BAKTAGenome Explorer: Cutibacterium granulosum (GCA_902482805.1)
Select a Genome:
|
BAKTA Annotations for GCA_902482805.1
|
Search & Sort all 3567 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 1001 | CABTAS010000002.1 | GCA902482805_00387 | gene | open | 13507-14205 | |||
| 1002 | CABTAS010000002.1 | GCA902482805_00388 | gene | open | 14293-15264 | nadA | ||
| 1003 | CABTAS010000002.1 | GCA902482805_00389 | gene | open | 15269-16975 | nadB | ||
| 1004 | CABTAS010000002.1 | GCA902482805_00390 | gene | open | 16972-17943 | nadC | ||
| 1005 | CABTAS010000002.1 | GCA902482805_00391 | gene | open | 18009-19400 | |||
| 1006 | CABTAS010000002.1 | GCA902482805_00392 | gene | open | 19492-19797 | |||
| 1007 | CABTAS010000002.1 | GCA902482805_00393 | gene | open | 19908-20324 | |||
| 1008 | CABTAS010000002.1 | GCA902482805_00394 | gene | open | 20646-21215 | |||
| 1009 | CABTAS010000002.1 | GCA902482805_00395 | gene | open | 21206-22150 | |||
| 1010 | CABTAS010000002.1 | GCA902482805_00396 | gene | open | 22183-23067 | |||
| 1011 | CABTAS010000002.1 | GCA902482805_00397 | gene | open | 23079-23636 | frr | ||
| 1012 | CABTAS010000002.1 | GCA902482805_00398 | gene | open | 23677-24387 | pyrH | ||
| 1013 | CABTAS010000002.1 | GCA902482805_00399 | gene | open | 24557-25369 | tsf | ||
| 1014 | CABTAS010000002.1 | GCA902482805_00400 | gene | open | 25400-26326 | rpsB | ||
| 1015 | CABTAS010000002.1 | GCA902482805_00401 | gene | open | 26957-27886 | |||
| 1016 | CABTAS010000002.1 | GCA902482805_00402 | gene | open | 28029-28964 | xerC | ||
| 1017 | CABTAS010000002.1 | GCA902482805_00403 | gene | open | 29032-30081 | |||
| 1018 | CABTAS010000002.1 | GCA902482805_00404 | gene | open | 30599-31201 | def | ||
| 1019 | CABTAS010000002.1 | GCA902482805_00405 | gene | open | 31303-32118 | trmH | ||
| 1020 | CABTAS010000002.1 | GCA902482805_00406 | gene | open | 32211-33200 | |||
| 1021 | CABTAS010000002.1 | GCA902482805_00407 | gene | open | 33470-34795 | hflK | ||
| 1022 | CABTAS010000002.1 | GCA902482805_00408 | gene | open | 34915-35379 | |||
| 1023 | CABTAS010000002.1 | GCA902482805_00409 | gene | open | 35383-36168 | |||
| 1024 | CABTAS010000002.1 | GCA902482805_00410 | gene | open | 36206-37033 | |||
| 1025 | CABTAS010000002.1 | GCA902482805_00411 | gene | open | 37138-37911 | fabI | ||
| 1026 | CABTAS010000002.1 | GCA902482805_00412 | gene | open | 38032-38757 | |||
| 1027 | CABTAS010000002.1 | GCA902482805_00413 | gene | open | 39030-39917 | |||
| 1028 | CABTAS010000002.1 | GCA902482805_00414 | gene | open | 39955-40617 | |||
| 1029 | CABTAS010000002.1 | GCA902482805_00415 | gene | open | 40708-42312 | abc-f | ||
| 1030 | CABTAS010000002.1 | GCA902482805_00416 | gene | open | 42498-42854 | |||
| 1031 | CABTAS010000002.1 | GCA902482805_00417 | gene | open | 42859-43305 | |||
| 1032 | CABTAS010000002.1 | GCA902482805_00418 | gene | open | 43307-43801 | sufU | ||
| 1033 | CABTAS010000002.1 | GCA902482805_00419 | gene | open | 43798-45081 | |||
