HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Campylobacter concisus clade-433 (GCA_902460695.1)

Select a Genome:
BAKTA Annotations for GCA_902460695.1
Genome Selected: Campylobacter concisus clade-433
ContigsBases CDSrRNA tmRNAtRNA
16 2128539 2039 7 1 49
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4203 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:8]    |    Number of Records Found: 4203 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
3501 CABPUK010000004.1 GCA902460695_01681 gene open 85517-86161
3502 CABPUK010000004.1 GCA902460695_01682 gene open 86402-87058 dsbA
3503 CABPUK010000004.1 GCA902460695_01683 gene open 87067-87687 dsbI
3504 CABPUK010000004.1 GCA902460695_01684 gene open 87735-89384
3505 CABPUK010000004.1 GCA902460695_01685 gene open 89388-90068
3506 CABPUK010000004.1 GCA902460695_01686 gene open 90138-90320
3507 CABPUK010000004.1 GCA902460695_01687 gene open 90591-93491
3508 CABPUK010000004.1 GCA902460695_01688 gene open 93620-97759
3509 CABPUK010000004.1 GCA902460695_01689 gene open 97909-98445
3510 CABPUK010000004.1 GCA902460695_01690 gene open 98533-99267
3511 CABPUK010000004.1 GCA902460695_01691 gene open 99303-100976 ilvD
3512 CABPUK010000004.1 GCA902460695_01692 gene open 101070-102104
3513 CABPUK010000004.1 GCA902460695_01693 gene open 102466-105666
3514 CABPUK010000004.1 GCA902460695_01694 gene open 105839-107245
3515 CABPUK010000004.1 GCA902460695_01695 gene open 107406-111785
3516 CABPUK010000004.1 GCA902460695_01696 gene open 111953-114319
3517 CABPUK010000004.1 GCA902460695_01697 gene open 119916-123071
3518 CABPUK010000004.1 GCA902460695_01698 gene open 123208-126945
3519 CABPUK010000004.1 GCA902460695_01699 gene open 127015-127365
3520 CABPUK010000004.1 GCA902460695_01700 gene open 127402-129168
3521 CABPUK010000004.1 GCA902460695_01701 gene open 129322-129423
3522 CABPUK010000004.1 GCA902460695_01702 gene open 129433-130557
3523 CABPUK010000004.1 GCA902460695_01703 gene open 130550-132085
3524 CABPUK010000004.1 GCA902460695_01704 gene open 132429-134063
3525 CABPUK010000004.1 GCA902460695_01705 gene open 134223-134825
3526 CABPUK010000004.1 GCA902460695_01706 gene open 135138-136712 recJ
3527 CABPUK010000004.1 GCA902460695_01707 gene open 136919-137503
3528 CABPUK010000004.1 GCA902460695_01708 gene open 137610-137993 lprI
3529 CABPUK010000004.1 GCA902460695_01709 gene open 138019-138237
3530 CABPUK010000004.1 GCA902460695_01710 gene open 138406-138990
3531 CABPUK010000004.1 GCA902460695_01711 gene open 139245-139730
3532 CABPUK010000004.1 GCA902460695_01712 gene open 139749-140381
3533 CABPUK010000004.1 GCA902460695_01713 gene open 140442-141209
3534 CABPUK010000004.1 GCA902460695_01714 gene open 141210-141704
3535 CABPUK010000004.1 GCA902460695_01715 gene open 141691-142713
3536 CABPUK010000004.1 GCA902460695_01716 gene open 142785-143909
3537 CABPUK010000004.1 GCA902460695_01717 gene open 143990-144730
3538 CABPUK010000004.1 GCA902460695_01722 gene open 145295-145450
3539 CABPUK010000004.1 GCA902460695_01724 gene open 145902-146318
3540 CABPUK010000004.1 GCA902460695_01725 gene open 146325-146855 tpx
3541 CABPUK010000004.1 GCA902460695_01726 gene open 146865-148007
3542 CABPUK010000004.1 GCA902460695_01727 gene open 148225-148680
3543 CABPUK010000004.1 GCA902460695_01728 gene open 148769-149935
3544 CABPUK010000004.1 GCA902460695_01729 gene open 150842-151459 sodB
3545 CABPUK010000004.1 GCA902460695_01730 gene open 152040-153032 dctP
3546 CABPUK010000004.1 GCA902460695_01731 gene open 153032-153574 dctQ
3547 CABPUK010000004.1 GCA902460695_01732 gene open 153586-154869 dctM
3548 CABPUK010000004.1 GCA902460695_01733 gene open 154895-155944
3549 CABPUK010000004.1 GCA902460695_01734 gene open 155937-157031
3550 CABPUK010000004.1 GCA902460695_01735 gene open 157077-157235
3551 CABPUK010000004.1 GCA902460695_01736 gene open 157246-159090
3552 CABPUK010000004.1 GCA902460695_01737 gene open 159083-159727
3553 CABPUK010000004.1 GCA902460695_01738 gene open 159898-160596
3554 CABPUK010000004.1 GCA902460695_01739 gene open 160589-160972 thiD2
3555 CABPUK010000004.1 GCA902460695_01740 gene open 161035-161364 secG
3556 CABPUK010000004.1 GCA902460695_01741 gene open 161367-162326
3557 CABPUK010000004.1 GCA902460695_01742 gene open 162316-162873 frr
3558 CABPUK010000004.1 GCA902460695_01743 gene open 162981-163658
3559 CABPUK010000004.1 GCA902460695_01744 gene open 163760-166135
3560 CABPUK010000004.1 GCA902460695_01745 gene open 166139-166669
3561 CABPUK010000004.1 GCA902460695_01746 gene open 166741-167295 rnhB
3562 CABPUK010000004.1 GCA902460695_01747 gene open 167295-168149
3563 CABPUK010000004.1 GCA902460695_01748 gene open 168230-169324
3564 CABPUK010000004.1 GCA902460695_01749 gene open 169688-169996 rpsJ
3565 CABPUK010000004.1 GCA902460695_01750 gene open 170017-170595 rplC
3566 CABPUK010000004.1 GCA902460695_01751 gene open 170592-171206 rplD
3567 CABPUK010000004.1 GCA902460695_01752 gene open 171208-171489 rplW
3568 CABPUK010000004.1 GCA902460695_01753 gene open 171491-172324 rplB
3569 CABPUK010000004.1 GCA902460695_01754 gene open 172327-172608 rpsS
3570 CABPUK010000004.1 GCA902460695_01755 gene open 172620-172952 rplV
3571 CABPUK010000004.1 GCA902460695_01756 gene open 172954-173652 rpsC
