HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Campylobacter concisus clade-433 (GCA_902460745.1)

Select a Genome:
BAKTA Annotations for GCA_902460745.1
Genome Selected: Campylobacter concisus clade-433
ContigsBases CDSrRNA tmRNAtRNA
13 2104638 1990 5 1 42
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4087 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:8]    |    Number of Records Found: 4087 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
3501 CABPUU010000002.1 GCA902460745_01745 gene open 411734-412795 ribD
3502 CABPUU010000002.1 GCA902460745_01746 gene open 412847-414496 fhs
3503 CABPUU010000002.1 GCA902460745_01747 gene open 414498-414914 rimP
3504 CABPUU010000002.1 GCA902460745_01748 gene open 414907-415272 rbfA
3505 CABPUU010000002.1 GCA902460745_01749 gene open 415269-417926 infB
3506 CABPUU010000002.1 GCA902460745_01750 gene open 417913-418167 ylxR
3507 CABPUU010000002.1 GCA902460745_01751 gene open 418189-419073 thrB
3508 CABPUU010000002.1 GCA902460745_01752 gene open 419082-419336
3509 CABPUU010000002.1 GCA902460745_01753 gene open 419525-420409 lpxC
3510 CABPUU010000002.1 GCA902460745_01754 gene open 420470-421840
3511 CABPUU010000002.1 GCA902460745_01755 gene open 421902-422732
3512 CABPUU010000002.1 GCA902460745_01756 gene open 422822-425077 bamA
3513 CABPUU010000002.1 GCA902460745_01757 gene open 425207-426124 accD
3514 CABPUU010000002.1 GCA902460745_01758 gene open 426127-426582 rlmH
3515 CABPUU010000002.1 GCA902460745_01759 gene open 426594-426950 dksA
3516 CABPUU010000002.1 GCA902460745_01760 gene open 426960-427958
3517 CABPUU010000002.1 GCA902460745_01761 gene open 427955-428878
3518 CABPUU010000002.1 GCA902460745_01762 gene open 428879-429493 recO
3519 CABPUU010000002.1 GCA902460745_01763 gene open 429490-430638
3520 CABPUU010000002.1 GCA902460745_01764 gene open 430840-431676
3521 CABPUU010000002.1 GCA902460745_01765 gene open 431758-431916
3522 CABPUU010000002.1 GCA902460745_01372 gene open 52195-52271 trnD
3523 CABPUU010000002.1 GCA902460745_01373 gene open 52284-52353 trnV
3524 CABPUU010000002.1 GCA902460745_01374 gene open 52520-52592 trnK
3525 CABPUU010000002.1 GCA902460745_01590 gene open 249376-249452 trnI
3526 CABPUU010000002.1 GCA902460745_01599 gene open 260077-260151 trnN
3527 CABPUU010000002.1 GCA902460745_01743 gene open 410728-410812 trnL
3528 CABPUU010000002.1 GCA902460745_01372 tRNA open 52195-52271 trnD tRNA-Asp(gtc)
3529 CABPUU010000002.1 GCA902460745_01373 tRNA open 52284-52353 trnV tRNA-Val(tac)
3530 CABPUU010000002.1 GCA902460745_01374 tRNA open 52520-52592 trnK tRNA-Lys(ttt)
3531 CABPUU010000002.1 GCA902460745_01590 tRNA open 249376-249452 trnI tRNA-Ile2(cat)
3532 CABPUU010000002.1 GCA902460745_01599 tRNA open 260077-260151 trnN tRNA-Asn(gtt)
3533 CABPUU010000002.1 GCA902460745_01743 tRNA open 410728-410812 trnL tRNA-Leu(gag)
3534 CABPUU010000003.1 GCA902460745_01766 CDS open 60-449 _na     129_aa hypothetical protein
3535 CABPUU010000003.1 GCA902460745_01767 CDS open 521-820 _na     99_aa hypothetical protein
3536 CABPUU010000003.1 GCA902460745_01768 CDS open 4244-5395 _na     383_aa Cj0814 family flagellar-dependent secreted protein
3537 CABPUU010000003.1 GCA902460745_01769 CDS open 6760-7458 _na     232_aa hypothetical protein
3538 CABPUU010000003.1 GCA902460745_01770 CDS open 10569-10856 _na     95_aa copG Ribbon-helix-helix protein CopG domain-containing protein
3539 CABPUU010000003.1 GCA902460745_01771 CDS open 10856-11419 _na     187_aa CobQ/CobB/MinD/ParA nucleotide binding domain-containing protein
3540 CABPUU010000003.1 GCA902460745_01772 CDS open 11524-13278 _na     584_aa Response regulator
3541 CABPUU010000003.1 GCA902460745_01773 CDS open 13376-14392 _na     338_aa hypothetical protein
3542 CABPUU010000003.1 GCA902460745_01774 CDS open 14389-14505 _na     38_aa hypothetical protein
3543 CABPUU010000003.1 GCA902460745_01775 CDS open 14809-15498 _na     229_aa lexA LexA family transcriptional regulator
3544 CABPUU010000003.1 GCA902460745_01776 CDS open 15549-16514 _na     321_aa repB RepB family plasmid replication initiator protein
3545 CABPUU010000003.1 GCA902460745_01777 CDS open 17011-17409 _na     132_aa hicB Type II toxin-antitoxin system HicB family antitoxin
3546 CABPUU010000003.1 GCA902460745_01778 CDS open 17484-17732 _na     82_aa hicA Type II toxin-antitoxin system HicA family toxin
3547 CABPUU010000003.1 GCA902460745_01779 CDS open 17855-19711 _na     618_aa Mobilization protein
3548 CABPUU010000003.1 GCA902460745_01780 CDS open 19701-20018 _na     105_aa Bacterial mobilisation domain-containing protein
3549 CABPUU010000003.1 GCA902460745_01781 CDS open 20005-20187 _na     60_aa hypothetical protein
3550 CABPUU010000003.1 GCA902460745_01782 CDS open 20398-20655 _na     85_aa hypothetical protein
3551 CABPUU010000003.1 GCA902460745_01783 CDS open 20648-20749 _na     33_aa hypothetical protein
3552 CABPUU010000003.1 GCA902460745_01784 CDS open 20841-21476 _na     211_aa Bacteriocin-type signal sequence domain-containing protein
3553 CABPUU010000003.1 GCA902460745_01785 CDS open 21487-22290 _na     267_aa hypothetical protein
3554 CABPUU010000003.1 GCA902460745_01786 CDS open 22301-23155 _na     284_aa hmcD HmcD domain-containing protein
3555 CABPUU010000003.1 GCA902460745_01787 CDS open 23235-23651 _na     138_aa hypothetical protein
3556 CABPUU010000003.1 GCA902460745_01788 CDS open 23707-24819 _na     370_aa flgG Flagellar biosynthesis protein FlgG
3557 CABPUU010000003.1 GCA902460745_01789 CDS open 24812-25417 _na     201_aa Peptidase C39 domain-containing protein
3558 CABPUU010000003.1 GCA902460745_01790 CDS open 25429-26244 _na     271_aa Cell surface protein
