HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Campylobacter concisus clade-433 (GCA_902460695.1)

Select a Genome:
BAKTA Annotations for GCA_902460695.1
Genome Selected: Campylobacter concisus clade-433
ContigsBases CDSrRNA tmRNAtRNA
16 2128539 2039 7 1 49
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4203 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:9]    |    Number of Records Found: 4203 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
4001 CABPUK010000007.1 GCA902460695_01981 gene open 30806-31807
4002 CABPUK010000007.1 GCA902460695_01982 gene open 32019-32579
4003 CABPUK010000007.1 GCA902460695_01983 gene open 32576-32833
4004 CABPUK010000007.1 GCA902460695_01984 gene open 32845-33066
4005 CABPUK010000007.1 GCA902460695_01985 gene open 33317-33991
4006 CABPUK010000007.1 GCA902460695_01986 gene open 34354-35571
4007 CABPUK010000007.1 GCA902460695_01987 gene open 35564-37423
4008 CABPUK010000007.1 GCA902460695_01988 gene open 37648-37935
4009 CABPUK010000007.1 GCA902460695_01989 gene open 37967-38185
4010 CABPUK010000007.1 GCA902460695_01990 gene open 38182-38460 copG
4011 CABPUK010000007.1 GCA902460695_01991 gene open 38565-38786 hicA
4012 CABPUK010000007.1 GCA902460695_01992 gene open 38789-39142 hicB
4013 CABPUK010000007.1 GCA902460695_01993 gene open 39321-42605
4014 CABPUK010000007.1 GCA902460695_01994 gene open 42684-43232
4015 CABPUK010000007.1 GCA902460695_01995 gene open 43241-44596
4016 CABPUK010000007.1 GCA902460695_01996 gene open 45152-45373 copG
4017 CABPUK010000007.1 GCA902460695_01997 gene open 45376-46062
4018 CABPUK010000007.1 GCA902460695_01998 gene open 47485-48174
4019 CABPUK010000007.1 GCA902460695_01999 gene open 51287-51916
4020 CABPUK010000007.1 GCA902460695_02000 gene open 51920-53290
4021 CABPUK010000007.1 GCA902460695_02001 gene open 53849-54538
4022 CABPUK010000007.1 GCA902460695_02002 gene open 55658-56431
4023 CABPUK010000007.1 GCA902460695_02003 gene open 57727-58344 sodB
4024 CABPUK010000007.1 GCA902460695_02004 gene open 59251-60417
4025 CABPUK010000007.1 GCA902460695_02005 gene open 60506-60961
4026 CABPUK010000007.1 GCA902460695_02006 gene open 61179-62321
4027 CABPUK010000007.1 GCA902460695_02007 gene open 62331-62861 tpx
4028 CABPUK010000007.1 GCA902460695_02008 gene open 62868-63284
4029 CABPUK010000007.1 GCA902460695_02010 gene open 63736-63891
4030 CABPUK010000007.1 GCA902460695_02015 gene open 64456-65196
4031 CABPUK010000007.1 GCA902460695_02016 gene open 65277-66401
4032 CABPUK010000007.1 GCA902460695_02017 gene open 66473-67495
4033 CABPUK010000007.1 GCA902460695_02018 gene open 67482-67976
4034 CABPUK010000007.1 GCA902460695_02019 gene open 67977-68744
4035 CABPUK010000007.1 GCA902460695_02020 gene open 68805-69437
4036 CABPUK010000007.1 GCA902460695_02021 gene open 69456-69941
4037 CABPUK010000007.1 GCA902460695_02009 gene open 63588-63677 trnS
4038 CABPUK010000007.1 GCA902460695_02011 gene open 63923-63996 trnC
4039 CABPUK010000007.1 GCA902460695_02012 gene open 64004-64090 trnL
4040 CABPUK010000007.1 GCA902460695_02013 gene open 64099-64173 trnG
4041 CABPUK010000007.1 GCA902460695_02014 gene open 64278-64353 trnA
4042 CABPUK010000007.1 GCA902460695_02009 tRNA open 63588-63677 trnS tRNA-Ser(tga)
4043 CABPUK010000007.1 GCA902460695_02011 tRNA open 63923-63996 trnC tRNA-Cys(gca)
4044 CABPUK010000007.1 GCA902460695_02012 tRNA open 64004-64090 trnL tRNA-Leu(taa)