3572 CABPUK010000004.1 GCA902460695_01757 gene open 173655-174080 rplP
3573 CABPUK010000004.1 GCA902460695_01758 gene open 174067-174261 rpmC
3574 CABPUK010000004.1 GCA902460695_01759 gene open 174263-174514 rpsQ
3575 CABPUK010000004.1 GCA902460695_01760 gene open 174514-174882 rplN
3576 CABPUK010000004.1 GCA902460695_01761 gene open 174882-175118 rplX
3577 CABPUK010000004.1 GCA902460695_01762 gene open 175124-175669 rplE
3578 CABPUK010000004.1 GCA902460695_01763 gene open 175671-175856 rpsZ
3579 CABPUK010000004.1 GCA902460695_01764 gene open 175866-176261 rpsH
3580 CABPUK010000004.1 GCA902460695_01765 gene open 176459-176995 rplF
3581 CABPUK010000004.1 GCA902460695_01766 gene open 177006-177362 rplR
3582 CABPUK010000004.1 GCA902460695_01767 gene open 177378-177821 rpsE
3583 CABPUK010000004.1 GCA902460695_01768 gene open 177837-178238 rplO
3584 CABPUK010000004.1 GCA902460695_01769 gene open 178238-179500 secY
3585 CABPUK010000004.1 GCA902460695_01770 gene open 179502-180260 map
3586 CABPUK010000004.1 GCA902460695_01771 gene open 180294-180512 infA
3587 CABPUK010000004.1 GCA902460695_01772 gene open 180819-181187 rpsM
3588 CABPUK010000004.1 GCA902460695_01773 gene open 181210-181602 rpsK
3589 CABPUK010000004.1 GCA902460695_01774 gene open 181628-182254 rpsD
3590 CABPUK010000004.1 GCA902460695_01775 gene open 182269-183285 rpoA
3591 CABPUK010000004.1 GCA902460695_01776 gene open 183297-183653 rplQ
3592 CABPUK010000004.1 GCA902460695_01777 gene open 184533-185507
3593 CABPUK010000004.1 GCA902460695_01778 gene open 185612-186223
3594 CABPUK010000004.1 GCA902460695_01779 gene open 186220-186969
3595 CABPUK010000004.1 GCA902460695_01780 gene open 186966-187658
3596 CABPUK010000004.1 GCA902460695_01781 gene open 187733-188653
3597 CABPUK010000004.1 GCA902460695_01782 gene open 188790-189065 nifU
3598 CABPUK010000004.1 GCA902460695_01783 gene open 189052-189606
3599 CABPUK010000004.1 GCA902460695_01784 gene open 189584-190867
3600 CABPUK010000004.1 GCA902460695_01785 gene open 190886-191455
3601 CABPUK010000004.1 GCA902460695_01786 gene open 191473-191820 panD
3602 CABPUK010000004.1 GCA902460695_01787 gene open 191824-192138
3603 CABPUK010000004.1 GCA902460695_01788 gene open 192135-193244
3604 CABPUK010000004.1 GCA902460695_01789 gene open 193241-194140
3605 CABPUK010000004.1 GCA902460695_01790 gene open 194248-196158 tkt
3606 CABPUK010000004.1 GCA902460695_01791 gene open 196217-197011 uppP
3607 CABPUK010000004.1 GCA902460695_01792 gene open 197081-198319
3608 CABPUK010000004.1 GCA902460695_01793 gene open 198329-198595
3609 CABPUK010000004.1 GCA902460695_01794 gene open 198570-199043 moaC
3610 CABPUK010000004.1 GCA902460695_01795 gene open 199465-200283
3611 CABPUK010000004.1 GCA902460695_01796 gene open 200296-202884
3612 CABPUK010000004.1 GCA902460695_01797 gene open 202966-203721
3613 CABPUK010000004.1 GCA902460695_01798 gene open 203714-204970 nosD
3614 CABPUK010000004.1 GCA902460695_01799 gene open 204963-205640 nosG
3615 CABPUK010000004.1 GCA902460695_01800 gene open 205637-206188
3616 CABPUK010000004.1 GCA902460695_01801 gene open 206185-206646
3617 CABPUK010000004.1 GCA902460695_01802 gene open 206649-207548 nosH
3618 CABPUK010000004.1 GCA902460695_01803 gene open 207558-208211
3619 CABPUK010000004.1 GCA902460695_01804 gene open 208204-209031 nosY
3620 CABPUK010000004.1 GCA902460695_01805 gene open 209165-209572
3621 CABPUK010000004.1 GCA902460695_01806 gene open 210273-210785
3622 CABPUK010000004.1 GCA902460695_01807 gene open 210782-212356
3623 CABPUK010000004.1 GCA902460695_01809 gene open 212546-213028
3624 CABPUK010000004.1 GCA902460695_01810 gene open 213031-213834
3625 CABPUK010000004.1 GCA902460695_01811 gene open 214551-215519
3626 CABPUK010000004.1 GCA902460695_01812 gene open 215629-216075 copG
3627 CABPUK010000004.1 GCA902460695_01813 gene open 216115-217428
3628 CABPUK010000004.1 GCA902460695_01814 gene open 217599-218939 corC
3629 CABPUK010000004.1 GCA902460695_01815 gene open 219371-220042
3630 CABPUK010000004.1 GCA902460695_01816 gene open 220043-220933
3631 CABPUK010000004.1 GCA902460695_01817 gene open 220944-221507 lemA
3632 CABPUK010000004.1 GCA902460695_01818 gene open 221666-222511
3633 CABPUK010000004.1 GCA902460695_01819 gene open 222521-223081
3634 CABPUK010000004.1 GCA902460695_01820 gene open 223124-223663
3635 CABPUK010000004.1 GCA902460695_01821 gene open 223641-224114
3636 CABPUK010000004.1 GCA902460695_01822 gene open 224209-224583
3637 CABPUK010000004.1 GCA902460695_01823 gene open 224670-229730
3638 CABPUK010000004.1 GCA902460695_01718 gene open 144833-144908 trnA
3639 CABPUK010000004.1 GCA902460695_01719 gene open 145013-145087 trnG
3640 CABPUK010000004.1 GCA902460695_01720 gene open 145096-145182 trnL
3641 CABPUK010000004.1 GCA902460695_01721 gene open 145190-145263 trnC
3642 CABPUK010000004.1 GCA902460695_01723 gene open 145509-145598 trnS
3643 CABPUK010000004.1 GCA902460695_01808 gene open 212415-212502 trnS
3644 CABPUK010000004.1 GCA902460695_01718 tRNA open 144833-144908 trnA tRNA-Ala(ggc)
3645 CABPUK010000004.1 GCA902460695_01719 tRNA open 145013-145087 trnG tRNA-Gly(gcc)
3646 CABPUK010000004.1 GCA902460695_01720 tRNA open 145096-145182 trnL tRNA-Leu(taa)
