HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Campylobacter concisus clade-433 (GCA_902460465.1)

Select a Genome:
BAKTA Annotations for GCA_902460465.1
Genome Selected: Campylobacter concisus clade-433
ContigsBases CDSrRNA tmRNAtRNA
52 2145119 2014 5 1 42
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4135 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:9]    |    Number of Records Found: 4135 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
4001 CABPUA010000013.1 GCA902460465_02002 CDS open 4021-4443 _na     140_aa C_GCAxxG_C_C family protein
4002 CABPUA010000013.1 GCA902460465_02003 CDS open 4443-5831 _na     462_aa Sodium-solute symporter
4003 CABPUA010000013.1 GCA902460465_02004 CDS open 5828-6748 _na     306_aa Calcineurin-like phosphoesterase domain-containing protein
4004 CABPUA010000013.1 GCA902460465_02005 CDS open 6783-7490 _na     235_aa Phage shock protein E
4005 CABPUA010000013.1 GCA902460465_01997 gene open 109-819
4006 CABPUA010000013.1 GCA902460465_01998 gene open 797-1459
4007 CABPUA010000013.1 GCA902460465_01999 gene open 1428-2132
4008 CABPUA010000013.1 GCA902460465_02000 gene open 2110-3072
4009 CABPUA010000013.1 GCA902460465_02001 gene open 3069-4004 arsS
4010 CABPUA010000013.1 GCA902460465_02002 gene open 4021-4443
4011 CABPUA010000013.1 GCA902460465_02003 gene open 4443-5831
4012 CABPUA010000013.1 GCA902460465_02004 gene open 5828-6748
4013 CABPUA010000013.1 GCA902460465_02005 gene open 6783-7490
4014 CABPUA010000014.1 GCA902460465_02006 CDS open 161-997 _na     278_aa CRISPR system precrRNA processing endoribonuclease RAMP protein Cas6
4015 CABPUA010000014.1 GCA902460465_02007 CDS open 984-2492 _na     502_aa cas10 type III-A CRISPR-associated protein Cas10/Csm1
4016 CABPUA010000014.1 GCA902460465_02008 CDS open 2489-2899 _na     136_aa CRISPR system Cms protein Csm2
4017 CABPUA010000014.1 GCA902460465_02009 CDS open 2909-3547 _na     212_aa csm3 type III-A CRISPR-associated RAMP protein Csm3
4018 CABPUA010000014.1 GCA902460465_02010 CDS open 3547-4434 _na     295_aa csm4 type III-A CRISPR-associated RAMP protein Csm4
4019 CABPUA010000014.1 GCA902460465_02011 CDS open 4424-5461 _na     345_aa CRISPR system Cms protein Csm5
4020 CABPUA010000014.1 GCA902460465_02012 CDS open 10818-11693 _na     291_aa Putative transcriptional regulator
4021 CABPUA010000014.1 GCA902460465_02013 CDS open 11800-12402 _na     200_aa ftsZ Cell division protein FtsZ
4022 CABPUA010000014.1 GCA902460465_02006 gene open 161-997
4023 CABPUA010000014.1 GCA902460465_02007 gene open 984-2492 cas10
4024 CABPUA010000014.1 GCA902460465_02008 gene open 2489-2899
4025 CABPUA010000014.1 GCA902460465_02009 gene open 2909-3547 csm3
4026 CABPUA010000014.1 GCA902460465_02010 gene open 3547-4434 csm4
4027 CABPUA010000014.1 GCA902460465_02011 gene open 4424-5461
4028 CABPUA010000014.1 GCA902460465_02012 gene open 10818-11693
4029 CABPUA010000014.1 GCA902460465_02013 gene open 11800-12402 ftsZ
