HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Campylobacter concisus clade-433 (GCA_902460675.1)

Select a Genome:
BAKTA Annotations for GCA_902460675.1
Genome Selected: Campylobacter concisus clade-433
ContigsBases CDSrRNA tmRNAtRNA
7 2051300 1972 4 1 43
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4049 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:1]    |    Number of Records Found: 4049 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1 CABPUQ010000001.1 GCA902460675_01597 gene open 1638461-1638819 ssrA
2 CABPUQ010000001.1 GCA902460675_01597 tmRNA open 1638461-1638819 ssrA transfer-messenger RNA%2C SsrA
3 CABPUQ010000001.1 rep_origin open 421801-421928
4 CABPUQ010000001.1 GCA902460675_00397 gene open 401140-401265 HPnc0260
5 CABPUQ010000001.1 GCA902460675_00416 gene open 414910-415007 Bacteria_small_SRP
6 CABPUQ010000001.1 GCA902460675_00888 gene open 922200-922526 RNaseP_bact_a
7 CABPUQ010000001.1 GCA902460675_01273 gene open 1322964-1323082 rrf
8 CABPUQ010000001.1 GCA902460675_01274 gene open 1323215-1326118 rrl
9 CABPUQ010000001.1 GCA902460675_01277 gene open 1326703-1328213 rrs
10 CABPUQ010000001.1 GCA902460675_00397 ncRNA open 401140-401265 Bacterial antisense RNA HPnc0260
11 CABPUQ010000001.1 GCA902460675_00416 ncRNA open 414910-415007 Bacterial small signal recognition particle RNA
12 CABPUQ010000001.1 GCA902460675_00888 ncRNA open 922200-922526 Bacterial RNase P class A
13 CABPUQ010000001.1 regulatory_region open 1745874-1746002 purD RNA motif
14 CABPUQ010000001.1 GCA902460675_01273 rRNA open 1322964-1323082 rrf 5S ribosomal RNA
15 CABPUQ010000001.1 GCA902460675_01274 rRNA open 1323215-1326118 rrl 23S ribosomal RNA
16 CABPUQ010000001.1 GCA902460675_01277 rRNA open 1326703-1328213 rrs 16S ribosomal RNA
17 CABPUQ010000001.1 repeat_region open 1389491-1390258 CRISPR array with 12 repeats of length 30%2C consensus sequence ATTAGAATTTACTCCGTTGGAGTTTGAAAC and spacer length 36
18 CABPUQ010000001.1 GCA902460675_00001 CDS open 697-1740 _na     347_aa Putative poly(Beta-D-mannuronate) O-acetylase
19 CABPUQ010000001.1 GCA902460675_00002 CDS open 1709-2155 _na     148_aa MBOAT family protein
20 CABPUQ010000001.1 GCA902460675_00003 CDS open 2145-3464 _na     439_aa DUF7033 domain-containing protein
21 CABPUQ010000001.1 GCA902460675_00004 CDS open 3457-5337 _na     626_aa asnB asparagine synthase (glutamine-hydrolyzing)
22 CABPUQ010000001.1 GCA902460675_00005 CDS open 5373-6158 _na     261_aa glycosyltransferase family 2 protein
23 CABPUQ010000001.1 GCA902460675_00006 CDS open 6180-7274 _na     364_aa DegT/DnrJ/EryC1/StrS family aminotransferase
24 CABPUQ010000001.1 GCA902460675_00007 CDS open 7278-7853 _na     191_aa N-acetyltransferase
25 CABPUQ010000001.1 GCA902460675_00008 CDS open 7853-8818 _na     321_aa Gfo/Idh/MocA family oxidoreductase
26 CABPUQ010000001.1 GCA902460675_00009 CDS open 8853-10436 _na     527_aa argS arginine--tRNA ligase
27 CABPUQ010000001.1 GCA902460675_00010 CDS open 10446-10667 _na     73_aa tatA Sec-independent protein translocase protein TatA
28 CABPUQ010000001.1 GCA902460675_00011 CDS open 10719-11330 _na     203_aa gmk guanylate kinase
29 CABPUQ010000001.1 GCA902460675_00012 CDS open 11331-12899 _na     522_aa Highly acidic protein
30 CABPUQ010000001.1 GCA902460675_00013 CDS open 12956-13717 _na     253_aa fliR flagellar biosynthetic protein FliR
31 CABPUQ010000001.1 GCA902460675_00014 CDS open 13807-14451 _na     214_aa ABC transporter%2C ATP-binding protein
32 CABPUQ010000001.1 GCA902460675_00015 CDS open 14451-15515 _na     354_aa tsf translation elongation factor Ts
33 CABPUQ010000001.1 GCA902460675_00016 CDS open 15515-16303 _na     262_aa rpsB 30S ribosomal protein S2
34 CABPUQ010000001.1 GCA902460675_00017 CDS open 16494-17633 _na     379_aa iadA beta-aspartyl-peptidase
35 CABPUQ010000001.1 GCA902460675_00018 CDS open 17644-17853 _na     69_aa PARP alpha-helical domain-containing protein
36 CABPUQ010000001.1 GCA902460675_00019 CDS open 17843-18562 _na     239_aa pgeF peptidoglycan editing factor PgeF
37 CABPUQ010000001.1 GCA902460675_00020 CDS open 18573-19187 _na     204_aa riboflavin synthase
38 CABPUQ010000001.1 GCA902460675_00021 CDS open 19792-20634 _na     280_aa Peptide methionine sulfoxide reductase
39 CABPUQ010000001.1 GCA902460675_00022 CDS open 20647-21501 _na     284_aa Colicin E2 tolerance protein CbrC-like protein
40 CABPUQ010000001.1 GCA902460675_00023 CDS open 21704-22639 _na     311_aa accA acetyl-CoA carboxylase carboxyl transferase subunit alpha
41 CABPUQ010000001.1 GCA902460675_00024 CDS open 22641-23852 _na     403_aa beta-ketoacyl-ACP synthase II
42 CABPUQ010000001.1 GCA902460675_00025 CDS open 23887-24120 _na     77_aa acpP acyl carrier protein
43 CABPUQ010000001.1 GCA902460675_00026 CDS open 24207-24950 _na     247_aa fabG 3-oxoacyl-ACP reductase FabG
44 CABPUQ010000001.1 GCA902460675_00027 CDS open 24987-26450 _na     487_aa gpmI 2%2C3-bisphosphoglycerate-independent phosphoglycerate mutase
45 CABPUQ010000001.1 GCA902460675_00028 CDS open 26530-27594 _na     354_aa mraY phospho-N-acetylmuramoyl-pentapeptide-transferase
46 CABPUQ010000001.1 GCA902460675_00029 CDS open 27598-28113 _na     171_aa Phage protein
47 CABPUQ010000001.1 GCA902460675_00030 CDS open 28118-29335 _na     405_aa murD UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase
48 CABPUQ010000001.1 GCA902460675_00031 CDS open 29484-32954 _na     1156_aa M23 family metallopeptidase
49 CABPUQ010000001.1 GCA902460675_00032 CDS open 32951-33421 _na     156_aa hypothetical protein
50 CABPUQ010000001.1 GCA902460675_00033 CDS open 33439-33849 _na     136_aa hypothetical protein
51 CABPUQ010000001.1 GCA902460675_00034 CDS open 37106-37315 _na     69_aa hypothetical protein
52 CABPUQ010000001.1 GCA902460675_00035 CDS open 37320-37871 _na     183_aa Lipoprotein
53 CABPUQ010000001.1 GCA902460675_00036 CDS open 37874-38671 _na     265_aa hypothetical protein
54 CABPUQ010000001.1 GCA902460675_00037 CDS open 38750-39421 _na     223_aa hypothetical protein
55 CABPUQ010000001.1 GCA902460675_00038 CDS open 39451-40239 _na     262_aa hypothetical protein
56 CABPUQ010000001.1 GCA902460675_00039 CDS open 40268-40603 _na     111_aa hypothetical protein
57 CABPUQ010000001.1 GCA902460675_00040 CDS open 40619-41410 _na     263_aa hypothetical protein
58 CABPUQ010000001.1 GCA902460675_00041 CDS open 41394-41873 _na     159_aa hypothetical protein
59 CABPUQ010000001.1 GCA902460675_00042 CDS open 41926-42291 _na     121_aa Periplasmic protein
60 CABPUQ010000001.1 GCA902460675_00043 CDS open 42351-42833 _na     160_aa hypothetical protein
61 CABPUQ010000001.1 GCA902460675_00044 CDS open 42778-43524 _na     248_aa Organic solvent tolerance-like N-terminal domain-containing protein
62 CABPUQ010000001.1 GCA902460675_00045 CDS open 43517-44056 _na     179_aa Ubiquitin-like domain-containing protein
63 CABPUQ010000001.1 GCA902460675_00046 CDS open 44247-45029 _na     260_aa fdhD formate dehydrogenase accessory sulfurtransferase FdhD
64 CABPUQ010000001.1 GCA902460675_00047 CDS open 45022-45765 _na     247_aa HTH lysR-type domain-containing protein
65 CABPUQ010000001.1 GCA902460675_00048 CDS open 45790-45978 _na     62_aa Sodium-dependent tyrosine transporter