3647 CABPUK010000004.1 GCA902460695_01721 tRNA open 145190-145263 trnC tRNA-Cys(gca)
3648 CABPUK010000004.1 GCA902460695_01723 tRNA open 145509-145598 trnS tRNA-Ser(tga)
3649 CABPUK010000004.1 GCA902460695_01808 tRNA open 212415-212502 trnS tRNA-Ser(gga)
3650 CABPUK010000005.1 GCA902460695_01826 gene open 683-2193 rrs
3651 CABPUK010000005.1 GCA902460695_01826 rRNA open 683-2193 rrs 16S ribosomal RNA
3652 CABPUK010000005.1 GCA902460695_01827 CDS open 9196-9615 _na     139_aa hypothetical protein
3653 CABPUK010000005.1 GCA902460695_01828 CDS open 9608-10048 _na     146_aa hypothetical protein
3654 CABPUK010000005.1 GCA902460695_01829 CDS open 10100-10402 _na     100_aa Membrane protein
3655 CABPUK010000005.1 GCA902460695_01830 CDS open 10392-10832 _na     146_aa hypothetical protein
3656 CABPUK010000005.1 GCA902460695_01831 CDS open 11894-12256 _na     120_aa hypothetical protein
3657 CABPUK010000005.1 GCA902460695_01832 CDS open 12287-12715 _na     142_aa hypothetical protein
3658 CABPUK010000005.1 GCA902460695_01833 CDS open 12715-13044 _na     109_aa hypothetical protein
3659 CABPUK010000005.1 GCA902460695_01834 CDS open 13099-13599 _na     166_aa hypothetical protein
3660 CABPUK010000005.1 GCA902460695_01835 CDS open 13816-14100 _na     94_aa hypothetical protein
3661 CABPUK010000005.1 GCA902460695_01836 CDS open 14154-14630 _na     158_aa hypothetical protein
3662 CABPUK010000005.1 GCA902460695_01837 CDS open 14899-15186 _na     95_aa hypothetical protein
3663 CABPUK010000005.1 GCA902460695_01838 CDS open 15203-16021 _na     272_aa Lipoprotein
3664 CABPUK010000005.1 GCA902460695_01839 CDS open 16023-16898 _na     291_aa Lipoprotein
3665 CABPUK010000005.1 GCA902460695_01840 CDS open 16877-18763 _na     628_aa hemagglutinin repeat-containing protein
3666 CABPUK010000005.1 GCA902460695_01841 CDS open 27185-28957 _na     590_aa Hemolysin secretion/activation protein%2C ShlB/FhaC/HecB family
3667 CABPUK010000005.1 GCA902460695_01842 CDS open 29596-30348 _na     250_aa DUF4198 domain-containing protein
3668 CABPUK010000005.1 GCA902460695_01849 CDS open 31804-32532 _na     242_aa HEAT repeat domain-containing protein
3669 CABPUK010000005.1 GCA902460695_01850 CDS open 32539-34947 _na     802_aa Flagellar protein
3670 CABPUK010000005.1 GCA902460695_01851 CDS open 34931-36421 _na     496_aa nuoN NADH-quinone oxidoreductase subunit NuoN
3671 CABPUK010000005.1 GCA902460695_01852 CDS open 36418-37929 _na     503_aa NADH-quinone oxidoreductase subunit M
3672 CABPUK010000005.1 GCA902460695_01853 CDS open 37929-39767 _na     612_aa nuoL NADH-quinone oxidoreductase subunit L
3673 CABPUK010000005.1 GCA902460695_01854 CDS open 39771-40073 _na     100_aa nuoK NADH-quinone oxidoreductase subunit NuoK
3674 CABPUK010000005.1 GCA902460695_01855 CDS open 40070-40606 _na     178_aa NADH-quinone oxidoreductase subunit J
3675 CABPUK010000005.1 GCA902460695_01856 CDS open 40599-41237 _na     212_aa nuoI NADH-quinone oxidoreductase subunit NuoI
3676 CABPUK010000005.1 GCA902460695_01857 CDS open 41246-42241 _na     331_aa nuoH NADH-quinone oxidoreductase subunit NuoH
3677 CABPUK010000005.1 GCA902460695_01858 CDS open 42234-44534 _na     766_aa NADH-quinone oxidoreductase subunit G
3678 CABPUK010000005.1 GCA902460695_01859 CDS open 44531-45241 _na     236_aa NADH dehydrogenase
3679 CABPUK010000005.1 GCA902460695_01860 CDS open 45238-45468 _na     76_aa NADH-ubiquinone oxidoreductase chain E
3680 CABPUK010000005.1 GCA902460695_01861 CDS open 45465-46694 _na     409_aa nuoD NADH-quinone oxidoreductase subunit D
3681 CABPUK010000005.1 GCA902460695_01862 CDS open 46691-47455 _na     254_aa NADH-quinone oxidoreductase subunit C
3682 CABPUK010000005.1 GCA902460695_01863 CDS open 47452-47964 _na     170_aa nuoB NADH-quinone oxidoreductase subunit B
3683 CABPUK010000005.1 GCA902460695_01864 CDS open 47946-48335 _na     129_aa NAD(P)H-quinone oxidoreductase subunit 3
3684 CABPUK010000005.1 GCA902460695_01865 CDS open 48442-50079 _na     545_aa multidrug ABC transporter permease/ATP-binding protein
3685 CABPUK010000005.1 GCA902460695_01866 CDS open 50079-51443 _na     454_aa coproporphyrinogen III oxidase family protein
3686 CABPUK010000005.1 GCA902460695_01867 CDS open 51634-52950 _na     438_aa ABC transporter permease
3687 CABPUK010000005.1 GCA902460695_01868 CDS open 52985-53776 _na     263_aa DUF2314 domain-containing protein
3688 CABPUK010000005.1 GCA902460695_01869 CDS open 54049-54546 _na     165_aa yajQ YajQ family cyclic di-GMP-binding protein
3689 CABPUK010000005.1 GCA902460695_01870 CDS open 54550-55479 _na     309_aa D-2-hydroxyacid dehydrogenase
3690 CABPUK010000005.1 GCA902460695_01871 CDS open 55482-56663 _na     393_aa Glutathionylspermidine amidase / glutathionylspermidine synthetase
3691 CABPUK010000005.1 GCA902460695_01872 CDS open 56666-57283 _na     205_aa Lipoprotein
3692 CABPUK010000005.1 GCA902460695_01873 CDS open 57280-57912 _na     210_aa Excisionase family DNA binding domain-containing protein
3693 CABPUK010000005.1 GCA902460695_01874 CDS open 58016-58228 _na     70_aa rpsU 30S ribosomal protein S21
3694 CABPUK010000005.1 GCA902460695_01875 CDS open 58372-59697 _na     441_aa ccoG cytochrome c oxidase accessory protein CcoG
