysteine--tRNA ligase |
| 292 | CABKQH010000001.1 | GCA902374575_00288 | CDS | open | 305665-307413 | _na 582_aa | Lipid A export ATP-binding/permease protein | |
| 293 | CABKQH010000001.1 | GCA902374575_00289 | CDS | open | 307467-308540 | _na 357_aa | quinone-dependent dihydroorotate dehydrogenase | |
| 294 | CABKQH010000001.1 | GCA902374575_00290 | CDS | open | 308552-309793 | _na 413_aa | Zn-dependent peptidase%2C M16 family | |
| 295 | CABKQH010000001.1 | GCA902374575_00291 | CDS | open | 309796-310689 | _na 297_aa | dapA | 4-hydroxy-tetrahydrodipicolinate synthase |
| 296 | CABKQH010000001.1 | GCA902374575_00292 | CDS | open | 310689-311477 | _na 262_aa | enoyl-ACP reductase | |
| 297 | CABKQH010000001.1 | GCA902374575_00293 | CDS | open | 311509-312054 | _na 181_aa | pgsA | CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase |
| 298 | CABKQH010000001.1 | GCA902374575_00294 | CDS | open | 312057-312953 | _na 298_aa | hypothetical protein | |
| 299 | CABKQH010000001.1 | GCA902374575_00295 | CDS | open | 313034-314143 | _na 369_aa | rseP | RIP metalloprotease RseP |
| 300 | CABKQH010000001.1 | GCA902374575_00296 | CDS | open | 314143-314778 | _na 211_aa | Pyridoxal phosphate homeostasis protein | |
| 301 | CABKQH010000001.1 | GCA902374575_00297 | CDS | open | 314874-316634 | _na 586_aa | Response regulator | |
| 302 | CABKQH010000001.1 | GCA902374575_00298 | CDS | open | 316729-317634 | _na 301_aa | Auxin efflux carrier | |
| 303 | CABKQH010000001.1 | GCA902374575_00299 | CDS | open | 317698-317991 | _na 97_aa | Pentapeptide MXKDX repeat protein | |
| 304 | CABKQH010000001.1 | GCA902374575_00300 | CDS | open | 318001-318663 | _na 220_aa | dccR | Two-component system response regulator DccR |
| 305 | CABKQH010000001.1 | GCA902374575_00301 | CDS | open | 318656-319825 | _na 389_aa | histidine kinase | |
| 306 | CABKQH010000001.1 | GCA902374575_00302 | CDS | open | 319953-321428 | _na 491_aa | Aldehyde dehydrogenase B | |
| 307 | CABKQH010000001.1 | GCA902374575_00303 | CDS | open | 321556-322278 | _na 240_aa | Calcineurin-like phosphoesterase domain-containing protein | |
| 308 | CABKQH010000001.1 | GCA902374575_00304 | CDS | open | 322259-323287 | _na 342_aa | hypothetical protein | |
| 309 | CABKQH010000001.1 | GCA902374575_00305 | CDS | open | 323340-324113 | _na 257_aa | brkB | Virulence factor%2C BrkB family protein |
| 310 | CABKQH010000001.1 | GCA902374575_00306 | CDS | open | 324165-324887 | _na 240_aa | pgbA | Plasminogen-binding protein PgbA N-terminal domain-containing protein |
| 311 | CABKQH010000001.1 | GCA902374575_00307 | CDS | open | 325002-326171 | _na 389_aa | Endopeptidase | |
| 312 | CABKQH010000001.1 | GCA902374575_00308 | CDS | open | 326181-327548 | _na 455_aa | mgtE | magnesium transporter |
| 313 | CABKQH010000001.1 | GCA902374575_00309 | CDS | open | 327533-328117 | _na 194_aa | Uridine diphosphate glucose pyrophosphatase | |
| 314 | CABKQH010000001.1 | GCA902374575_00310 | CDS | open | 328305-330398 | _na 697_aa | RNA degradosome polyphosphate kinase | |
| 315 | CABKQH010000001.1 | GCA902374575_00311 | CDS | open | 330635-331267 | _na 210_aa | Nucleoside transporter/FeoB GTPase Gate domain-containing protein | |
| 316 | CABKQH010000001.1 | GCA902374575_00312 | CDS | open | 331271-331726 | _na 151_aa | Membrane protein | |
| 317 | CABKQH010000001.1 | GCA902374575_00313 | CDS | open | 331736-332854 | _na 372_aa | Peptidase M20 dimerisation domain-containing protein | |