| 1034 | CABTAS010000002.1 | GCA902482805_00420 | gene | open | 45081-45848 | sufC | ||
| 1035 | CABTAS010000002.1 | GCA902482805_00421 | gene | open | 45853-46179 | |||
| 1036 | CABTAS010000002.1 | GCA902482805_00422 | gene | open | 46176-47279 | sufD | ||
| 1037 | CABTAS010000002.1 | GCA902482805_00423 | gene | open | 47439-48896 | sufB | ||
| 1038 | CABTAS010000002.1 | GCA902482805_00424 | gene | open | 49028-49840 | arsR | ||
| 1039 | CABTAS010000002.1 | GCA902482805_00425 | gene | open | 50197-52752 | |||
| 1040 | CABTAS010000002.1 | GCA902482805_00426 | gene | open | 52960-53694 | |||
| 1041 | CABTAS010000002.1 | GCA902482805_00427 | gene | open | 53821-54423 | mauE | ||
| 1042 | CABTAS010000002.1 | GCA902482805_00428 | gene | open | 54512-55303 | |||
| 1043 | CABTAS010000002.1 | GCA902482805_00429 | gene | open | 55373-58102 | valS | ||
| 1044 | CABTAS010000002.1 | GCA902482805_00430 | gene | open | 58622-61915 | |||
| 1045 | CABTAS010000002.1 | GCA902482805_00431 | gene | open | 62017-62409 | |||
| 1046 | CABTAS010000002.1 | GCA902482805_00432 | gene | open | 62559-63857 | clpX | ||
| 1047 | CABTAS010000002.1 | GCA902482805_00433 | gene | open | 64049-64741 | |||
| 1048 | CABTAS010000002.1 | GCA902482805_00434 | gene | open | 64750-65355 | |||
| 1049 | CABTAS010000002.1 | GCA902482805_00435 | gene | open | 65626-66951 | |||
| 1050 | CABTAS010000002.1 | GCA902482805_00436 | gene | open | 67199-68746 | tig | ||
| 1051 | CABTAS010000002.1 | GCA902482805_00438 | gene | open | 69114-69857 | recO | ||
| 1052 | CABTAS010000002.1 | GCA902482805_00439 | gene | open | 70134-71114 | |||
| 1053 | CABTAS010000002.1 | GCA902482805_00440 | gene | open | 71288-72106 | |||
| 1054 | CABTAS010000002.1 | GCA902482805_00441 | gene | open | 72241-73263 | era | ||
| 1055 | CABTAS010000002.1 | GCA902482805_00442 | gene | open | 73253-74554 | |||
| 1056 | CABTAS010000002.1 | GCA902482805_00443 | gene | open | 74551-75015 | ybeY | ||
| 1057 | CABTAS010000002.1 | GCA902482805_00444 | gene | open | 75012-76142 | |||
| 1058 | CABTAS010000002.1 | GCA902482805_00445 | gene | open | 76342-77481 | |||
| 1059 | CABTAS010000002.1 | GCA902482805_00446 | gene | open | 77527-78534 | pip | ||
| 1060 | CABTAS010000002.1 | GCA902482805_00447 | gene | open | 78672-79469 | |||
| 1061 | CABTAS010000002.1 | GCA902482805_00448 | gene | open | 79476-80756 | tgt | ||
| 1062 | CABTAS010000002.1 | GCA902482805_00449 | gene | open | 80806-81753 | rhtA | ||
| 1063 | CABTAS010000002.1 | GCA902482805_00450 | gene | open | 82056-83252 | |||
| 1064 | CABTAS010000002.1 | GCA902482805_00451 | gene | open | 83323-83736 | doxX | ||
| 1065 | CABTAS010000002.1 | GCA902482805_00452 | gene | open | 84014-84763 | |||
| 1066 | CABTAS010000002.1 | GCA902482805_00453 | gene | open | 84760-85983 | dnaJ | ||
| 1067 | CABTAS010000002.1 | GCA902482805_00454 | gene | open | 85940-86956 | hrcA | ||
| 1068 | CABTAS010000002.1 | GCA902482805_00455 | gene | open | 87209-88039 | |||
| 1069 | CABTAS010000002.1 | GCA902482805_00456 | gene | open | 88153-89016 | |||