3559 CABPUU010000003.1 GCA902460745_01791 CDS open 26301-26801 _na     166_aa Bacteriocin-type signal sequence domain-containing protein
3560 CABPUU010000003.1 GCA902460745_01792 CDS open 27065-28264 _na     399_aa DUF4885 domain-containing protein
3561 CABPUU010000003.1 GCA902460745_01793 CDS open 28318-28875 _na     185_aa Bacteriocin
3562 CABPUU010000003.1 GCA902460745_01794 CDS open 29374-30165 _na     263_aa Cell surface protein
3563 CABPUU010000003.1 GCA902460745_01795 CDS open 30316-30948 _na     210_aa tetratricopeptide repeat protein
3564 CABPUU010000003.1 GCA902460745_01796 CDS open 31138-31302 _na     54_aa hypothetical protein
3565 CABPUU010000003.1 GCA902460745_01797 CDS open 31438-32196 _na     252_aa tRNA(Ile)-lysidine/2-thiocytidine synthase N-terminal domain-containing protein
3566 CABPUU010000003.1 GCA902460745_01798 CDS open 32193-32876 _na     227_aa 5'-methylthioadenosine/adenosylhomocysteine nucleosidase
3567 CABPUU010000003.1 GCA902460745_01799 CDS open 32873-33802 _na     309_aa fabD ACP S-malonyltransferase
3568 CABPUU010000003.1 GCA902460745_01800 CDS open 33812-34390 _na     192_aa Peptidyl-prolyl cis-trans isomerase
3569 CABPUU010000003.1 GCA902460745_01801 CDS open 34452-35294 _na     280_aa ybgF Tol-Pal system protein YbgF
3570 CABPUU010000003.1 GCA902460745_01802 CDS open 35311-35817 _na     168_aa Peptidoglycan-associated lipoprotein
3571 CABPUU010000003.1 GCA902460745_01803 CDS open 35882-37138 _na     418_aa tolB Tol-Pal system protein TolB
3572 CABPUU010000003.1 GCA902460745_01804 CDS open 37163-38110 _na     315_aa tonB TonB family domain-containing protein
3573 CABPUU010000003.1 GCA902460745_01805 CDS open 38112-38510 _na     132_aa tolR Tol-Pal system subunit TolR
3574 CABPUU010000003.1 GCA902460745_01806 CDS open 38511-39095 _na     194_aa tolQ Tol-Pal system subunit TolQ
3575 CABPUU010000003.1 GCA902460745_01807 CDS open 39096-39485 _na     129_aa atpC ATP synthase F1 subunit epsilon
3576 CABPUU010000003.1 GCA902460745_01808 CDS open 39504-40901 _na     465_aa atpD F0F1 ATP synthase subunit beta
3577 CABPUU010000003.1 GCA902460745_01809 CDS open 40913-41800 _na     295_aa atpG ATP synthase F1 subunit gamma
3578 CABPUU010000003.1 GCA902460745_01810 CDS open 41810-43327 _na     505_aa atpA F0F1 ATP synthase subunit alpha
3579 CABPUU010000003.1 GCA902460745_01811 CDS open 43342-43872 _na     176_aa atpH F0F1 ATP synthase subunit delta
3580 CABPUU010000003.1 GCA902460745_01812 CDS open 43872-44384 _na     170_aa atpF F0F1 ATP synthase subunit B
3581 CABPUU010000003.1 GCA902460745_01813 CDS open 44394-44816 _na     140_aa ATP synthase%2C F0 complex%2C b' subunit
3582 CABPUU010000003.1 GCA902460745_01814 CDS open 44912-45772 _na     286_aa Chromosome partitioning protein
3583 CABPUU010000003.1 GCA902460745_01815 CDS open 45788-46570 _na     260_aa AAA domain-containing protein
3584 CABPUU010000003.1 GCA902460745_01816 CDS open 46567-47202 _na     211_aa biotin--[acetyl-CoA-carboxylase] ligase
3585 CABPUU010000003.1 GCA902460745_01817 CDS open 47204-47992 _na     262_aa hydroxymethylpyrimidine kinase
3586 CABPUU010000003.1 GCA902460745_01818 CDS open 48009-48914 _na     301_aa fmt methionyl-tRNA formyltransferase
3587 CABPUU010000003.1 GCA902460745_01819 CDS open 48931-49266 _na     111_aa EF-hand domain-containing protein
3588 CABPUU010000003.1 GCA902460745_01820 CDS open 49313-50371 _na     352_aa obgE GTPase ObgE
3589 CABPUU010000003.1 GCA902460745_01821 CDS open 50547-53183 _na     878_aa polA DNA polymerase I
3590 CABPUU010000003.1 GCA902460745_01822 CDS open 53233-54513 _na     426_aa Citrate transporter
3591 CABPUU010000003.1 GCA902460745_01823 CDS open 54643-55620 _na     325_aa Asparaginase
3592 CABPUU010000003.1 GCA902460745_01824 CDS open 55693-56352 _na     219_aa gntR Transcriptional regulator%2C GntR family
3593 CABPUU010000003.1 GCA902460745_01825 CDS open 56403-57014 _na     203_aa ttdB L(+)-tartrate dehydratase subunit beta
3594 CABPUU010000003.1 GCA902460745_01826 CDS open 57011-57910 _na     299_aa ttdA L(+)-tartrate dehydratase subunit alpha
3595 CABPUU010000003.1 GCA902460745_01827 CDS open 57928-59253 _na     441_aa DUF2809 domain-containing protein
3596 CABPUU010000003.1 GCA902460745_01828 CDS open 59283-60029 _na     248_aa larB nickel pincer cofactor biosynthesis protein LarB
3597 CABPUU010000003.1 GCA902460745_01829 CDS open 60026-60799 _na     257_aa larE ATP-dependent sacrificial sulfur transferase LarE
3598 CABPUU010000003.1 GCA902460745_01830 CDS open 60771-61967 _na     398_aa larC nickel pincer cofactor biosynthesis protein LarC
3599 CABPUU010000003.1 GCA902460745_01831 CDS open 61964-63214 _na     416_aa larA nickel-dependent lactate racemase
3600 CABPUU010000003.1 GCA902460745_01832 CDS open 63420-65099 _na     559_aa dcuB C4-dicarboxylate transporter DcuB
3601 CABPUU010000003.1 GCA902460745_01833 CDS open 65191-66264 _na     357_aa flhB flagellar biosynthesis protein FlhB
3602 CABPUU010000003.1 GCA902460745_01834 CDS open 66409-67374 _na     321_aa hypothetical protein
3603 CABPUU010000003.1 GCA902460745_01835 CDS open 67447-67899 _na     150_aa hypothetical protein
3604 CABPUU010000003.1 GCA902460745_01836 CDS open 67922-68335 _na     137_aa hypothetical protein
3605 CABPUU010000003.1 GCA902460745_01837 CDS open 68521-68835 _na     104_aa rplU 50S ribosomal protein L21
3606 CABPUU010000003.1 GCA902460745_01838 CDS open 68847-69104 _na     85_aa rpmA 50S ribosomal protein L27
3607 CABPUU010000003.1 GCA902460745_01839 CDS open 69149-70255 _na     368_aa Glycosyltransferase%2C family 1
3608 CABPUU010000003.1 GCA902460745_01840 CDS open 70259-71533 _na     424_aa Membrane protein%2C putative O-glycosylation ligase
3609 CABPUU010000003.1 GCA902460745_01841 CDS open 71530-72612 _na     360_aa Glycosyltransferase family 4 protein