| 318 | CABKQH010000001.1 | GCA902374575_00314 | CDS | open | 332914-333258 | _na 114_aa | 3-octaprenyl-4-hydroxybenzoate carboxy-lyase-like C-terminal domain-containing protein | |
| 319 | CABKQH010000001.1 | GCA902374575_00315 | CDS | open | 334189-334992 | _na 267_aa | 3'-5' exonuclease | |
| 320 | CABKQH010000001.1 | GCA902374575_00316 | CDS | open | 334989-335636 | _na 215_aa | rpe | ribulose-phosphate 3-epimerase |
| 321 | CABKQH010000001.1 | GCA902374575_00317 | CDS | open | 335646-337019 | _na 457_aa | Prephenate dehydrogenase | |
| 322 | CABKQH010000001.1 | GCA902374575_00318 | CDS | open | 337016-337762 | _na 248_aa | HDOD domain-containing protein | |
| 323 | CABKQH010000001.1 | GCA902374575_00319 | CDS | open | 337948-338139 | _na 63_aa | rpmB | 50S ribosomal protein L28 |
| 324 | CABKQH010000001.1 | GCA902374575_00320 | CDS | open | 338162-339292 | _na 376_aa | Potassium channel protein | |
| 325 | CABKQH010000001.1 | GCA902374575_00321 | CDS | open | 339410-339616 | _na 68_aa | DUF465 domain-containing protein | |
| 326 | CABKQH010000001.1 | GCA902374575_00324 | CDS | open | 341119-341364 | _na 81_aa | hypothetical protein | |
| 327 | CABKQH010000001.1 | GCA902374575_00325 | CDS | open | 341365-341496 | _na 43_aa | hypothetical protein | |
| 328 | CABKQH010000001.1 | GCA902374575_00326 | CDS | open | 341517-343406 | _na 629_aa | DNA segregation ATPase FtsK/SpoIIIE | |
| 329 | CABKQH010000001.1 | GCA902374575_00327 | CDS | open | 343760-346075 | _na 771_aa | flgL | flagellar hook-associated protein FlgL |
| 330 | CABKQH010000001.1 | GCA902374575_00328 | CDS | open | 346217-346963 | _na 248_aa | yaaA | YaaA family protein |
| 331 | CABKQH010000001.1 | GCA902374575_00329 | CDS | open | 347087-347389 | _na 100_aa | DNA-binding protein HU | |
| 332 | CABKQH010000001.1 | GCA902374575_00331 | CDS | open | 347698-348738 | _na 346_aa | flgG | Flagellar biosynthesis protein FlgG |
| 333 | CABKQH010000001.1 | GCA902374575_00332 | CDS | open | 348914-349750 | _na 278_aa | Polyribonucleotide nucleotidyltransferase | |
| 334 | CABKQH010000001.1 | GCA902374575_00333 | CDS | open | 349810-350487 | _na 225_aa | Cell surface protein | |
| 335 | CABKQH010000001.1 | GCA902374575_00334 | CDS | open | 350644-351447 | _na 267_aa | hypothetical protein | |
| 336 | CABKQH010000001.1 | GCA902374575_00335 | CDS | open | 351583-351927 | _na 114_aa | acpS | Holo-[acyl-carrier-protein] synthase |
| 337 | CABKQH010000001.1 | GCA902374575_00336 | CDS | open | 351924-352460 | _na 178_aa | fliL | flagellar basal body-associated protein FliL |
| 338 | CABKQH010000001.1 | GCA902374575_00337 | CDS | open | 352519-353001 | _na 160_aa | ybaK | Cys-tRNA(Pro) deacylase |
| 339 | CABKQH010000001.1 | GCA902374575_00338 | CDS | open | 352990-353976 | _na 328_aa | Dihydrodipicolinate reductase | |
| 340 | CABKQH010000001.1 | GCA902374575_00339 | CDS | open | 353973-354581 | _na 202_aa | Glycine transporter domain-containing protein | |
| 341 | CABKQH010000001.1 | GCA902374575_00340 | CDS | open | 354699-355364 | _na 221_aa | Ysc84 actin-binding domain-containing protein | |
| 342 | CABKQH010000001.1 | GCA902374575_00341 | CDS | open | 355471-355680 | _na 69_aa | hypothetical protein | |
| 343 | CABKQH010000001.1 | GCA902374575_00342 | CDS | open | 355831-356277 | _na 148_aa | Transcriptional regulator%2C Fur family | |
| 344 | CABKQH010000001.1 | GCA902374575_00343 | CDS | open | 356380-356703 | _na 107_aa | HMA domain-containing protein | |