| 1070 | CABTAS010000002.1 | GCA902482805_00457 | gene | open | 89013-89870 | |||
| 1071 | CABTAS010000002.1 | GCA902482805_00458 | gene | open | 89940-91421 | hemW | ||
| 1072 | CABTAS010000002.1 | GCA902482805_00459 | gene | open | 91574-92857 | |||
| 1073 | CABTAS010000002.1 | GCA902482805_00460 | gene | open | 92854-93819 | ycjO | ||
| 1074 | CABTAS010000002.1 | GCA902482805_00461 | gene | open | 93816-94655 | |||
| 1075 | CABTAS010000002.1 | GCA902482805_00462 | gene | open | 94805-95437 | |||
| 1076 | CABTAS010000002.1 | GCA902482805_00463 | gene | open | 95583-96509 | |||
| 1077 | CABTAS010000002.1 | GCA902482805_00464 | gene | open | 96548-97774 | |||
| 1078 | CABTAS010000002.1 | GCA902482805_00465 | gene | open | 97783-99087 | |||
| 1079 | CABTAS010000002.1 | GCA902482805_00466 | gene | open | 99397-100443 | |||
| 1080 | CABTAS010000002.1 | GCA902482805_00467 | gene | open | 101146-102285 | ytpA | ||
| 1081 | CABTAS010000002.1 | GCA902482805_00468 | gene | open | 102398-103372 | |||
| 1082 | CABTAS010000002.1 | GCA902482805_00469 | gene | open | 103835-104980 | |||
| 1083 | CABTAS010000002.1 | GCA902482805_00470 | gene | open | 105149-106735 | menD | ||
| 1084 | CABTAS010000002.1 | GCA902482805_00471 | gene | open | 106907-108001 | |||
| 1085 | CABTAS010000002.1 | GCA902482805_00472 | gene | open | 107998-109932 | lepA | ||
| 1086 | CABTAS010000002.1 | GCA902482805_00473 | gene | open | 110125-110388 | rpsT | ||
| 1087 | CABTAS010000002.1 | GCA902482805_00474 | gene | open | 110613-111581 | holA | ||
| 1088 | CABTAS010000002.1 | GCA902482805_00475 | gene | open | 111610-113379 | |||
| 1089 | CABTAS010000002.1 | GCA902482805_00476 | gene | open | 113604-115910 | |||
| 1090 | CABTAS010000002.1 | GCA902482805_00477 | gene | open | 115897-116775 | |||
| 1091 | CABTAS010000002.1 | GCA902482805_00478 | gene | open | 116924-119407 | leuS | ||
| 1092 | CABTAS010000002.1 | GCA902482805_00479 | gene | open | 119608-120654 | |||
| 1093 | CABTAS010000002.1 | GCA902482805_00480 | gene | open | 120863-121465 | |||
| 1094 | CABTAS010000002.1 | GCA902482805_00481 | gene | open | 121549-123255 | |||
| 1095 | CABTAS010000002.1 | GCA902482805_00482 | gene | open | 123444-124400 | |||
| 1096 | CABTAS010000002.1 | GCA902482805_00483 | gene | open | 124670-125326 | |||
| 1097 | CABTAS010000002.1 | GCA902482805_00484 | gene | open | 125313-126122 | thiM | ||
| 1098 | CABTAS010000002.1 | GCA902482805_00485 | gene | open | 126443-126592 | |||
| 1099 | CABTAS010000002.1 | GCA902482805_00486 | gene | open | 126618-127337 | |||
| 1100 | CABTAS010000002.1 | GCA902482805_00487 | gene | open | 127334-127510 | |||
| 1101 | CABTAS010000002.1 | GCA902482805_00488 | gene | open | 127502-128293 | |||
| 1102 | CABTAS010000002.1 | GCA902482805_00489 | gene | open | 128518-129135 | |||
| 1103 | CABTAS010000002.1 | GCA902482805_00491 | gene | open | 129448-130086 | |||
| 1104 | CABTAS010000002.1 | GCA902482805_00492 | gene | open | 130083-130604 | rsfS | ||