4030 CABPUA010000015.1 repeat_region open 2322-3056 CRISPR array with 10 repeats of length 33%2C consensus sequence GATACAAATTTCCCCGATCTAGGGGATTGAAAC and spacer length 44
4031 CABPUA010000015.1 GCA902460465_02014 CDS open 362-1174 _na     270_aa CRISPR-associated protein Cas6 C-terminal domain-containing protein
4032 CABPUA010000015.1 GCA902460465_02015 CDS open 1235-2191 _na     318_aa Reverse transcriptase domain-containing protein
4033 CABPUA010000015.1 GCA902460465_02016 CDS open 3227-3895 _na     222_aa Outer membrane protein beta-barrel domain-containing protein
4034 CABPUA010000015.1 GCA902460465_02017 CDS open 4045-4839 _na     264_aa CRISPR-associated protein
4035 CABPUA010000015.1 GCA902460465_02014 gene open 362-1174
4036 CABPUA010000015.1 GCA902460465_02015 gene open 1235-2191
4037 CABPUA010000015.1 GCA902460465_02016 gene open 3227-3895
4038 CABPUA010000015.1 GCA902460465_02017 gene open 4045-4839
4039 CABPUA010000016.1 GCA902460465_02018 CDS open 122-2029 _na     635_aa asnB asparagine synthase (glutamine-hydrolyzing)
4040 CABPUA010000016.1 GCA902460465_02019 CDS open 2036-3709 _na     557_aa asnB asparagine synthase (glutamine-hydrolyzing)
4041 CABPUA010000016.1 GCA902460465_02018 gene open 122-2029 asnB
4042 CABPUA010000016.1 GCA902460465_02019 gene open 2036-3709 asnB
4043 CABPUA010000017.1 GCA902460465_02020 CDS open 198-1301 _na     367_aa HP0729 family protein
4044 CABPUA010000017.1 GCA902460465_02021 CDS open 1313-1522 _na     69_aa hypothetical protein
4045 CABPUA010000017.1 GCA902460465_02022 CDS open 1616-1753 _na     45_aa hypothetical protein
4046 CABPUA010000017.1 GCA902460465_02023 CDS open 2027-2413 _na     128_aa hypothetical protein
4047 CABPUA010000017.1 GCA902460465_02024 CDS open 2508-3083 _na     191_aa DUF4359 domain-containing protein
4048 CABPUA010000017.1 GCA902460465_02020 gene open 198-1301
4049 CABPUA010000017.1 GCA902460465_02021 gene open 1313-1522
4050 CABPUA010000017.1 GCA902460465_02022 gene open 1616-1753
4051 CABPUA010000017.1 GCA902460465_02023 gene open 2027-2413
4052 CABPUA010000017.1 GCA902460465_02024 gene open 2508-3083
4053 CABPUA010000018.1 GCA902460465_02025 CDS open 207-482 _na     91_aa cas2 CRISPR-associated endonuclease Cas2
4054 CABPUA010000018.1 GCA902460465_02026 CDS open 482-2716 _na     744_aa cas1 CRISPR-associated endonuclease Cas1
4055 CABPUA010000018.1 GCA902460465_02025 gene open 207-482 cas2
4056 CABPUA010000018.1 GCA902460465_02026 gene open 482-2716 cas1
4057 CABPUA010000019.1 GCA902460465_02027 CDS open 118-444 _na     108_aa hypothetical protein
4058 CABPUA010000019.1 GCA902460465_02028 CDS open 520-1140 _na     206_aa DUF4433 domain-containing protein
4059 CABPUA010000019.1 GCA902460465_02029 CDS open 1150-1833 _na     227_aa Macro domain-containing protein
4060 CABPUA010000019.1 GCA902460465_02030 CDS open 1830-2789 _na     319_aa WYL domain-containing protein
4061 CABPUA010000019.1 GCA902460465_02027 gene open 118-444
4062 CABPUA010000019.1 GCA902460465_02028 gene open 520-1140
4063 CABPUA010000019.1 GCA902460465_02029 gene open 1150-1833