3695 CABPUK010000005.1 GCA902460695_01876 CDS open 59728-60354 _na     208_aa cmeR Transcriptional repressor of CmeABC operon%2C CmeR
3696 CABPUK010000005.1 GCA902460695_01877 CDS open 60462-61622 _na     386_aa cmeA Multidrug efflux system CmeABC%2C periplasmic fusion protein CmeA
3697 CABPUK010000005.1 GCA902460695_01878 CDS open 61633-64752 _na     1039_aa cmeB Multidrug efflux system CmeABC%2C inner membrane drug transporter CmeB
3698 CABPUK010000005.1 GCA902460695_01879 CDS open 64749-66131 _na     460_aa RND transporter
3699 CABPUK010000005.1 GCA902460695_01880 CDS open 66153-66380 _na     75_aa ATP-binding protein
3700 CABPUK010000005.1 GCA902460695_01881 CDS open 66510-67217 _na     235_aa aqpZ aquaporin Z
3701 CABPUK010000005.1 GCA902460695_01882 CDS open 67459-70308 _na     949_aa vgrG Type VI secretion system tip protein VgrG
3702 CABPUK010000005.1 GCA902460695_01883 CDS open 70308-70853 _na     181_aa Ankyrin repeat domain-containing protein
3703 CABPUK010000005.1 GCA902460695_01884 CDS open 70853-71410 _na     185_aa Ankyrin repeat domain-containing protein
3704 CABPUK010000005.1 GCA902460695_01885 CDS open 71407-72042 _na     211_aa Membrane protein
3705 CABPUK010000005.1 GCA902460695_01886 CDS open 72032-72460 _na     142_aa hypothetical protein
3706 CABPUK010000005.1 GCA902460695_01887 CDS open 72460-73005 _na     181_aa Ankyrin repeat domain-containing protein
3707 CABPUK010000005.1 GCA902460695_01888 CDS open 73002-73562 _na     186_aa Ankyrin
3708 CABPUK010000005.1 GCA902460695_01889 CDS open 73672-74193 _na     173_aa Hcp family type VI secretion system effector
3709 CABPUK010000005.1 GCA902460695_01890 CDS open 74258-75175 _na     305_aa Type VI secretion system protein
3710 CABPUK010000005.1 GCA902460695_01891 CDS open 75185-78673 _na     1162_aa tssM type VI secretion system membrane subunit TssM
3711 CABPUK010000005.1 GCA902460695_01892 CDS open 78751-79647 _na     298_aa Type VI secretion protein
3712 CABPUK010000005.1 GCA902460695_01893 CDS open 79644-81362 _na     572_aa tssF type VI secretion system baseplate subunit TssF
3713 CABPUK010000005.1 GCA902460695_01894 CDS open 81362-81751 _na     129_aa GPW/gp25 family protein
3714 CABPUK010000005.1 GCA902460695_01895 CDS open 81760-83208 _na     482_aa tssC type VI secretion system contractile sheath large subunit
3715 CABPUK010000005.1 GCA902460695_01896 CDS open 83211-83696 _na     161_aa tssB type VI secretion system contractile sheath small subunit
3716 CABPUK010000005.1 GCA902460695_01897 CDS open 83777-85057 _na     426_aa Type VI secretion system protein
3717 CABPUK010000005.1 GCA902460695_01898 CDS open 85058-85822 _na     254_aa icmH type IVB secretion system protein IcmH/DotU
3718 CABPUK010000005.1 GCA902460695_01899 CDS open 85832-87226 _na     464_aa tssK type VI secretion system baseplate subunit TssK
3719 CABPUK010000005.1 GCA902460695_01900 CDS open 87228-87695 _na     155_aa tssJ type VI secretion system lipoprotein TssJ
3720 CABPUK010000005.1 GCA902460695_01901 CDS open 87811-89169 _na     452_aa Thioredoxin reductase
3721 CABPUK010000005.1 GCA902460695_01902 CDS open 89173-90003 _na     276_aa 3-deoxy-D-arabinoheptulosonate-7-phosphate synthase
3722 CABPUK010000005.1 GCA902460695_01903 CDS open 90022-90909 _na     295_aa thioredoxin reductase
3723 CABPUK010000005.1 GCA902460695_01827 gene open 9196-9615
3724 CABPUK010000005.1 GCA902460695_01828 gene open 9608-10048
3725 CABPUK010000005.1 GCA902460695_01829 gene open 10100-10402
3726 CABPUK010000005.1 GCA902460695_01830 gene open 10392-10832
3727 CABPUK010000005.1 GCA902460695_01831 gene open 11894-12256
3728 CABPUK010000005.1 GCA902460695_01832 gene open 12287-12715
3729 CABPUK010000005.1 GCA902460695_01833 gene open 12715-13044
3730 CABPUK010000005.1 GCA902460695_01834 gene open 13099-13599
3731 CABPUK010000005.1 GCA902460695_01835 gene open 13816-14100
3732 CABPUK010000005.1 GCA902460695_01836 gene open 14154-14630
3733 CABPUK010000005.1 GCA902460695_01837 gene open 14899-15186
3734 CABPUK010000005.1 GCA902460695_01838 gene open 15203-16021
3735 CABPUK010000005.1 GCA902460695_01839 gene open 16023-16898
3736 CABPUK010000005.1 GCA902460695_01840 gene open 16877-18763
3737 CABPUK010000005.1 GCA902460695_01841 gene open 27185-28957
3738 CABPUK010000005.1 GCA902460695_01842 gene open 29596-30348
3739 CABPUK010000005.1 GCA902460695_01849 gene open 31804-32532
3740 CABPUK010000005.1 GCA902460695_01850 gene open 32539-34947
3741 CABPUK010000005.1 GCA902460695_01851 gene open 34931-36421 nuoN
3742 CABPUK010000005.1 GCA902460695_01852 gene open 36418-37929
3743 CABPUK010000005.1 GCA902460695_01853 gene open 37929-39767 nuoL
3744 CABPUK010000005.1 GCA902460695_01854 gene open 39771-40073 nuoK
3745 CABPUK010000005.1 GCA902460695_01855 gene open 40070-40606
3746 CABPUK010000005.1 GCA902460695_01856 gene open 40599-41237 nuoI
3747 CABPUK010000005.1 GCA902460695_01857 gene open 41246-42241 nuoH
3748 CABPUK010000005.1 GCA902460695_01858 gene open 42234-44534
3749 CABPUK010000005.1 GCA902460695_01859 gene open 44531-45241
3750 CABPUK010000005.1 GCA902460695_01860 gene open 45238-45468
3751 CABPUK010000005.1 GCA902460695_01861 gene open 45465-46694 nuoD
3752 CABPUK010000005.1 GCA902460695_01862 gene open 46691-47455
3753 CABPUK010000005.1 GCA902460695_01863 gene open 47452-47964 nuoB
