HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Haemophilus parainfluenzae (GCA_902461185.1)

Select a Genome:
BAKTA Annotations for GCA_902461185.1
Genome Selected: Haemophilus parainfluenzae
ContigsBases CDSrRNA tmRNAtRNA
22 2151510 2034 5 1 48
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4217 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:5]    |    Number of Records Found: 4217 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
2001 CABPXD010000004.1 GCA902461185_00995 gene open 198063-199019 fmt
2002 CABPXD010000004.1 GCA902461185_00996 gene open 199079-199588 def
2003 CABPXD010000005.1 GCA902461185_00997 CDS open 11-136 _na     41_aa hypothetical protein
2004 CABPXD010000005.1 GCA902461185_00998 CDS open 118-408 _na     96_aa hypothetical protein
2005 CABPXD010000005.1 GCA902461185_00999 CDS open 433-765 _na     110_aa DUF3892 domain-containing protein
2006 CABPXD010000005.1 GCA902461185_01000 CDS open 849-1034 _na     61_aa hypothetical protein
2007 CABPXD010000005.1 GCA902461185_01001 CDS open 1224-2372 _na     382_aa Replication-associated protein G2P
2008 CABPXD010000005.1 GCA902461185_01002 CDS open 2412-2738 _na     108_aa Single-stranded DNA-binding protein
2009 CABPXD010000005.1 GCA902461185_01003 CDS open 2824-3081 _na     85_aa hypothetical protein
2010 CABPXD010000005.1 GCA902461185_01004 CDS open 3116-3346 _na     76_aa hypothetical protein
2011 CABPXD010000005.1 GCA902461185_01005 CDS open 3414-4850 _na     478_aa hypothetical protein
2012 CABPXD010000005.1 GCA902461185_01006 CDS open 4864-5157 _na     97_aa DUF2523 domain-containing protein
2013 CABPXD010000005.1 GCA902461185_01007 CDS open 5168-6214 _na     348_aa Zona occludens toxin N-terminal domain-containing protein
2014 CABPXD010000005.1 GCA902461185_01008 CDS open 6211-7347 _na     378_aa gspD Type II secretion system protein GspD
2015 CABPXD010000005.1 GCA902461185_01009 CDS open 7431-7838 _na     135_aa hypothetical protein
2016 CABPXD010000005.1 GCA902461185_01010 CDS open 8232-8357 _na     41_aa hypothetical protein
2017 CABPXD010000005.1 GCA902461185_01011 CDS open 8339-8629 _na     96_aa hypothetical protein
2018 CABPXD010000005.1 GCA902461185_01012 CDS open 8654-8986 _na     110_aa DUF3892 domain-containing protein
2019 CABPXD010000005.1 GCA902461185_01013 CDS open 9070-9255 _na     61_aa hypothetical protein
2020 CABPXD010000005.1 GCA902461185_01014 CDS open 9445-10593 _na     382_aa Replication-associated protein G2P
2021 CABPXD010000005.1 GCA902461185_01015 CDS open 10633-10959 _na     108_aa Single-stranded DNA-binding protein
2022 CABPXD010000005.1 GCA902461185_01016 CDS open 11045-11302 _na     85_aa hypothetical protein
2023 CABPXD010000005.1 GCA902461185_01017 CDS open 11337-11567 _na     76_aa hypothetical protein
2024 CABPXD010000005.1 GCA902461185_01018 CDS open 11635-13071 _na     478_aa hypothetical protein
2025 CABPXD010000005.1 GCA902461185_01019 CDS open 13085-13378 _na     97_aa DUF2523 domain-containing protein
2026 CABPXD010000005.1 GCA902461185_01020 CDS open 13389-14435 _na     348_aa Zona occludens toxin N-terminal domain-containing protein
2027 CABPXD010000005.1 GCA902461185_01021 CDS open 14432-15568 _na     378_aa gspD Type II secretion system protein GspD
2028 CABPXD010000005.1 GCA902461185_01022 CDS open 15652-16059 _na     135_aa hypothetical protein
2029 CABPXD010000005.1 GCA902461185_01023 CDS open 16894-17379 _na     161_aa ftnA non-heme ferritin
2030 CABPXD010000005.1 GCA902461185_01024 CDS open 17400-17900 _na     166_aa ftnA non-heme ferritin
2031 CABPXD010000005.1 GCA902461185_01026 CDS open 18240-19169 _na     309_aa ttcA tRNA 2-thiocytidine(32) synthetase TtcA
2032 CABPXD010000005.1 GCA902461185_01027 CDS open 19171-19500 _na     109_aa Sulfurtransferase
2033 CABPXD010000005.1 GCA902461185_01028 CDS open 19595-21043 _na     482_aa VWFA domain-containing protein
2034 CABPXD010000005.1 GCA902461185_01029 CDS open 21053-22546 _na     497_aa VWA domain-containing protein
2035 CABPXD010000005.1 GCA902461185_01030 CDS open 22651-23136 _na     161_aa Lipoprotein
2036 CABPXD010000005.1 GCA902461185_01031 CDS open 23146-23850 _na     234_aa Glycine zipper domain-containing protein
2037 CABPXD010000005.1 GCA902461185_01032 CDS open 23871-25451 _na     526_aa Sulfatase-modifying factor enzyme domain-containing protein
2038 CABPXD010000005.1 GCA902461185_01033 CDS open 25444-26652 _na     402_aa ABC transporter permease
2039 CABPXD010000005.1 GCA902461185_01034 CDS open 26671-27390 _na     239_aa ABC transporter%2C ATP-binding protein
2040 CABPXD010000005.1 GCA902461185_01035 CDS open 27404-29407 _na     667_aa Ppka
2041 CABPXD010000005.1 GCA902461185_01036 CDS open 29407-30396 _na     329_aa Sel1 repeat protein
2042 CABPXD010000005.1 GCA902461185_01037 CDS open 30407-33088 _na     893_aa hopL1 Type III effector HopL1
2043 CABPXD010000005.1 GCA902461185_01038 CDS open 33101-36139 _na     1012_aa putative protein conserved in bacteria%2C putative virulence factor
2044 CABPXD010000005.1 GCA902461185_01039 CDS open 36176-37762 _na     528_aa Virulence factor
2045 CABPXD010000005.1 GCA902461185_01040 CDS open 37971-39062 _na     363_aa Iron chelate uptake ABC transporter%2C FeCT family%2C permease protein
2046 CABPXD010000005.1 GCA902461185_01041 CDS open 39062-39850 _na     262_aa ABC transporter%2C ATP-binding protein
2047 CABPXD010000005.1 GCA902461185_01042 CDS open 39872-40906 _na     344_aa Periplasmic binding protein
2048 CABPXD010000005.1 GCA902461185_01043 CDS open 40987-41196 _na     69_aa Molybdenum-pterin-binding protein
2049 CABPXD010000005.1 GCA902461185_01044 CDS open 41429-43696 _na     755_aa Ferric enterobactin receptor
2050 CABPXD010000005.1 GCA902461185_01045 CDS open 43760-44779 _na     339_aa Periplasmic binding protein
2051 CABPXD010000005.1 GCA902461185_01046 CDS open 45009-47393 _na     794_aa TonB-dependent receptor