4045 CABPUK010000007.1 GCA902460695_02013 tRNA open 64099-64173 trnG tRNA-Gly(gcc)
4046 CABPUK010000007.1 GCA902460695_02014 tRNA open 64278-64353 trnA tRNA-Ala(ggc)
4047 CABPUK010000008.1 GCA902460695_02022 CDS open 465-722 _na     85_aa Phage protein
4048 CABPUK010000008.1 GCA902460695_02023 CDS open 782-967 _na     61_aa hypothetical protein
4049 CABPUK010000008.1 GCA902460695_02024 CDS open 958-1464 _na     168_aa hypothetical protein
4050 CABPUK010000008.1 GCA902460695_02025 CDS open 1465-2640 _na     391_aa DUF1173 domain-containing protein
4051 CABPUK010000008.1 GCA902460695_02026 CDS open 2664-4796 _na     710_aa ATP-dependent helicase
4052 CABPUK010000008.1 GCA902460695_02027 CDS open 4947-12323 _na     2458_aa DNA-directed RNA polymerase%2C omega subunit family protein
4053 CABPUK010000008.1 GCA902460695_02028 CDS open 12323-13741 _na     472_aa putative AAA domain-containing protein ycf46
4054 CABPUK010000008.1 GCA902460695_02029 CDS open 13752-14861 _na     369_aa parB ParB N-terminal domain-containing protein
4055 CABPUK010000008.1 GCA902460695_02030 CDS open 14861-15787 _na     308_aa hypothetical protein
4056 CABPUK010000008.1 GCA902460695_02031 CDS open 15784-16887 _na     367_aa hypothetical protein
4057 CABPUK010000008.1 GCA902460695_02032 CDS open 16887-20645 _na     1252_aa sbcC Exonuclease SbcC
4058 CABPUK010000008.1 GCA902460695_02033 CDS open 20666-21400 _na     244_aa hypothetical protein
4059 CABPUK010000008.1 GCA902460695_02034 CDS open 21795-22418 _na     207_aa hypothetical protein
4060 CABPUK010000008.1 GCA902460695_02035 CDS open 22449-22952 _na     167_aa hypothetical protein
4061 CABPUK010000008.1 GCA902460695_02036 CDS open 22976-23944 _na     322_aa ParM/StbA family protein
4062 CABPUK010000008.1 GCA902460695_02037 CDS open 24139-24357 _na     72_aa WGR domain-containing protein
4063 CABPUK010000008.1 GCA902460695_02038 CDS open 24453-25043 _na     196_aa yubB YubB ferredoxin-like domain-containing protein
4064 CABPUK010000008.1 GCA902460695_02039 CDS open 25057-25206 _na     49_aa hypothetical protein
4065 CABPUK010000008.1 GCA902460695_02040 CDS open 25336-25698 _na     120_aa hypothetical protein
4066 CABPUK010000008.1 GCA902460695_02041 CDS open 25693-26034 _na     113_aa hypothetical protein
4067 CABPUK010000008.1 GCA902460695_02042 CDS open 26010-26456 _na     148_aa HTH cro/C1-type domain-containing protein
4068 CABPUK010000008.1 GCA902460695_02043 CDS open 26546-27406 _na     286_aa DUF3822 domain-containing protein
4069 CABPUK010000008.1 GCA902460695_02044 CDS open 27414-28088 _na     224_aa hypothetical protein
4070 CABPUK010000008.1 GCA902460695_02045 CDS open 28184-28627 _na     147_aa hypothetical protein
4071 CABPUK010000008.1 GCA902460695_02046 CDS open 28624-28881 _na     85_aa hypothetical protein
4072 CABPUK010000008.1 GCA902460695_02047 CDS open 28904-29005 _na     33_aa hypothetical protein
4073 CABPUK010000008.1 GCA902460695_02048 CDS open 29063-29242 _na     59_aa hypothetical protein
4074 CABPUK010000008.1 GCA902460695_02049 CDS open 29253-29723 _na     156_aa hypothetical protein
4075 CABPUK010000008.1 GCA902460695_02050 CDS open 29749-30285 _na     178_aa yopX YopX family protein
4076 CABPUK010000008.1 GCA902460695_02051 CDS open 30300-30707 _na     135_aa yopX YopX protein domain-containing protein