| 1105 | CABTAS010000002.1 | GCA902482805_00493 | gene | open | 130620-131333 | nadD | ||
| 1106 | CABTAS010000002.1 | GCA902482805_00494 | gene | open | 131391-132710 | |||
| 1107 | CABTAS010000002.1 | GCA902482805_00495 | gene | open | 132864-133997 | |||
| 1108 | CABTAS010000002.1 | GCA902482805_00496 | gene | open | 133994-135514 | obgE | ||
| 1109 | CABTAS010000002.1 | GCA902482805_00497 | gene | open | 135700-135957 | rpmA | ||
| 1110 | CABTAS010000002.1 | GCA902482805_00498 | gene | open | 135970-136278 | rplU | ||
| 1111 | CABTAS010000002.1 | GCA902482805_00499 | gene | open | 136882-137883 | |||
| 1112 | CABTAS010000002.1 | GCA902482805_00500 | gene | open | 137891-138850 | |||
| 1113 | CABTAS010000002.1 | GCA902482805_00501 | gene | open | 138847-139680 | |||
| 1114 | CABTAS010000002.1 | GCA902482805_00502 | gene | open | 139677-140747 | |||
| 1115 | CABTAS010000002.1 | GCA902482805_00503 | gene | open | 140910-141257 | erpA | ||
| 1116 | CABTAS010000002.1 | GCA902482805_00504 | gene | open | 141566-142660 | |||
| 1117 | CABTAS010000002.1 | GCA902482805_00505 | gene | open | 142664-142954 | |||
| 1118 | CABTAS010000002.1 | GCA902482805_00506 | gene | open | 142954-143745 | |||
| 1119 | CABTAS010000002.1 | GCA902482805_00507 | gene | open | 144138-144851 | |||
| 1120 | CABTAS010000002.1 | GCA902482805_00508 | gene | open | 145011-145229 | |||
| 1121 | CABTAS010000002.1 | GCA902482805_00509 | gene | open | 145547-147067 | |||
| 1122 | CABTAS010000002.1 | GCA902482805_00510 | gene | open | 147144-148520 | sucB | ||
| 1123 | CABTAS010000002.1 | GCA902482805_00511 | gene | open | 148562-149428 | ssuB | ||
| 1124 | CABTAS010000002.1 | GCA902482805_00512 | gene | open | 149422-150546 | cmpB | ||
| 1125 | CABTAS010000002.1 | GCA902482805_00513 | gene | open | 150543-151721 | |||
| 1126 | CABTAS010000002.1 | GCA902482805_00514 | gene | open | 151934-152641 | gntR | ||
| 1127 | CABTAS010000002.1 | GCA902482805_00515 | gene | open | 152794-153330 | |||
| 1128 | CABTAS010000002.1 | GCA902482805_00516 | gene | open | 153421-154803 | |||
| 1129 | CABTAS010000002.1 | GCA902482805_00517 | gene | open | 154926-155798 | gnd | ||
| 1130 | CABTAS010000002.1 | GCA902482805_00518 | gene | open | 156194-156943 | lipB | ||
| 1131 | CABTAS010000002.1 | GCA902482805_00519 | gene | open | 157017-158057 | lipA | ||
| 1132 | CABTAS010000002.1 | GCA902482805_00520 | gene | open | 158181-158810 | |||
| 1133 | CABTAS010000002.1 | GCA902482805_00521 | gene | open | 158814-159392 | |||
| 1134 | CABTAS010000002.1 | GCA902482805_00522 | gene | open | 159464-160738 | |||
| 1135 | CABTAS010000002.1 | GCA902482805_00523 | gene | open | 161230-161997 | |||
| 1136 | CABTAS010000002.1 | GCA902482805_00524 | gene | open | 161987-163840 | ccmA | ||
| 1137 | CABTAS010000002.1 | GCA902482805_00525 | gene | open | 163870-164091 | |||
| 1138 | CABTAS010000002.1 | GCA902482805_00526 | gene | open | 164158-164802 | |||
| 1139 | CABTAS010000002.1 | GCA902482805_00527 | gene | open | 164951-166132 | |||