2052 CABPXD010000005.1 GCA902461185_01047 CDS open 47639-49912 _na     757_aa metE 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase
2053 CABPXD010000005.1 GCA902461185_01048 CDS open 50000-50875 _na     291_aa cdd cytidine deaminase
2054 CABPXD010000005.1 GCA902461185_01049 CDS open 50967-51509 _na     180_aa putative RNA 2'-phosphotransferase
2055 CABPXD010000005.1 GCA902461185_01050 CDS open 51511-51882 _na     123_aa SMI1/KNR4 family protein
2056 CABPXD010000005.1 GCA902461185_01051 CDS open 52022-52834 _na     270_aa Oligopeptide ABC transporter ATP-binding subunit
2057 CABPXD010000005.1 GCA902461185_01052 CDS open 52836-54812 _na     658_aa ABC-type dipeptide transporter
2058 CABPXD010000005.1 GCA902461185_01053 CDS open 54812-55765 _na     317_aa ABC transporter permease
2059 CABPXD010000005.1 GCA902461185_01054 CDS open 56057-57655 _na     532_aa ABC transporter periplasmic binding protein
2060 CABPXD010000005.1 GCA902461185_01055 CDS open 58007-58489 _na     160_aa DNA-binding ferritin-like protein
2061 CABPXD010000005.1 GCA902461185_01056 CDS open 58578-59708 _na     376_aa Tetratricopeptide repeat protein
2062 CABPXD010000005.1 GCA902461185_01057 CDS open 59815-61071 _na     418_aa Tetratricopeptide repeat protein
2063 CABPXD010000005.1 GCA902461185_01058 CDS open 61157-61432 _na     91_aa YceK/YidQ family lipoprotein
2064 CABPXD010000005.1 GCA902461185_01059 CDS open 61639-62100 _na     153_aa thrE Threonine/Serine exporter ThrE domain-containing protein
2065 CABPXD010000005.1 GCA902461185_01060 CDS open 62105-62875 _na     256_aa Threonine/serine exporter-like N-terminal domain-containing protein
2066 CABPXD010000005.1 GCA902461185_01061 CDS open 62992-63762 _na     256_aa hypothetical protein
2067 CABPXD010000005.1 GCA902461185_01062 CDS open 64024-64671 _na     215_aa grxB glutaredoxin 2
2068 CABPXD010000005.1 GCA902461185_01063 CDS open 64675-66609 _na     644_aa recD exodeoxyribonuclease V subunit alpha
2069 CABPXD010000005.1 GCA902461185_01064 CDS open 66609-70250 _na     1213_aa recB exodeoxyribonuclease V subunit beta
2070 CABPXD010000005.1 GCA902461185_01065 CDS open 70388-71938 _na     516_aa hsdM type I restriction-modification system subunit M
2071 CABPXD010000005.1 GCA902461185_01066 CDS open 71945-73129 _na     394_aa restriction endonuclease subunit S
2072 CABPXD010000005.1 GCA902461185_01067 CDS open 73235-76330 _na     1031_aa Type I restriction enzyme endonuclease subunit
2073 CABPXD010000005.1 GCA902461185_01068 CDS open 76410-76766 _na     118_aa Phosphoribosylglycinamide formyltransferase
2074 CABPXD010000005.1 GCA902461185_01069 CDS open 76824-78131 _na     435_aa nCS2 Inner membrane protein
2075 CABPXD010000005.1 GCA902461185_01070 CDS open 78152-79105 _na     317_aa oxidoreductase
2076 CABPXD010000005.1 GCA902461185_01071 CDS open 79182-79661 _na     159_aa ybaK Cys-tRNA(Pro) deacylase
2077 CABPXD010000005.1 GCA902461185_01072 CDS open 79720-80253 _na     177_aa fabA bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase
2078 CABPXD010000005.1 GCA902461185_01073 CDS open 80422-82224 _na     600_aa endopeptidase La
2079 CABPXD010000005.1 GCA902461185_01074 CDS open 82327-82776 _na     149_aa matP macrodomain Ter protein MatP
2080 CABPXD010000005.1 GCA902461185_01075 CDS open 82857-83066 _na     69_aa cspD cold shock domain-containing protein CspD
2081 CABPXD010000005.1 GCA902461185_01076 CDS open 83214-83378 _na     54_aa yoaH YoaH family protein
2082 CABPXD010000005.1 GCA902461185_01077 CDS open 83391-84107 _na     238_aa truC tRNA pseudouridine(65) synthase TruC
2083 CABPXD010000005.1 GCA902461185_01078 CDS open 84108-84428 _na     106_aa Anhydro-N-acetylmuramic acid kinase
2084 CABPXD010000005.1 GCA902461185_01079 CDS open 84499-84768 _na     89_aa acylphosphatase
2085 CABPXD010000005.1 GCA902461185_01080 CDS open 84889-85545 _na     218_aa curli polymerization inhibitor CsgI-related protein
2086 CABPXD010000005.1 GCA902461185_01081 CDS open 85643-87796 _na     717_aa TIGR01666 family membrane protein
2087 CABPXD010000005.1 GCA902461185_01082 CDS open 87898-88476 _na     192_aa rsxA electron transport complex subunit RsxA
2088 CABPXD010000005.1 GCA902461185_01083 CDS open 88547-89140 _na     197_aa rsxB electron transport complex subunit RsxB
2089 CABPXD010000005.1 GCA902461185_01084 CDS open 89133-91733 _na     866_aa rsxC electron transport complex subunit RsxC
2090 CABPXD010000005.1 GCA902461185_01085 CDS open 91748-92830 _na     360_aa rsxD electron transport complex subunit RsxD
2091 CABPXD010000005.1 GCA902461185_01086 CDS open 92830-93456 _na     208_aa rsxG electron transport complex subunit RsxG
2092 CABPXD010000005.1 GCA902461185_01087 CDS open 93467-94177 _na     236_aa Ion-translocating oxidoreductase complex subunit E
2093 CABPXD010000005.1 GCA902461185_01088 CDS open 94174-94809 _na     211_aa nth endonuclease III
2094 CABPXD010000005.1 GCA902461185_01089 CDS open 94836-96206 _na     456_aa yocR putative sodium-dependent transporter HI_1690
2095 CABPXD010000005.1 GCA902461185_01090 CDS open 96252-98195 _na     647_aa uup ABC transporter ATP-binding protein
2096 CABPXD010000005.1 GCA902461185_01091 CDS open 98241-99593 _na     450_aa anti-phage deoxyguanosine triphosphatase
2097 CABPXD010000005.1 GCA902461185_01092 CDS open 99590-100282 _na     230_aa CidB/LrgB family autolysis modulator
2098 CABPXD010000005.1 GCA902461185_01093 CDS open 100292-100708 _na     138_aa UPF0299 membrane protein HMPREF9417_1184
2099 CABPXD010000005.1 GCA902461185_01094 CDS open 100821-101336 _na     171_aa Nuclease-like protein
2100 CABPXD010000005.1 GCA902461185_01095 CDS open 101326-102528 _na     400_aa cysteine desulfurase
2101 CABPXD010000005.1 GCA902461185_01096 CDS open 102522-102896 _na     124_aa Fe-S metabolism associated domain protein