4077 CABPUK010000008.1 GCA902460695_02052 CDS open 30884-31585 _na     233_aa hypothetical protein
4078 CABPUK010000008.1 GCA902460695_02053 CDS open 31596-32051 _na     151_aa single-stranded DNA-binding protein
4079 CABPUK010000008.1 GCA902460695_02054 CDS open 32237-33214 _na     325_aa Transcriptional regulator
4080 CABPUK010000008.1 GCA902460695_02055 CDS open 33208-33630 _na     140_aa hypothetical protein
4081 CABPUK010000008.1 GCA902460695_02056 CDS open 33764-34654 _na     296_aa Integrase-recombinase protein XERCD family
4082 CABPUK010000008.1 GCA902460695_02057 CDS open 34692-35144 _na     150_aa SET domain-containing protein
4083 CABPUK010000008.1 GCA902460695_02058 CDS open 35161-35361 _na     66_aa hypothetical protein
4084 CABPUK010000008.1 GCA902460695_02059 CDS open 35364-35651 _na     95_aa hypothetical protein
4085 CABPUK010000008.1 GCA902460695_02060 CDS open 35655-36029 _na     124_aa hypothetical protein
4086 CABPUK010000008.1 GCA902460695_02061 CDS open 36026-36295 _na     89_aa hypothetical protein
4087 CABPUK010000008.1 GCA902460695_02062 CDS open 36403-36786 _na     127_aa hypothetical protein
4088 CABPUK010000008.1 GCA902460695_02063 CDS open 36808-37398 _na     196_aa hypothetical protein
4089 CABPUK010000008.1 GCA902460695_02064 CDS open 37631-37837 _na     68_aa hypothetical protein
4090 CABPUK010000008.1 GCA902460695_02065 CDS open 37851-38273 _na     140_aa hypothetical protein
4091 CABPUK010000008.1 GCA902460695_02066 CDS open 38288-39892 _na     534_aa DUF4942 domain-containing protein
4092 CABPUK010000008.1 GCA902460695_02067 CDS open 39905-40144 _na     79_aa hypothetical protein
4093 CABPUK010000008.1 GCA902460695_02068 CDS open 40157-40438 _na     93_aa Phage protein
4094 CABPUK010000008.1 GCA902460695_02069 CDS open 40621-41298 _na     225_aa hypothetical protein
4095 CABPUK010000008.1 GCA902460695_02070 CDS open 41324-41530 _na     68_aa hypothetical protein
4096 CABPUK010000008.1 GCA902460695_02071 CDS open 41531-41953 _na     140_aa yopX YopX family protein
4097 CABPUK010000008.1 GCA902460695_02072 CDS open 41963-42187 _na     74_aa hypothetical protein
4098 CABPUK010000008.1 GCA902460695_02073 CDS open 42212-42502 _na     96_aa hypothetical protein
4099 CABPUK010000008.1 GCA902460695_02074 CDS open 42852-43466 _na     204_aa hypothetical protein
4100 CABPUK010000008.1 GCA902460695_02022 gene open 465-722
4101 CABPUK010000008.1 GCA902460695_02023 gene open 782-967
4102 CABPUK010000008.1 GCA902460695_02024 gene open 958-1464
4103 CABPUK010000008.1 GCA902460695_02025 gene open 1465-2640
4104 CABPUK010000008.1 GCA902460695_02026 gene open 2664-4796
4105 CABPUK010000008.1 GCA902460695_02027 gene open 4947-12323
4106 CABPUK010000008.1 GCA902460695_02028 gene open 12323-13741
4107 CABPUK010000008.1 GCA902460695_02029 gene open 13752-14861 parB
4108 CABPUK010000008.1 GCA902460695_02030 gene open 14861-15787
4109 CABPUK010000008.1 GCA902460695_02031 gene open 15784-16887
4110 CABPUK010000008.1 GCA902460695_02032 gene open 16887-20645 sbcC
4111 CABPUK010000008.1 GCA902460695_02033 gene open 20666-21400
4112 CABPUK010000008.1 GCA902460695_02034 gene open 21795-22418
4113 CABPUK010000008.1 GCA902460695_02035 gene open 22449-22952
4114 CABPUK010000008.1 GCA902460695_02036 gene open 22976-23944
4115 CABPUK010000008.1 GCA902460695_02037 gene open 24139-24357
4116 CABPUK010000008.1 GCA902460695_02038 gene open 24453-25043 yubB