3754 CABPUK010000005.1 GCA902460695_01864 gene open 47946-48335
3755 CABPUK010000005.1 GCA902460695_01865 gene open 48442-50079
3756 CABPUK010000005.1 GCA902460695_01866 gene open 50079-51443
3757 CABPUK010000005.1 GCA902460695_01867 gene open 51634-52950
3758 CABPUK010000005.1 GCA902460695_01868 gene open 52985-53776
3759 CABPUK010000005.1 GCA902460695_01869 gene open 54049-54546 yajQ
3760 CABPUK010000005.1 GCA902460695_01870 gene open 54550-55479
3761 CABPUK010000005.1 GCA902460695_01871 gene open 55482-56663
3762 CABPUK010000005.1 GCA902460695_01872 gene open 56666-57283
3763 CABPUK010000005.1 GCA902460695_01873 gene open 57280-57912
3764 CABPUK010000005.1 GCA902460695_01874 gene open 58016-58228 rpsU
3765 CABPUK010000005.1 GCA902460695_01875 gene open 58372-59697 ccoG
3766 CABPUK010000005.1 GCA902460695_01876 gene open 59728-60354 cmeR
3767 CABPUK010000005.1 GCA902460695_01877 gene open 60462-61622 cmeA
3768 CABPUK010000005.1 GCA902460695_01878 gene open 61633-64752 cmeB
3769 CABPUK010000005.1 GCA902460695_01879 gene open 64749-66131
3770 CABPUK010000005.1 GCA902460695_01880 gene open 66153-66380
3771 CABPUK010000005.1 GCA902460695_01881 gene open 66510-67217 aqpZ
3772 CABPUK010000005.1 GCA902460695_01882 gene open 67459-70308 vgrG
3773 CABPUK010000005.1 GCA902460695_01883 gene open 70308-70853
3774 CABPUK010000005.1 GCA902460695_01884 gene open 70853-71410
3775 CABPUK010000005.1 GCA902460695_01885 gene open 71407-72042
3776 CABPUK010000005.1 GCA902460695_01886 gene open 72032-72460
3777 CABPUK010000005.1 GCA902460695_01887 gene open 72460-73005
3778 CABPUK010000005.1 GCA902460695_01888 gene open 73002-73562
3779 CABPUK010000005.1 GCA902460695_01889 gene open 73672-74193
3780 CABPUK010000005.1 GCA902460695_01890 gene open 74258-75175
3781 CABPUK010000005.1 GCA902460695_01891 gene open 75185-78673 tssM
3782 CABPUK010000005.1 GCA902460695_01892 gene open 78751-79647
3783 CABPUK010000005.1 GCA902460695_01893 gene open 79644-81362 tssF
3784 CABPUK010000005.1 GCA902460695_01894 gene open 81362-81751
3785 CABPUK010000005.1 GCA902460695_01895 gene open 81760-83208 tssC
3786 CABPUK010000005.1 GCA902460695_01896 gene open 83211-83696 tssB
3787 CABPUK010000005.1 GCA902460695_01897 gene open 83777-85057
3788 CABPUK010000005.1 GCA902460695_01898 gene open 85058-85822 icmH
3789 CABPUK010000005.1 GCA902460695_01899 gene open 85832-87226 tssK
3790 CABPUK010000005.1 GCA902460695_01900 gene open 87228-87695 tssJ
3791 CABPUK010000005.1 GCA902460695_01901 gene open 87811-89169
3792 CABPUK010000005.1 GCA902460695_01902 gene open 89173-90003
3793 CABPUK010000005.1 GCA902460695_01903 gene open 90022-90909
3794 CABPUK010000005.1 GCA902460695_01824 gene open 424-499 trnA
3795 CABPUK010000005.1 GCA902460695_01825 gene open 512-588 trnI
3796 CABPUK010000005.1 GCA902460695_01843 gene open 30944-31018 trnE
3797 CABPUK010000005.1 GCA902460695_01844 gene open 31025-31100 trnK
3798 CABPUK010000005.1 GCA902460695_01845 gene open 31222-31298 trnD
3799 CABPUK010000005.1 GCA902460695_01846 gene open 31311-31386 trnV
3800 CABPUK010000005.1 GCA902460695_01847 gene open 31403-31478 trnE
3801 CABPUK010000005.1 GCA902460695_01848 gene open 31492-31567 trnK
3802 CABPUK010000005.1 GCA902460695_01824 tRNA open 424-499 trnA tRNA-Ala(tgc)
3803 CABPUK010000005.1 GCA902460695_01825 tRNA open 512-588 trnI tRNA-Ile(gat)
3804 CABPUK010000005.1 GCA902460695_01843 tRNA open 30944-31018 trnE tRNA-Glu(ctc)
3805 CABPUK010000005.1 GCA902460695_01844 tRNA open 31025-31100 trnK tRNA-Lys(ctt)
3806 CABPUK010000005.1 GCA902460695_01845 tRNA open 31222-31298 trnD tRNA-Asp(gtc)
3807 CABPUK010000005.1 GCA902460695_01846 tRNA open 31311-31386 trnV tRNA-Val(tac)
3808 CABPUK010000005.1 GCA902460695_01847 tRNA open 31403-31478 trnE tRNA-Glu(ctc)
3809 CABPUK010000005.1 GCA902460695_01848 tRNA open 31492-31567 trnK tRNA-Lys(ttt)
3810 CABPUK010000006.1 GCA902460695_01904 CDS open 1143-1277 _na     44_aa hypothetical protein
3811 CABPUK010000006.1 GCA902460695_01905 CDS open 1578-1832 _na     84_aa copG Ribbon-helix-helix protein%2C CopG family
3812 CABPUK010000006.1 GCA902460695_01906 CDS open 1810-2094 _na     94_aa Toxin-like protein
3813 CABPUK010000006.1 GCA902460695_01907 CDS open 2284-3540 _na     418_aa HIPA protein
3814 CABPUK010000006.1 GCA902460695_01908 CDS open 3570-4214 _na     214_aa hypothetical protein
3815 CABPUK010000006.1 GCA902460695_01909 CDS open 4207-4584 _na     125_aa hypothetical protein
3816 CABPUK010000006.1 GCA902460695_01910 CDS open 4586-5122 _na     178_aa hypothetical protein
3817 CABPUK010000006.1 GCA902460695_01911 CDS open 5133-6542 _na     469_aa DNA 3'-5' helicase
3818 CABPUK010000006.1 GCA902460695_01912 CDS open 6871-9270 _na     799_aa traM TraD/TraG TraM recognition site domain-containing protein
3819 CABPUK010000006.1 GCA902460695_01913 CDS open 9270-9722 _na     150_aa hypothetical protein
3820 CABPUK010000006.1 GCA902460695_01914 CDS open 9735-12215 _na     826_aa ATP-binding protein
3821 CABPUK010000006.1 GCA902460695_01915 CDS open 12212-12712 _na     166_aa hypothetical protein
3822 CABPUK010000006.1 GCA902460695_01916 CDS open 12881-14035 _na     384_aa hypothetical protein