2102 CABPXD010000005.1 GCA902461185_01097 CDS open 102899-103684 _na     261_aa Zn-ribbon-containing protein
2103 CABPXD010000005.1 GCA902461185_01098 CDS open 103709-104548 _na     279_aa queF NADPH-dependent 7-cyano-7-deazaguanine reductase QueF
2104 CABPXD010000005.1 GCA902461185_01099 CDS open 104592-105716 _na     374_aa tyrA bifunctional chorismate mutase/prephenate dehydrogenase
2105 CABPXD010000005.1 GCA902461185_01100 CDS open 105803-106717 _na     304_aa truB tRNA pseudouridine(55) synthase TruB
2106 CABPXD010000005.1 GCA902461185_01101 CDS open 106717-107103 _na     128_aa rbfA 30S ribosome-binding factor RbfA
2107 CABPXD010000005.1 GCA902461185_01102 CDS open 107166-109685 _na     839_aa infB translation initiation factor IF-2
2108 CABPXD010000005.1 GCA902461185_01103 CDS open 109697-111184 _na     495_aa nusA Transcription termination/antitermination protein NusA
2109 CABPXD010000005.1 GCA902461185_01104 CDS open 111200-111655 _na     151_aa rimP ribosome maturation factor RimP
2110 CABPXD010000005.1 GCA902461185_01106 CDS open 111976-112104 _na     42_aa Lipoprotein
2111 CABPXD010000005.1 GCA902461185_01107 CDS open 112101-112823 _na     240_aa Protein kinase family protein
2112 CABPXD010000005.1 GCA902461185_01108 CDS open 112911-113471 _na     186_aa DUF1439 domain-containing protein
2113 CABPXD010000005.1 GCA902461185_01109 CDS open 113499-114854 _na     451_aa qseC quorum sensing histidine kinase QseC
2114 CABPXD010000005.1 GCA902461185_01110 CDS open 114844-115572 _na     242_aa Response regulator receiver domain protein
2115 CABPXD010000005.1 GCA902461185_01111 CDS open 115588-115956 _na     122_aa Putative outer membrane protein
2116 CABPXD010000005.1 GCA902461185_01112 CDS open 116102-116788 _na     228_aa Lipoprotein
2117 CABPXD010000005.1 GCA902461185_01113 CDS open 116895-117143 _na     82_aa yfaE class I ribonucleotide reductase maintenance protein YfaE
2118 CABPXD010000005.1 GCA902461185_01114 CDS open 117224-117688 _na     154_aa hypothetical protein
2119 CABPXD010000005.1 GCA902461185_01115 CDS open 117795-118607 _na     270_aa dapB 4-hydroxy-tetrahydrodipicolinate reductase
2120 CABPXD010000005.1 GCA902461185_01116 CDS open 118624-119250 _na     208_aa Threonine efflux protein
2121 CABPXD010000005.1 GCA902461185_01117 CDS open 119244-119738 _na     164_aa Phosphatidylglycerophosphatase A
2122 CABPXD010000005.1 GCA902461185_01118 CDS open 119738-120718 _na     326_aa thiL thiamine-phosphate kinase
2123 CABPXD010000005.1 GCA902461185_01119 CDS open 120776-121213 _na     145_aa nusB transcription antitermination factor NusB
2124 CABPXD010000005.1 GCA902461185_01120 CDS open 121219-121692 _na     157_aa ribE 6%2C7-dimethyl-8-ribityllumazine synthase
2125 CABPXD010000005.1 GCA902461185_01121 CDS open 121798-124263 _na     821_aa Alpha-1%2C4 glucan phosphorylase
2126 CABPXD010000005.1 GCA902461185_01122 CDS open 124375-125814 _na     479_aa glgA glycogen synthase GlgA
2127 CABPXD010000005.1 GCA902461185_01123 CDS open 125905-127203 _na     432_aa glgC glucose-1-phosphate adenylyltransferase
2128 CABPXD010000005.1 GCA902461185_01124 CDS open 127193-129211 _na     672_aa glgX glycogen debranching protein GlgX
2129 CABPXD010000005.1 GCA902461185_01125 CDS open 129229-131418 _na     729_aa glgB 1%2C4-alpha-glucan branching protein GlgB
2130 CABPXD010000005.1 GCA902461185_01126 CDS open 131430-131849 _na     139_aa 4-alpha-glucanotransferase
2131 CABPXD010000005.1 GCA902461185_01127 CDS open 131988-132428 _na     146_aa ycgN YcgN family cysteine cluster protein
2132 CABPXD010000005.1 GCA902461185_01128 CDS open 132495-134258 _na     587_aa glnS glutamine--tRNA ligase
2133 CABPXD010000005.1 GCA902461185_01129 CDS open 134392-135573 _na     393_aa Efflux transporter%2C RND family%2C MFP subunit
2134 CABPXD010000005.1 GCA902461185_01130 CDS open 135592-137523 _na     643_aa pvdT Pyoverdine export ATP-binding/permease protein PvdT
2135 CABPXD010000005.1 GCA902461185_01131 CDS open 137608-138975 _na     455_aa tdeA toxin/drug exporter TdeA
2136 CABPXD010000005.1 GCA902461185_01132 CDS open 139029-139658 _na     209_aa Phosphoglycerate mutase family protein
2137 CABPXD010000005.1 GCA902461185_01133 CDS open 139733-140845 _na     370_aa apbC iron-sulfur cluster carrier protein ApbC
2138 CABPXD010000005.1 GCA902461185_01134 CDS open 141007-143055 _na     682_aa metG methionine--tRNA ligase
2139 CABPXD010000005.1 GCA902461185_01135 CDS open 143159-144019 _na     286_aa tehB SAM-dependent methyltransferase TehB
2140 CABPXD010000005.1 GCA902461185_01136 CDS open 144092-144919 _na     275_aa dapD 2%2C3%2C4%2C5-tetrahydropyridine-2%2C6-dicarboxylate N-succinyltransferase
2141 CABPXD010000005.1 GCA902461185_01137 CDS open 145065-145529 _na     154_aa Glycine zipper 2TM domain-containing protein
2142 CABPXD010000005.1 GCA902461185_01138 CDS open 145556-145855 _na     99_aa Glucose-6-phosphate isomerase
2143 CABPXD010000005.1 GCA902461185_01139 CDS open 145860-146417 _na     185_aa VOC family protein
2144 CABPXD010000005.1 GCA902461185_01140 CDS open 146518-148251 _na     577_aa argS arginine--tRNA ligase
2145 CABPXD010000005.1 GCA902461185_01141 CDS open 148288-149049 _na     253_aa IS3 family transposase
2146 CABPXD010000005.1 GCA902461185_01142 CDS open 149091-149465 _na     124_aa Transposase
2147 CABPXD010000005.1 GCA902461185_01143 CDS open 149561-152197 _na     878_aa YadA-like family protein
2148 CABPXD010000005.1 GCA902461185_00997 gene open 11-136
2149 CABPXD010000005.1 GCA902461185_00998 gene open 118-408
2150 CABPXD010000005.1 GCA902461185_00999 gene open 433-765
2151 CABPXD010000005.1 GCA902461185_01000 gene open 849-1034
2152 CABPXD010000005.1 GCA902461185_01001 gene open 1224-2372
2153 CABPXD010000005.1 GCA902461185_01002 gene open 2412-2738
2154 CABPXD010000005.1 GCA902461185_01003 gene open 2824-3081
2155 CABPXD010000005.1 GCA902461185_01004 gene open 3116-3346