4117 CABPUK010000008.1 GCA902460695_02039 gene open 25057-25206
4118 CABPUK010000008.1 GCA902460695_02040 gene open 25336-25698
4119 CABPUK010000008.1 GCA902460695_02041 gene open 25693-26034
4120 CABPUK010000008.1 GCA902460695_02042 gene open 26010-26456
4121 CABPUK010000008.1 GCA902460695_02043 gene open 26546-27406
4122 CABPUK010000008.1 GCA902460695_02044 gene open 27414-28088
4123 CABPUK010000008.1 GCA902460695_02045 gene open 28184-28627
4124 CABPUK010000008.1 GCA902460695_02046 gene open 28624-28881
4125 CABPUK010000008.1 GCA902460695_02047 gene open 28904-29005
4126 CABPUK010000008.1 GCA902460695_02048 gene open 29063-29242
4127 CABPUK010000008.1 GCA902460695_02049 gene open 29253-29723
4128 CABPUK010000008.1 GCA902460695_02050 gene open 29749-30285 yopX
4129 CABPUK010000008.1 GCA902460695_02051 gene open 30300-30707 yopX
4130 CABPUK010000008.1 GCA902460695_02052 gene open 30884-31585
4131 CABPUK010000008.1 GCA902460695_02053 gene open 31596-32051
4132 CABPUK010000008.1 GCA902460695_02054 gene open 32237-33214
4133 CABPUK010000008.1 GCA902460695_02055 gene open 33208-33630
4134 CABPUK010000008.1 GCA902460695_02056 gene open 33764-34654
4135 CABPUK010000008.1 GCA902460695_02057 gene open 34692-35144
4136 CABPUK010000008.1 GCA902460695_02058 gene open 35161-35361
4137 CABPUK010000008.1 GCA902460695_02059 gene open 35364-35651
4138 CABPUK010000008.1 GCA902460695_02060 gene open 35655-36029
4139 CABPUK010000008.1 GCA902460695_02061 gene open 36026-36295
4140 CABPUK010000008.1 GCA902460695_02062 gene open 36403-36786
4141 CABPUK010000008.1 GCA902460695_02063 gene open 36808-37398
4142 CABPUK010000008.1 GCA902460695_02064 gene open 37631-37837
4143 CABPUK010000008.1 GCA902460695_02065 gene open 37851-38273
4144 CABPUK010000008.1 GCA902460695_02066 gene open 38288-39892
4145 CABPUK010000008.1 GCA902460695_02067 gene open 39905-40144
4146 CABPUK010000008.1 GCA902460695_02068 gene open 40157-40438
4147 CABPUK010000008.1 GCA902460695_02069 gene open 40621-41298
4148 CABPUK010000008.1 GCA902460695_02070 gene open 41324-41530
4149 CABPUK010000008.1 GCA902460695_02071 gene open 41531-41953 yopX
4150 CABPUK010000008.1 GCA902460695_02072 gene open 41963-42187
4151 CABPUK010000008.1 GCA902460695_02073 gene open 42212-42502
4152 CABPUK010000008.1 GCA902460695_02074 gene open 42852-43466
4153 CABPUK010000009.1 repeat_region open 6042-6208 CRISPR array with 3 repeats of length 30%2C consensus sequence GTTTTAAACAATGTAGTGAAGGTTTAGAAC and spacer length 33
4154 CABPUK010000009.1 GCA902460695_02075 CDS open 410-2239 _na     609_aa yoaA DinG family ATP-dependent helicase YoaA
4155 CABPUK010000009.1 GCA902460695_02076 CDS open 2339-3772 _na     477_aa CRISPR-associated protein
4156 CABPUK010000009.1 GCA902460695_02077 CDS open 3773-4444 _na     223_aa hypothetical protein
4157 CABPUK010000009.1 GCA902460695_02078 CDS open 4462-5472 _na     336_aa RAMP superfamily CRISPR-associated protein
4158 CABPUK010000009.1 GCA902460695_02079 CDS open 7660-8235 _na     191_aa tyrosine-type recombinase/integrase
4159 CABPUK010000009.1 GCA902460695_02075 gene open 410-2239 yoaA
4160 CABPUK010000009.1 GCA902460695_02076 gene open 2339-3772
4161 CABPUK010000009.1 GCA902460695_02077 gene open 3773-4444
4162 CABPUK010000009.1 GCA902460695_02078 gene open 4462-5472
4163 CABPUK010000009.1 GCA902460695_02079 gene open 7660-8235