| 345 | CABKQH010000001.1 | GCA902374575_00344 | CDS | open | 356696-357346 | _na 216_aa | Aminotransferase | |
| 346 | CABKQH010000001.1 | GCA902374575_00345 | CDS | open | 357339-357689 | _na 116_aa | Periplasmic protein | |
| 347 | CABKQH010000001.1 | GCA902374575_00346 | CDS | open | 357699-358013 | _na 104_aa | Cys/Met metabolism pyridoxal-phosphate-dependent enzyme | |
| 348 | CABKQH010000001.1 | GCA902374575_00347 | CDS | open | 358013-358327 | _na 104_aa | Oxidoreductase | |
| 349 | CABKQH010000001.1 | GCA902374575_00348 | CDS | open | 358296-360386 | _na 696_aa | Lead%2C cadmium%2C zinc and mercury transporting ATPase | |
| 350 | CABKQH010000001.1 | GCA902374575_00349 | CDS | open | 360404-361864 | _na 486_aa | Na+/alanine symporter family protein | |
| 351 | CABKQH010000001.1 | GCA902374575_00350 | CDS | open | 361875-362132 | _na 85_aa | Helicase | |
| 352 | CABKQH010000001.1 | GCA902374575_00351 | CDS | open | 362134-362967 | _na 277_aa | modD | Putative pyrophosphorylase ModD |
| 353 | CABKQH010000001.1 | GCA902374575_00352 | CDS | open | 363639-363779 | _na 46_aa | hypothetical protein | |
| 354 | CABKQH010000001.1 | GCA902374575_00353 | CDS | open | 364496-365818 | _na 440_aa | Nitrate/nitrite sensing protein domain-containing protein | |
| 355 | CABKQH010000001.1 | GCA902374575_00354 | CDS | open | 365886-365981 | _na 31_aa | hypothetical protein | |
| 356 | CABKQH010000001.1 | GCA902374575_00355 | CDS | open | 366113-368680 | _na 855_aa | Anaerobic dimethyl sulfoxide reductase chain A | |
| 357 | CABKQH010000001.1 | GCA902374575_00356 | CDS | open | 368691-369266 | _na 191_aa | Molybdopterin-containing oxidoreductase II%2C DMSO/TMAO/BSO reductase family%2C monoheme c-type cytochrome | |
| 358 | CABKQH010000001.1 | GCA902374575_00357 | CDS | open | 369364-369786 | _na 140_aa | eamA | EamA domain-containing protein |
| 359 | CABKQH010000001.1 | GCA902374575_00358 | CDS | open | 369838-370761 | _na 307_aa | Dyp-type peroxidase family protein | |
| 360 | CABKQH010000001.1 | GCA902374575_00359 | CDS | open | 370785-371480 | _na 231_aa | DUF4230 domain-containing protein | |
| 361 | CABKQH010000001.1 | GCA902374575_00360 | CDS | open | 371538-372371 | _na 277_aa | Metallo-beta-lactamase domain-containing protein | |
| 362 | CABKQH010000001.1 | GCA902374575_00361 | CDS | open | 372466-373677 | _na 403_aa | ilvA | threonine ammonia-lyase |
| 363 | CABKQH010000001.1 | GCA902374575_00362 | CDS | open | 373692-374801 | _na 369_aa | trmA | tRNA (uridine(54)-C5)-methyltransferase TrmA |
| 364 | CABKQH010000001.1 | GCA902374575_00363 | CDS | open | 374804-376507 | _na 567_aa | Na+/H+ antiporter NhaC-like C-terminal domain-containing protein | |
| 365 | CABKQH010000001.1 | GCA902374575_00364 | CDS | open | 376517-377263 | _na 248_aa | Oxidoreductase | |
| 366 | CABKQH010000001.1 | GCA902374575_00365 | CDS | open | 377272-378483 | _na 403_aa | Ankyrin repeat domain-containing protein | |
| 367 | CABKQH010000001.1 | GCA902374575_00366 | CDS | open | 378520-381105 | _na 861_aa | bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase | |
| 368 | CABKQH010000001.1 | GCA902374575_00367 | CDS | open | 381228-381686 | _na 152_aa | Methylated-DNA--protein-cysteine methyltransferase | |
| 369 | CABKQH010000001.1 | GCA902374575_00368 | CDS | open | 381723-384818 | _na 1031_aa | Type I restriction enzyme endonuclease subunit | |