4064 CABPUA010000019.1 GCA902460465_02030 gene open 1830-2789
4065 CABPUA010000020.1 GCA902460465_02031 CDS open 120-758 _na     212_aa 4Fe-4S ferredoxin-type domain-containing protein
4066 CABPUA010000020.1 GCA902460465_02032 CDS open 758-1135 _na     125_aa Iron ABC transporter permease
4067 CABPUA010000020.1 GCA902460465_02031 gene open 120-758
4068 CABPUA010000020.1 GCA902460465_02032 gene open 758-1135
4069 CABPUA010000021.1 GCA902460465_02033 CDS open 66-860 _na     264_aa restriction endonuclease subunit S
4070 CABPUA010000021.1 GCA902460465_02034 CDS open 862-1665 _na     267_aa Site-specific recombinase%2C phage integrase family
4071 CABPUA010000021.1 GCA902460465_02035 CDS open 1696-2088 _na     130_aa restriction endonuclease subunit S
4072 CABPUA010000021.1 GCA902460465_02033 gene open 66-860
4073 CABPUA010000021.1 GCA902460465_02034 gene open 862-1665
4074 CABPUA010000021.1 GCA902460465_02035 gene open 1696-2088
4075 CABPUA010000022.1 GCA902460465_02036 CDS open 864-1469 _na     201_aa tRNA 2-selenouridine synthase
4076 CABPUA010000022.1 GCA902460465_02036 gene open 864-1469
4077 CABPUA010000023.1 GCA902460465_02037 CDS open 201-605 _na     134_aa hypothetical protein
4078 CABPUA010000023.1 GCA902460465_02038 CDS open 620-775 _na     51_aa Diadenosine tetraphosphate hydrolase
4079 CABPUA010000023.1 GCA902460465_02039 CDS open 772-1365 _na     197_aa tRNA 2-selenouridine synthase
4080 CABPUA010000023.1 GCA902460465_02037 gene open 201-605
4081 CABPUA010000023.1 GCA902460465_02038 gene open 620-775
4082 CABPUA010000023.1 GCA902460465_02039 gene open 772-1365
4083 CABPUA010000024.1 repeat_region open 4-1570 CRISPR array with 21 repeats of length 37%2C consensus sequence ATTTAAACAAATTTGACCCGATCAAGGGGATTGAAAC and spacer length 37
4084 CABPUA010000025.1 GCA902460465_02040 CDS open 240-1655 _na     471_aa Recombinase
4085 CABPUA010000025.1 GCA902460465_02040 gene open 240-1655
4086 CABPUA010000026.1 GCA902460465_02041 CDS open 52-1578 _na     508_aa carbamoyltransferase C-terminal domain-containing protein
4087 CABPUA010000026.1 GCA902460465_02041 gene open 52-1578
4088 CABPUA010000028.1 GCA902460465_02042 CDS open 3-1223 _na     406_aa 2-aminoethylphosphonate aminotransferase
4089 CABPUA010000028.1 GCA902460465_02042 gene open 3-1223
4090 CABPUA010000029.1 GCA902460465_02043 CDS open 108-263 _na     51_aa Diadenosine tetraphosphate hydrolase
4091 CABPUA010000029.1 GCA902460465_02044 CDS open 260-910 _na     216_aa tRNA 2-selenouridine synthase
4092 CABPUA010000029.1 GCA902460465_02043 gene open 108-263
4093 CABPUA010000029.1 GCA902460465_02044 gene open 260-910
4094 CABPUA010000030.1 GCA902460465_02045 CDS open 59-853 _na     264_aa glycosyltransferase
4095 CABPUA010000030.1 GCA902460465_02045 gene open 59-853
4096 CABPUA010000031.1 GCA902460465_02046 CDS open 46-537 _na     163_aa hypothetical protein
4097 CABPUA010000031.1 GCA902460465_02046 gene open 46-537
4098 CABPUA010000032.1 GCA902460465_02047 CDS open 484-1098 _na     204_aa tRNA 2-selenouridine synthase