66 CABPUQ010000001.1 GCA902460675_00049 CDS open 46064-47389 _na     441_aa Cysteine sulfinate desulfinase
67 CABPUQ010000001.1 GCA902460675_00050 CDS open 48036-48650 _na     204_aa hisG ATP phosphoribosyltransferase
68 CABPUQ010000001.1 GCA902460675_00051 CDS open 48647-49276 _na     209_aa type III pantothenate kinase
69 CABPUQ010000001.1 GCA902460675_00052 CDS open 49263-49595 _na     110_aa hypothetical protein
70 CABPUQ010000001.1 GCA902460675_00053 CDS open 49592-50599 _na     335_aa L-seryl-tRNA selenium transferase
71 CABPUQ010000001.1 GCA902460675_00054 CDS open 50599-51162 _na     187_aa Tetratricopeptide repeat-like domain-containing protein
72 CABPUQ010000001.1 GCA902460675_00055 CDS open 51287-51574 _na     95_aa gatC Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC
73 CABPUQ010000001.1 GCA902460675_00056 CDS open 51578-52708 _na     376_aa pilT Type IV pili twitching motility protein PilT
74 CABPUQ010000001.1 GCA902460675_00057 CDS open 52708-53319 _na     203_aa cvpA Membrane protein%2C CvpA family
75 CABPUQ010000001.1 GCA902460675_00058 CDS open 53276-53788 _na     170_aa Transcriptional repressor
76 CABPUQ010000001.1 GCA902460675_00059 CDS open 53790-55301 _na     503_aa lysS lysine--tRNA ligase
77 CABPUQ010000001.1 GCA902460675_00060 CDS open 55298-56542 _na     414_aa glyA Serine hydroxymethyltransferase
78 CABPUQ010000001.1 GCA902460675_00061 CDS open 56542-57084 _na     180_aa DUF1882 domain-containing protein
79 CABPUQ010000001.1 GCA902460675_00062 CDS open 57094-57987 _na     297_aa SPOR domain-containing protein
80 CABPUQ010000001.1 GCA902460675_00063 CDS open 57984-58772 _na     262_aa shikimate dehydrogenase
81 CABPUQ010000001.1 GCA902460675_00064 CDS open 59340-61175 _na     611_aa Arylsulfotransferase N-terminal domain-containing protein
82 CABPUQ010000001.1 GCA902460675_00065 CDS open 61381-62124 _na     247_aa ABC transporter ATP-binding protein
83 CABPUQ010000001.1 GCA902460675_00066 CDS open 62121-62846 _na     241_aa ABC transporter%2C permease protein
84 CABPUQ010000001.1 GCA902460675_00067 CDS open 62843-63760 _na     305_aa Twin-arginine translocation pathway signal protein
85 CABPUQ010000001.1 GCA902460675_00068 CDS open 63914-65953 _na     679_aa cooS anaerobic carbon-monoxide dehydrogenase catalytic subunit
86 CABPUQ010000001.1 GCA902460675_00069 CDS open 66153-67589 _na     478_aa Band 7 domain-containing protein
87 CABPUQ010000001.1 GCA902460675_00070 CDS open 67871-68551 _na     226_aa Chorismate dehydratase
88 CABPUQ010000001.1 GCA902460675_00071 CDS open 68548-68820 _na     90_aa Barstar (barnase inhibitor) domain-containing protein
89 CABPUQ010000001.1 GCA902460675_00072 CDS open 68817-69323 _na     168_aa Ribonuclease
90 CABPUQ010000001.1 GCA902460675_00073 CDS open 69333-69959 _na     208_aa upp uracil phosphoribosyltransferase
91 CABPUQ010000001.1 GCA902460675_00074 CDS open 70049-71302 _na     417_aa Malate oxidoreductase
92 CABPUQ010000001.1 GCA902460675_00075 CDS open 71299-72678 _na     459_aa gltX glutamate--tRNA ligase
93 CABPUQ010000001.1 GCA902460675_00076 CDS open 72749-73579 _na     276_aa surA SurA N-terminal domain-containing protein
94 CABPUQ010000001.1 GCA902460675_00077 CDS open 74208-75299 _na     363_aa dapE succinyl-diaminopimelate desuccinylase
95 CABPUQ010000001.1 GCA902460675_00078 CDS open 75299-77209 _na     636_aa Diguanylate cyclase
96 CABPUQ010000001.1 GCA902460675_00079 CDS open 77300-79501 _na     733_aa mutS2 endonuclease MutS2
97 CABPUQ010000001.1 GCA902460675_00080 CDS open 79498-79842 _na     114_aa Integral membrane protein
98 CABPUQ010000001.1 GCA902460675_00081 CDS open 79836-80153 _na     105_aa hypothetical protein
99 CABPUQ010000001.1 GCA902460675_00082 CDS open 80153-81481 _na     442_aa murC UDP-N-acetylmuramate--L-alanine ligase
100 CABPUQ010000001.1 GCA902460675_00083 CDS open 81547-81900 _na     117_aa MmcQ-like protein
101 CABPUQ010000001.1 GCA902460675_00084 CDS open 82299-83834 _na     511_aa Flavocytochrome c
102 CABPUQ010000001.1 GCA902460675_00085 CDS open 83988-84545 _na     185_aa DNA-3-methyladenine glycosylase
103 CABPUQ010000001.1 GCA902460675_00086 CDS open 84542-85336 _na     264_aa CN hydrolase domain-containing protein
104 CABPUQ010000001.1 GCA902460675_00087 CDS open 85329-85520 _na     63_aa xseB exodeoxyribonuclease VII small subunit
105 CABPUQ010000001.1 GCA902460675_00088 CDS open 85524-86630 _na     368_aa homoserine O-acetyltransferase
106 CABPUQ010000001.1 GCA902460675_00089 CDS open 86630-88078 _na     482_aa guaB IMP dehydrogenase
107 CABPUQ010000001.1 GCA902460675_00090 CDS open 88083-89441 _na     452_aa gatA Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA
108 CABPUQ010000001.1 GCA902460675_00091 CDS open 89541-92297 _na     918_aa ileS isoleucine--tRNA ligase
109 CABPUQ010000001.1 GCA902460675_00092 CDS open 92393-93490 _na     365_aa Competence/damage-inducible domain protein
110 CABPUQ010000001.1 GCA902460675_00093 CDS open 93771-93992 _na     73_aa hypothetical protein
111 CABPUQ010000001.1 GCA902460675_00094 CDS open 94185-96413 _na     742_aa Membrane protein%2C exporter
112 CABPUQ010000001.1 GCA902460675_00095 CDS open 96410-96928 _na     172_aa lolA Outer membrane lipoprotein carrier protein LolA
113 CABPUQ010000001.1 GCA902460675_00096 CDS open 96925-97353 _na     142_aa Acyl-CoA thioesterase
114 CABPUQ010000001.1 GCA902460675_00097 CDS open 97350-98960 _na     536_aa Glycosyltransferase family 2 protein
115 CABPUQ010000001.1 GCA902460675_00098 CDS open 98957-100513 _na     518_aa Acyl-CoA synthetase AMP-fatty acid ligase
116 CABPUQ010000001.1 GCA902460675_00099 CDS open 100503-101048 _na     181_aa DNA gyrase subunit B
117 CABPUQ010000001.1 GCA902460675_00100 CDS open 101038-101283 _na     81_aa acyl carrier protein
118 CABPUQ010000001.1 GCA902460675_00101 CDS open 101286-101543 _na     85_aa Acyl carrier protein
119 CABPUQ010000001.1 GCA902460675_00102 CDS open 101527-102273 _na     248_aa Lysophospholipid acyltransferase
120 CABPUQ010000001.1 GCA902460675_00103 CDS open 102263-102931 _na     222_aa Beta-ketoacyl synthase
121 CABPUQ010000001.1 GCA902460675_00104 CDS open 102931-103347 _na     138_aa Excinuclease ATPase subunit
122 CABPUQ010000001.1 GCA902460675_00105 CDS open 103360-104613 _na     417_aa beta-ketoacyl-ACP synthase
123 CABPUQ010000001.1 GCA902460675_00106 CDS open 104613-105317 _na     234_aa fabG 3-oxoacyl-ACP reductase FabG
124 CABPUQ010000001.1 GCA902460675_00107 CDS open 105325-105765 _na     146_aa 3-hydroxydecanoyl-[ACP] dehydratase
125 CABPUQ010000001.1 GCA902460675_00108 CDS open 105765-106931 _na     388_aa fabV 3-oxoacyl-[ACP] synthase FabV like
126 CABPUQ010000001.1 GCA902460675_00109 CDS open 106918-107295 _na     125_aa Lipoprotein
127 CABPUQ010000001.1 GCA902460675_00110 CDS open 107321-107842 _na     173_aa 4'-phosphopantetheinyl transferase domain-containing protein
128 CABPUQ010000001.1 GCA902460675_00111 CDS open 107823-108506 _na     227_aa ABC transporter substrate-binding protein
129 CABPUQ010000001.1 GCA902460675_00112 CDS open 109103-109957 _na     284_aa TPM domain-containing protein