2156 CABPXD010000005.1 GCA902461185_01005 gene open 3414-4850
2157 CABPXD010000005.1 GCA902461185_01006 gene open 4864-5157
2158 CABPXD010000005.1 GCA902461185_01007 gene open 5168-6214
2159 CABPXD010000005.1 GCA902461185_01008 gene open 6211-7347 gspD
2160 CABPXD010000005.1 GCA902461185_01009 gene open 7431-7838
2161 CABPXD010000005.1 GCA902461185_01010 gene open 8232-8357
2162 CABPXD010000005.1 GCA902461185_01011 gene open 8339-8629
2163 CABPXD010000005.1 GCA902461185_01012 gene open 8654-8986
2164 CABPXD010000005.1 GCA902461185_01013 gene open 9070-9255
2165 CABPXD010000005.1 GCA902461185_01014 gene open 9445-10593
2166 CABPXD010000005.1 GCA902461185_01015 gene open 10633-10959
2167 CABPXD010000005.1 GCA902461185_01016 gene open 11045-11302
2168 CABPXD010000005.1 GCA902461185_01017 gene open 11337-11567
2169 CABPXD010000005.1 GCA902461185_01018 gene open 11635-13071
2170 CABPXD010000005.1 GCA902461185_01019 gene open 13085-13378
2171 CABPXD010000005.1 GCA902461185_01020 gene open 13389-14435
2172 CABPXD010000005.1 GCA902461185_01021 gene open 14432-15568 gspD
2173 CABPXD010000005.1 GCA902461185_01022 gene open 15652-16059
2174 CABPXD010000005.1 GCA902461185_01023 gene open 16894-17379 ftnA
2175 CABPXD010000005.1 GCA902461185_01024 gene open 17400-17900 ftnA
2176 CABPXD010000005.1 GCA902461185_01026 gene open 18240-19169 ttcA
2177 CABPXD010000005.1 GCA902461185_01027 gene open 19171-19500
2178 CABPXD010000005.1 GCA902461185_01028 gene open 19595-21043
2179 CABPXD010000005.1 GCA902461185_01029 gene open 21053-22546
2180 CABPXD010000005.1 GCA902461185_01030 gene open 22651-23136
2181 CABPXD010000005.1 GCA902461185_01031 gene open 23146-23850
2182 CABPXD010000005.1 GCA902461185_01032 gene open 23871-25451
2183 CABPXD010000005.1 GCA902461185_01033 gene open 25444-26652
2184 CABPXD010000005.1 GCA902461185_01034 gene open 26671-27390
2185 CABPXD010000005.1 GCA902461185_01035 gene open 27404-29407
2186 CABPXD010000005.1 GCA902461185_01036 gene open 29407-30396
2187 CABPXD010000005.1 GCA902461185_01037 gene open 30407-33088 hopL1
2188 CABPXD010000005.1 GCA902461185_01038 gene open 33101-36139
2189 CABPXD010000005.1 GCA902461185_01039 gene open 36176-37762
2190 CABPXD010000005.1 GCA902461185_01040 gene open 37971-39062
2191 CABPXD010000005.1 GCA902461185_01041 gene open 39062-39850
2192 CABPXD010000005.1 GCA902461185_01042 gene open 39872-40906
2193 CABPXD010000005.1 GCA902461185_01043 gene open 40987-41196
2194 CABPXD010000005.1 GCA902461185_01044 gene open 41429-43696
2195 CABPXD010000005.1 GCA902461185_01045 gene open 43760-44779
2196 CABPXD010000005.1 GCA902461185_01046 gene open 45009-47393
2197 CABPXD010000005.1 GCA902461185_01047 gene open 47639-49912 metE
2198 CABPXD010000005.1 GCA902461185_01048 gene open 50000-50875 cdd
2199 CABPXD010000005.1 GCA902461185_01049 gene open 50967-51509
2200 CABPXD010000005.1 GCA902461185_01050 gene open 51511-51882
2201 CABPXD010000005.1 GCA902461185_01051 gene open 52022-52834
2202 CABPXD010000005.1 GCA902461185_01052 gene open 52836-54812
2203 CABPXD010000005.1 GCA902461185_01053 gene open 54812-55765
2204 CABPXD010000005.1 GCA902461185_01054 gene open 56057-57655
2205 CABPXD010000005.1 GCA902461185_01055 gene open 58007-58489
2206 CABPXD010000005.1 GCA902461185_01056 gene open 58578-59708
2207 CABPXD010000005.1 GCA902461185_01057 gene open 59815-61071
2208 CABPXD010000005.1 GCA902461185_01058 gene open 61157-61432
2209 CABPXD010000005.1 GCA902461185_01059 gene open 61639-62100 thrE
2210 CABPXD010000005.1 GCA902461185_01060 gene open 62105-62875
2211 CABPXD010000005.1 GCA902461185_01061 gene open 62992-63762
2212 CABPXD010000005.1 GCA902461185_01062 gene open 64024-64671 grxB
2213 CABPXD010000005.1 GCA902461185_01063 gene open 64675-66609 recD
2214 CABPXD010000005.1 GCA902461185_01064 gene open 66609-70250 recB
2215 CABPXD010000005.1 GCA902461185_01065 gene open 70388-71938 hsdM
2216 CABPXD010000005.1 GCA902461185_01066 gene open 71945-73129
2217 CABPXD010000005.1 GCA902461185_01067 gene open 73235-76330
2218 CABPXD010000005.1 GCA902461185_01068 gene open 76410-76766
2219 CABPXD010000005.1 GCA902461185_01069 gene open 76824-78131 nCS2
2220 CABPXD010000005.1 GCA902461185_01070 gene open 78152-79105
2221 CABPXD010000005.1 GCA902461185_01071 gene open 79182-79661 ybaK
2222 CABPXD010000005.1 GCA902461185_01072 gene open 79720-80253 fabA
2223 CABPXD010000005.1 GCA902461185_01073 gene open 80422-82224
2224 CABPXD010000005.1 GCA902461185_01074 gene open 82327-82776 matP
2225 CABPXD010000005.1 GCA902461185_01075 gene open 82857-83066 cspD
2226 CABPXD010000005.1 GCA902461185_01076 gene open 83214-83378 yoaH
2227 CABPXD010000005.1 GCA902461185_01077 gene open 83391-84107 truC
2228 CABPXD010000005.1 GCA902461185_01078 gene open 84108-84428
2229 CABPXD010000005.1 GCA902461185_01079 gene open 84499-84768
2230 CABPXD010000005.1 GCA902461185_01080 gene open 84889-85545
2231 CABPXD010000005.1 GCA902461185_01081 gene open 85643-87796
2232 CABPXD010000005.1 GCA902461185_01082 gene open 87898-88476 rsxA
2233 CABPXD010000005.1 GCA902461185_01083 gene open 88547-89140 rsxB
2234 CABPXD010000005.1 GCA902461185_01084 gene open 89133-91733 rsxC
2235 CABPXD010000005.1 GCA902461185_01085 gene open 91748-92830 rsxD
2236 CABPXD010000005.1 GCA902461185_01086 gene open 92830-93456 rsxG
2237 CABPXD010000005.1 GCA902461185_01087 gene open 93467-94177
2238 CABPXD010000005.1 GCA902461185_01088 gene open 94174-94809 nth
2239 CABPXD010000005.1 GCA902461185_01089 gene open 94836-96206 yocR
2240 CABPXD010000005.1 GCA902461185_01090 gene open 96252-98195 uup
2241 CABPXD010000005.1 GCA902461185_01091 gene open 98241-99593
2242 CABPXD010000005.1 GCA902461185_01092 gene open 99590-100282
2243 CABPXD010000005.1 GCA902461185_01093 gene open 100292-100708
2244 CABPXD010000005.1 GCA902461185_01094 gene open 100821-101336
2245 CABPXD010000005.1 GCA902461185_01095 gene open 101326-102528