3823 CABPUK010000006.1 GCA902460695_01917 CDS open 14060-16951 _na     963_aa Large polyvalent protein-associated domain-containing protein
3824 CABPUK010000006.1 GCA902460695_01918 CDS open 17018-19009 _na     663_aa recJ Single-stranded-DNA-specific exonuclease RecJ
3825 CABPUK010000006.1 GCA902460695_01919 CDS open 19006-20694 _na     562_aa DNA helicase
3826 CABPUK010000006.1 GCA902460695_01920 CDS open 20707-23436 _na     909_aa HD/PDEase domain-containing protein
3827 CABPUK010000006.1 GCA902460695_01921 CDS open 23449-25191 _na     580_aa Toprim domain-containing protein
3828 CABPUK010000006.1 GCA902460695_01922 CDS open 25199-25606 _na     135_aa hypothetical protein
3829 CABPUK010000006.1 GCA902460695_01923 CDS open 25590-26333 _na     247_aa hypothetical protein
3830 CABPUK010000006.1 GCA902460695_01924 CDS open 26351-27100 _na     249_aa hypothetical protein
3831 CABPUK010000006.1 GCA902460695_01925 CDS open 27076-28632 _na     518_aa hypothetical protein
3832 CABPUK010000006.1 GCA902460695_01926 CDS open 28642-29055 _na     137_aa Lipoprotein
3833 CABPUK010000006.1 GCA902460695_01927 CDS open 29057-30631 _na     524_aa traG Conjugal transfer protein TraG
3834 CABPUK010000006.1 GCA902460695_01928 CDS open 30607-31338 _na     243_aa hypothetical protein
3835 CABPUK010000006.1 GCA902460695_01929 CDS open 31515-31763 _na     82_aa hypothetical protein
3836 CABPUK010000006.1 GCA902460695_01930 CDS open 31788-32441 _na     217_aa Secreted protein
3837 CABPUK010000006.1 GCA902460695_01931 CDS open 32559-32690 _na     43_aa hypothetical protein
3838 CABPUK010000006.1 GCA902460695_01932 CDS open 32844-35636 _na     930_aa hypothetical protein
3839 CABPUK010000006.1 GCA902460695_01933 CDS open 35633-36946 _na     437_aa hypothetical protein
3840 CABPUK010000006.1 GCA902460695_01934 CDS open 36936-37283 _na     115_aa Lipoprotein
3841 CABPUK010000006.1 GCA902460695_01935 CDS open 37296-38216 _na     306_aa hypothetical protein
3842 CABPUK010000006.1 GCA902460695_01936 CDS open 38213-38599 _na     128_aa hypothetical protein
3843 CABPUK010000006.1 GCA902460695_01937 CDS open 38583-39278 _na     231_aa hypothetical protein
3844 CABPUK010000006.1 GCA902460695_01938 CDS open 39275-39922 _na     215_aa hypothetical protein
3845 CABPUK010000006.1 GCA902460695_01939 CDS open 39919-41346 _na     475_aa Periplasmic protein
3846 CABPUK010000006.1 GCA902460695_01940 CDS open 41343-42134 _na     263_aa hypothetical protein
3847 CABPUK010000006.1 GCA902460695_01941 CDS open 42204-42653 _na     149_aa hypothetical protein
3848 CABPUK010000006.1 GCA902460695_01942 CDS open 42817-43755 _na     312_aa AMIN domain-containing protein
3849 CABPUK010000006.1 GCA902460695_01943 CDS open 43758-44495 _na     245_aa hypothetical protein
3850 CABPUK010000006.1 GCA902460695_01944 CDS open 44505-44903 _na     132_aa Poly(A) polymerase
3851 CABPUK010000006.1 GCA902460695_01945 CDS open 44907-45236 _na     109_aa hypothetical protein
3852 CABPUK010000006.1 GCA902460695_01946 CDS open 45321-46127 _na     268_aa dsbG Disulfide isomerase DsbG N-terminal domain-containing protein
3853 CABPUK010000006.1 GCA902460695_01947 CDS open 46145-46720 _na     191_aa hypothetical protein
3854 CABPUK010000006.1 GCA902460695_01948 CDS open 46720-47415 _na     231_aa Response regulator
3855 CABPUK010000006.1 GCA902460695_01949 CDS open 47412-48017 _na     201_aa Transglycosylase SLT domain-containing protein
3856 CABPUK010000006.1 GCA902460695_01950 CDS open 48149-48508 _na     119_aa hypothetical protein
3857 CABPUK010000006.1 GCA902460695_01951 CDS open 48619-48969 _na     116_aa hypothetical protein
3858 CABPUK010000006.1 GCA902460695_01952 CDS open 48979-49338 _na     119_aa hypothetical protein
3859 CABPUK010000006.1 GCA902460695_01953 CDS open 49350-49520 _na     56_aa hypothetical protein
3860 CABPUK010000006.1 GCA902460695_01904 gene open 1143-1277
3861 CABPUK010000006.1 GCA902460695_01905 gene open 1578-1832 copG
3862 CABPUK010000006.1 GCA902460695_01906 gene open 1810-2094
3863 CABPUK010000006.1 GCA902460695_01907 gene open 2284-3540
3864 CABPUK010000006.1 GCA902460695_01908 gene open 3570-4214
3865 CABPUK010000006.1 GCA902460695_01909 gene open 4207-4584
3866 CABPUK010000006.1 GCA902460695_01910 gene open 4586-5122
3867 CABPUK010000006.1 GCA902460695_01911 gene open 5133-6542
3868 CABPUK010000006.1 GCA902460695_01912 gene open 6871-9270 traM
3869 CABPUK010000006.1 GCA902460695_01913 gene open 9270-9722
3870 CABPUK010000006.1 GCA902460695_01914 gene open 9735-12215
3871 CABPUK010000006.1 GCA902460695_01915 gene open 12212-12712
3872 CABPUK010000006.1 GCA902460695_01916 gene open 12881-14035
3873 CABPUK010000006.1 GCA902460695_01917 gene open 14060-16951
3874 CABPUK010000006.1 GCA902460695_01918 gene open 17018-19009 recJ
3875 CABPUK010000006.1 GCA902460695_01919 gene open 19006-20694
3876 CABPUK010000006.1 GCA902460695_01920 gene open 20707-23436
3877 CABPUK010000006.1 GCA902460695_01921 gene open 23449-25191
3878 CABPUK010000006.1 GCA902460695_01922 gene open 25199-25606
3879 CABPUK010000006.1 GCA902460695_01923 gene open 25590-26333
3880 CABPUK010000006.1 GCA902460695_01924 gene open 26351-27100
3881 CABPUK010000006.1 GCA902460695_01925 gene open 27076-28632
3882 CABPUK010000006.1 GCA902460695_01926 gene open 28642-29055