| 370 | CABKQH010000001.1 | GCA902374575_00369 | CDS | open | 384829-385395 | _na 188_aa | Type I restriction modification DNA specificity domain-containing protein | |
| 371 | CABKQH010000001.1 | GCA902374575_00370 | CDS | open | 385398-386000 | _na 200_aa | Type I restriction modification DNA specificity domain-containing protein | |
| 372 | CABKQH010000001.1 | GCA902374575_00371 | CDS | open | 386130-387122 | _na 330_aa | Bro-N domain-containing protein | |
| 373 | CABKQH010000001.1 | GCA902374575_00372 | CDS | open | 387119-388672 | _na 517_aa | type I restriction-modification system subunit M | |
| 374 | CABKQH010000001.1 | GCA902374575_00373 | CDS | open | 388683-389696 | _na 337_aa | bifunctional 3%2C4-dihydroxy-2-butanone 4-phosphate synthase/GTP cyclohydrolase II | |
| 375 | CABKQH010000001.1 | GCA902374575_00378 | CDS | open | 390804-391487 | _na 227_aa | CRISPR associated protein Cas6 C-terminal domain-containing protein | |
| 376 | CABKQH010000001.1 | GCA902374575_00379 | CDS | open | 391551-392942 | _na 463_aa | CRISPR-associated protein TM1802 (cas_TM1802) | |
| 377 | CABKQH010000001.1 | GCA902374575_00380 | CDS | open | 392945-393361 | _na 138_aa | CRISPR type III-B/RAMP module-associated protein Cmr5 | |
| 378 | CABKQH010000001.1 | GCA902374575_00381 | CDS | open | 393354-394229 | _na 291_aa | cas7b | type I-B CRISPR-associated protein Cas7/Csh2 |
| 379 | CABKQH010000001.1 | GCA902374575_00382 | CDS | open | 394229-394969 | _na 246_aa | CRISPR-associated protein%2C Cas5h family | |
| 380 | CABKQH010000001.1 | GCA902374575_00383 | CDS | open | 394969-397179 | _na 736_aa | CRISPR-associated helicase Cas3 | |
| 381 | CABKQH010000001.1 | GCA902374575_00384 | CDS | open | 397179-397679 | _na 166_aa | CRISPR-associated exonuclease Cas4 | |
| 382 | CABKQH010000001.1 | GCA902374575_00385 | CDS | open | 397688-397966 | _na 92_aa | cas2 | CRISPR-associated endonuclease Cas2 |
| 383 | CABKQH010000001.1 | GCA902374575_00386 | CDS | open | 397976-398974 | _na 332_aa | cas1 | CRISPR-associated endonuclease Cas1 |
| 384 | CABKQH010000001.1 | GCA902374575_00387 | CDS | open | 401594-401872 | _na 92_aa | HTH cro/C1-type domain-containing protein | |
| 385 | CABKQH010000001.1 | GCA902374575_00388 | CDS | open | 401869-402162 | _na 97_aa | Addiction module killer protein | |
| 386 | CABKQH010000001.1 | GCA902374575_00389 | CDS | open | 402542-403063 | _na 173_aa | comE | ComE family competence protein |
| 387 | CABKQH010000001.1 | GCA902374575_00390 | CDS | open | 403200-403556 | _na 118_aa | rplS | 50S ribosomal protein L19 |
| 388 | CABKQH010000001.1 | GCA902374575_00391 | CDS | open | 403565-404257 | _na 230_aa | trmD | tRNA (guanosine(37)-N1)-methyltransferase TrmD |
| 389 | CABKQH010000001.1 | GCA902374575_00392 | CDS | open | 404254-404784 | _na 176_aa | rimM | ribosome maturation factor RimM |
| 390 | CABKQH010000001.1 | GCA902374575_00393 | CDS | open | 404777-405019 | _na 80_aa | RNA-binding protein (KH domain) | |
| 391 | CABKQH010000001.1 | GCA902374575_00394 | CDS | open | 405019-405246 | _na 75_aa | rpsP | 30S ribosomal protein S16 |
| 392 | CABKQH010000001.1 | GCA902374575_00395 | CDS | open | 405318-406658 | _na 446_aa | ffh | signal recognition particle protein |
| 393 | CABKQH010000001.1 | GCA902374575_00396 | CDS | open | 406721-407479 | _na 252_aa | RNA pseudouridylate synthase | |
| 394 | CABKQH010000001.1 | GCA902374575_00397 | CDS | open | 407476-408651 | _na 391_aa | waaA | lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase |
| 395 | CABKQH010000001.1 | GCA902374575_00398 | CDS | open | 408620-408817 | _na 65_aa | C4-type zinc ribbon domain-containing protein | |
| 396 | CABKQH010000001.1 | GCA902374575_00399 | CDS | open | 409041-409328 | _na 95_aa | hypothetical protein | |
| 397 | CABKQH010000001.1 | GCA902374575_00400 | CDS | open | 409346-410068 | _na 240_aa | Nif3-like dinuclear metal center hexameric protein | |
| 398 | CABKQH010000001.1 | GCA902374575_00401 | CDS | open | 410075-410935 | _na 286_aa | glyQ | glycine--tRNA ligase subunit alpha |
| 399 | CABKQH010000001.1 | GCA902374575_00402 | CDS | open | 410946-411362 | _na 138_aa | Bacterial transcription activator effector binding domain-containing protein | |
| 400 | CABKQH010000001.1 | GCA902374575_00403 | CDS | open | 411366-411839 | _na 157_aa | DUF3972 domain-containing protein | |
| 401 | CABKQH010000001.1 | GCA902374575_00404 | CDS | open | 411851-412345 | _na 164_aa | N5-carboxyaminoimidazole ribonucleotide mutase | |
| 402 | CABKQH010000001.1 | GCA902374575_00405 | CDS | open | 412342-413601 | _na 419_aa | Peptidase family U32 C-terminal domain-containing protein | |
| 403 | CABKQH010000001.1 | GCA902374575_00406 | CDS | open | 413601-414350 | _na 249_aa | Chemotaxis protein | |
| 404 | CABKQH010000001.1 | GCA902374575_00407 | CDS | open | 414488-415267 | _na 259_aa | Histidinol-phosphatase | |
| 405 | CABKQH010000001.1 | GCA902374575_00408 | CDS | open | 415354-416784 | _na 476_aa | glnA | type I glutamate--ammonia ligase |
| 406 | CABKQH010000001.1 | GCA902374575_00409 | CDS | open | 417606-419270 | _na 554_aa | DNA polymerase III subunit gamma/tau | |
| 407 | CABKQH010000001.1 | GCA902374575_00410 | CDS | open | 419388-419990 | _na 200_aa | L-lysine exporter | |
| 408 | CABKQH010000001.1 | GCA902374575_00411 | CDS | open | 419884-420201 | _na 105_aa | ccoS | cbb3-type cytochrome oxidase assembly protein CcoS |
| 409 | CABKQH010000001.1 | GCA902374575_00412 | CDS | open | 420201-422579 | _na 792_aa | Copper-transporting ATPase | |
| 410 | CABKQH010000001.1 | GCA902374575_00413 | CDS | open | 422576-423196 | _na 206_aa | PAC domain-containing protein | |
| 411 | CABKQH010000001.1 | GCA902374575_00414 | CDS | open | 423344-423727 | _na 127_aa | ridA | Enamine deaminase RidA |
| 412 | CABKQH010000001.1 | GCA902374575_00415 | CDS | open | 423748-424833 | _na 361_aa | Threonine synthase | |
| 413 | CABKQH010000001.1 | GCA902374575_00416 | CDS | open | 424997-426340 | _na 447_aa | rho | transcription termination factor Rho |
| 414 | CABKQH010000001.1 | GCA902374575_00417 | CDS | open | 426471-426683 | _na 70_aa | Transcriptional regulator | |
| 415 | CABKQH010000001.1 | GCA902374575_00418 | CDS | open | 426842-427441 | _na 199_aa | Outer membrane protein beta-barrel domain-containing protein | |
| 416 | CABKQH010000001.1 | GCA902374575_00419 | CDS | open | 427496-427975 | _na 159_aa | N-acetyltransferase domain-containing protein | |
| 417 | CABKQH010000001.1 | GCA902374575_00420 | CDS | open | 427975-429078 | _na 367_aa | nusA | Transcription termination/antitermination protein NusA |
| 418 | CABKQH010000001.1 | GCA902374575_00421 | CDS | open | 429251-429493 | _na 80_aa | HP0268 domain-containing protein | |
| 419 | CABKQH010000001.1 | GCA902374575_00422 | CDS | open | 429493-430794 | _na 433_aa | miaB | tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB |
| 420 | CABKQH010000001.1 | GCA902374575_00423 | CDS | open | 430775-431554 | _na 259_aa | DUF374 domain-containing protein | |