2246 CABPXD010000005.1 GCA902461185_01096 gene open 102522-102896
2247 CABPXD010000005.1 GCA902461185_01097 gene open 102899-103684
2248 CABPXD010000005.1 GCA902461185_01098 gene open 103709-104548 queF
2249 CABPXD010000005.1 GCA902461185_01099 gene open 104592-105716 tyrA
2250 CABPXD010000005.1 GCA902461185_01100 gene open 105803-106717 truB
2251 CABPXD010000005.1 GCA902461185_01101 gene open 106717-107103 rbfA
2252 CABPXD010000005.1 GCA902461185_01102 gene open 107166-109685 infB
2253 CABPXD010000005.1 GCA902461185_01103 gene open 109697-111184 nusA
2254 CABPXD010000005.1 GCA902461185_01104 gene open 111200-111655 rimP
2255 CABPXD010000005.1 GCA902461185_01106 gene open 111976-112104
2256 CABPXD010000005.1 GCA902461185_01107 gene open 112101-112823
2257 CABPXD010000005.1 GCA902461185_01108 gene open 112911-113471
2258 CABPXD010000005.1 GCA902461185_01109 gene open 113499-114854 qseC
2259 CABPXD010000005.1 GCA902461185_01110 gene open 114844-115572
2260 CABPXD010000005.1 GCA902461185_01111 gene open 115588-115956
2261 CABPXD010000005.1 GCA902461185_01112 gene open 116102-116788
2262 CABPXD010000005.1 GCA902461185_01113 gene open 116895-117143 yfaE
2263 CABPXD010000005.1 GCA902461185_01114 gene open 117224-117688
2264 CABPXD010000005.1 GCA902461185_01115 gene open 117795-118607 dapB
2265 CABPXD010000005.1 GCA902461185_01116 gene open 118624-119250
2266 CABPXD010000005.1 GCA902461185_01117 gene open 119244-119738
2267 CABPXD010000005.1 GCA902461185_01118 gene open 119738-120718 thiL
2268 CABPXD010000005.1 GCA902461185_01119 gene open 120776-121213 nusB
2269 CABPXD010000005.1 GCA902461185_01120 gene open 121219-121692 ribE
2270 CABPXD010000005.1 GCA902461185_01121 gene open 121798-124263
2271 CABPXD010000005.1 GCA902461185_01122 gene open 124375-125814 glgA
2272 CABPXD010000005.1 GCA902461185_01123 gene open 125905-127203 glgC
2273 CABPXD010000005.1 GCA902461185_01124 gene open 127193-129211 glgX
2274 CABPXD010000005.1 GCA902461185_01125 gene open 129229-131418 glgB
2275 CABPXD010000005.1 GCA902461185_01126 gene open 131430-131849
2276 CABPXD010000005.1 GCA902461185_01127 gene open 131988-132428 ycgN
2277 CABPXD010000005.1 GCA902461185_01128 gene open 132495-134258 glnS
2278 CABPXD010000005.1 GCA902461185_01129 gene open 134392-135573
2279 CABPXD010000005.1 GCA902461185_01130 gene open 135592-137523 pvdT
2280 CABPXD010000005.1 GCA902461185_01131 gene open 137608-138975 tdeA
2281 CABPXD010000005.1 GCA902461185_01132 gene open 139029-139658
2282 CABPXD010000005.1 GCA902461185_01133 gene open 139733-140845 apbC
2283 CABPXD010000005.1 GCA902461185_01134 gene open 141007-143055 metG
2284 CABPXD010000005.1 GCA902461185_01135 gene open 143159-144019 tehB
2285 CABPXD010000005.1 GCA902461185_01136 gene open 144092-144919 dapD
2286 CABPXD010000005.1 GCA902461185_01137 gene open 145065-145529
2287 CABPXD010000005.1 GCA902461185_01138 gene open 145556-145855
2288 CABPXD010000005.1 GCA902461185_01139 gene open 145860-146417
2289 CABPXD010000005.1 GCA902461185_01140 gene open 146518-148251 argS
2290 CABPXD010000005.1 GCA902461185_01141 gene open 148288-149049
2291 CABPXD010000005.1 GCA902461185_01142 gene open 149091-149465
2292 CABPXD010000005.1 GCA902461185_01143 gene open 149561-152197
2293 CABPXD010000005.1 GCA902461185_01025 gene open 18095-18180 trnL
2294 CABPXD010000005.1 GCA902461185_01105 gene open 111785-111861 trnfM
2295 CABPXD010000005.1 GCA902461185_01025 tRNA open 18095-18180 trnL tRNA-Leu(caa)
2296 CABPXD010000005.1 GCA902461185_01105 tRNA open 111785-111861 trnfM tRNA-fMet(cat)
2297 CABPXD010000006.1 GCA902461185_01215 gene open 79057-79254 6S
2298 CABPXD010000006.1 GCA902461185_01215 ncRNA open 79057-79254 6S / SsrS RNA
2299 CABPXD010000006.1 regulatory_region open 120947-121068 Glycine riboswitch aptamer
2300 CABPXD010000006.1 repeat_region open 62205-65181 CRISPR array with 45 repeats of length 32%2C consensus sequence GCAGCCGCCTTCGGGCGGCTGTGTGTTGAAAC and spacer length 34
2301 CABPXD010000006.1 GCA902461185_01144 CDS open 161-1867 _na     568_aa menD 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase
2302 CABPXD010000006.1 GCA902461185_01145 CDS open 1873-3153 _na     426_aa menF Isochorismate synthase MenF
2303 CABPXD010000006.1 GCA902461185_01146 CDS open 3306-4520 _na     404_aa alaA Glutamate-pyruvate aminotransferase AlaA
2304 CABPXD010000006.1 GCA902461185_01147 CDS open 4571-5503 _na     310_aa Phosphatidate cytidylyltransferase
2305 CABPXD010000006.1 GCA902461185_01148 CDS open 5513-6145 _na     210_aa Acyltransferase
2306 CABPXD010000006.1 GCA902461185_01149 CDS open 6157-6762 _na     201_aa CDP-alcohol phosphatidyltransferase
2307 CABPXD010000006.1 GCA902461185_01150 CDS open 6840-7748 _na     302_aa era GTPase Era
2308 CABPXD010000006.1 GCA902461185_01151 CDS open 7745-8482 _na     245_aa rnc ribonuclease III
2309 CABPXD010000006.1 GCA902461185_01152 CDS open 8430-9479 _na     349_aa lepB signal peptidase I
2310 CABPXD010000006.1 GCA902461185_01153 CDS open 9489-11312 _na     607_aa lepA translation elongation factor 4
2311 CABPXD010000006.1 GCA902461185_01154 CDS open 11454-11837 _na     127_aa grcA autonomous glycyl radical cofactor GrcA
2312 CABPXD010000006.1 GCA902461185_01155 CDS open 12102-12761 _na     219_aa ung uracil-DNA glycosylase
2313 CABPXD010000006.1 GCA902461185_01156 CDS open 12758-13276 _na     172_aa tadA tRNA adenosine(34) deaminase TadA
2314 CABPXD010000006.1 GCA902461185_01157 CDS open 13286-14137 _na     283_aa thyA thymidylate synthase
2315 CABPXD010000006.1 GCA902461185_01158 CDS open 14151-14957 _na     268_aa lgt prolipoprotein diacylglyceryl transferase
2316 CABPXD010000006.1 GCA902461185_01159 CDS open 14966-15760 _na     264_aa putative membrane transporter protein
2317 CABPXD010000006.1 GCA902461185_01160 CDS open 15760-16353 _na     197_aa rppH RNA pyrophosphohydrolase