130 CABPUQ010000001.1 GCA902460675_00113 CDS open 109957-110550 _na     197_aa lemA LemA protein
131 CABPUQ010000001.1 GCA902460675_00114 CDS open 110661-115682 _na     1673_aa retention module-containing protein
132 CABPUQ010000001.1 GCA902460675_00115 CDS open 115977-116384 _na     135_aa Pyridoxamine 5'-phosphate oxidase putative domain-containing protein
133 CABPUQ010000001.1 GCA902460675_00116 CDS open 116385-116753 _na     122_aa L-arabinose ABC transporter
134 CABPUQ010000001.1 GCA902460675_00117 CDS open 116838-117359 _na     173_aa ATP/GTP-binding protein
135 CABPUQ010000001.1 GCA902460675_00118 CDS open 117377-118117 _na     246_aa Glycerophosphoryl diester phosphodiesterase membrane domain-containing protein
136 CABPUQ010000001.1 GCA902460675_00119 CDS open 118114-118809 _na     231_aa dUTPase%2C dimeric
137 CABPUQ010000001.1 GCA902460675_00120 CDS open 118939-119127 _na     62_aa ClpX-type ZB domain-containing protein
138 CABPUQ010000001.1 GCA902460675_00121 CDS open 119124-121493 _na     789_aa Diguanylate cyclase/phosphodiesterase
139 CABPUQ010000001.1 GCA902460675_00122 CDS open 121558-122097 _na     179_aa YcxB-like protein domain-containing protein
140 CABPUQ010000001.1 GCA902460675_00123 CDS open 122116-124476 _na     786_aa Diguanylate cyclase/phosphodiesterase
141 CABPUQ010000001.1 GCA902460675_00124 CDS open 124469-126313 _na     614_aa ciaB invasion protein CiaB
142 CABPUQ010000001.1 GCA902460675_00125 CDS open 126403-126816 _na     137_aa Acyl-CoA thioester hydrolase
143 CABPUQ010000001.1 GCA902460675_00126 CDS open 126967-127605 _na     212_aa HTH crp-type domain-containing protein
144 CABPUQ010000001.1 GCA902460675_00127 CDS open 127608-128714 _na     368_aa nnrS Heme-copper protein NnrS
145 CABPUQ010000001.1 GCA902460675_00128 CDS open 128707-129396 _na     229_aa ABC transporter domain-containing protein
146 CABPUQ010000001.1 GCA902460675_00129 CDS open 129396-130193 _na     265_aa ABC transmembrane type-1 domain-containing protein
147 CABPUQ010000001.1 GCA902460675_00130 CDS open 130190-131155 _na     321_aa SsuA/THI5-like domain-containing protein
148 CABPUQ010000001.1 GCA902460675_00131 CDS open 131167-133020 _na     617_aa TonB-dependent receptor-like beta-barrel domain-containing protein
149 CABPUQ010000001.1 GCA902460675_00132 CDS open 133284-133751 _na     155_aa Molybdate transport repressor
150 CABPUQ010000001.1 GCA902460675_00133 CDS open 133762-134196 _na     144_aa Molybdopterin synthase%2C large subunit
151 CABPUQ010000001.1 GCA902460675_00134 CDS open 134198-134419 _na     73_aa Molybdopterin synthase%2C small subunit
152 CABPUQ010000001.1 GCA902460675_00135 CDS open 134504-135643 _na     379_aa nspC carboxynorspermidine decarboxylase
153 CABPUQ010000001.1 GCA902460675_00136 CDS open 135967-136563 _na     198_aa DJ-1/PfpI domain-containing protein
154 CABPUQ010000001.1 GCA902460675_00137 CDS open 136964-137911 _na     315_aa formate dehydrogenase subunit gamma
155 CABPUQ010000001.1 GCA902460675_00138 CDS open 138058-138660 _na     200_aa yedF sulfurtransferase-like selenium metabolism protein YedF
156 CABPUQ010000001.1 GCA902460675_00139 CDS open 138774-139679 _na     301_aa selD selenide%2C water dikinase SelD
157 CABPUQ010000001.1 GCA902460675_00140 CDS open 139790-140419 _na     209_aa Oxygen-insensitive NAD(P)H nitroreductase
158 CABPUQ010000001.1 GCA902460675_00141 CDS open 140539-144591 _na     1350_aa Diguanylate cyclase
159 CABPUQ010000001.1 GCA902460675_00142 CDS open 144584-145444 _na     286_aa ATP phosphoribosyltransferase regulatory subunit
160 CABPUQ010000001.1 GCA902460675_00143 CDS open 145447-146697 _na     416_aa purA adenylosuccinate synthase
161 CABPUQ010000001.1 GCA902460675_00144 CDS open 146694-147116 _na     140_aa fliJ Flagellar FliJ protein
162 CABPUQ010000001.1 GCA902460675_00145 CDS open 147116-147679 _na     187_aa mgtE Magnesium transporter MgtE intracellular domain-containing protein
163 CABPUQ010000001.1 GCA902460675_00146 CDS open 147772-148272 _na     166_aa BaiN-like insert domain-containing protein
164 CABPUQ010000001.1 GCA902460675_00147 CDS open 148323-148595 _na     90_aa MGS-like domain-containing protein
165 CABPUQ010000001.1 GCA902460675_00148 CDS open 148904-149542 _na     212_aa HAD-superfamily hydrolase%2C subfamily IA%2C putative phosphoglycolate phosphatase
166 CABPUQ010000001.1 GCA902460675_00149 CDS open 149615-150628 _na     337_aa OmpA-like domain-containing protein
167 CABPUQ010000001.1 GCA902460675_00150 CDS open 150783-151172 _na     129_aa rpsI 30S ribosomal protein S9
168 CABPUQ010000001.1 GCA902460675_00151 CDS open 151175-151603 _na     142_aa rplM 50S ribosomal protein L13
169 CABPUQ010000001.1 GCA902460675_00152 CDS open 151684-154503 _na     939_aa RecB-like helicase
170 CABPUQ010000001.1 GCA902460675_00153 CDS open 154500-156845 _na     781_aa addB Exonuclease V%2C helicase AddB
171 CABPUQ010000001.1 GCA902460675_00154 CDS open 157245-158426 _na     393_aa nhaA Na+/H+ antiporter NhaA
172 CABPUQ010000001.1 GCA902460675_00155 CDS open 158673-159143 _na     156_aa YtkA-like domain-containing protein
173 CABPUQ010000001.1 GCA902460675_00156 CDS open 159136-159705 _na     189_aa TPM domain-containing protein
174 CABPUQ010000001.1 GCA902460675_00157 CDS open 159708-159809 _na     33_aa hypothetical protein
175 CABPUQ010000001.1 GCA902460675_00158 CDS open 159812-160024 _na     70_aa Periplasmic protein
176 CABPUQ010000001.1 GCA902460675_00159 CDS open 160024-160887 _na     287_aa Cytochrome c oxidase subunit III
177 CABPUQ010000001.1 GCA902460675_00160 CDS open 160875-161087 _na     70_aa ccoQ cytochrome c oxidase%2C cbb3-type%2C CcoQ subunit
178 CABPUQ010000001.1 GCA902460675_00161 CDS open 161097-161762 _na     221_aa ccoO cytochrome-c oxidase%2C cbb3-type subunit II
179 CABPUQ010000001.1 GCA902460675_00162 CDS open 161762-163252 _na     496_aa ccoN cytochrome-c oxidase%2C cbb3-type subunit I
180 CABPUQ010000001.1 GCA902460675_00163 CDS open 163345-164028 _na     227_aa Putative two-component response regulator
181 CABPUQ010000001.1 GCA902460675_00164 CDS open 164021-164761 _na     246_aa histidine kinase
182 CABPUQ010000001.1 GCA902460675_00165 CDS open 164754-165419 _na     221_aa Urease accessory protein UreH-like transmembrane domain-containing protein
183 CABPUQ010000001.1 GCA902460675_00166 CDS open 165419-166537 _na     372_aa carbamoyl phosphate synthase small subunit
184 CABPUQ010000001.1 GCA902460675_00167 CDS open 166537-167088 _na     183_aa Competence protein
185 CABPUQ010000001.1 GCA902460675_00168 CDS open 167138-167578 _na     146_aa Isoleucyl-tRNA synthetase
186 CABPUQ010000001.1 GCA902460675_00169 CDS open 167828-168688 _na     286_aa Formate efflux transporter
187 CABPUQ010000001.1 GCA902460675_00170 CDS open 168874-169320 _na     148_aa Coenzyme F420 hydrogenase maturation protease
188 CABPUQ010000001.1 GCA902460675_00171 CDS open 169320-169664 _na     114_aa Formate hydrogenlyase family maturation protein
189 CABPUQ010000001.1 GCA902460675_00172 CDS open 169661-170485 _na     274_aa Hydrogenase-4%2C component I
190 CABPUQ010000001.1 GCA902460675_00173 CDS open 170482-171021 _na     179_aa 4Fe-4S dicluster domain-containing protein