| 421 | CABKQH010000001.1 | GCA902374575_00424 | CDS | open | 431544-431990 | _na 148_aa | Tetratricopeptide repeat protein | |
| 422 | CABKQH010000001.1 | GCA902374575_00425 | CDS | open | 432051-433055 | _na 334_aa | Clan AA aspartic protease | |
| 423 | CABKQH010000001.1 | GCA902374575_00426 | CDS | open | 433052-433573 | _na 173_aa | pilN | Pilus assembly protein PilN |
| 424 | CABKQH010000001.1 | GCA902374575_00427 | CDS | open | 433566-434102 | _na 178_aa | Transformation system protein | |
| 425 | CABKQH010000001.1 | GCA902374575_00428 | CDS | open | 434107-434784 | _na 225_aa | hypothetical protein | |
| 426 | CABKQH010000001.1 | GCA902374575_00429 | CDS | open | 435140-436012 | _na 290_aa | MBOAT family protein | |
| 427 | CABKQH010000001.1 | GCA902374575_00430 | CDS | open | 436100-436363 | _na 87_aa | hypothetical protein | |
| 428 | CABKQH010000001.1 | GCA902374575_00431 | CDS | open | 436526-437149 | _na 207_aa | beta-lactamase | |
| 429 | CABKQH010000001.1 | GCA902374575_00432 | CDS | open | 437162-437821 | _na 219_aa | beta-lactamase | |
| 430 | CABKQH010000001.1 | GCA902374575_00433 | CDS | open | 437832-439172 | _na 446_aa | Dihydrolipoamide dehydrogenase | |
| 431 | CABKQH010000001.1 | GCA902374575_00434 | CDS | open | 439169-439486 | _na 105_aa | Type II secretion system protein | |
| 432 | CABKQH010000001.1 | GCA902374575_00435 | CDS | open | 439564-440115 | _na 183_aa | beta-lactamase | |
| 433 | CABKQH010000001.1 | GCA902374575_00436 | CDS | open | 440137-441237 | _na 366_aa | prfB | peptide chain release factor 2 |
| 434 | CABKQH010000001.1 | GCA902374575_00437 | CDS | open | 441358-442179 | _na 273_aa | panC | pantoate--beta-alanine ligase |
| 435 | CABKQH010000001.1 | GCA902374575_00438 | CDS | open | 442182-443492 | _na 436_aa | rimO | 30S ribosomal protein S12 methylthiotransferase RimO |
| 436 | CABKQH010000001.1 | GCA902374575_00439 | CDS | open | 443489-444481 | _na 330_aa | tRNA(Ile)-lysidine synthase | |
| 437 | CABKQH010000001.1 | GCA902374575_00440 | CDS | open | 445456-445851 | _na 131_aa | sseB | SseB protein N-terminal domain-containing protein |
| 438 | CABKQH010000001.1 | GCA902374575_00441 | CDS | open | 445853-446422 | _na 189_aa | gmhA | D-sedoheptulose 7-phosphate isomerase |
| 439 | CABKQH010000001.1 | GCA902374575_00442 | CDS | open | 446397-447815 | _na 472_aa | hldE | Bifunctional protein HldE |
| 440 | CABKQH010000001.1 | GCA902374575_00443 | CDS | open | 447808-448797 | _na 329_aa | rfaD | ADP-glyceromanno-heptose 6-epimerase |
| 441 | CABKQH010000001.1 | GCA902374575_00444 | CDS | open | 448794-449309 | _na 171_aa | gmhB | D-glycero-beta-D-manno-heptose 1%2C7-bisphosphate 7-phosphatase |
| 442 | CABKQH010000001.1 | GCA902374575_00445 | CDS | open | 449402-449704 | _na 100_aa | Cytochrome C553 (Soluble cytochrome f) | |
| 443 | CABKQH010000001.1 | GCA902374575_00446 | CDS | open | 450206-450757 | _na 183_aa | epsC | serine O-acetyltransferase EpsC |
| 444 | CABKQH010000001.1 | GCA902374575_00447 | CDS | open | 450760-451665 | _na 301_aa | cysK | cysteine synthase A |
| 445 | CABKQH010000001.1 | GCA902374575_00448 | CDS | open | 451759-452427 | _na 222_aa | Endonuclease III | |
| 446 | CABKQH010000001.1 | GCA902374575_00449 | CDS | open | 452424-453188 | _na 254_aa | AAA+ ATPase domain-containing protein | |
| 447 | CABKQH010000001.1 | GCA902374575_00450 | CDS | open | 453185-456130 | _na 981_aa | mfd | transcription-repair coupling factor |