| 1140 | CABTAS010000002.1 | GCA902482805_00528 | gene | open | 166270-167691 | glnA | ||
| 1141 | CABTAS010000002.1 | GCA902482805_00529 | gene | open | 167704-168543 | |||
| 1142 | CABTAS010000002.1 | GCA902482805_00530 | gene | open | 168674-169903 | yjjP | ||
| 1143 | CABTAS010000002.1 | GCA902482805_00531 | gene | open | 170063-172933 | |||
| 1144 | CABTAS010000002.1 | GCA902482805_00532 | gene | open | 173169-173945 | |||
| 1145 | CABTAS010000002.1 | GCA902482805_00533 | gene | open | 173927-175261 | glnA | ||
| 1146 | CABTAS010000002.1 | GCA902482805_00534 | gene | open | 175554-176945 | |||
| 1147 | CABTAS010000002.1 | GCA902482805_00535 | gene | open | 176942-177694 | |||
| 1148 | CABTAS010000002.1 | GCA902482805_00536 | gene | open | 177700-178545 | map | ||
| 1149 | CABTAS010000002.1 | GCA902482805_00537 | gene | open | 178529-180445 | nikD | ||
| 1150 | CABTAS010000002.1 | GCA902482805_00538 | gene | open | 180442-182112 | |||
| 1151 | CABTAS010000002.1 | GCA902482805_00539 | gene | open | 182200-183186 | |||
| 1152 | CABTAS010000002.1 | GCA902482805_00540 | gene | open | 183183-184202 | |||
| 1153 | CABTAS010000002.1 | GCA902482805_00541 | gene | open | 184855-185994 | |||
| 1154 | CABTAS010000002.1 | GCA902482805_00543 | gene | open | 186675-187400 | |||
| 1155 | CABTAS010000002.1 | GCA902482805_00544 | gene | open | 187537-189057 | |||
| 1156 | CABTAS010000002.1 | GCA902482805_00545 | gene | open | 189062-189562 | |||
| 1157 | CABTAS010000002.1 | GCA902482805_00546 | gene | open | 189706-190875 | |||
| 1158 | CABTAS010000002.1 | GCA902482805_00547 | gene | open | 191148-191561 | |||
| 1159 | CABTAS010000002.1 | GCA902482805_00548 | gene | open | 191598-192479 | dapA | ||
| 1160 | CABTAS010000002.1 | GCA902482805_00549 | gene | open | 192511-193239 | |||
| 1161 | CABTAS010000002.1 | GCA902482805_00550 | gene | open | 193429-194655 | glgC | ||
| 1162 | CABTAS010000002.1 | GCA902482805_00551 | gene | open | 194785-195981 | |||
| 1163 | CABTAS010000002.1 | GCA902482805_00552 | gene | open | 196209-196376 | |||
| 1164 | CABTAS010000002.1 | GCA902482805_00553 | gene | open | 196419-196709 | |||
| 1165 | CABTAS010000002.1 | GCA902482805_00554 | gene | open | 196762-197898 | dapE | ||
| 1166 | CABTAS010000002.1 | GCA902482805_00555 | gene | open | 197957-198904 | dapD | ||
| 1167 | CABTAS010000002.1 | GCA902482805_00556 | gene | open | 198911-199810 | |||
| 1168 | CABTAS010000002.1 | GCA902482805_00557 | gene | open | 199938-201071 | dapC | ||
| 1169 | CABTAS010000002.1 | GCA902482805_00558 | gene | open | 201084-201404 | fdxA | ||
| 1170 | CABTAS010000002.1 | GCA902482805_00559 | gene | open | 201552-203285 | vanW | ||
| 1171 | CABTAS010000002.1 | GCA902482805_00560 | gene | open | 203460-204869 | |||
| 1172 | CABTAS010000002.1 | GCA902482805_00561 | gene | open | 204874-206421 | |||
| 1173 | CABTAS010000002.1 | GCA902482805_00562 | gene | open | 206776-208929 | tkt | ||
| 1174 | CABTAS010000002.1 | GCA902482805_00563 | gene | open | 209071-209577 | |||