191 CABPUQ010000001.1 GCA902460675_00174 CDS open 171018-172754 _na     578_aa DNA-3-methyladenine glycosylase I
192 CABPUQ010000001.1 GCA902460675_00175 CDS open 172751-174232 _na     493_aa NADH:quinone oxidoreductase/Mrp antiporter transmembrane domain-containing protein
193 CABPUQ010000001.1 GCA902460675_00176 CDS open 174235-174879 _na     214_aa hyfE hydrogenase 4 membrane subunit
194 CABPUQ010000001.1 GCA902460675_00177 CDS open 174881-175801 _na     306_aa Formate hydrogenlyase subunit 4
195 CABPUQ010000001.1 GCA902460675_00178 CDS open 175811-177778 _na     655_aa Hydrogenase-4%2C component B
196 CABPUQ010000001.1 GCA902460675_00179 CDS open 177780-178349 _na     189_aa Hydrogenase-4%2C component A
197 CABPUQ010000001.1 GCA902460675_00180 CDS open 178767-179852 _na     361_aa Metallo-beta-lactamase domain-containing protein
198 CABPUQ010000001.1 GCA902460675_00181 CDS open 179897-180184 _na     95_aa hypothetical protein
199 CABPUQ010000001.1 GCA902460675_00182 CDS open 180815-181168 _na     117_aa crcB fluoride efflux transporter CrcB
200 CABPUQ010000001.1 GCA902460675_00183 CDS open 181168-182007 _na     279_aa bioB biotin synthase
201 CABPUQ010000001.1 GCA902460675_00184 CDS open 182356-183396 _na     346_aa Ubiquinol cytochrome c oxidoreductase PetABC%2C membrane-bound cytochrome c subunit
202 CABPUQ010000001.1 GCA902460675_00185 CDS open 183399-184643 _na     414_aa Ubiquinol cytochrome c oxidoreductase PetABC%2C cytochrome b subunit
203 CABPUQ010000001.1 GCA902460675_00186 CDS open 184654-185157 _na     167_aa petA ubiquinol-cytochrome c reductase iron-sulfur subunit
204 CABPUQ010000001.1 GCA902460675_00187 CDS open 185520-187382 _na     620_aa mnmG tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG
205 CABPUQ010000001.1 GCA902460675_00188 CDS open 187554-191006 _na     1150_aa acyl-[ACP]--phospholipid O-acyltransferase
206 CABPUQ010000001.1 GCA902460675_00189 CDS open 191144-191923 _na     259_aa Solute-binding protein family 3/N-terminal domain-containing protein
207 CABPUQ010000001.1 GCA902460675_00190 CDS open 191933-192685 _na     250_aa Amino acid ABC transporter%2C periplasmic cysteine-binding protein
208 CABPUQ010000001.1 GCA902460675_00191 CDS open 192695-193447 _na     250_aa Solute-binding protein family 3/N-terminal domain-containing protein
209 CABPUQ010000001.1 GCA902460675_00192 CDS open 193471-194139 _na     222_aa ABC transmembrane type-1 domain-containing protein
210 CABPUQ010000001.1 GCA902460675_00193 CDS open 194139-194876 _na     245_aa ABC transporter domain-containing protein
211 CABPUQ010000001.1 GCA902460675_00194 CDS open 194905-195396 _na     163_aa fldA flavodoxin FldA
212 CABPUQ010000001.1 GCA902460675_00195 CDS open 195408-196121 _na     237_aa UDP-N-acetylmuramate--alanine ligase
213 CABPUQ010000001.1 GCA902460675_00196 CDS open 196125-196436 _na     103_aa DUF2325 domain-containing protein
214 CABPUQ010000001.1 GCA902460675_00197 CDS open 196573-197739 _na     388_aa sugar transporter
215 CABPUQ010000001.1 GCA902460675_00198 CDS open 197896-201474 _na     1192_aa nifJ pyruvate:ferredoxin (flavodoxin) oxidoreductase
216 CABPUQ010000001.1 GCA902460675_00199 CDS open 201540-202046 _na     168_aa DNA-deoxyinosine glycosylase
217 CABPUQ010000001.1 GCA902460675_00200 CDS open 202110-204902 _na     930_aa hypothetical protein
218 CABPUQ010000001.1 GCA902460675_00201 CDS open 204902-206113 _na     403_aa lprI lysozyme inhibitor LprI family protein
219 CABPUQ010000001.1 GCA902460675_00202 CDS open 206113-207333 _na     406_aa lprI lysozyme inhibitor LprI family protein
220 CABPUQ010000001.1 GCA902460675_00203 CDS open 207570-207692 _na     40_aa hypothetical protein
221 CABPUQ010000001.1 GCA902460675_00204 CDS open 207683-208441 _na     252_aa Lipoprotein
222 CABPUQ010000001.1 GCA902460675_00205 CDS open 208516-209280 _na     254_aa Lipoprotein
223 CABPUQ010000001.1 GCA902460675_00206 CDS open 209360-209851 _na     163_aa hypothetical protein
224 CABPUQ010000001.1 GCA902460675_00207 CDS open 209892-209993 _na     33_aa hypothetical protein
225 CABPUQ010000001.1 GCA902460675_00208 CDS open 210006-210293 _na     95_aa hypothetical protein
226 CABPUQ010000001.1 GCA902460675_00209 CDS open 210424-210735 _na     103_aa Membrane protein
227 CABPUQ010000001.1 GCA902460675_00210 CDS open 210725-211096 _na     123_aa Membrane protein
228 CABPUQ010000001.1 GCA902460675_00211 CDS open 211105-211977 _na     290_aa hypothetical protein
229 CABPUQ010000001.1 GCA902460675_00212 CDS open 212070-212330 _na     86_aa hypothetical protein
230 CABPUQ010000001.1 GCA902460675_00213 CDS open 212341-212625 _na     94_aa hypothetical protein
231 CABPUQ010000001.1 GCA902460675_00214 CDS open 212682-213158 _na     158_aa hypothetical protein
232 CABPUQ010000001.1 GCA902460675_00215 CDS open 213347-213709 _na     120_aa hypothetical protein
233 CABPUQ010000001.1 GCA902460675_00216 CDS open 213726-214544 _na     272_aa Lipoprotein
234 CABPUQ010000001.1 GCA902460675_00217 CDS open 214546-215421 _na     291_aa Lipoprotein
235 CABPUQ010000001.1 GCA902460675_00218 CDS open 215397-216527 _na     376_aa hypothetical protein
236 CABPUQ010000001.1 GCA902460675_00219 CDS open 216798-216998 _na     66_aa hypothetical protein
237 CABPUQ010000001.1 GCA902460675_00220 CDS open 217101-217496 _na     131_aa tetratricopeptide repeat protein
238 CABPUQ010000001.1 GCA902460675_00221 CDS open 218837-219088 _na     83_aa hypothetical protein
239 CABPUQ010000001.1 GCA902460675_00222 CDS open 219085-225558 _na     2157_aa hemagglutinin repeat-containing protein
240 CABPUQ010000001.1 GCA902460675_00223 CDS open 225568-227340 _na     590_aa Hemolysin secretion/activation protein%2C ShlB/FhaC/HecB family
241 CABPUQ010000001.1 GCA902460675_00224 CDS open 227786-228538 _na     250_aa DUF4198 domain-containing protein
242 CABPUQ010000001.1 GCA902460675_00231 CDS open 230001-230729 _na     242_aa HEAT repeat domain-containing protein
243 CABPUQ010000001.1 GCA902460675_00232 CDS open 230736-233144 _na     802_aa Flagellar protein
244 CABPUQ010000001.1 GCA902460675_00233 CDS open 233128-234618 _na     496_aa nuoN NADH-quinone oxidoreductase subunit NuoN
245 CABPUQ010000001.1 GCA902460675_00234 CDS open 234615-236126 _na     503_aa NADH-quinone oxidoreductase subunit M
246 CABPUQ010000001.1 GCA902460675_00235 CDS open 236126-237964 _na     612_aa nuoL NADH-quinone oxidoreductase subunit L
247 CABPUQ010000001.1 GCA902460675_00236 CDS open 237968-238270 _na     100_aa nuoK NADH-quinone oxidoreductase subunit NuoK
248 CABPUQ010000001.1 GCA902460675_00237 CDS open 238267-238803 _na     178_aa NADH-quinone oxidoreductase subunit J
249 CABPUQ010000001.1 GCA902460675_00238 CDS open 238796-239434 _na     212_aa nuoI NADH-quinone oxidoreductase subunit NuoI
250 CABPUQ010000001.1 GCA902460675_00239 CDS open 239443-240438 _na     331_aa nuoH NADH-quinone oxidoreductase subunit NuoH
251 CABPUQ010000001.1 GCA902460675_00240 CDS open 240431-242743 _na     770_aa NADH-quinone oxidoreductase subunit G
252 CABPUQ010000001.1 GCA902460675_00241 CDS open 242740-243450 _na     236_aa NADH dehydrogenase