3610 CABPUU010000003.1 GCA902460745_01842 CDS open 72658-75486 _na     942_aa uvrA excinuclease ABC subunit UvrA
3611 CABPUU010000003.1 GCA902460745_01843 CDS open 75661-75945 _na     94_aa 4Fe-4S binding protein
3612 CABPUU010000003.1 GCA902460745_01844 CDS open 76048-76461 _na     137_aa ndk nucleoside-diphosphate kinase
3613 CABPUU010000003.1 GCA902460745_01845 CDS open 76476-76835 _na     119_aa DNA-binding protein
3614 CABPUU010000003.1 GCA902460745_01846 CDS open 76847-76993 _na     48_aa rpmF 50S ribosomal protein L32
3615 CABPUU010000003.1 GCA902460745_01847 CDS open 76997-77986 _na     329_aa plsX phosphate acyltransferase PlsX
3616 CABPUU010000003.1 GCA902460745_01848 CDS open 77990-78994 _na     334_aa fabH Beta-ketoacyl-[acyl-carrier-protein] synthase III
3617 CABPUU010000003.1 GCA902460745_01849 CDS open 79192-79791 _na     199_aa Alkyl hydroperoxide reductase protein%2C peroxidase component
3618 CABPUU010000003.1 GCA902460745_01850 CDS open 79914-80996 _na     360_aa pilZ PilZ domain-containing protein
3619 CABPUU010000003.1 GCA902460745_01851 CDS open 81005-83293 _na     762_aa herA Helicase HerA central domain-containing protein
3620 CABPUU010000003.1 GCA902460745_01852 CDS open 83353-83964 _na     203_aa plsY glycerol-3-phosphate 1-O-acyltransferase PlsY
3621 CABPUU010000003.1 GCA902460745_01853 CDS open 83961-84287 _na     108_aa Dihydroneopterin aldolase/epimerase domain-containing protein
3622 CABPUU010000003.1 GCA902460745_01854 CDS open 84364-85035 _na     223_aa ompR Two-component system response regulator
3623 CABPUU010000003.1 GCA902460745_01855 CDS open 85014-86291 _na     425_aa histidine kinase
3624 CABPUU010000003.1 GCA902460745_01856 CDS open 86295-87743 _na     482_aa Guanosine-5'-triphosphate%2C 3'-diphosphate pyrophosphatase
3625 CABPUU010000003.1 GCA902460745_01857 CDS open 88566-89444 _na     292_aa Excinuclease ABC subunit A
3626 CABPUU010000003.1 GCA902460745_01858 CDS open 89441-89758 _na     105_aa fliN flagellar motor switch protein FliN
3627 CABPUU010000003.1 GCA902460745_01859 CDS open 89755-90174 _na     139_aa Chemotaxis phosphatase CheX-like domain-containing protein
3628 CABPUU010000003.1 GCA902460745_01860 CDS open 90252-91001 _na     249_aa trpA tryptophan synthase subunit alpha
3629 CABPUU010000003.1 GCA902460745_01861 CDS open 90994-92175 _na     393_aa trpB tryptophan synthase subunit beta
3630 CABPUU010000003.1 GCA902460745_01862 CDS open 92168-92779 _na     203_aa N-(5'-phosphoribosyl)anthranilate isomerase
3631 CABPUU010000003.1 GCA902460745_01863 CDS open 92779-94383 _na     534_aa Anthranilate phosphoribosyltransferase
3632 CABPUU010000003.1 GCA902460745_01864 CDS open 94464-95036 _na     190_aa recR recombination mediator RecR
3633 CABPUU010000003.1 GCA902460745_01865 CDS open 95033-96289 _na     418_aa arsS ArsS family sensor histidine kinase
3634 CABPUU010000003.1 GCA902460745_01866 CDS open 96286-96957 _na     223_aa Two-component system response regulator
3635 CABPUU010000003.1 GCA902460745_01867 CDS open 97081-98223 _na     380_aa dnaJ molecular chaperone DnaJ
3636 CABPUU010000003.1 GCA902460745_01868 CDS open 98979-100430 _na     483_aa pyk pyruvate kinase
3637 CABPUU010000003.1 GCA902460745_01869 CDS open 100523-101584 _na     353_aa dctP DctP family TRAP transporter solute receptor
3638 CABPUU010000003.1 GCA902460745_01870 CDS open 101699-102313 _na     204_aa lptC LPS export ABC transporter periplasmic protein LptC
3639 CABPUU010000003.1 GCA902460745_01871 CDS open 102324-102470 _na     48_aa Diadenosine tetraphosphate hydrolase
3640 CABPUU010000003.1 GCA902460745_01872 CDS open 102573-103403 _na     276_aa Periplasmic protein
3641 CABPUU010000003.1 GCA902460745_01873 CDS open 103400-103543 _na     47_aa Diadenosine tetraphosphate hydrolase
3642 CABPUU010000003.1 GCA902460745_01874 CDS open 104881-105237 _na     118_aa hypothetical protein
3643 CABPUU010000003.1 GCA902460745_01875 CDS open 105238-108483 _na     1081_aa Mbeg1-like protein
3644 CABPUU010000003.1 GCA902460745_01876 CDS open 108492-109691 _na     399_aa Molybdopterin molybdenumtransferase
3645 CABPUU010000003.1 GCA902460745_01877 CDS open 109827-110885 _na     352_aa yedE YedE family putative selenium transporter
3646 CABPUU010000003.1 GCA902460745_01879 CDS open 111393-112031 _na     212_aa 4Fe-4S ferredoxin-type domain-containing protein
3647 CABPUU010000003.1 GCA902460745_01880 CDS open 112031-112408 _na     125_aa Iron ABC transporter permease
3648 CABPUU010000003.1 GCA902460745_01881 CDS open 112405-113916 _na     503_aa Aminoglycoside phosphotransferase domain-containing protein
3649 CABPUU010000003.1 GCA902460745_01882 CDS open 113913-114623 _na     236_aa TVP38/TMEM64 family membrane protein
3650 CABPUU010000003.1 GCA902460745_01883 CDS open 114601-115263 _na     220_aa TVP38/TMEM64 family membrane protein
3651 CABPUU010000003.1 GCA902460745_01884 CDS open 115232-115936 _na     234_aa TIGR04283 family arsenosugar biosynthesis glycosyltransferase
3652 CABPUU010000003.1 GCA902460745_01885 CDS open 115958-116572 _na     204_aa DUF6037 domain-containing protein
3653 CABPUU010000003.1 GCA902460745_01886 CDS open 116615-117580 _na     321_aa 4Fe-4S ferredoxin-type domain-containing protein
3654 CABPUU010000003.1 GCA902460745_01887 CDS open 117577-118512 _na     311_aa arsS arsenosugar biosynthesis radical SAM (seleno)protein ArsS
3655 CABPUU010000003.1 GCA902460745_01888 CDS open 118529-118951 _na     140_aa C_GCAxxG_C_C family protein
3656 CABPUU010000003.1 GCA902460745_01889 CDS open 118951-120339 _na     462_aa Sodium-solute symporter
3657 CABPUU010000003.1 GCA902460745_01890 CDS open 120336-121256 _na     306_aa Calcineurin-like phosphoesterase domain-containing protein