| 1175 | CABTAS010000002.1 | GCA902482805_00564 | gene | open | 209974-211485 | |||
| 1176 | CABTAS010000002.1 | GCA902482805_00565 | gene | open | 211498-212079 | |||
| 1177 | CABTAS010000002.1 | GCA902482805_00566 | gene | open | 212204-213196 | |||
| 1178 | CABTAS010000002.1 | GCA902482805_00567 | gene | open | 213350-214156 | |||
| 1179 | CABTAS010000002.1 | GCA902482805_00568 | gene | open | 214159-215016 | |||
| 1180 | CABTAS010000002.1 | GCA902482805_00569 | gene | open | 214947-215288 | |||
| 1181 | CABTAS010000002.1 | GCA902482805_00570 | gene | open | 215678-217624 | |||
| 1182 | CABTAS010000002.1 | GCA902482805_00571 | gene | open | 217937-218869 | |||
| 1183 | CABTAS010000002.1 | GCA902482805_00572 | gene | open | 218985-219935 | |||
| 1184 | CABTAS010000002.1 | GCA902482805_00573 | gene | open | 219932-220798 | |||
| 1185 | CABTAS010000002.1 | GCA902482805_00574 | gene | open | 220809-221036 | |||
| 1186 | CABTAS010000002.1 | GCA902482805_00575 | gene | open | 221040-222065 | meaB | ||
| 1187 | CABTAS010000002.1 | GCA902482805_00576 | gene | open | 222345-224534 | scpA | ||
| 1188 | CABTAS010000002.1 | GCA902482805_00577 | gene | open | 224531-226438 | mutA | ||
| 1189 | CABTAS010000002.1 | GCA902482805_00578 | gene | open | 227037-227966 | ytpA | ||
| 1190 | CABTAS010000002.1 | GCA902482805_00579 | gene | open | 228139-229305 | |||
| 1191 | CABTAS010000002.1 | GCA902482805_00580 | gene | open | 229368-230882 | |||
| 1192 | CABTAS010000002.1 | GCA902482805_00581 | gene | open | 231152-231652 | tpx | ||
| 1193 | CABTAS010000002.1 | GCA902482805_00582 | gene | open | 231969-232487 | |||
| 1194 | CABTAS010000002.1 | GCA902482805_00583 | gene | open | 232540-233358 | |||
| 1195 | CABTAS010000002.1 | GCA902482805_00584 | gene | open | 233498-234145 | |||
| 1196 | CABTAS010000002.1 | GCA902482805_00585 | gene | open | 234300-235817 | |||
| 1197 | CABTAS010000002.1 | GCA902482805_00586 | gene | open | 235877-236449 | |||
| 1198 | CABTAS010000002.1 | GCA902482805_00587 | gene | open | 236590-237018 | |||
| 1199 | CABTAS010000002.1 | GCA902482805_00588 | gene | open | 237077-237478 | |||
| 1200 | CABTAS010000002.1 | GCA902482805_00589 | gene | open | 237977-238645 | |||
| 1201 | CABTAS010000002.1 | GCA902482805_00590 | gene | open | 238767-239195 | osmC | ||
| 1202 | CABTAS010000002.1 | GCA902482805_00591 | gene | open | 239523-240647 | |||
| 1203 | CABTAS010000002.1 | GCA902482805_00592 | gene | open | 242522-243145 | |||
| 1204 | CABTAS010000002.1 | GCA902482805_00593 | gene | open | 243273-243632 | arsR | ||
| 1205 | CABTAS010000002.1 | GCA902482805_00594 | gene | open | 243629-245521 | zntA | ||
| 1206 | CABTAS010000002.1 | GCA902482805_00595 | gene | open | 245544-246584 | |||
| 1207 | CABTAS010000002.1 | GCA902482805_00596 | gene | open | 246597-247670 | ychF | ||
| 1208 | CABTAS010000002.1 | GCA902482805_00597 | gene | open | 247726-249057 | |||
| 1209 | CABTAS010000002.1 | GCA902482805_00598 | gene | open | 249120-250322 | |||
| 1210 | CABTAS010000002.1 | GCA902482805_00599 | gene | open | 250504-251472 | |||