4164 CABPUK010000010.1 GCA902460695_02080 CDS open 72-1844 _na     590_aa shlA Putative large exoprotein involved in heme utilization or adhesion of ShlA
4165 CABPUK010000010.1 GCA902460695_02081 CDS open 1841-2029 _na     62_aa Integral membrane protein
4166 CABPUK010000010.1 GCA902460695_02082 CDS open 2103-2288 _na     61_aa hypothetical protein
4167 CABPUK010000010.1 GCA902460695_02083 CDS open 2293-2592 _na     99_aa hypothetical protein
4168 CABPUK010000010.1 GCA902460695_02084 CDS open 2562-2939 _na     125_aa hypothetical protein
4169 CABPUK010000010.1 GCA902460695_02085 CDS open 2936-3220 _na     94_aa hypothetical protein
4170 CABPUK010000010.1 GCA902460695_02086 CDS open 3345-3629 _na     94_aa Putative membrane protein
4171 CABPUK010000010.1 GCA902460695_02080 gene open 72-1844 shlA
4172 CABPUK010000010.1 GCA902460695_02081 gene open 1841-2029
4173 CABPUK010000010.1 GCA902460695_02082 gene open 2103-2288
4174 CABPUK010000010.1 GCA902460695_02083 gene open 2293-2592
4175 CABPUK010000010.1 GCA902460695_02084 gene open 2562-2939
4176 CABPUK010000010.1 GCA902460695_02085 gene open 2936-3220
4177 CABPUK010000010.1 GCA902460695_02086 gene open 3345-3629
4178 CABPUK010000011.1 GCA902460695_02087 CDS open 434-1288 _na     284_aa repL Plasmid replication protein RepL domain-containing protein
4179 CABPUK010000011.1 GCA902460695_02088 CDS open 1288-1686 _na     132_aa PIN domain-containing protein
4180 CABPUK010000011.1 GCA902460695_02089 CDS open 2376-3668 _na     430_aa DNA primase
4181 CABPUK010000011.1 GCA902460695_02087 gene open 434-1288 repL
4182 CABPUK010000011.1 GCA902460695_02088 gene open 1288-1686
4183 CABPUK010000011.1 GCA902460695_02089 gene open 2376-3668
4184 CABPUK010000012.1 GCA902460695_02090 CDS open 1161-1418 _na     85_aa Phage protein
4185 CABPUK010000012.1 GCA902460695_02091 CDS open 1441-1872 _na     143_aa bspA BspA family leucine-rich repeat surface protein
4186 CABPUK010000012.1 GCA902460695_02092 CDS open 1869-1982 _na     37_aa hypothetical protein
4187 CABPUK010000012.1 GCA902460695_02093 CDS open 2066-2701 _na     211_aa Putative ATPase
4188 CABPUK010000012.1 GCA902460695_02090 gene open 1161-1418
4189 CABPUK010000012.1 GCA902460695_02091 gene open 1441-1872 bspA
4190 CABPUK010000012.1 GCA902460695_02092 gene open 1869-1982
4191 CABPUK010000012.1 GCA902460695_02093 gene open 2066-2701
4192 CABPUK010000013.1 GCA902460695_02094 CDS open 96-1262 _na     388_aa DUF4885 domain-containing protein
4193 CABPUK010000013.1 GCA902460695_02094 gene open 96-1262
4194 CABPUK010000014.1 GCA902460695_02095 CDS open 59-310 _na     83_aa Antitoxin
4195 CABPUK010000014.1 GCA902460695_02096 CDS open 614-1342 _na     242_aa 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine pyrophosphokinase
4196 CABPUK010000014.1 GCA902460695_02095 gene open 59-310
4197 CABPUK010000014.1 GCA902460695_02096 gene open 614-1342
4198 CABPUK010000015.1 GCA902460695_02097 CDS open 31-1239 _na     402_aa HipA-like kinase domain-containing protein
4199 CABPUK010000015.1 GCA902460695_02097 gene open 31-1239
4200 CABPUK010000016.1 GCA902460695_02098 CDS open 48-251 _na     67_aa diadenosine tetraphosphate hydrolase
4201 CABPUK010000016.1 GCA902460695_02099 CDS open 320-970 _na     216_aa tRNA 2-selenouridine synthase
4202 CABPUK010000016.1 GCA902460695_02098 gene open 48-251
4203 CABPUK010000016.1 GCA902460695_02099 gene open 320-970