2318 CABPXD010000006.1 GCA902461185_01161 CDS open 16838-17401 _na     187_aa ampD 1%2C6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD
2319 CABPXD010000006.1 GCA902461185_01162 CDS open 17543-17986 _na     147_aa ppdD prepilin peptidase-dependent pilin
2320 CABPXD010000006.1 GCA902461185_01163 CDS open 17993-19372 _na     459_aa Type II/IV secretion system protein
2321 CABPXD010000006.1 GCA902461185_01164 CDS open 19381-20604 _na     407_aa Bacterial type II secretion system domain protein F
2322 CABPXD010000006.1 GCA902461185_01165 CDS open 20601-21278 _na     225_aa Peptidase%2C A24 family
2323 CABPXD010000006.1 GCA902461185_01166 CDS open 21364-21984 _na     206_aa coaE dephospho-CoA kinase
2324 CABPXD010000006.1 GCA902461185_01167 CDS open 21959-22183 _na     74_aa yacG DNA gyrase inhibitor YacG
2325 CABPXD010000006.1 GCA902461185_01168 CDS open 22180-22461 _na     93_aa N-acetyltransferase domain-containing protein
2326 CABPXD010000006.1 GCA902461185_01169 CDS open 22551-23810 _na     419_aa rhlB ATP-dependent RNA helicase RhlB
2327 CABPXD010000006.1 GCA902461185_01170 CDS open 23851-24339 _na     162_aa mreD rod shape-determining protein MreD
2328 CABPXD010000006.1 GCA902461185_01171 CDS open 24339-25403 _na     354_aa mreC rod shape-determining protein MreC
2329 CABPXD010000006.1 GCA902461185_01172 CDS open 25489-26544 _na     351_aa mreB Cell shape-determining protein MreB
2330 CABPXD010000006.1 GCA902461185_01173 CDS open 26716-28539 _na     607_aa Multidrug ABC transporter membrane protein/ATP-binding protein
2331 CABPXD010000006.1 GCA902461185_01174 CDS open 28672-30324 _na     550_aa putative transporter
2332 CABPXD010000006.1 GCA902461185_01175 CDS open 30475-30783 _na     102_aa rsfS ribosome silencing factor
2333 CABPXD010000006.1 GCA902461185_01176 CDS open 30823-31290 _na     155_aa rlmH 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH
2334 CABPXD010000006.1 GCA902461185_01177 CDS open 31306-33282 _na     658_aa mrdA penicillin-binding protein 2
2335 CABPXD010000006.1 GCA902461185_01178 CDS open 33282-34397 _na     371_aa rodA rod shape-determining protein RodA
2336 CABPXD010000006.1 GCA902461185_01179 CDS open 34451-35308 _na     285_aa rlpA Endolytic peptidoglycan transglycosylase RlpA
2337 CABPXD010000006.1 GCA902461185_01180 CDS open 35330-36517 _na     395_aa serine-type D-Ala-D-Ala carboxypeptidase
2338 CABPXD010000006.1 GCA902461185_01181 CDS open 36626-36904 _na     92_aa ybeD DUF493 domain-containing protein
2339 CABPXD010000006.1 GCA902461185_01182 CDS open 36906-37547 _na     213_aa lipB lipoyl(octanoyl) transferase LipB
2340 CABPXD010000006.1 GCA902461185_01183 CDS open 37610-38572 _na     320_aa lipA lipoyl synthase
2341 CABPXD010000006.1 GCA902461185_01184 CDS open 38643-40667 _na     674_aa DUF945 domain-containing protein
2342 CABPXD010000006.1 GCA902461185_01185 CDS open 40766-41410 _na     214_aa adk adenylate kinase
2343 CABPXD010000006.1 GCA902461185_01186 CDS open 41509-42783 _na     424_aa AmpG-related permease
2344 CABPXD010000006.1 GCA902461185_01187 CDS open 42864-43880 _na     338_aa galE UDP-glucose 4-epimerase
2345 CABPXD010000006.1 GCA902461185_01188 CDS open 44086-47319 _na     1077_aa Outer membrane autotransporter barrel domain protein
2346 CABPXD010000006.1 GCA902461185_01189 CDS open 47427-47957 _na     176_aa ppa Inorganic pyrophosphatase
2347 CABPXD010000006.1 GCA902461185_01190 CDS open 48160-49476 _na     438_aa nCS2 Putative permease HI_0125
2348 CABPXD010000006.1 GCA902461185_01191 CDS open 49656-51035 _na     459_aa yegQ tRNA 5-hydroxyuridine modification protein YegQ
2349 CABPXD010000006.1 GCA902461185_01192 CDS open 51338-53629 _na     763_aa CRISPR-associated helicase/endonuclease Cas3
2350 CABPXD010000006.1 GCA902461185_01193 CDS open 53668-55110 _na     480_aa AAA family ATPase
2351 CABPXD010000006.1 GCA902461185_01194 CDS open 55198-55872 _na     224_aa cas5c type I-C CRISPR-associated protein Cas5c
2352 CABPXD010000006.1 GCA902461185_01195 CDS open 55869-57761 _na     630_aa cas8c type I-C CRISPR-associated protein Cas8c/Csd1
2353 CABPXD010000006.1 GCA902461185_01196 CDS open 57773-58756 _na     327_aa cas7c type I-C CRISPR-associated protein Cas7/Csd2
2354 CABPXD010000006.1 GCA902461185_01197 CDS open 58772-59425 _na     217_aa cas4 CRISPR-associated protein Cas4
2355 CABPXD010000006.1 GCA902461185_01198 CDS open 59437-60594 _na     385_aa HNH endonuclease
2356 CABPXD010000006.1 GCA902461185_01199 CDS open 60703-61716 _na     337_aa cas1c type I-C CRISPR-associated endonuclease Cas1c
2357 CABPXD010000006.1 GCA902461185_01200 CDS open 61720-62013 _na     97_aa cas2 CRISPR-associated endonuclease Cas2
2358 CABPXD010000006.1 GCA902461185_01201 CDS open 65280-65630 _na     116_aa phnB Glyoxalase
2359 CABPXD010000006.1 GCA902461185_01202 CDS open 65902-66993 _na     363_aa queA tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA
2360 CABPXD010000006.1 GCA902461185_01203 CDS open 67026-68165 _na     379_aa Aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme
2361 CABPXD010000006.1 GCA902461185_01204 CDS open 68376-69524 _na     382_aa tgt tRNA guanosine(34) transglycosylase Tgt
2362 CABPXD010000006.1 GCA902461185_01205 CDS open 69589-70101 _na     170_aa Hemerythrin HHE cation-binding domain-containing protein
2363 CABPXD010000006.1 GCA902461185_01206 CDS open 70105-70332 _na     75_aa UPF0033 domain-containing protein
2364 CABPXD010000006.1 GCA902461185_01207 CDS open 70435-70725 _na     96_aa yajC preprotein translocase subunit YajC
2365 CABPXD010000006.1 GCA902461185_01208 CDS open 70749-72599 _na     616_aa secD Protein translocase subunit SecD
2366 CABPXD010000006.1 GCA902461185_01209 CDS open 72610-73584 _na     324_aa secF Protein-export membrane protein SecF
2367 CABPXD010000006.1 GCA902461185_01210 CDS open 73667-74707 _na     346_aa tqsA Autoinducer 2 exporter TqsA