| 1211 | CABTAS010000002.1 | GCA902482805_00600 | gene | open | 251959-253227 | xseA | ||
| 1212 | CABTAS010000002.1 | GCA902482805_00601 | gene | open | 253224-253607 | |||
| 1213 | CABTAS010000002.1 | GCA902482805_00602 | gene | open | 253631-254923 | |||
| 1214 | CABTAS010000002.1 | GCA902482805_00603 | gene | open | 255275-255994 | |||
| 1215 | CABTAS010000002.1 | GCA902482805_00604 | gene | open | 256147-256968 | |||
| 1216 | CABTAS010000002.1 | GCA902482805_00605 | gene | open | 257051-257557 | greA | ||
| 1217 | CABTAS010000002.1 | GCA902482805_00606 | gene | open | 257664-258605 | |||
| 1218 | CABTAS010000002.1 | GCA902482805_00607 | gene | open | 259440-260123 | |||
| 1219 | CABTAS010000002.1 | GCA902482805_00608 | gene | open | 260156-260803 | msrA | ||
| 1220 | CABTAS010000002.1 | GCA902482805_00609 | gene | open | 261094-261489 | |||
| 1221 | CABTAS010000002.1 | GCA902482805_00610 | gene | open | 261486-261917 | |||
| 1222 | CABTAS010000002.1 | GCA902482805_00611 | gene | open | 261960-262472 | |||
| 1223 | CABTAS010000002.1 | GCA902482805_00612 | gene | open | 262546-262704 | |||
| 1224 | CABTAS010000002.1 | GCA902482805_00374 | gene | open | 1-72 | trnN | ||
| 1225 | CABTAS010000002.1 | GCA902482805_00437 | gene | open | 68972-69045 | trnG | ||
| 1226 | CABTAS010000002.1 | GCA902482805_00490 | gene | open | 129260-129332 | trnA | ||
| 1227 | CABTAS010000002.1 | GCA902482805_00374 | tRNA | open | 1-72 | trnN | tRNA-Asn(gtt) | |
| 1228 | CABTAS010000002.1 | GCA902482805_00437 | tRNA | open | 68972-69045 | trnG | tRNA-Gly(tcc) | |
| 1229 | CABTAS010000002.1 | GCA902482805_00490 | tRNA | open | 129260-129332 | trnA | tRNA-Ala(ggc) | |
| 1230 | CABTAS010000003.1 | repeat_region | open | 38604-39860 | CRISPR array with 21 repeats of length 28%2C consensus sequence GGCTCATCCCCGCGTCTGCGGGGAGCAC and spacer length 33 | |||
| 1231 | CABTAS010000003.1 | GCA902482805_00615 | CDS | open | 224-673 | _na 149_aa | hypothetical protein | |
| 1232 | CABTAS010000003.1 | GCA902482805_00616 | CDS | open | 737-1156 | _na 139_aa | hypothetical protein | |
| 1233 | CABTAS010000003.1 | GCA902482805_00617 | CDS | open | 1391-1696 | _na 101_aa | Bacteriophage holin | |
| 1234 | CABTAS010000003.1 | GCA902482805_00618 | CDS | open | 1698-2534 | _na 278_aa | hypothetical protein | |
| 1235 | CABTAS010000003.1 | GCA902482805_00619 | CDS | open | 2621-3130 | _na 169_aa | Carbohydrate-binding module family 5/12 | |
| 1236 | CABTAS010000003.1 | GCA902482805_00620 | CDS | open | 3127-3513 | _na 128_aa | hypothetical protein | |
| 1237 | CABTAS010000003.1 | GCA902482805_00621 | CDS | open | 3524-5536 | _na 670_aa | hypothetical protein | |
| 1238 | CABTAS010000003.1 | GCA902482805_00622 | CDS | open | 5536-6705 | _na 389_aa | hypothetical protein | |
| 1239 | CABTAS010000003.1 | GCA902482805_00623 | CDS | open | 6702-8546 | _na 614_aa | DNRLRE domain-containing protein | |
| 1240 | CABTAS010000003.1 | GCA902482805_00624 | CDS | open | 8543-13036 | _na 1497_aa | peptidoglycan DD-metalloendopeptidase family protein | |