3883 CABPUK010000006.1 GCA902460695_01927 gene open 29057-30631 traG
3884 CABPUK010000006.1 GCA902460695_01928 gene open 30607-31338
3885 CABPUK010000006.1 GCA902460695_01929 gene open 31515-31763
3886 CABPUK010000006.1 GCA902460695_01930 gene open 31788-32441
3887 CABPUK010000006.1 GCA902460695_01931 gene open 32559-32690
3888 CABPUK010000006.1 GCA902460695_01932 gene open 32844-35636
3889 CABPUK010000006.1 GCA902460695_01933 gene open 35633-36946
3890 CABPUK010000006.1 GCA902460695_01934 gene open 36936-37283
3891 CABPUK010000006.1 GCA902460695_01935 gene open 37296-38216
3892 CABPUK010000006.1 GCA902460695_01936 gene open 38213-38599
3893 CABPUK010000006.1 GCA902460695_01937 gene open 38583-39278
3894 CABPUK010000006.1 GCA902460695_01938 gene open 39275-39922
3895 CABPUK010000006.1 GCA902460695_01939 gene open 39919-41346
3896 CABPUK010000006.1 GCA902460695_01940 gene open 41343-42134
3897 CABPUK010000006.1 GCA902460695_01941 gene open 42204-42653
3898 CABPUK010000006.1 GCA902460695_01942 gene open 42817-43755
3899 CABPUK010000006.1 GCA902460695_01943 gene open 43758-44495
3900 CABPUK010000006.1 GCA902460695_01944 gene open 44505-44903
3901 CABPUK010000006.1 GCA902460695_01945 gene open 44907-45236
3902 CABPUK010000006.1 GCA902460695_01946 gene open 45321-46127 dsbG
3903 CABPUK010000006.1 GCA902460695_01947 gene open 46145-46720
3904 CABPUK010000006.1 GCA902460695_01948 gene open 46720-47415
3905 CABPUK010000006.1 GCA902460695_01949 gene open 47412-48017
3906 CABPUK010000006.1 GCA902460695_01950 gene open 48149-48508
3907 CABPUK010000006.1 GCA902460695_01951 gene open 48619-48969
3908 CABPUK010000006.1 GCA902460695_01952 gene open 48979-49338
3909 CABPUK010000006.1 GCA902460695_01953 gene open 49350-49520
3910 CABPUK010000007.1 repeat_region open 19627-20323 CRISPR array with 9 repeats of length 34%2C consensus sequence GATACAAATTTCCCCGATCTAGGGGATTGAAAC and spacer length 45
3911 CABPUK010000007.1 GCA902460695_01954 CDS open 366-1952 _na     528_aa hypothetical protein
3912 CABPUK010000007.1 GCA902460695_01955 CDS open 1952-2470 _na     172_aa hypothetical protein
3913 CABPUK010000007.1 GCA902460695_01956 CDS open 2638-2952 _na     104_aa hypothetical protein
3914 CABPUK010000007.1 GCA902460695_01957 CDS open 2915-3331 _na     138_aa hypothetical protein
3915 CABPUK010000007.1 GCA902460695_01958 CDS open 3379-3999 _na     206_aa Lipoprotein
3916 CABPUK010000007.1 GCA902460695_01959 CDS open 4071-4358 _na     95_aa Phage protein
3917 CABPUK010000007.1 GCA902460695_01960 CDS open 4493-5215 _na     240_aa Integrase
3918 CABPUK010000007.1 GCA902460695_01961 CDS open 5346-5819 _na     157_aa Micrococcal nuclease (Thermonuclease)-like protein
3919 CABPUK010000007.1 GCA902460695_01962 CDS open 5826-7973 _na     715_aa VWFA domain-containing protein
3920 CABPUK010000007.1 GCA902460695_01963 CDS open 7976-9922 _na     648_aa hypothetical protein
3921 CABPUK010000007.1 GCA902460695_01964 CDS open 10595-12211 _na     538_aa AAA+ ATPase domain-containing protein
3922 CABPUK010000007.1 GCA902460695_01965 CDS open 12463-13434 _na     323_aa PP2C family serine/threonine-protein phosphatase
3923 CABPUK010000007.1 GCA902460695_01966 CDS open 13435-14124 _na     229_aa VWA domain-containing protein
3924 CABPUK010000007.1 GCA902460695_01967 CDS open 14136-16187 _na     683_aa protein kinase domain-containing protein
3925 CABPUK010000007.1 GCA902460695_01968 CDS open 16439-16567 _na     42_aa hypothetical protein
3926 CABPUK010000007.1 GCA902460695_01969 CDS open 16717-17529 _na     270_aa CRISPR-associated protein Cas6 C-terminal domain-containing protein
3927 CABPUK010000007.1 GCA902460695_01970 CDS open 17588-19414 _na     608_aa cas1 CRISPR-associated endonuclease Cas1
3928 CABPUK010000007.1 GCA902460695_01971 CDS open 20535-21203 _na     222_aa Outer membrane protein beta-barrel domain-containing protein
3929 CABPUK010000007.1 GCA902460695_01972 CDS open 21348-22862 _na     504_aa Cas10/Cmr2 second palm domain-containing protein
3930 CABPUK010000007.1 GCA902460695_01973 CDS open 22859-23410 _na     183_aa DUF324 domain-containing protein
3931 CABPUK010000007.1 GCA902460695_01974 CDS open 23383-24894 _na     503_aa CRISPR-associated protein
3932 CABPUK010000007.1 GCA902460695_01975 CDS open 24891-26195 _na     434_aa DUF324 domain-containing protein
3933 CABPUK010000007.1 GCA902460695_01976 CDS open 26182-26604 _na     140_aa TIGR04423 family type III CRISPR-associated protein
3934 CABPUK010000007.1 GCA902460695_01977 CDS open 26601-28331 _na     576_aa DUF324 domain-containing protein
3935 CABPUK010000007.1 GCA902460695_01978 CDS open 28333-29127 _na     264_aa CRISPR-associated protein
3936 CABPUK010000007.1 GCA902460695_01979 CDS open 29131-30429 _na     432_aa CRISPR-associated protein%2C TM1812 family
3937 CABPUK010000007.1 GCA902460695_01980 CDS open 30426-30806 _na     126_aa csx20 CRISPR-associated protein Csx20
3938 CABPUK010000007.1 GCA902460695_01981 CDS open 30806-31807 _na     333_aa Transcriptional regulator
3939 CABPUK010000007.1 GCA902460695_01982 CDS open 32019-32579 _na     186_aa hypothetical protein
3940 CABPUK010000007.1 GCA902460695_01983 CDS open 32576-32833 _na     85_aa hypothetical protein