3658 CABPUU010000003.1 GCA902460745_01891 CDS open 121291-121998 _na     235_aa Phage shock protein E
3659 CABPUU010000003.1 GCA902460745_01766 gene open 60-449
3660 CABPUU010000003.1 GCA902460745_01767 gene open 521-820
3661 CABPUU010000003.1 GCA902460745_01768 gene open 4244-5395
3662 CABPUU010000003.1 GCA902460745_01769 gene open 6760-7458
3663 CABPUU010000003.1 GCA902460745_01770 gene open 10569-10856 copG
3664 CABPUU010000003.1 GCA902460745_01771 gene open 10856-11419
3665 CABPUU010000003.1 GCA902460745_01772 gene open 11524-13278
3666 CABPUU010000003.1 GCA902460745_01773 gene open 13376-14392
3667 CABPUU010000003.1 GCA902460745_01774 gene open 14389-14505
3668 CABPUU010000003.1 GCA902460745_01775 gene open 14809-15498 lexA
3669 CABPUU010000003.1 GCA902460745_01776 gene open 15549-16514 repB
3670 CABPUU010000003.1 GCA902460745_01777 gene open 17011-17409 hicB
3671 CABPUU010000003.1 GCA902460745_01778 gene open 17484-17732 hicA
3672 CABPUU010000003.1 GCA902460745_01779 gene open 17855-19711
3673 CABPUU010000003.1 GCA902460745_01780 gene open 19701-20018
3674 CABPUU010000003.1 GCA902460745_01781 gene open 20005-20187
3675 CABPUU010000003.1 GCA902460745_01782 gene open 20398-20655
3676 CABPUU010000003.1 GCA902460745_01783 gene open 20648-20749
3677 CABPUU010000003.1 GCA902460745_01784 gene open 20841-21476
3678 CABPUU010000003.1 GCA902460745_01785 gene open 21487-22290
3679 CABPUU010000003.1 GCA902460745_01786 gene open 22301-23155 hmcD
3680 CABPUU010000003.1 GCA902460745_01787 gene open 23235-23651
3681 CABPUU010000003.1 GCA902460745_01788 gene open 23707-24819 flgG
3682 CABPUU010000003.1 GCA902460745_01789 gene open 24812-25417
3683 CABPUU010000003.1 GCA902460745_01790 gene open 25429-26244
3684 CABPUU010000003.1 GCA902460745_01791 gene open 26301-26801
3685 CABPUU010000003.1 GCA902460745_01792 gene open 27065-28264
3686 CABPUU010000003.1 GCA902460745_01793 gene open 28318-28875
3687 CABPUU010000003.1 GCA902460745_01794 gene open 29374-30165
3688 CABPUU010000003.1 GCA902460745_01795 gene open 30316-30948
3689 CABPUU010000003.1 GCA902460745_01796 gene open 31138-31302
3690 CABPUU010000003.1 GCA902460745_01797 gene open 31438-32196
3691 CABPUU010000003.1 GCA902460745_01798 gene open 32193-32876
3692 CABPUU010000003.1 GCA902460745_01799 gene open 32873-33802 fabD
3693 CABPUU010000003.1 GCA902460745_01800 gene open 33812-34390
3694 CABPUU010000003.1 GCA902460745_01801 gene open 34452-35294 ybgF
3695 CABPUU010000003.1 GCA902460745_01802 gene open 35311-35817
3696 CABPUU010000003.1 GCA902460745_01803 gene open 35882-37138 tolB
3697 CABPUU010000003.1 GCA902460745_01804 gene open 37163-38110 tonB
3698 CABPUU010000003.1 GCA902460745_01805 gene open 38112-38510 tolR
3699 CABPUU010000003.1 GCA902460745_01806 gene open 38511-39095 tolQ
3700 CABPUU010000003.1 GCA902460745_01807 gene open 39096-39485 atpC
3701 CABPUU010000003.1 GCA902460745_01808 gene open 39504-40901 atpD
3702 CABPUU010000003.1 GCA902460745_01809 gene open 40913-41800 atpG
3703 CABPUU010000003.1 GCA902460745_01810 gene open 41810-43327 atpA
3704 CABPUU010000003.1 GCA902460745_01811 gene open 43342-43872 atpH
3705 CABPUU010000003.1 GCA902460745_01812 gene open 43872-44384 atpF
3706 CABPUU010000003.1 GCA902460745_01813 gene open 44394-44816
3707 CABPUU010000003.1 GCA902460745_01814 gene open 44912-45772
3708 CABPUU010000003.1 GCA902460745_01815 gene open 45788-46570
3709 CABPUU010000003.1 GCA902460745_01816 gene open 46567-47202
3710 CABPUU010000003.1 GCA902460745_01817 gene open 47204-47992
3711 CABPUU010000003.1 GCA902460745_01818 gene open 48009-48914 fmt
3712 CABPUU010000003.1 GCA902460745_01819 gene open 48931-49266
3713 CABPUU010000003.1 GCA902460745_01820 gene open 49313-50371 obgE
3714 CABPUU010000003.1 GCA902460745_01821 gene open 50547-53183 polA
3715 CABPUU010000003.1 GCA902460745_01822 gene open 53233-54513
3716 CABPUU010000003.1 GCA902460745_01823 gene open 54643-55620
3717 CABPUU010000003.1 GCA902460745_01824 gene open 55693-56352 gntR
3718 CABPUU010000003.1 GCA902460745_01825 gene open 56403-57014 ttdB
3719 CABPUU010000003.1 GCA902460745_01826 gene open 57011-57910 ttdA
3720 CABPUU010000003.1 GCA902460745_01827 gene open 57928-59253
3721 CABPUU010000003.1 GCA902460745_01828 gene open 59283-60029 larB
3722 CABPUU010000003.1 GCA902460745_01829 gene open 60026-60799 larE
3723 CABPUU010000003.1 GCA902460745_01830 gene open 60771-61967 larC
3724 CABPUU010000003.1 GCA902460745_01831 gene open 61964-63214 larA
3725 CABPUU010000003.1 GCA902460745_01832 gene open 63420-65099 dcuB
3726 CABPUU010000003.1 GCA902460745_01833 gene open 65191-66264 flhB
3727 CABPUU010000003.1 GCA902460745_01834 gene open 66409-67374
3728 CABPUU010000003.1 GCA902460745_01835 gene open 67447-67899
3729 CABPUU010000003.1 GCA902460745_01836 gene open 67922-68335
3730 CABPUU010000003.1 GCA902460745_01837 gene open 68521-68835 rplU
3731 CABPUU010000003.1 GCA902460745_01838 gene open 68847-69104 rpmA
3732 CABPUU010000003.1 GCA902460745_01839 gene open 69149-70255
3733 CABPUU010000003.1 GCA902460745_01840 gene open 70259-71533
3734 CABPUU010000003.1 GCA902460745_01841 gene open 71530-72612
3735 CABPUU010000003.1 GCA902460745_01842 gene open 72658-75486 uvrA
3736 CABPUU010000003.1 GCA902460745_01843 gene open 75661-75945
3737 CABPUU010000003.1 GCA902460745_01844 gene open 76048-76461 ndk
3738 CABPUU010000003.1 GCA902460745_01845 gene open 76476-76835
3739 CABPUU010000003.1 GCA902460745_01846 gene open 76847-76993 rpmF
3740 CABPUU010000003.1 GCA902460745_01847 gene open 76997-77986 plsX
3741 CABPUU010000003.1 GCA902460745_01848 gene open 77990-78994 fabH
3742 CABPUU010000003.1 GCA902460745_01849 gene open 79192-79791
3743 CABPUU010000003.1 GCA902460745_01850 gene open 79914-80996 pilZ