2368 CABPXD010000006.1 GCA902461185_01211 CDS open 74707-75045 _na     112_aa glnB nitrogen regulatory protein P-II
2369 CABPXD010000006.1 GCA902461185_01212 CDS open 75047-75640 _na     197_aa mog molybdopterin adenylyltransferase
2370 CABPXD010000006.1 GCA902461185_01213 CDS open 75752-78322 _na     856_aa clpB ATP-dependent chaperone ClpB
2371 CABPXD010000006.1 GCA902461185_01214 CDS open 78458-79126 _na     222_aa 5-formyltetrahydrofolate cyclo-ligase
2372 CABPXD010000006.1 GCA902461185_01216 CDS open 79346-80137 _na     263_aa bamD Outer membrane protein assembly factor BamD
2373 CABPXD010000006.1 GCA902461185_01217 CDS open 80247-81221 _na     324_aa rluD 23S rRNA pseudouridine(1911/1915/1917) synthase RluD
2374 CABPXD010000006.1 GCA902461185_01218 CDS open 81223-81960 _na     245_aa pgeF peptidoglycan editing factor PgeF
2375 CABPXD010000006.1 GCA902461185_01219 CDS open 82009-82428 _na     139_aa ruvX Holliday junction resolvase RuvX
2376 CABPXD010000006.1 GCA902461185_01220 CDS open 82428-82988 _na     186_aa YqgE/AlgH family protein
2377 CABPXD010000006.1 GCA902461185_01221 CDS open 82988-83722 _na     244_aa rsmE 16S rRNA (uracil(1498)-N(3))-methyltransferase
2378 CABPXD010000006.1 GCA902461185_01222 CDS open 83781-84509 _na     242_aa fadR fatty acid metabolism transcriptional regulator FadR
2379 CABPXD010000006.1 GCA902461185_01223 CDS open 84644-86182 _na     512_aa nhaB Na(+)/H(+) antiporter NhaB
2380 CABPXD010000006.1 GCA902461185_01224 CDS open 86202-86735 _na     177_aa dsbB disulfide bond formation protein DsbB
2381 CABPXD010000006.1 GCA902461185_01225 CDS open 86810-87085 _na     91_aa DUF1294 domain-containing protein
2382 CABPXD010000006.1 GCA902461185_01226 CDS open 87189-88895 _na     568_aa Sel1 repeat protein
2383 CABPXD010000006.1 GCA902461185_01227 CDS open 89251-90516 _na     421_aa glyA Serine hydroxymethyltransferase
2384 CABPXD010000006.1 GCA902461185_01228 CDS open 90632-91201 _na     189_aa Lipoprotein
2385 CABPXD010000006.1 GCA902461185_01229 CDS open 91265-92488 _na     407_aa DUF711 domain-containing protein
2386 CABPXD010000006.1 GCA902461185_01230 CDS open 92513-93802 _na     429_aa purD Phosphoribosylamine--glycine ligase
2387 CABPXD010000006.1 GCA902461185_01231 CDS open 93908-95506 _na     532_aa purH bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase
2388 CABPXD010000006.1 GCA902461185_01232 CDS open 95691-96089 _na     132_aa Membrane protein
2389 CABPXD010000006.1 GCA902461185_01233 CDS open 96206-97972 _na     588_aa dsbD Thiol:disulfide interchange protein DsbD
2390 CABPXD010000006.1 GCA902461185_01234 CDS open 98152-98865 _na     237_aa arcA two-component system response regulator ArcA
2391 CABPXD010000006.1 GCA902461185_01235 CDS open 98978-99460 _na     160_aa smpB SsrA-binding protein SmpB
2392 CABPXD010000006.1 GCA902461185_01236 CDS open 99621-99887 _na     88_aa type B 50S ribosomal protein L31
2393 CABPXD010000006.1 GCA902461185_01237 CDS open 99897-100034 _na     45_aa ykgO type B 50S ribosomal protein L36
2394 CABPXD010000006.1 GCA902461185_01238 CDS open 100085-101257 _na     390_aa cgtA Obg family GTPase CgtA
2395 CABPXD010000006.1 GCA902461185_01239 CDS open 101285-102202 _na     305_aa eamA EamA domain-containing protein
2396 CABPXD010000006.1 GCA902461185_01240 CDS open 102385-102642 _na     85_aa rpmA 50S ribosomal protein L27
2397 CABPXD010000006.1 GCA902461185_01241 CDS open 102663-102974 _na     103_aa rplU 50S ribosomal protein L21
2398 CABPXD010000006.1 GCA902461185_01242 CDS open 103198-104193 _na     331_aa ispB octaprenyl diphosphate synthase
2399 CABPXD010000006.1 GCA902461185_01243 CDS open 104195-104935 _na     246_aa queH Epoxyqueuosine reductase QueH
2400 CABPXD010000006.1 GCA902461185_01244 CDS open 104984-105289 _na     101_aa zapA Cell division protein ZapA
2401 CABPXD010000006.1 GCA902461185_01245 CDS open 105450-108248 _na     932_aa polA DNA polymerase I
2402 CABPXD010000006.1 GCA902461185_01246 CDS open 108260-108574 _na     104_aa Cupin domain protein
2403 CABPXD010000006.1 GCA902461185_01247 CDS open 108593-109897 _na     434_aa UPF0597 protein HMPREF9417_0660
2404 CABPXD010000006.1 GCA902461185_01248 CDS open 110064-111107 _na     347_aa Putative inner membrane protein
2405 CABPXD010000006.1 GCA902461185_01249 CDS open 111117-111338 _na     73_aa tusA UPF0033 domain-containing protein
2406 CABPXD010000006.1 GCA902461185_01250 CDS open 111406-111873 _na     155_aa nanQ N-acetylneuraminate anomerase
2407 CABPXD010000006.1 GCA902461185_01251 CDS open 111924-112091 _na     55_aa hypothetical protein
2408 CABPXD010000006.1 GCA902461185_01252 CDS open 112115-114253 _na     712_aa pnp polyribonucleotide nucleotidyltransferase
2409 CABPXD010000006.1 GCA902461185_01253 CDS open 114318-115259 _na     313_aa nlpI lipoprotein NlpI
2410 CABPXD010000006.1 GCA902461185_01254 CDS open 115335-117185 _na     616_aa deaD ATP-dependent RNA helicase DeaD
2411 CABPXD010000006.1 GCA902461185_01255 CDS open 117281-118675 _na     464_aa mltF membrane-bound lytic murein transglycosylase MltF
2412 CABPXD010000006.1 GCA902461185_01256 CDS open 118731-118874 _na     47_aa hypothetical protein
2413 CABPXD010000006.1 GCA902461185_01257 CDS open 118924-119247 _na     107_aa hpf ribosome hibernation-promoting factor%2C HPF/YfiA family
2414 CABPXD010000006.1 GCA902461185_01258 CDS open 119489-120859 _na     456_aa Sodium:alanine symporter
2415 CABPXD010000006.1 GCA902461185_01259 CDS open 121377-123374 _na     665_aa tkt transketolase
2416 CABPXD010000006.1 GCA902461185_01260 CDS open 123460-124137 _na     225_aa ahpA Hemolysin regulation protein AhpA
2417 CABPXD010000006.1 GCA902461185_01261 CDS open 124206-125150 _na     314_aa serB phosphoserine phosphatase
2418 CABPXD010000006.1 GCA902461185_01262 CDS open 125171-125662 _na     163_aa yajQ YajQ family cyclic di-GMP-binding protein