253 CABPUQ010000001.1 GCA902460675_00242 CDS open 243447-243677 _na     76_aa NADH-ubiquinone oxidoreductase chain E
254 CABPUQ010000001.1 GCA902460675_00243 CDS open 243674-244903 _na     409_aa nuoD NADH-quinone oxidoreductase subunit D
255 CABPUQ010000001.1 GCA902460675_00244 CDS open 244900-245664 _na     254_aa NADH-quinone oxidoreductase subunit C
256 CABPUQ010000001.1 GCA902460675_00245 CDS open 245661-246173 _na     170_aa nuoB NADH-quinone oxidoreductase subunit B
257 CABPUQ010000001.1 GCA902460675_00246 CDS open 246155-246544 _na     129_aa NAD(P)H-quinone oxidoreductase subunit 3
258 CABPUQ010000001.1 GCA902460675_00247 CDS open 246652-248286 _na     544_aa multidrug ABC transporter permease/ATP-binding protein
259 CABPUQ010000001.1 GCA902460675_00248 CDS open 248286-249650 _na     454_aa coproporphyrinogen III oxidase family protein
260 CABPUQ010000001.1 GCA902460675_00249 CDS open 249825-251162 _na     445_aa ABC transporter permease
261 CABPUQ010000001.1 GCA902460675_00250 CDS open 251185-251976 _na     263_aa DUF2314 domain-containing protein
262 CABPUQ010000001.1 GCA902460675_00251 CDS open 252306-252803 _na     165_aa yajQ YajQ family cyclic di-GMP-binding protein
263 CABPUQ010000001.1 GCA902460675_00252 CDS open 252807-253736 _na     309_aa D-2-hydroxyacid dehydrogenase
264 CABPUQ010000001.1 GCA902460675_00253 CDS open 253739-254920 _na     393_aa Glutathionylspermidine amidase / glutathionylspermidine synthetase
265 CABPUQ010000001.1 GCA902460675_00254 CDS open 254922-255545 _na     207_aa Lipoprotein
266 CABPUQ010000001.1 GCA902460675_00255 CDS open 255627-256016 _na     129_aa hypothetical protein
267 CABPUQ010000001.1 GCA902460675_00256 CDS open 256584-257216 _na     210_aa Excisionase family DNA binding domain-containing protein
268 CABPUQ010000001.1 GCA902460675_00257 CDS open 257320-257532 _na     70_aa rpsU 30S ribosomal protein S21
269 CABPUQ010000001.1 GCA902460675_00258 CDS open 257591-259066 _na     491_aa Flavocytochrome c
270 CABPUQ010000001.1 GCA902460675_00259 CDS open 259171-260496 _na     441_aa ccoG cytochrome c oxidase accessory protein CcoG
271 CABPUQ010000001.1 GCA902460675_00260 CDS open 260527-261159 _na     210_aa cmeR Transcriptional repressor of CmeABC operon%2C CmeR
272 CABPUQ010000001.1 GCA902460675_00261 CDS open 261261-262418 _na     385_aa cmeA Multidrug efflux system CmeABC%2C periplasmic fusion protein CmeA
273 CABPUQ010000001.1 GCA902460675_00262 CDS open 262429-265554 _na     1041_aa cmeB Multidrug efflux system CmeABC%2C inner membrane drug transporter CmeB
274 CABPUQ010000001.1 GCA902460675_00263 CDS open 265544-266926 _na     460_aa RND transporter
275 CABPUQ010000001.1 GCA902460675_00264 CDS open 266948-267175 _na     75_aa ATP-binding protein
276 CABPUQ010000001.1 GCA902460675_00265 CDS open 267304-268011 _na     235_aa aqpZ aquaporin Z
277 CABPUQ010000001.1 GCA902460675_00266 CDS open 268297-268749 _na     150_aa hypothetical protein
278 CABPUQ010000001.1 GCA902460675_00267 CDS open 269050-269652 _na     200_aa hypothetical protein
279 CABPUQ010000001.1 GCA902460675_00268 CDS open 270058-273294 _na     1078_aa peptidoglycan DD-metalloendopeptidase family protein
280 CABPUQ010000001.1 GCA902460675_00269 CDS open 273291-273788 _na     165_aa hypothetical protein
281 CABPUQ010000001.1 GCA902460675_00270 CDS open 273807-276770 _na     987_aa type VI secretion system Vgr family protein
282 CABPUQ010000001.1 GCA902460675_00271 CDS open 276780-277412 _na     210_aa Membrane protein
283 CABPUQ010000001.1 GCA902460675_00272 CDS open 277402-277839 _na     145_aa hypothetical protein
284 CABPUQ010000001.1 GCA902460675_00273 CDS open 277839-278384 _na     181_aa Ankyrin repeat domain-containing protein
285 CABPUQ010000001.1 GCA902460675_00274 CDS open 278494-279015 _na     173_aa Hcp family type VI secretion system effector
286 CABPUQ010000001.1 GCA902460675_00275 CDS open 279080-279997 _na     305_aa Type VI secretion system protein
287 CABPUQ010000001.1 GCA902460675_00276 CDS open 280007-283495 _na     1162_aa tssM type VI secretion system membrane subunit TssM
288 CABPUQ010000001.1 GCA902460675_00277 CDS open 283573-284469 _na     298_aa Type VI secretion protein
289 CABPUQ010000001.1 GCA902460675_00278 CDS open 284466-286184 _na     572_aa tssF type VI secretion system baseplate subunit TssF
290 CABPUQ010000001.1 GCA902460675_00279 CDS open 286184-286573 _na     129_aa GPW/gp25 family protein
291 CABPUQ010000001.1 GCA902460675_00280 CDS open 286582-288030 _na     482_aa tssC type VI secretion system contractile sheath large subunit
292 CABPUQ010000001.1 GCA902460675_00281 CDS open 288033-288518 _na     161_aa tssB type VI secretion system contractile sheath small subunit
293 CABPUQ010000001.1 GCA902460675_00282 CDS open 288598-289878 _na     426_aa Type VI secretion system protein
294 CABPUQ010000001.1 GCA902460675_00283 CDS open 289879-290643 _na     254_aa icmH type IVB secretion system protein IcmH/DotU
295 CABPUQ010000001.1 GCA902460675_00284 CDS open 290653-292047 _na     464_aa tssK type VI secretion system baseplate subunit TssK
296 CABPUQ010000001.1 GCA902460675_00285 CDS open 292049-292516 _na     155_aa tssJ type VI secretion system lipoprotein TssJ
297 CABPUQ010000001.1 GCA902460675_00286 CDS open 292632-293981 _na     449_aa Thioredoxin reductase
298 CABPUQ010000001.1 GCA902460675_00287 CDS open 293985-297764 _na     1259_aa hypothetical protein
299 CABPUQ010000001.1 GCA902460675_00288 CDS open 297789-301379 _na     1196_aa DUF2974 domain-containing protein
300 CABPUQ010000001.1 GCA902460675_00289 CDS open 302258-302395 _na     45_aa Diadenosine tetraphosphate hydrolase
301 CABPUQ010000001.1 GCA902460675_00290 CDS open 302395-303018 _na     207_aa tRNA 2-selenouridine synthase
302 CABPUQ010000001.1 GCA902460675_00291 CDS open 303335-304525 _na     396_aa nifS NifS family cysteine desulfurase
303 CABPUQ010000001.1 GCA902460675_00292 CDS open 304542-305534 _na     330_aa nifU Nitrogen fixation protein NifU
304 CABPUQ010000001.1 GCA902460675_00293 CDS open 305616-306491 _na     291_aa miaA tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA
305 CABPUQ010000001.1 GCA902460675_00294 CDS open 306494-307708 _na     404_aa D-amino acid dehydrogenase small subunit
306 CABPUQ010000001.1 GCA902460675_00295 CDS open 307810-308670 _na     286_aa mqnP menaquinone biosynthesis prenyltransferase MqnP
307 CABPUQ010000001.1 GCA902460675_00296 CDS open 308667-309188 _na     173_aa hypothetical protein
308 CABPUQ010000001.1 GCA902460675_00297 CDS open 309198-309704 _na     168_aa Periplasmic protein
309 CABPUQ010000001.1 GCA902460675_00298 CDS open 309838-310806 _na     322_aa moaA GTP 3'%2C8-cyclase MoaA
310 CABPUQ010000001.1 GCA902460675_00299 CDS open 310806-311561 _na     251_aa 7-carboxy-7-deazaguanine synthase
311 CABPUQ010000001.1 GCA902460675_00300 CDS open 311561-312142 _na     193_aa 6-carboxy-5%2C6%2C7%2C8-tetrahydropterin synthase
312 CABPUQ010000001.1 GCA902460675_00301 CDS open 312142-312345 _na     67_aa Lipoprotein
313 CABPUQ010000001.1 GCA902460675_00302 CDS open 312342-312743 _na     133_aa Integral membrane protein
314 CABPUQ010000001.1 GCA902460675_00303 CDS open 312744-313400 _na     218_aa 16S rRNA (uracil(1498)-N(3))-methyltransferase