3941 CABPUK010000007.1 GCA902460695_01984 CDS open 32845-33066 _na     73_aa hypothetical protein
3942 CABPUK010000007.1 GCA902460695_01985 CDS open 33317-33991 _na     224_aa NYN domain-containing protein
3943 CABPUK010000007.1 GCA902460695_01986 CDS open 34354-35571 _na     405_aa HNH endonuclease signature motif containing protein
3944 CABPUK010000007.1 GCA902460695_01987 CDS open 35564-37423 _na     619_aa DNA adenine methylase
3945 CABPUK010000007.1 GCA902460695_01988 CDS open 37648-37935 _na     95_aa hypothetical protein
3946 CABPUK010000007.1 GCA902460695_01989 CDS open 37967-38185 _na     72_aa hypothetical protein
3947 CABPUK010000007.1 GCA902460695_01990 CDS open 38182-38460 _na     92_aa copG CopG family transcriptional regulator
3948 CABPUK010000007.1 GCA902460695_01991 CDS open 38565-38786 _na     73_aa hicA type II toxin-antitoxin system HicA family toxin
3949 CABPUK010000007.1 GCA902460695_01992 CDS open 38789-39142 _na     117_aa hicB HicB family protein
3950 CABPUK010000007.1 GCA902460695_01993 CDS open 39321-42605 _na     1094_aa CHAT domain-containing protein
3951 CABPUK010000007.1 GCA902460695_01994 CDS open 42684-43232 _na     182_aa hypothetical protein
3952 CABPUK010000007.1 GCA902460695_01995 CDS open 43241-44596 _na     451_aa CHASE2 domain-containing protein
3953 CABPUK010000007.1 GCA902460695_01996 CDS open 45152-45373 _na     73_aa copG CopG family transcriptional regulator
3954 CABPUK010000007.1 GCA902460695_01997 CDS open 45376-46062 _na     228_aa Para protein
3955 CABPUK010000007.1 GCA902460695_01998 CDS open 47485-48174 _na     229_aa 3-deoxy-D-arabinoheptulosonate-7-phosphate synthase
3956 CABPUK010000007.1 GCA902460695_01999 CDS open 51287-51916 _na     209_aa hypothetical protein
3957 CABPUK010000007.1 GCA902460695_02000 CDS open 51920-53290 _na     456_aa Thioredoxin reductase
3958 CABPUK010000007.1 GCA902460695_02001 CDS open 53849-54538 _na     229_aa 3-deoxy-D-arabinoheptulosonate-7-phosphate synthase
3959 CABPUK010000007.1 GCA902460695_02002 CDS open 55658-56431 _na     257_aa Thioredoxin reductase
3960 CABPUK010000007.1 GCA902460695_02003 CDS open 57727-58344 _na     205_aa sodB superoxide dismutase [Fe]
3961 CABPUK010000007.1 GCA902460695_02004 CDS open 59251-60417 _na     388_aa cysteine-S-conjugate beta-lyase
3962 CABPUK010000007.1 GCA902460695_02005 CDS open 60506-60961 _na     151_aa Septicolysin
3963 CABPUK010000007.1 GCA902460695_02006 CDS open 61179-62321 _na     380_aa Cystathionine gamma-lyase
3964 CABPUK010000007.1 GCA902460695_02007 CDS open 62331-62861 _na     176_aa tpx thiol peroxidase
3965 CABPUK010000007.1 GCA902460695_02008 CDS open 62868-63284 _na     138_aa ATP-binding domain-containing protein
3966 CABPUK010000007.1 GCA902460695_02010 CDS open 63736-63891 _na     51_aa Lipoprotein
3967 CABPUK010000007.1 GCA902460695_02015 CDS open 64456-65196 _na     246_aa Spore coat protein
3968 CABPUK010000007.1 GCA902460695_02016 CDS open 65277-66401 _na     374_aa PepSY domain-containing protein
3969 CABPUK010000007.1 GCA902460695_02017 CDS open 66473-67495 _na     340_aa ribonucleotide-diphosphate reductase subunit beta
3970 CABPUK010000007.1 GCA902460695_02018 CDS open 67482-67976 _na     164_aa Lipoprotein
3971 CABPUK010000007.1 GCA902460695_02019 CDS open 67977-68744 _na     255_aa CN hydrolase domain-containing protein
3972 CABPUK010000007.1 GCA902460695_02020 CDS open 68805-69437 _na     210_aa protein-L-isoaspartate(D-aspartate) O-methyltransferase
3973 CABPUK010000007.1 GCA902460695_02021 CDS open 69456-69941 _na     161_aa Lipoprotein
3974 CABPUK010000007.1 GCA902460695_01954 gene open 366-1952
3975 CABPUK010000007.1 GCA902460695_01955 gene open 1952-2470
3976 CABPUK010000007.1 GCA902460695_01956 gene open 2638-2952
3977 CABPUK010000007.1 GCA902460695_01957 gene open 2915-3331
3978 CABPUK010000007.1 GCA902460695_01958 gene open 3379-3999
3979 CABPUK010000007.1 GCA902460695_01959 gene open 4071-4358
3980 CABPUK010000007.1 GCA902460695_01960 gene open 4493-5215
3981 CABPUK010000007.1 GCA902460695_01961 gene open 5346-5819
3982 CABPUK010000007.1 GCA902460695_01962 gene open 5826-7973
3983 CABPUK010000007.1 GCA902460695_01963 gene open 7976-9922
3984 CABPUK010000007.1 GCA902460695_01964 gene open 10595-12211
3985 CABPUK010000007.1 GCA902460695_01965 gene open 12463-13434
3986 CABPUK010000007.1 GCA902460695_01966 gene open 13435-14124
3987 CABPUK010000007.1 GCA902460695_01967 gene open 14136-16187
3988 CABPUK010000007.1 GCA902460695_01968 gene open 16439-16567
3989 CABPUK010000007.1 GCA902460695_01969 gene open 16717-17529
3990 CABPUK010000007.1 GCA902460695_01970 gene open 17588-19414 cas1
3991 CABPUK010000007.1 GCA902460695_01971 gene open 20535-21203
3992 CABPUK010000007.1 GCA902460695_01972 gene open 21348-22862
3993 CABPUK010000007.1 GCA902460695_01973 gene open 22859-23410
3994 CABPUK010000007.1 GCA902460695_01974 gene open 23383-24894
3995 CABPUK010000007.1 GCA902460695_01975 gene open 24891-26195
3996 CABPUK010000007.1 GCA902460695_01976 gene open 26182-26604
3997 CABPUK010000007.1 GCA902460695_01977 gene open 26601-28331
3998 CABPUK010000007.1 GCA902460695_01978 gene open 28333-29127
3999 CABPUK010000007.1 GCA902460695_01979 gene open 29131-30429
4000 CABPUK010000007.1 GCA902460695_01980 gene open 30426-30806 csx20