2419 CABPXD010000006.1 GCA902461185_01263 CDS open 125667-126143 _na     158_aa hypothetical protein
2420 CABPXD010000006.1 GCA902461185_01264 CDS open 126226-129099 _na     957_aa ATP-dependent helicase
2421 CABPXD010000006.1 GCA902461185_01265 CDS open 129096-132395 _na     1099_aa Type III restriction endonuclease subunit R
2422 CABPXD010000006.1 GCA902461185_01266 CDS open 132538-135150 _na     870_aa site-specific DNA-methyltransferase (adenine-specific)
2423 CABPXD010000006.1 GCA902461185_01267 CDS open 135202-135453 _na     83_aa hypothetical protein
2424 CABPXD010000006.1 GCA902461185_01268 CDS open 135698-137071 _na     457_aa argH argininosuccinate lyase
2425 CABPXD010000006.1 GCA902461185_01269 CDS open 137213-138565 _na     450_aa rho transcription termination factor Rho
2426 CABPXD010000006.1 GCA902461185_01144 gene open 161-1867 menD
2427 CABPXD010000006.1 GCA902461185_01145 gene open 1873-3153 menF
2428 CABPXD010000006.1 GCA902461185_01146 gene open 3306-4520 alaA
2429 CABPXD010000006.1 GCA902461185_01147 gene open 4571-5503
2430 CABPXD010000006.1 GCA902461185_01148 gene open 5513-6145
2431 CABPXD010000006.1 GCA902461185_01149 gene open 6157-6762
2432 CABPXD010000006.1 GCA902461185_01150 gene open 6840-7748 era
2433 CABPXD010000006.1 GCA902461185_01151 gene open 7745-8482 rnc
2434 CABPXD010000006.1 GCA902461185_01152 gene open 8430-9479 lepB
2435 CABPXD010000006.1 GCA902461185_01153 gene open 9489-11312 lepA
2436 CABPXD010000006.1 GCA902461185_01154 gene open 11454-11837 grcA
2437 CABPXD010000006.1 GCA902461185_01155 gene open 12102-12761 ung
2438 CABPXD010000006.1 GCA902461185_01156 gene open 12758-13276 tadA
2439 CABPXD010000006.1 GCA902461185_01157 gene open 13286-14137 thyA
2440 CABPXD010000006.1 GCA902461185_01158 gene open 14151-14957 lgt
2441 CABPXD010000006.1 GCA902461185_01159 gene open 14966-15760
2442 CABPXD010000006.1 GCA902461185_01160 gene open 15760-16353 rppH
2443 CABPXD010000006.1 GCA902461185_01161 gene open 16838-17401 ampD
2444 CABPXD010000006.1 GCA902461185_01162 gene open 17543-17986 ppdD
2445 CABPXD010000006.1 GCA902461185_01163 gene open 17993-19372
2446 CABPXD010000006.1 GCA902461185_01164 gene open 19381-20604
2447 CABPXD010000006.1 GCA902461185_01165 gene open 20601-21278
2448 CABPXD010000006.1 GCA902461185_01166 gene open 21364-21984 coaE
2449 CABPXD010000006.1 GCA902461185_01167 gene open 21959-22183 yacG
2450 CABPXD010000006.1 GCA902461185_01168 gene open 22180-22461
2451 CABPXD010000006.1 GCA902461185_01169 gene open 22551-23810 rhlB
2452 CABPXD010000006.1 GCA902461185_01170 gene open 23851-24339 mreD
2453 CABPXD010000006.1 GCA902461185_01171 gene open 24339-25403 mreC
2454 CABPXD010000006.1 GCA902461185_01172 gene open 25489-26544 mreB
2455 CABPXD010000006.1 GCA902461185_01173 gene open 26716-28539
2456 CABPXD010000006.1 GCA902461185_01174 gene open 28672-30324
2457 CABPXD010000006.1 GCA902461185_01175 gene open 30475-30783 rsfS
2458 CABPXD010000006.1 GCA902461185_01176 gene open 30823-31290 rlmH
2459 CABPXD010000006.1 GCA902461185_01177 gene open 31306-33282 mrdA
2460 CABPXD010000006.1 GCA902461185_01178 gene open 33282-34397 rodA
2461 CABPXD010000006.1 GCA902461185_01179 gene open 34451-35308 rlpA
2462 CABPXD010000006.1 GCA902461185_01180 gene open 35330-36517
2463 CABPXD010000006.1 GCA902461185_01181 gene open 36626-36904 ybeD
2464 CABPXD010000006.1 GCA902461185_01182 gene open 36906-37547 lipB
2465 CABPXD010000006.1 GCA902461185_01183 gene open 37610-38572 lipA
2466 CABPXD010000006.1 GCA902461185_01184 gene open 38643-40667
2467 CABPXD010000006.1 GCA902461185_01185 gene open 40766-41410 adk
2468 CABPXD010000006.1 GCA902461185_01186 gene open 41509-42783
2469 CABPXD010000006.1 GCA902461185_01187 gene open 42864-43880 galE
2470 CABPXD010000006.1 GCA902461185_01188 gene open 44086-47319
2471 CABPXD010000006.1 GCA902461185_01189 gene open 47427-47957 ppa
2472 CABPXD010000006.1 GCA902461185_01190 gene open 48160-49476 nCS2
2473 CABPXD010000006.1 GCA902461185_01191 gene open 49656-51035 yegQ
2474 CABPXD010000006.1 GCA902461185_01192 gene open 51338-53629
2475 CABPXD010000006.1 GCA902461185_01193 gene open 53668-55110
2476 CABPXD010000006.1 GCA902461185_01194 gene open 55198-55872 cas5c
2477 CABPXD010000006.1 GCA902461185_01195 gene open 55869-57761 cas8c
2478 CABPXD010000006.1 GCA902461185_01196 gene open 57773-58756 cas7c
2479 CABPXD010000006.1 GCA902461185_01197 gene open 58772-59425 cas4
2480 CABPXD010000006.1 GCA902461185_01198 gene open 59437-60594
2481 CABPXD010000006.1 GCA902461185_01199 gene open 60703-61716 cas1c
2482 CABPXD010000006.1 GCA902461185_01200 gene open 61720-62013 cas2
2483 CABPXD010000006.1 GCA902461185_01201 gene open 65280-65630 phnB
2484 CABPXD010000006.1 GCA902461185_01202 gene open 65902-66993 queA
2485 CABPXD010000006.1 GCA902461185_01203 gene open 67026-68165
2486 CABPXD010000006.1 GCA902461185_01204 gene open 68376-69524 tgt
2487 CABPXD010000006.1 GCA902461185_01205 gene open 69589-70101
2488 CABPXD010000006.1 GCA902461185_01206 gene open 70105-70332
2489 CABPXD010000006.1 GCA902461185_01207 gene open 70435-70725 yajC
2490 CABPXD010000006.1 GCA902461185_01208 gene open 70749-72599 secD
2491 CABPXD010000006.1 GCA902461185_01209 gene open 72610-73584 secF
2492 CABPXD010000006.1 GCA902461185_01210 gene open 73667-74707 tqsA
2493 CABPXD010000006.1 GCA902461185_01211 gene open 74707-75045 glnB
2494 CABPXD010000006.1 GCA902461185_01212 gene open 75047-75640 mog
2495 CABPXD010000006.1 GCA902461185_01213 gene open 75752-78322 clpB
2496 CABPXD010000006.1 GCA902461185_01214 gene open 78458-79126
2497 CABPXD010000006.1 GCA902461185_01216 gene open 79346-80137 bamD
2498 CABPXD010000006.1 GCA902461185_01217 gene open 80247-81221 rluD
2499 CABPXD010000006.1 GCA902461185_01218 gene open 81223-81960 pgeF
2500 CABPXD010000006.1 GCA902461185_01219 gene open 82009-82428 ruvX