3744 CABPUU010000003.1 GCA902460745_01851 gene open 81005-83293 herA
3745 CABPUU010000003.1 GCA902460745_01852 gene open 83353-83964 plsY
3746 CABPUU010000003.1 GCA902460745_01853 gene open 83961-84287
3747 CABPUU010000003.1 GCA902460745_01854 gene open 84364-85035 ompR
3748 CABPUU010000003.1 GCA902460745_01855 gene open 85014-86291
3749 CABPUU010000003.1 GCA902460745_01856 gene open 86295-87743
3750 CABPUU010000003.1 GCA902460745_01857 gene open 88566-89444
3751 CABPUU010000003.1 GCA902460745_01858 gene open 89441-89758 fliN
3752 CABPUU010000003.1 GCA902460745_01859 gene open 89755-90174
3753 CABPUU010000003.1 GCA902460745_01860 gene open 90252-91001 trpA
3754 CABPUU010000003.1 GCA902460745_01861 gene open 90994-92175 trpB
3755 CABPUU010000003.1 GCA902460745_01862 gene open 92168-92779
3756 CABPUU010000003.1 GCA902460745_01863 gene open 92779-94383
3757 CABPUU010000003.1 GCA902460745_01864 gene open 94464-95036 recR
3758 CABPUU010000003.1 GCA902460745_01865 gene open 95033-96289 arsS
3759 CABPUU010000003.1 GCA902460745_01866 gene open 96286-96957
3760 CABPUU010000003.1 GCA902460745_01867 gene open 97081-98223 dnaJ
3761 CABPUU010000003.1 GCA902460745_01868 gene open 98979-100430 pyk
3762 CABPUU010000003.1 GCA902460745_01869 gene open 100523-101584 dctP
3763 CABPUU010000003.1 GCA902460745_01870 gene open 101699-102313 lptC
3764 CABPUU010000003.1 GCA902460745_01871 gene open 102324-102470
3765 CABPUU010000003.1 GCA902460745_01872 gene open 102573-103403
3766 CABPUU010000003.1 GCA902460745_01873 gene open 103400-103543
3767 CABPUU010000003.1 GCA902460745_01874 gene open 104881-105237
3768 CABPUU010000003.1 GCA902460745_01875 gene open 105238-108483
3769 CABPUU010000003.1 GCA902460745_01876 gene open 108492-109691
3770 CABPUU010000003.1 GCA902460745_01877 gene open 109827-110885 yedE
3771 CABPUU010000003.1 GCA902460745_01879 gene open 111393-112031
3772 CABPUU010000003.1 GCA902460745_01880 gene open 112031-112408
3773 CABPUU010000003.1 GCA902460745_01881 gene open 112405-113916
3774 CABPUU010000003.1 GCA902460745_01882 gene open 113913-114623
3775 CABPUU010000003.1 GCA902460745_01883 gene open 114601-115263
3776 CABPUU010000003.1 GCA902460745_01884 gene open 115232-115936
3777 CABPUU010000003.1 GCA902460745_01885 gene open 115958-116572
3778 CABPUU010000003.1 GCA902460745_01886 gene open 116615-117580
3779 CABPUU010000003.1 GCA902460745_01887 gene open 117577-118512 arsS
3780 CABPUU010000003.1 GCA902460745_01888 gene open 118529-118951
3781 CABPUU010000003.1 GCA902460745_01889 gene open 118951-120339
3782 CABPUU010000003.1 GCA902460745_01890 gene open 120336-121256
3783 CABPUU010000003.1 GCA902460745_01891 gene open 121291-121998
3784 CABPUU010000003.1 GCA902460745_01878 gene open 111002-111078 trnM
3785 CABPUU010000003.1 GCA902460745_01878 tRNA open 111002-111078 trnM tRNA-Met(cat)
3786 CABPUU010000004.1 GCA902460745_01892 CDS open 66-455 _na     129_aa hypothetical protein
3787 CABPUU010000004.1 GCA902460745_01893 CDS open 571-1038 _na     155_aa tssJ type VI secretion system lipoprotein TssJ
3788 CABPUU010000004.1 GCA902460745_01894 CDS open 1040-2434 _na     464_aa tssK type VI secretion system baseplate subunit TssK
3789 CABPUU010000004.1 GCA902460745_01895 CDS open 2444-3208 _na     254_aa icmH type IVB secretion system protein IcmH/DotU
3790 CABPUU010000004.1 GCA902460745_01896 CDS open 3209-4489 _na     426_aa Type VI secretion system protein
3791 CABPUU010000004.1 GCA902460745_01897 CDS open 4570-5055 _na     161_aa tssB type VI secretion system contractile sheath small subunit
3792 CABPUU010000004.1 GCA902460745_01898 CDS open 5058-6506 _na     482_aa tssC type VI secretion system contractile sheath large subunit
3793 CABPUU010000004.1 GCA902460745_01899 CDS open 6515-6904 _na     129_aa GPW/gp25 family protein
3794 CABPUU010000004.1 GCA902460745_01900 CDS open 6904-8622 _na     572_aa tssF type VI secretion system baseplate subunit TssF
3795 CABPUU010000004.1 GCA902460745_01901 CDS open 8619-9515 _na     298_aa Type VI secretion protein
3796 CABPUU010000004.1 GCA902460745_01902 CDS open 9593-13081 _na     1162_aa tssM type VI secretion system membrane subunit TssM
3797 CABPUU010000004.1 GCA902460745_01903 CDS open 13091-14008 _na     305_aa Type VI secretion system protein
3798 CABPUU010000004.1 GCA902460745_01904 CDS open 14073-14594 _na     173_aa Hcp family type VI secretion system effector
3799 CABPUU010000004.1 GCA902460745_01905 CDS open 14704-15264 _na     186_aa Ankyrin repeat domain-containing protein
3800 CABPUU010000004.1 GCA902460745_01906 CDS open 15261-15818 _na     185_aa Ankyrin repeat domain-containing protein
3801 CABPUU010000004.1 GCA902460745_01907 CDS open 15818-16258 _na     146_aa hypothetical protein
3802 CABPUU010000004.1 GCA902460745_01908 CDS open 16248-16883 _na     211_aa Membrane protein
3803 CABPUU010000004.1 GCA902460745_01909 CDS open 16880-17431 _na     183_aa Ankyrin repeat domain-containing protein
3804 CABPUU010000004.1 GCA902460745_01910 CDS open 17428-17979 _na     183_aa hypothetical protein
3805 CABPUU010000004.1 GCA902460745_01911 CDS open 17979-20807 _na     942_aa vgrG Type VI secretion system tip protein VgrG
3806 CABPUU010000004.1 GCA902460745_01912 CDS open 20826-21323 _na     165_aa hypothetical protein
3807 CABPUU010000004.1 GCA902460745_01913 CDS open 21320-24556 _na     1078_aa peptidoglycan DD-metalloendopeptidase family protein
3808 CABPUU010000004.1 GCA902460745_01914 CDS open 24896-25348 _na     150_aa hypothetical protein
3809 CABPUU010000004.1 GCA902460745_01915 CDS open 25652-26359 _na     235_aa aqpZ aquaporin Z
3810 CABPUU010000004.1 GCA902460745_01916 CDS open 26495-26722 _na     75_aa ATP-binding protein
3811 CABPUU010000004.1 GCA902460745_01917 CDS open 26744-28126 _na     460_aa RND transporter