| 448 | CABKQH010000001.1 | GCA902374575_00451 | CDS | open | 456111-457313 | _na 400_aa | tetrahydrofolate synthase | |
| 449 | CABKQH010000001.1 | GCA902374575_00452 | CDS | open | 457310-458884 | _na 524_aa | GGDEF domain-containing protein | |
| 450 | CABKQH010000001.1 | GCA902374575_00453 | CDS | open | 458865-459404 | _na 179_aa | Lipoprotein | |
| 451 | CABKQH010000001.1 | GCA902374575_00454 | CDS | open | 459408-461873 | _na 821_aa | leuS | leucine--tRNA ligase |
| 452 | CABKQH010000001.1 | GCA902374575_00455 | CDS | open | 461882-462220 | _na 112_aa | macA | MacA |
| 453 | CABKQH010000001.1 | GCA902374575_00456 | CDS | open | 462230-463201 | _na 323_aa | secF | Protein-export membrane protein SecF |
| 454 | CABKQH010000001.1 | GCA902374575_00457 | CDS | open | 463204-464784 | _na 526_aa | secD | Protein translocase subunit SecD |
| 455 | CABKQH010000001.1 | GCA902374575_00458 | CDS | open | 464784-465056 | _na 90_aa | yajC | preprotein translocase subunit YajC |
| 456 | CABKQH010000001.1 | GCA902374575_00459 | CDS | open | 465161-466324 | _na 387_aa | apolipoprotein N-acyltransferase | |
| 457 | CABKQH010000001.1 | GCA902374575_00460 | CDS | open | 466366-467571 | _na 401_aa | metK | methionine adenosyltransferase |
| 458 | CABKQH010000001.1 | GCA902374575_00461 | CDS | open | 467710-469077 | _na 455_aa | sstT | serine/threonine transporter SstT |
| 459 | CABKQH010000001.1 | GCA902374575_00462 | CDS | open | 469164-470885 | _na 573_aa | Oligoendopeptidase F | |
| 460 | CABKQH010000001.1 | GCA902374575_00463 | CDS | open | 470887-471336 | _na 149_aa | Stringent starvation protein B | |
| 461 | CABKQH010000001.1 | GCA902374575_00464 | CDS | open | 471388-473457 | _na 689_aa | DNA 3'-5' helicase | |
| 462 | CABKQH010000001.1 | GCA902374575_00465 | CDS | open | 473454-474275 | _na 273_aa | truB | tRNA pseudouridine(55) synthase TruB |
| 463 | CABKQH010000001.1 | GCA902374575_00466 | CDS | open | 474269-474499 | _na 76_aa | csrA | carbon storage regulator CsrA |
| 464 | CABKQH010000001.1 | GCA902374575_00467 | CDS | open | 474496-475239 | _na 247_aa | 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase | |
| 465 | CABKQH010000001.1 | GCA902374575_00468 | CDS | open | 475251-475706 | _na 151_aa | smpB | SsrA-binding protein SmpB |
| 466 | CABKQH010000001.1 | GCA902374575_00469 | CDS | open | 475715-476311 | _na 198_aa | Thioredoxin domain-containing protein | |
| 467 | CABKQH010000001.1 | GCA902374575_00470 | CDS | open | 476374-476808 | _na 144_aa | flgB | flagellar basal body rod protein FlgB |
| 468 | CABKQH010000001.1 | GCA902374575_00471 | CDS | open | 476817-477317 | _na 166_aa | flgC | flagellar basal body rod protein FlgC |
| 469 | CABKQH010000001.1 | GCA902374575_00472 | CDS | open | 477317-477610 | _na 97_aa | fliE | flagellar hook-basal body complex protein FliE |
| 470 | CABKQH010000001.1 | GCA902374575_00473 | CDS | open | 477619-479451 | _na 610_aa | ftsI | Cell division protein FtsI / penicillin-binding protein |
| 471 | CABKQH010000001.1 | GCA902374575_00474 | CDS | open | 479540-480001 | _na 153_aa | Response regulator | |
| 472 | CABKQH010000001.1 | GCA902374575_00475 | CDS | open | 480049-481002 | _na 317_aa | hemH | ferrochelatase |
| 473 | CABKQH010000001.1 | GCA902374575_00476 | CDS | open | 481002-481871 | _na 289_aa | Gfo/Idh/MocA-like oxidoreductase N-terminal domain-containing protein | |
| 474 | CABKQH010000001.1 | GCA902374575_00477 | CDS | open | 482042-484600 | _na 852_aa | alaS | alanine--tRNA ligase |