315 CABPUQ010000001.1 GCA902460675_00304 CDS open 313482-313682 _na     66_aa rpmE 50S ribosomal protein L31
316 CABPUQ010000001.1 GCA902460675_00305 CDS open 313686-314501 _na     271_aa rsmI 16S rRNA (cytidine(1402)-2'-O)-methyltransferase
317 CABPUQ010000001.1 GCA902460675_00306 CDS open 314602-315282 _na     226_aa rlmB 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB
318 CABPUQ010000001.1 GCA902460675_00307 CDS open 315275-316216 _na     313_aa Phosphatidylglycerophosphate synthase
319 CABPUQ010000001.1 GCA902460675_00308 CDS open 316210-316992 _na     260_aa Periplasmic protein
320 CABPUQ010000001.1 GCA902460675_00309 CDS open 317002-318210 _na     402_aa LL-diaminopimelate aminotransferase
321 CABPUQ010000001.1 GCA902460675_00310 CDS open 318207-319469 _na     420_aa Homoserine dehydrogenase
322 CABPUQ010000001.1 GCA902460675_00311 CDS open 319471-319812 _na     113_aa yraN YraN family protein
323 CABPUQ010000001.1 GCA902460675_00312 CDS open 319886-320200 _na     104_aa trxA thioredoxin
324 CABPUQ010000001.1 GCA902460675_00313 CDS open 320200-320646 _na     148_aa fliL Flagellar protein FliL
325 CABPUQ010000001.1 GCA902460675_00314 CDS open 320656-321594 _na     312_aa Thioredoxin reductase
326 CABPUQ010000001.1 GCA902460675_00315 CDS open 321942-322712 _na     256_aa dapB 4-hydroxy-tetrahydrodipicolinate reductase
327 CABPUQ010000001.1 GCA902460675_00316 CDS open 322991-324328 _na     445_aa purF amidophosphoribosyltransferase
328 CABPUQ010000001.1 GCA902460675_00317 CDS open 324325-324987 _na     220_aa Lipoprotein
329 CABPUQ010000001.1 GCA902460675_00318 CDS open 325103-325762 _na     219_aa Secreted protein
330 CABPUQ010000001.1 GCA902460675_00319 CDS open 325936-326154 _na     72_aa hypothetical protein
331 CABPUQ010000001.1 GCA902460675_00320 CDS open 326273-327430 _na     385_aa double-cubane-cluster-containing anaerobic reductase
332 CABPUQ010000001.1 GCA902460675_00321 CDS open 327417-328196 _na     259_aa ATPase BadF/BadG/BcrA/BcrD type domain-containing protein
333 CABPUQ010000001.1 GCA902460675_00322 CDS open 328349-329701 _na     450_aa Multidrug-efflux transporter
334 CABPUQ010000001.1 GCA902460675_00323 CDS open 329746-330414 _na     222_aa Lipoprotein
335 CABPUQ010000001.1 GCA902460675_00324 CDS open 330399-330803 _na     134_aa DUF4810 domain-containing protein
336 CABPUQ010000001.1 GCA902460675_00325 CDS open 330793-331470 _na     225_aa Lipoprotein
337 CABPUQ010000001.1 GCA902460675_00326 CDS open 331476-332378 _na     300_aa eamA EamA domain-containing protein
338 CABPUQ010000001.1 GCA902460675_00327 CDS open 332356-332778 _na     140_aa tsaC Threonylcarbamoyl-AMP synthase TsaC
339 CABPUQ010000001.1 GCA902460675_00328 CDS open 333735-335537 _na     600_aa typA translational GTPase TypA
340 CABPUQ010000001.1 GCA902460675_00329 CDS open 335699-337099 _na     466_aa Flagellar hook-length control protein-like C-terminal domain-containing protein
341 CABPUQ010000001.1 GCA902460675_00330 CDS open 337108-337815 _na     235_aa flagellar basal body rod modification protein
342 CABPUQ010000001.1 GCA902460675_00331 CDS open 337821-339422 _na     533_aa Flagellar hook protein
343 CABPUQ010000001.1 GCA902460675_00332 CDS open 339589-340158 _na     189_aa torY Cytochrome c-type protein TorY
344 CABPUQ010000001.1 GCA902460675_00333 CDS open 340179-342620 _na     813_aa Trimethylamine-N-oxide reductase
345 CABPUQ010000001.1 GCA902460675_00339 CDS open 345378-345848 _na     156_aa Prepilin-type cleavage/methylation domain-containing protein
346 CABPUQ010000001.1 GCA902460675_00340 CDS open 345972-346397 _na     141_aa Prepilin-type N-terminal cleavage/methylation domain-containing protein
347 CABPUQ010000001.1 GCA902460675_00341 CDS open 346548-347411 _na     287_aa Cytochrome c551 peroxidase
348 CABPUQ010000001.1 GCA902460675_00342 CDS open 347404-349821 _na     805_aa PAS sensor-containing phosphodiesterase
349 CABPUQ010000001.1 GCA902460675_00344 CDS open 350173-350643 _na     156_aa Lipoprotein
350 CABPUQ010000001.1 GCA902460675_00345 CDS open 350640-351491 _na     283_aa nfo deoxyribonuclease IV
351 CABPUQ010000001.1 GCA902460675_00346 CDS open 351488-352729 _na     413_aa Porin
352 CABPUQ010000001.1 GCA902460675_00347 CDS open 352738-354405 _na     555_aa Long-chain-fatty-acid--CoA ligase
353 CABPUQ010000001.1 GCA902460675_00348 CDS open 354405-356138 _na     577_aa AAA+ ATPase domain-containing protein
354 CABPUQ010000001.1 GCA902460675_00349 CDS open 357236-358543 _na     435_aa fliI flagellar protein export ATPase FliI
355 CABPUQ010000001.1 GCA902460675_00350 CDS open 358540-359112 _na     190_aa folE GTP cyclohydrolase I FolE
356 CABPUQ010000001.1 GCA902460675_00351 CDS open 359250-360581 _na     443_aa tig trigger factor
357 CABPUQ010000001.1 GCA902460675_00352 CDS open 360581-361171 _na     196_aa clpP ATP-dependent Clp endopeptidase proteolytic subunit ClpP
358 CABPUQ010000001.1 GCA902460675_00353 CDS open 361180-362214 _na     344_aa GGDEF domain-containing protein
359 CABPUQ010000001.1 GCA902460675_00354 CDS open 362216-362734 _na     172_aa def peptide deformylase
360 CABPUQ010000001.1 GCA902460675_00355 CDS open 362731-364236 _na     501_aa Mg chelatase-related protein
361 CABPUQ010000001.1 GCA902460675_00356 CDS open 364238-365641 _na     467_aa Bifunctional NAD(P)H-hydrate repair enzyme
362 CABPUQ010000001.1 GCA902460675_00357 CDS open 365623-366213 _na     196_aa purN phosphoribosylglycinamide formyltransferase
363 CABPUQ010000001.1 GCA902460675_00358 CDS open 366206-366931 _na     241_aa terC Membrane protein%2C TerC family
364 CABPUQ010000001.1 GCA902460675_00359 CDS open 366973-367326 _na     117_aa Biphenyl-2%2C3-diol 1%2C2-dioxygenase III-related protein
365 CABPUQ010000001.1 GCA902460675_00360 CDS open 367339-368670 _na     443_aa Multidrug-efflux transporter
366 CABPUQ010000001.1 GCA902460675_00361 CDS open 368651-369457 _na     268_aa Metal ion ABC transporter%2C membrane protein
367 CABPUQ010000001.1 GCA902460675_00362 CDS open 369467-370249 _na     260_aa Metal ion ABC transporter%2C ATP-binding protein
368 CABPUQ010000001.1 GCA902460675_00363 CDS open 370246-371739 _na     497_aa Nickel/cobalt efflux system
369 CABPUQ010000001.1 GCA902460675_00364 CDS open 371742-372650 _na     302_aa Cation ABC transporter substrate-binding protein
370 CABPUQ010000001.1 GCA902460675_00365 CDS open 372796-373155 _na     119_aa Transcriptional regulator%2C Fur family
371 CABPUQ010000001.1 GCA902460675_00366 CDS open 373146-373538 _na     130_aa YbgC/YbaW family acyl-CoA thioester hydrolase
372 CABPUQ010000001.1 GCA902460675_00367 CDS open 373584-374309 _na     241_aa Methyltransferase domain-containing protein
373 CABPUQ010000001.1 GCA902460675_00368 CDS open 374306-375184 _na     292_aa eamA EamA domain-containing protein
374 CABPUQ010000001.1 GCA902460675_00369 CDS open 375181-375930 _na     249_aa DUF4197 domain-containing protein
375 CABPUQ010000001.1 GCA902460675_00370 CDS open 376039-376596 _na     185_aa mntP manganese efflux pump MntP family protein
376 CABPUQ010000001.1 GCA902460675_00371 CDS open 376593-377351 _na     252_aa exodeoxyribonuclease III