3812 CABPUU010000004.1 GCA902460745_01918 CDS open 28116-31241 _na     1041_aa cmeB Multidrug efflux system CmeABC%2C inner membrane drug transporter CmeB
3813 CABPUU010000004.1 GCA902460745_01919 CDS open 31252-32412 _na     386_aa cmeA Multidrug efflux system CmeABC%2C periplasmic fusion protein CmeA
3814 CABPUU010000004.1 GCA902460745_01920 CDS open 32520-33146 _na     208_aa cmeR Transcriptional repressor of CmeABC operon%2C CmeR
3815 CABPUU010000004.1 GCA902460745_01921 CDS open 33177-34502 _na     441_aa ccoG cytochrome c oxidase accessory protein CcoG
3816 CABPUU010000004.1 GCA902460745_01922 CDS open 34607-36082 _na     491_aa Flavocytochrome c
3817 CABPUU010000004.1 GCA902460745_01923 CDS open 36141-36353 _na     70_aa rpsU 30S ribosomal protein S21
3818 CABPUU010000004.1 GCA902460745_01924 CDS open 36457-37089 _na     210_aa Excisionase family DNA binding domain-containing protein
3819 CABPUU010000004.1 GCA902460745_01925 CDS open 37086-37703 _na     205_aa Lipoprotein
3820 CABPUU010000004.1 GCA902460745_01926 CDS open 37706-38887 _na     393_aa Glutathionylspermidine amidase / glutathionylspermidine synthetase
3821 CABPUU010000004.1 GCA902460745_01927 CDS open 38890-39819 _na     309_aa D-2-hydroxyacid dehydrogenase
3822 CABPUU010000004.1 GCA902460745_01928 CDS open 39823-40320 _na     165_aa yajQ YajQ family cyclic di-GMP-binding protein
3823 CABPUU010000004.1 GCA902460745_01929 CDS open 40680-41471 _na     263_aa DUF2314 domain-containing protein
3824 CABPUU010000004.1 GCA902460745_01930 CDS open 41520-42758 _na     412_aa hypothetical protein
3825 CABPUU010000004.1 GCA902460745_01931 CDS open 42761-44089 _na     442_aa ABC transporter permease
3826 CABPUU010000004.1 GCA902460745_01932 CDS open 44264-45628 _na     454_aa coproporphyrinogen III oxidase family protein
3827 CABPUU010000004.1 GCA902460745_01933 CDS open 45628-47262 _na     544_aa multidrug ABC transporter permease/ATP-binding protein
3828 CABPUU010000004.1 GCA902460745_01934 CDS open 47370-47759 _na     129_aa NAD(P)H-quinone oxidoreductase subunit 3
3829 CABPUU010000004.1 GCA902460745_01935 CDS open 47741-48253 _na     170_aa nuoB NADH-quinone oxidoreductase subunit B
3830 CABPUU010000004.1 GCA902460745_01936 CDS open 48250-49014 _na     254_aa NADH-quinone oxidoreductase subunit C
3831 CABPUU010000004.1 GCA902460745_01937 CDS open 49011-50240 _na     409_aa nuoD NADH-quinone oxidoreductase subunit D
3832 CABPUU010000004.1 GCA902460745_01938 CDS open 50237-50467 _na     76_aa NADH-ubiquinone oxidoreductase chain E
3833 CABPUU010000004.1 GCA902460745_01939 CDS open 50464-51174 _na     236_aa NADH dehydrogenase
3834 CABPUU010000004.1 GCA902460745_01940 CDS open 51171-53471 _na     766_aa NADH-quinone oxidoreductase subunit G
3835 CABPUU010000004.1 GCA902460745_01941 CDS open 53464-54459 _na     331_aa nuoH NADH-quinone oxidoreductase subunit NuoH
3836 CABPUU010000004.1 GCA902460745_01942 CDS open 54468-55106 _na     212_aa nuoI NADH-quinone oxidoreductase subunit NuoI
3837 CABPUU010000004.1 GCA902460745_01943 CDS open 55099-55635 _na     178_aa NADH-quinone oxidoreductase subunit J
3838 CABPUU010000004.1 GCA902460745_01944 CDS open 55632-55934 _na     100_aa nuoK NADH-quinone oxidoreductase subunit NuoK
3839 CABPUU010000004.1 GCA902460745_01945 CDS open 55938-57776 _na     612_aa nuoL NADH-quinone oxidoreductase subunit L
3840 CABPUU010000004.1 GCA902460745_01946 CDS open 57776-59287 _na     503_aa NADH-quinone oxidoreductase subunit M
3841 CABPUU010000004.1 GCA902460745_01947 CDS open 59284-60774 _na     496_aa nuoN NADH-quinone oxidoreductase subunit NuoN
3842 CABPUU010000004.1 GCA902460745_01948 CDS open 60758-63166 _na     802_aa Flagellar protein
3843 CABPUU010000004.1 GCA902460745_01949 CDS open 63173-63901 _na     242_aa HEAT repeat domain-containing protein
3844 CABPUU010000004.1 GCA902460745_01956 CDS open 65368-66120 _na     250_aa DUF4198 domain-containing protein
3845 CABPUU010000004.1 GCA902460745_01957 CDS open 66565-68337 _na     590_aa Hemolysin secretion/activation protein%2C ShlB/FhaC/HecB family
3846 CABPUU010000004.1 GCA902460745_01958 CDS open 77395-77598 _na     67_aa hypothetical protein
3847 CABPUU010000004.1 GCA902460745_01959 CDS open 77692-78522 _na     276_aa hypothetical protein
3848 CABPUU010000004.1 GCA902460745_01960 CDS open 78612-79376 _na     254_aa Lipoprotein
3849 CABPUU010000004.1 GCA902460745_01961 CDS open 79378-80196 _na     272_aa Lipoprotein
3850 CABPUU010000004.1 GCA902460745_01962 CDS open 80213-80581 _na     122_aa hypothetical protein
3851 CABPUU010000004.1 GCA902460745_01963 CDS open 80770-81246 _na     158_aa hypothetical protein
3852 CABPUU010000004.1 GCA902460745_01964 CDS open 81407-81586 _na     59_aa hypothetical protein
3853 CABPUU010000004.1 GCA902460745_01965 CDS open 81929-82504 _na     191_aa hypothetical protein
3854 CABPUU010000004.1 GCA902460745_01966 CDS open 82567-82821 _na     84_aa hypothetical protein
3855 CABPUU010000004.1 GCA902460745_01967 CDS open 83090-83530 _na     146_aa hypothetical protein
3856 CABPUU010000004.1 GCA902460745_01968 CDS open 83475-83747 _na     90_aa hypothetical protein
3857 CABPUU010000004.1 GCA902460745_01969 CDS open 83891-84115 _na     74_aa hypothetical protein
3858 CABPUU010000004.1 GCA902460745_01970 CDS open 84118-84480 _na     120_aa Cyclic nucleotide-binding domain-containing protein
3859 CABPUU010000004.1 GCA902460745_01971 CDS open 84508-84897 _na     129_aa DUF6984 domain-containing protein
3860 CABPUU010000004.1 GCA902460745_01972 CDS open 84901-85284 _na     127_aa hypothetical protein
3861 CABPUU010000004.1 GCA902460745_01973 CDS open 85281-85706 _na     141_aa hypothetical protein