| 475 | CABKQH010000001.1 | GCA902374575_00478 | CDS | open | 484597-485097 | _na 166_aa | 3-isopropylmalate dehydratase small subunit | |
| 476 | CABKQH010000001.1 | GCA902374575_00479 | CDS | open | 485094-485636 | _na 180_aa | maf | septum formation inhibitor Maf |
| 477 | CABKQH010000001.1 | GCA902374575_00480 | CDS | open | 485633-487561 | _na 642_aa | peptidoglycan glycosyltransferase | |
| 478 | CABKQH010000001.1 | GCA902374575_00481 | CDS | open | 487570-487884 | _na 104_aa | Late competence protein ComEA%2C DNA receptor | |
| 479 | CABKQH010000001.1 | GCA902374575_00482 | CDS | open | 487942-489516 | _na 524_aa | Phosphoethanolamine transferase | |
| 480 | CABKQH010000001.1 | GCA902374575_00483 | CDS | open | 489559-491577 | _na 672_aa | Glycine--tRNA ligase beta subunit | |
| 481 | CABKQH010000001.1 | GCA902374575_00484 | CDS | open | 491574-491729 | _na 51_aa | Small hydrophobic protein | |
| 482 | CABKQH010000001.1 | GCA902374575_00485 | CDS | open | 491730-493133 | _na 467_aa | Endonuclease/exonuclease/phosphatase domain-containing protein | |
| 483 | CABKQH010000001.1 | GCA902374575_00486 | CDS | open | 493130-493609 | _na 159_aa | Putative tRNA (cytidine(34)-2'-O)-methyltransferase | |
| 484 | CABKQH010000001.1 | GCA902374575_00487 | CDS | open | 493684-494856 | _na 390_aa | Multifunctional tRNA nucleotidyl transferase / 2'3'-cyclic phosphodiesterase / 2' nucleotidase/phosphatase | |
| 485 | CABKQH010000001.1 | GCA902374575_00488 | CDS | open | 494816-495241 | _na 141_aa | Campylobacter invasion antigen D C-terminal domain-containing protein | |
| 486 | CABKQH010000001.1 | GCA902374575_00489 | CDS | open | 495238-495483 | _na 81_aa | Tetratricopeptide repeat protein | |
| 487 | CABKQH010000001.1 | GCA902374575_00490 | CDS | open | 495480-496547 | _na 355_aa | leuB | 3-isopropylmalate dehydrogenase |
| 488 | CABKQH010000001.1 | GCA902374575_00491 | CDS | open | 496557-497042 | _na 161_aa | 3-isopropylmalate dehydratase small subunit | |
| 489 | CABKQH010000001.1 | GCA902374575_00492 | CDS | open | 497323-498177 | _na 284_aa | Sugar-binding protein | |
| 490 | CABKQH010000001.1 | GCA902374575_00493 | CDS | open | 498326-499219 | _na 297_aa | DUF4299 domain-containing protein | |
| 491 | CABKQH010000001.1 | GCA902374575_00494 | CDS | open | 499237-499596 | _na 119_aa | drsE | Putative DrsE domain protein |
| 492 | CABKQH010000001.1 | GCA902374575_00495 | CDS | open | 499670-500269 | _na 199_aa | Homoserine/Threonine efflux protein | |
| 493 | CABKQH010000001.1 | GCA902374575_00496 | CDS | open | 500711-501202 | _na 163_aa | DUF1877 domain-containing protein | |
| 494 | CABKQH010000001.1 | GCA902374575_00497 | CDS | open | 501286-502332 | _na 348_aa | Asparaginase II | |
| 495 | CABKQH010000001.1 | GCA902374575_00498 | CDS | open | 502418-502753 | _na 111_aa | azlD | Branched-chain amino acid transporter AzlD |
| 496 | CABKQH010000001.1 | GCA902374575_00499 | CDS | open | 502750-503412 | _na 220_aa | Branched-chain amino acid transport protein | |
| 497 | CABKQH010000001.1 | GCA902374575_00500 | CDS | open | 503562-504521 | _na 319_aa | beta-lactamase | |
| 498 | CABKQH010000001.1 | GCA902374575_00501 | CDS | open | 504531-504971 | _na 146_aa | Beta-lactamase | |
| 499 | CABKQH010000001.1 | GCA902374575_00502 | CDS | open | 505072-505863 | _na 263_aa | beta-lactamase | |
| 500 | CABKQH010000001.1 | GCA902374575_00503 | CDS | open | 505898-506677 | _na 259_aa | beta-lactamase |