4099 CABPUA010000032.1 GCA902460465_02048 CDS open 1098-1253 _na     51_aa Diadenosine tetraphosphate hydrolase
4100 CABPUA010000032.1 GCA902460465_02047 gene open 484-1098
4101 CABPUA010000032.1 GCA902460465_02048 gene open 1098-1253
4102 CABPUA010000034.1 GCA902460465_02049 CDS open 52-366 _na     104_aa csx20 CRISPR-associated protein Csx20
4103 CABPUA010000034.1 GCA902460465_02049 gene open 52-366 csx20
4104 CABPUA010000035.1 GCA902460465_02050 gene open 106-224 rrf
4105 CABPUA010000035.1 GCA902460465_02050 rRNA open 106-224 rrf 5S ribosomal RNA
4106 CABPUA010000036.1 GCA902460465_02051 CDS open 545-700 _na     51_aa Diadenosine tetraphosphate hydrolase
4107 CABPUA010000036.1 GCA902460465_02052 CDS open 703-1299 _na     198_aa tRNA 2-selenouridine synthase
4108 CABPUA010000036.1 GCA902460465_02051 gene open 545-700
4109 CABPUA010000036.1 GCA902460465_02052 gene open 703-1299
4110 CABPUA010000037.1 GCA902460465_02053 CDS open 22-669 _na     215_aa glycosyltransferase family 2 protein
4111 CABPUA010000037.1 GCA902460465_02053 gene open 22-669
4112 CABPUA010000038.1 GCA902460465_02054 CDS open 127-888 _na     253_aa Putative polysaccharide biosynthesis protein
4113 CABPUA010000038.1 GCA902460465_02054 gene open 127-888
4114 CABPUA010000040.1 GCA902460465_02055 CDS open 610-1005 _na     131_aa hypothetical protein
4115 CABPUA010000040.1 GCA902460465_02055 gene open 610-1005
4116 CABPUA010000041.1 GCA902460465_02056 CDS open 70-675 _na     201_aa glycosyltransferase family 10 domain-containing protein
4117 CABPUA010000041.1 GCA902460465_02057 CDS open 668-883 _na     71_aa hypothetical protein
4118 CABPUA010000041.1 GCA902460465_02056 gene open 70-675
4119 CABPUA010000041.1 GCA902460465_02057 gene open 668-883
4120 CABPUA010000042.1 GCA902460465_02058 CDS open 1-630 _na     209_aa tRNA 2-selenouridine synthase
4121 CABPUA010000042.1 GCA902460465_02059 CDS open 633-791 _na     52_aa Diadenosine tetraphosphate hydrolase
4122 CABPUA010000042.1 GCA902460465_02058 gene open 1-630
4123 CABPUA010000042.1 GCA902460465_02059 gene open 633-791
4124 CABPUA010000043.1 GCA902460465_02060 CDS open 524-988 _na     154_aa hypothetical protein
4125 CABPUA010000043.1 GCA902460465_02060 gene open 524-988
4126 CABPUA010000046.1 GCA902460465_02061 CDS open 170-844 _na     224_aa Cell surface protein
4127 CABPUA010000046.1 GCA902460465_02061 gene open 170-844
4128 CABPUA010000047.1 GCA902460465_02062 CDS open 38-469 _na     143_aa hypothetical protein
4129 CABPUA010000047.1 GCA902460465_02062 gene open 38-469
4130 CABPUA010000048.1 GCA902460465_02063 CDS open 307-672 _na     121_aa hypothetical protein
4131 CABPUA010000048.1 GCA902460465_02063 gene open 307-672
4132 CABPUA010000050.1 GCA902460465_02064 CDS open 54-248 _na     64_aa hypothetical protein
4133 CABPUA010000050.1 GCA902460465_02064 gene open 54-248
4134 CABPUA010000051.1 GCA902460465_02065 CDS open 173-514 _na     113_aa transcriptional repressor
4135 CABPUA010000051.1 GCA902460465_02065 gene open 173-514