3862 CABPUU010000004.1 GCA902460745_01974 CDS open 85716-86111 _na     131_aa hypothetical protein
3863 CABPUU010000004.1 GCA902460745_01892 gene open 66-455
3864 CABPUU010000004.1 GCA902460745_01893 gene open 571-1038 tssJ
3865 CABPUU010000004.1 GCA902460745_01894 gene open 1040-2434 tssK
3866 CABPUU010000004.1 GCA902460745_01895 gene open 2444-3208 icmH
3867 CABPUU010000004.1 GCA902460745_01896 gene open 3209-4489
3868 CABPUU010000004.1 GCA902460745_01897 gene open 4570-5055 tssB
3869 CABPUU010000004.1 GCA902460745_01898 gene open 5058-6506 tssC
3870 CABPUU010000004.1 GCA902460745_01899 gene open 6515-6904
3871 CABPUU010000004.1 GCA902460745_01900 gene open 6904-8622 tssF
3872 CABPUU010000004.1 GCA902460745_01901 gene open 8619-9515
3873 CABPUU010000004.1 GCA902460745_01902 gene open 9593-13081 tssM
3874 CABPUU010000004.1 GCA902460745_01903 gene open 13091-14008
3875 CABPUU010000004.1 GCA902460745_01904 gene open 14073-14594
3876 CABPUU010000004.1 GCA902460745_01905 gene open 14704-15264
3877 CABPUU010000004.1 GCA902460745_01906 gene open 15261-15818
3878 CABPUU010000004.1 GCA902460745_01907 gene open 15818-16258
3879 CABPUU010000004.1 GCA902460745_01908 gene open 16248-16883
3880 CABPUU010000004.1 GCA902460745_01909 gene open 16880-17431
3881 CABPUU010000004.1 GCA902460745_01910 gene open 17428-17979
3882 CABPUU010000004.1 GCA902460745_01911 gene open 17979-20807 vgrG
3883 CABPUU010000004.1 GCA902460745_01912 gene open 20826-21323
3884 CABPUU010000004.1 GCA902460745_01913 gene open 21320-24556
3885 CABPUU010000004.1 GCA902460745_01914 gene open 24896-25348
3886 CABPUU010000004.1 GCA902460745_01915 gene open 25652-26359 aqpZ
3887 CABPUU010000004.1 GCA902460745_01916 gene open 26495-26722
3888 CABPUU010000004.1 GCA902460745_01917 gene open 26744-28126
3889 CABPUU010000004.1 GCA902460745_01918 gene open 28116-31241 cmeB
3890 CABPUU010000004.1 GCA902460745_01919 gene open 31252-32412 cmeA
3891 CABPUU010000004.1 GCA902460745_01920 gene open 32520-33146 cmeR
3892 CABPUU010000004.1 GCA902460745_01921 gene open 33177-34502 ccoG
3893 CABPUU010000004.1 GCA902460745_01922 gene open 34607-36082
3894 CABPUU010000004.1 GCA902460745_01923 gene open 36141-36353 rpsU
3895 CABPUU010000004.1 GCA902460745_01924 gene open 36457-37089
3896 CABPUU010000004.1 GCA902460745_01925 gene open 37086-37703
3897 CABPUU010000004.1 GCA902460745_01926 gene open 37706-38887
3898 CABPUU010000004.1 GCA902460745_01927 gene open 38890-39819
3899 CABPUU010000004.1 GCA902460745_01928 gene open 39823-40320 yajQ
3900 CABPUU010000004.1 GCA902460745_01929 gene open 40680-41471
3901 CABPUU010000004.1 GCA902460745_01930 gene open 41520-42758
3902 CABPUU010000004.1 GCA902460745_01931 gene open 42761-44089
3903 CABPUU010000004.1 GCA902460745_01932 gene open 44264-45628
3904 CABPUU010000004.1 GCA902460745_01933 gene open 45628-47262
3905 CABPUU010000004.1 GCA902460745_01934 gene open 47370-47759
3906 CABPUU010000004.1 GCA902460745_01935 gene open 47741-48253 nuoB
3907 CABPUU010000004.1 GCA902460745_01936 gene open 48250-49014
3908 CABPUU010000004.1 GCA902460745_01937 gene open 49011-50240 nuoD
3909 CABPUU010000004.1 GCA902460745_01938 gene open 50237-50467
3910 CABPUU010000004.1 GCA902460745_01939 gene open 50464-51174
3911 CABPUU010000004.1 GCA902460745_01940 gene open 51171-53471
3912 CABPUU010000004.1 GCA902460745_01941 gene open 53464-54459 nuoH
3913 CABPUU010000004.1 GCA902460745_01942 gene open 54468-55106 nuoI
3914 CABPUU010000004.1 GCA902460745_01943 gene open 55099-55635
3915 CABPUU010000004.1 GCA902460745_01944 gene open 55632-55934 nuoK
3916 CABPUU010000004.1 GCA902460745_01945 gene open 55938-57776 nuoL
3917 CABPUU010000004.1 GCA902460745_01946 gene open 57776-59287
3918 CABPUU010000004.1 GCA902460745_01947 gene open 59284-60774 nuoN
3919 CABPUU010000004.1 GCA902460745_01948 gene open 60758-63166
3920 CABPUU010000004.1 GCA902460745_01949 gene open 63173-63901
3921 CABPUU010000004.1 GCA902460745_01956 gene open 65368-66120
3922 CABPUU010000004.1 GCA902460745_01957 gene open 66565-68337
3923 CABPUU010000004.1 GCA902460745_01958 gene open 77395-77598
3924 CABPUU010000004.1 GCA902460745_01959 gene open 77692-78522
3925 CABPUU010000004.1 GCA902460745_01960 gene open 78612-79376
3926 CABPUU010000004.1 GCA902460745_01961 gene open 79378-80196
3927 CABPUU010000004.1 GCA902460745_01962 gene open 80213-80581
3928 CABPUU010000004.1 GCA902460745_01963 gene open 80770-81246
3929 CABPUU010000004.1 GCA902460745_01964 gene open 81407-81586
3930 CABPUU010000004.1 GCA902460745_01965 gene open 81929-82504
3931 CABPUU010000004.1 GCA902460745_01966 gene open 82567-82821
3932 CABPUU010000004.1 GCA902460745_01967 gene open 83090-83530
3933 CABPUU010000004.1 GCA902460745_01968 gene open 83475-83747
3934 CABPUU010000004.1 GCA902460745_01969 gene open 83891-84115
3935 CABPUU010000004.1 GCA902460745_01970 gene open 84118-84480
3936 CABPUU010000004.1 GCA902460745_01971 gene open 84508-84897
3937 CABPUU010000004.1 GCA902460745_01972 gene open 84901-85284
3938 CABPUU010000004.1 GCA902460745_01973 gene open 85281-85706
3939 CABPUU010000004.1 GCA902460745_01974 gene open 85716-86111
3940 CABPUU010000004.1 GCA902460745_01950 gene open 64138-64213 trnK
3941 CABPUU010000004.1 GCA902460745_01951 gene open 64228-64303 trnE
3942 CABPUU010000004.1 GCA902460745_01952 gene open 64320-64395 trnV
3943 CABPUU010000004.1 GCA902460745_01953 gene open 64408-64484 trnD
3944 CABPUU010000004.1 GCA902460745_01954 gene open 64603-64678 trnK
3945 CABPUU010000004.1 GCA902460745_01955 gene open 64685-64759 trnE
3946 CABPUU010000004.1 GCA902460745_01950 tRNA open 64138-64213 trnK tRNA-Lys(ttt)
3947 CABPUU010000004.1 GCA902460745_01951 tRNA open 64228-64303 trnE tRNA-Glu(ctc)
3948 CABPUU010000004.1 GCA902460745_01952 tRNA open 64320-64395 trnV tRNA-Val(tac)