377 CABPUQ010000001.1 GCA902460675_00372 CDS open 377405-377770 _na     121_aa Diacylglycerol kinase
378 CABPUQ010000001.1 GCA902460675_00373 CDS open 377772-377999 _na     75_aa HTH arsR-type domain-containing protein
379 CABPUQ010000001.1 GCA902460675_00374 CDS open 378029-379594 _na     521_aa Flavocytochrome c
380 CABPUQ010000001.1 GCA902460675_00375 CDS open 379949-380368 _na     139_aa modE DNA-binding protein domain protein of ModE
381 CABPUQ010000001.1 GCA902460675_00376 CDS open 380665-381732 _na     355_aa prfA peptide chain release factor 1
382 CABPUQ010000001.1 GCA902460675_00377 CDS open 381747-382016 _na     89_aa rpsT 30S ribosomal protein S20
383 CABPUQ010000001.1 GCA902460675_00378 CDS open 382174-383514 _na     446_aa glmM phosphoglucosamine mutase
384 CABPUQ010000001.1 GCA902460675_00379 CDS open 383507-383959 _na     150_aa lspA signal peptidase II
385 CABPUQ010000001.1 GCA902460675_00380 CDS open 383949-384311 _na     120_aa TM2 domain-containing protein
386 CABPUQ010000001.1 GCA902460675_00381 CDS open 384321-384755 _na     144_aa Protoporphyrinogen IX oxidase
387 CABPUQ010000001.1 GCA902460675_00382 CDS open 384765-385310 _na     181_aa Periplasmic protein
388 CABPUQ010000001.1 GCA902460675_00383 CDS open 385427-386866 _na     479_aa acetyl-CoA carboxylase subunit A
389 CABPUQ010000001.1 GCA902460675_00384 CDS open 386907-387836 _na     309_aa hypothetical protein
390 CABPUQ010000001.1 GCA902460675_00385 CDS open 387937-388509 _na     190_aa Knr4/Smi1-like domain-containing protein
391 CABPUQ010000001.1 GCA902460675_00386 CDS open 388705-390063 _na     452_aa gdhA NADP-specific glutamate dehydrogenase
392 CABPUQ010000001.1 GCA902460675_00387 CDS open 391450-391968 _na     172_aa infC translation initiation factor IF-3
393 CABPUQ010000001.1 GCA902460675_00388 CDS open 391965-393785 _na     606_aa thrS threonine--tRNA ligase
394 CABPUQ010000001.1 GCA902460675_00389 CDS open 394127-394702 _na     191_aa YbaK/aminoacyl-tRNA synthetase-associated domain-containing protein
395 CABPUQ010000001.1 GCA902460675_00390 CDS open 394766-395458 _na     230_aa ung uracil-DNA glycosylase
396 CABPUQ010000001.1 GCA902460675_00391 CDS open 395460-395753 _na     97_aa Periplasmic protein
397 CABPUQ010000001.1 GCA902460675_00392 CDS open 395833-396363 _na     176_aa Pyridoxamine 5'-phosphate oxidase putative domain-containing protein
398 CABPUQ010000001.1 GCA902460675_00393 CDS open 396366-397550 _na     394_aa AAA+ ATPase domain-containing protein
399 CABPUQ010000001.1 GCA902460675_00394 CDS open 397591-398106 _na     171_aa ruvA ATP-dependent DNA helicase RuvA
400 CABPUQ010000001.1 GCA902460675_00395 CDS open 398195-399613 _na     472_aa Na+/alanine symporter family protein
401 CABPUQ010000001.1 GCA902460675_00396 CDS open 399658-400974 _na     438_aa Bacterial Ig-like domain-containing protein
402 CABPUQ010000001.1 GCA902460675_00399 CDS open 401527-401964 _na     145_aa Cytochrome c3
403 CABPUQ010000001.1 GCA902460675_00400 CDS open 401961-402665 _na     234_aa NapC/NirT cytochrome c N-terminal domain-containing protein
404 CABPUQ010000001.1 GCA902460675_00401 CDS open 402665-402805 _na     46_aa Two-component system response regulator
405 CABPUQ010000001.1 GCA902460675_00402 CDS open 402997-403353 _na     118_aa winged helix-turn-helix domain-containing protein
406 CABPUQ010000001.1 GCA902460675_00403 CDS open 403660-404544 _na     294_aa Methylenetetrahydrofolate reductase
407 CABPUQ010000001.1 GCA902460675_00404 CDS open 404549-405007 _na     152_aa Lipoprotein
408 CABPUQ010000001.1 GCA902460675_00405 CDS open 405033-407306 _na     757_aa metE 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase
409 CABPUQ010000001.1 GCA902460675_00406 CDS open 407817-409313 _na     498_aa C69 family dipeptidase
410 CABPUQ010000001.1 GCA902460675_00407 CDS open 409515-409706 _na     63_aa rpmI 50S ribosomal protein L35
411 CABPUQ010000001.1 GCA902460675_00408 CDS open 409806-410162 _na     118_aa rplT 50S ribosomal protein L20
412 CABPUQ010000001.1 GCA902460675_00409 CDS open 410321-411064 _na     247_aa dapF diaminopimelate epimerase
413 CABPUQ010000001.1 GCA902460675_00410 CDS open 411140-411760 _na     206_aa Phosphomethylpyrimidine kinase
414 CABPUQ010000001.1 GCA902460675_00411 CDS open 411750-412352 _na     200_aa coaE dephospho-CoA kinase
415 CABPUQ010000001.1 GCA902460675_00412 CDS open 412432-413415 _na     327_aa Phosphoribosylformylglycinamidine cyclo-ligase
416 CABPUQ010000001.1 GCA902460675_00413 CDS open 413415-413639 _na     74_aa hypothetical protein
417 CABPUQ010000001.1 GCA902460675_00414 CDS open 413641-414060 _na     139_aa RDD domain-containing protein
418 CABPUQ010000001.1 GCA902460675_00415 CDS open 414362-414796 _na     144_aa terB TerB family tellurite resistance protein
419 CABPUQ010000001.1 GCA902460675_00417 CDS open 414994-416229 _na     411_aa HD domain-containing protein
420 CABPUQ010000001.1 GCA902460675_00418 CDS open 416229-416888 _na     219_aa queF preQ(1) synthase
421 CABPUQ010000001.1 GCA902460675_00419 CDS open 416942-419251 _na     769_aa gyrB DNA topoisomerase (ATP-hydrolyzing) subunit B
422 CABPUQ010000001.1 GCA902460675_00420 CDS open 419269-420336 _na     355_aa dnaN DNA polymerase III subunit beta
423 CABPUQ010000001.1 GCA902460675_00421 CDS open 420336-420482 _na     48_aa hypothetical protein
424 CABPUQ010000001.1 GCA902460675_00422 CDS open 420490-421800 _na     436_aa dnaA chromosomal replication initiator protein DnaA
425 CABPUQ010000001.1 GCA902460675_00423 CDS open 421929-422402 _na     157_aa ruvC crossover junction endodeoxyribonuclease RuvC
426 CABPUQ010000001.1 GCA902460675_00424 CDS open 422419-423108 _na     229_aa MOSC domain-containing protein
427 CABPUQ010000001.1 GCA902460675_00425 CDS open 423175-425139 _na     654_aa Cache sensor-containing MCP-domain signal transduction protein
428 CABPUQ010000001.1 GCA902460675_00426 CDS open 425237-425752 _na     171_aa luxS S-ribosylhomocysteine lyase
429 CABPUQ010000001.1 GCA902460675_00427 CDS open 425754-426860 _na     368_aa site-specific DNA-methyltransferase (adenine-specific)
430 CABPUQ010000001.1 GCA902460675_00428 CDS open 426906-427535 _na     209_aa thyX FAD-dependent thymidylate synthase
431 CABPUQ010000001.1 GCA902460675_00429 CDS open 427628-430069 _na     813_aa flgE flagellar hook protein FlgE
432 CABPUQ010000001.1 GCA902460675_00430 CDS open 430197-431564 _na     455_aa Na+/H+ antiporter NhaC-like C-terminal domain-containing protein
433 CABPUQ010000001.1 GCA902460675_00431 CDS open 431683-432291 _na     202_aa pyrE orotate phosphoribosyltransferase
434 CABPUQ010000001.1 GCA902460675_00432 CDS open 432486-434189 _na     567_aa Methyl-accepting chemotaxis protein
435 CABPUQ010000001.1 GCA902460675_00433 CDS open 434358-435047 _na     229_aa Two-component system response regulator
436 CABPUQ010000001.1 GCA902460675_00434 CDS open 435037-436464 _na     475_aa Histidine kinase domain-containing protein
437 CABPUQ010000001.1 GCA902460675_00435 CDS open 436560-438626 _na     688_aa Cytochrome c family protein
438 CABPUQ010000001.1 GCA902460675_00436 CDS open 438671-439429 _na     252_aa Peptidyl-prolyl cis-trans isomerase
439 CABPUQ010000001.1 GCA902460675_00437 CDS open 439449-440120 _na     223_aa 4Fe-4S dicluster domain-containing protein
440 CABPUQ010000001.1 GCA902460675_00438 CDS open 440122-441051 _na     309_aa nrfD Polysulfide reductase NrfD
441 CABPUQ010000001.1 GCA902460675_00439 CDS open 441068-443686 _na     872_aa ccsA Cytochrome c biogenesis protein CcsA
442 CABPUQ010000001.1 GCA902460675_00440 CDS open 443695-444516 _na     273_aa beta-lactamase
443 CABPUQ010000001.1 GCA902460675_00441 CDS open 444516-445052 _na     178_aa yopX YopX protein domain-containing protein
444 CABPUQ010000001.1 GCA902460675_00442 CDS open 445049-445507 _na     152_aa nosL NosL family protein
445 CABPUQ010000001.1 GCA902460675_00443 CDS open 445684-446793 _na     369_aa ABC3 transporter permease C-terminal domain-containing protein
446 CABPUQ010000001.1 GCA902460675_00444 CDS open 446790-447458 _na     222_aa ABC transporter domain-containing protein
447 CABPUQ010000001.1 GCA902460675_00445 CDS open 447455-448408 _na     317_aa Membrane protein
448 CABPUQ010000001.1 GCA902460675_00446 CDS open 448405-448914 _na     169_aa Periplasmic protein
449 CABPUQ010000001.1 GCA902460675_00447 CDS open 448964-450235 _na     423_aa beta-lactamase
450 CABPUQ010000001.1 GCA902460675_00448 CDS open 450309-451082 _na     257_aa Pseudouridine synthase
451 CABPUQ010000001.1 GCA902460675_00449 CDS open 451084-452037 _na     317_aa KpsF/GutQ family sugar-phosphate isomerase
452 CABPUQ010000001.1 GCA902460675_00450 CDS open 452047-454200 _na     717_aa Ribonuclease J
453 CABPUQ010000001.1 GCA902460675_00451 CDS open 454166-455026 _na     286_aa rsmA 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA
454 CABPUQ010000001.1 GCA902460675_00452 CDS open 455115-458393 _na     1092_aa DNA2/NAM7 helicase-like C-terminal domain-containing protein
455 CABPUQ010000001.1 GCA902460675_00453 CDS open 458396-459151 _na     251_aa hisF Imidazole glycerol phosphate synthase subunit HisF
456 CABPUQ010000001.1 GCA902460675_00454 CDS open 459151-459831 _na     226_aa Purine-nucleoside phosphorylase
457 CABPUQ010000001.1 GCA902460675_00455 CDS open 459828-460973 _na     381_aa rlmN 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN
458 CABPUQ010000001.1 GCA902460675_00456 CDS open 460970-461077 _na     35_aa hypothetical protein
459 CABPUQ010000001.1 GCA902460675_00457 CDS open 461287-462201 _na     304_aa RNA pseudouridylate synthase
460 CABPUQ010000001.1 GCA902460675_00458 CDS open 462389-463720 _na     443_aa purB adenylosuccinate lyase
461 CABPUQ010000001.1 GCA902460675_00459 CDS open 464084-466459 _na     791_aa ribonucleoside-diphosphate reductase subunit alpha
462 CABPUQ010000001.1 GCA902460675_00460 CDS open 466521-466964 _na     147_aa Lipoprotein
463 CABPUQ010000001.1 GCA902460675_00461 CDS open 467267-469369 _na     700_aa ribonucleoside triphosphate reductase
464 CABPUQ010000001.1 GCA902460675_00462 CDS open 469379-469549 _na     56_aa Anaerobic ribonucleoside triphosphate reductase (N-terminal region)
465 CABPUQ010000001.1 GCA902460675_00463 CDS open 469650-470324 _na     224_aa anaerobic ribonucleoside-triphosphate reductase activating protein
466 CABPUQ010000001.1 GCA902460675_00464 CDS open 470409-471554 _na     381_aa gldA Alcohol dehydrogenase iron-type/glycerol dehydrogenase GldA domain-containing protein
467 CABPUQ010000001.1 GCA902460675_00465 CDS open 471584-472225 _na     213_aa NAD(P)-binding domain-containing protein
468 CABPUQ010000001.1 GCA902460675_00466 CDS open 472222-472992 _na     256_aa Oxidoreductase
469 CABPUQ010000001.1 GCA902460675_00467 CDS open 473063-474499 _na     478_aa subtype B tannase
470 CABPUQ010000001.1 GCA902460675_00468 CDS open 474549-475070 _na     173_aa Periplasmic protein
471 CABPUQ010000001.1 GCA902460675_00469 CDS open 475084-475764 _na     226_aa ABM domain-containing protein
472 CABPUQ010000001.1 GCA902460675_00470 CDS open 475842-475982 _na     46_aa hypothetical protein
473 CABPUQ010000001.1 GCA902460675_00471 CDS open 476229-476519 _na     96_aa TonB-dependent receptor
474 CABPUQ010000001.1 GCA902460675_00472 CDS open 476631-477275 _na     214_aa Desulforubrerythrin
475 CABPUQ010000001.1 GCA902460675_00473 CDS open 477515-478171 _na     218_aa dsbA Thiol:disulfide interchange protein DsbA
476 CABPUQ010000001.1 GCA902460675_00474 CDS open 478180-478800 _na     206_aa dsbI protein-disulfide oxidoreductase DsbI
477 CABPUQ010000001.1 GCA902460675_00475 CDS open 478848-480497 _na     549_aa Histidine kinase domain-containing protein
478 CABPUQ010000001.1 GCA902460675_00476 CDS open 480501-481181 _na     226_aa Putative two-component response regulator
479 CABPUQ010000001.1 GCA902460675_00477 CDS open 481704-484646 _na     980_aa retention module-containing protein
480 CABPUQ010000001.1 GCA902460675_00478 CDS open 484781-488938 _na     1385_aa PA14 domain-containing protein
481 CABPUQ010000001.1 GCA902460675_00479 CDS open 489088-489624 _na     178_aa Retention module-containing protein
482 CABPUQ010000001.1 GCA902460675_00480 CDS open 489710-490444 _na     244_aa hydroxymethylpyrimidine kinase
483 CABPUQ010000001.1 GCA902460675_00481 CDS open 490486-492159 _na     557_aa ilvD dihydroxy-acid dehydratase
484 CABPUQ010000001.1 GCA902460675_00482 CDS open 492253-493287 _na     344_aa Asparaginase II
485 CABPUQ010000001.1 GCA902460675_00483 CDS open 493649-496837 _na     1062_aa Retention module-containing protein
486 CABPUQ010000001.1 GCA902460675_00484 CDS open 497011-498417 _na     468_aa RTX toxin
487 CABPUQ010000001.1 GCA902460675_00485 CDS open 498578-503032 _na     1484_aa Retention module-containing protein
488 CABPUQ010000001.1 GCA902460675_00486 CDS open 512461-515814 _na     1117_aa Ig-like domain repeat protein
489 CABPUQ010000001.1 GCA902460675_00487 CDS open 515881-516234 _na     117_aa DUF2802 domain-containing protein
490 CABPUQ010000001.1 GCA902460675_00488 CDS open 516273-518039 _na     588_aa Arylsulfate sulfotransferase
491 CABPUQ010000001.1 GCA902460675_00489 CDS open 518192-518293 _na     33_aa hypothetical protein
492 CABPUQ010000001.1 GCA902460675_00490 CDS open 518303-519427 _na     374_aa Cytochrome d ubiquinol oxidase subunit II
493 CABPUQ010000001.1 GCA902460675_00491 CDS open 519420-520955 _na     511_aa Cytochrome d ubiquinol oxidase subunit 1
494 CABPUQ010000001.1 GCA902460675_00492 CDS open 520957-521115 _na     52_aa DUF4492 domain-containing protein
495 CABPUQ010000001.1 GCA902460675_00493 CDS open 521191-521994 _na     267_aa Bacteriophage T4 Gp32 single-stranded DNA-binding domain-containing protein
496 CABPUQ010000001.1 GCA902460675_00494 CDS open 522539-524173 _na     544_aa CTP synthase
497 CABPUQ010000001.1 GCA902460675_00495 CDS open 524336-524944 _na     202_aa Outer membrane protein beta-barrel domain-containing protein
498 CABPUQ010000001.1 GCA902460675_00496 CDS open 525257-526831 _na     524_aa recJ single-stranded-DNA-specific exonuclease RecJ
499 CABPUQ010000001.1 GCA902460675_00497 CDS open 527038-527625 _na     195_aa Outer membrane protein
500 CABPUQ010000001.1 GCA902460675_00498 CDS open 527733-528116 _na     127_aa lprI Lysozyme inhibitor LprI N-terminal domain-containing protein