3949 CABPUU010000004.1 GCA902460745_01953 tRNA open 64408-64484 trnD tRNA-Asp(gtc)
3950 CABPUU010000004.1 GCA902460745_01954 tRNA open 64603-64678 trnK tRNA-Lys(ctt)
3951 CABPUU010000004.1 GCA902460745_01955 tRNA open 64685-64759 trnE tRNA-Glu(ctc)
3952 CABPUU010000005.1 repeat_region open 9613-10415 CRISPR array with 11 repeats of length 37%2C consensus sequence GTTTCAATCCCCTTGATCGGGTCAAATTTGTTTAAAT and spacer length 38
3953 CABPUU010000005.1 repeat_region open 32897-33416 CRISPR array with 7 repeats of length 32%2C consensus sequence GATACAAATTTCCCCGATCTAGGGGATTGAAA and spacer length 47
3954 CABPUU010000005.1 GCA902460745_01975 CDS open 675-2831 _na     718_aa Tyr recombinase domain-containing protein
3955 CABPUU010000005.1 GCA902460745_01976 CDS open 2952-4151 _na     399_aa AAA+ ATPase domain-containing protein
3956 CABPUU010000005.1 GCA902460745_01977 CDS open 4394-4531 _na     45_aa hypothetical protein
3957 CABPUU010000005.1 GCA902460745_01978 CDS open 4698-4850 _na     50_aa hypothetical protein
3958 CABPUU010000005.1 GCA902460745_01979 CDS open 5164-6498 _na     444_aa CRISPR-associated DxTHG motif protein
3959 CABPUU010000005.1 GCA902460745_01980 CDS open 6574-7194 _na     206_aa DUF4433 domain-containing protein
3960 CABPUU010000005.1 GCA902460745_01981 CDS open 7204-7887 _na     227_aa Macro domain-containing protein
3961 CABPUU010000005.1 GCA902460745_01982 CDS open 7884-8843 _na     319_aa WYL domain-containing protein
3962 CABPUU010000005.1 GCA902460745_01983 CDS open 10849-11124 _na     91_aa cas2 CRISPR-associated endonuclease Cas2
3963 CABPUU010000005.1 GCA902460745_01984 CDS open 11124-13358 _na     744_aa cas1 CRISPR-associated endonuclease Cas1
3964 CABPUU010000005.1 GCA902460745_01985 CDS open 13857-14066 _na     69_aa hypothetical protein
3965 CABPUU010000005.1 GCA902460745_01986 CDS open 14047-14883 _na     278_aa CRISPR system precrRNA processing endoribonuclease RAMP protein Cas6
3966 CABPUU010000005.1 GCA902460745_01987 CDS open 14870-16378 _na     502_aa cas10 type III-A CRISPR-associated protein Cas10/Csm1
3967 CABPUU010000005.1 GCA902460745_01988 CDS open 16375-16785 _na     136_aa CRISPR system Cms protein Csm2
3968 CABPUU010000005.1 GCA902460745_01989 CDS open 16795-17433 _na     212_aa csm3 type III-A CRISPR-associated RAMP protein Csm3
3969 CABPUU010000005.1 GCA902460745_01990 CDS open 17433-18320 _na     295_aa csm4 type III-A CRISPR-associated RAMP protein Csm4
3970 CABPUU010000005.1 GCA902460745_01991 CDS open 18310-19347 _na     345_aa CRISPR system Cms protein Csm5
3971 CABPUU010000005.1 GCA902460745_01992 CDS open 19727-22177 _na     816_aa Aminotransferase
3972 CABPUU010000005.1 GCA902460745_01993 CDS open 22167-22529 _na     120_aa mobC Plasmid mobilization relaxosome protein MobC
3973 CABPUU010000005.1 GCA902460745_01994 CDS open 22682-23227 _na     181_aa Chemotaxis protein
3974 CABPUU010000005.1 GCA902460745_01995 CDS open 23231-23428 _na     65_aa hypothetical protein
3975 CABPUU010000005.1 GCA902460745_01996 CDS open 23965-24837 _na     290_aa Putative transcriptional regulator
3976 CABPUU010000005.1 GCA902460745_01997 CDS open 25081-26586 _na     501_aa ADP-ribosylation/Crystallin J1
3977 CABPUU010000005.1 GCA902460745_01998 CDS open 26583-28397 _na     604_aa ENT domain-containing protein
3978 CABPUU010000005.1 GCA902460745_01999 CDS open 28510-28896 _na     128_aa hypothetical protein
3979 CABPUU010000005.1 GCA902460745_02000 CDS open 28991-29590 _na     199_aa DUF4359 domain-containing protein
3980 CABPUU010000005.1 GCA902460745_02001 CDS open 29943-30755 _na     270_aa CRISPR-associated protein Cas6 C-terminal domain-containing protein
3981 CABPUU010000005.1 GCA902460745_02002 CDS open 30819-31775 _na     318_aa Reverse transcriptase domain-containing protein
3982 CABPUU010000005.1 GCA902460745_02003 CDS open 33587-34255 _na     222_aa Outer membrane protein beta-barrel domain-containing protein
3983 CABPUU010000005.1 GCA902460745_02004 CDS open 34402-35196 _na     264_aa CRISPR-associated protein
3984 CABPUU010000005.1 GCA902460745_02005 CDS open 35200-36447 _na     415_aa CRISPR-associated DxTHG motif protein
3985 CABPUU010000005.1 GCA902460745_02006 CDS open 36444-36824 _na     126_aa csx20 CRISPR-associated protein Csx20
3986 CABPUU010000005.1 GCA902460745_02007 CDS open 36824-37825 _na     333_aa Transcriptional regulator
3987 CABPUU010000005.1 GCA902460745_02008 CDS open 38101-38748 _na     215_aa tRNA 2-selenouridine synthase
3988 CABPUU010000005.1 GCA902460745_02009 CDS open 38761-42312 _na     1183_aa Mbeg1-like protein
3989 CABPUU010000005.1 GCA902460745_02010 CDS open 46365-47012 _na     215_aa hypothetical protein
3990 CABPUU010000005.1 GCA902460745_02011 CDS open 47923-49284 _na     453_aa thioredoxin reductase
3991 CABPUU010000005.1 GCA902460745_02012 CDS open 49288-51357 _na     689_aa hypothetical protein
3992 CABPUU010000005.1 GCA902460745_02013 CDS open 54615-56465 _na     616_aa site-specific DNA-methyltransferase (adenine-specific)
3993 CABPUU010000005.1 GCA902460745_02014 CDS open 56462-57703 _na     413_aa Type I restriction modification DNA specificity domain-containing protein
3994 CABPUU010000005.1 GCA902460745_02015 CDS open 57717-58706 _na     329_aa DUF3644 domain-containing protein
3995 CABPUU010000005.1 GCA902460745_02016 CDS open 58703-61846 _na     1047_aa Type I restriction enzyme endonuclease subunit
3996 CABPUU010000005.1 GCA902460745_02017 CDS open 61934-62137 _na     67_aa hypothetical protein
3997 CABPUU010000005.1 GCA902460745_01975 gene open 675-2831
3998 CABPUU010000005.1 GCA902460745_01976 gene open 2952-4151
3999 CABPUU010000005.1 GCA902460745_01977 gene open 4394-4531
4000 CABPUU010000005.1 GCA902460745_01978 gene open 4698-4850