| 1241 | CABTAS010000003.1 | GCA902482805_00625 | CDS | open | 13039-13356 | _na 105_aa | hypothetical protein | |
| 1242 | CABTAS010000003.1 | GCA902482805_00626 | CDS | open | 13398-13670 | _na 90_aa | hypothetical protein | |
| 1243 | CABTAS010000003.1 | GCA902482805_00627 | CDS | open | 13750-14352 | _na 200_aa | hypothetical protein | |
| 1244 | CABTAS010000003.1 | GCA902482805_00628 | CDS | open | 14362-14742 | _na 126_aa | hypothetical protein | |
| 1245 | CABTAS010000003.1 | GCA902482805_00629 | CDS | open | 14739-15044 | _na 101_aa | hypothetical protein | |
| 1246 | CABTAS010000003.1 | GCA902482805_00630 | CDS | open | 15037-15366 | _na 109_aa | hypothetical protein | |
| 1247 | CABTAS010000003.1 | GCA902482805_00631 | CDS | open | 15363-15737 | _na 124_aa | Gp19/Gp15/Gp42 family protein | |
| 1248 | CABTAS010000003.1 | GCA902482805_00632 | CDS | open | 15740-16690 | _na 316_aa | phage major capsid protein | |
| 1249 | CABTAS010000003.1 | GCA902482805_00633 | CDS | open | 16709-17161 | _na 150_aa | head scaffolding protein | |
| 1250 | CABTAS010000003.1 | GCA902482805_00634 | CDS | open | 17307-18056 | _na 249_aa | head maturation protease | |
| 1251 | CABTAS010000003.1 | GCA902482805_00635 | CDS | open | 18056-19507 | _na 483_aa | phage portal protein | |
| 1252 | CABTAS010000003.1 | GCA902482805_00636 | CDS | open | 19504-20940 | _na 478_aa | phage terminase | |
| 1253 | CABTAS010000003.1 | GCA902482805_00637 | CDS | open | 20933-21241 | _na 102_aa | hypothetical protein | |
| 1254 | CABTAS010000003.1 | GCA902482805_00638 | CDS | open | 21821-22546 | _na 241_aa | hypothetical protein | |
| 1255 | CABTAS010000003.1 | GCA902482805_00639 | CDS | open | 22596-22970 | _na 124_aa | hypothetical protein | |
| 1256 | CABTAS010000003.1 | GCA902482805_00640 | CDS | open | 23224-24186 | _na 320_aa | hypothetical protein | |
| 1257 | CABTAS010000003.1 | GCA902482805_00641 | CDS | open | 24188-24922 | _na 244_aa | phosphoadenosine phosphosulfate reductase family protein | |
| 1258 | CABTAS010000003.1 | GCA902482805_00642 | CDS | open | 24870-25130 | _na 86_aa | hypothetical protein | |
| 1259 | CABTAS010000003.1 | GCA902482805_00643 | CDS | open | 25121-25711 | _na 196_aa | hypothetical protein | |
| 1260 | CABTAS010000003.1 | GCA902482805_00644 | CDS | open | 25708-26601 | _na 297_aa | hypothetical protein | |
| 1261 | CABTAS010000003.1 | GCA902482805_00645 | CDS | open | 26601-26990 | _na 129_aa | hypothetical protein | |
| 1262 | CABTAS010000003.1 | GCA902482805_00646 | CDS | open | 26987-27706 | _na 239_aa | tniQ | TniQ protein |
| 1263 | CABTAS010000003.1 | GCA902482805_00647 | CDS | open | 27703-28272 | _na 189_aa | type I-E CRISPR-associated protein Cas6/Cse3/CasE | |
| 1264 | CABTAS010000003.1 | GCA902482805_00648 | CDS | open | 28269-28637 | _na 122_aa | hypothetical protein | |
| 1265 | CABTAS010000003.1 | GCA902482805_00649 | CDS | open | 28634-29077 | _na 147_aa | hypothetical protein | |
| 1266 | CABTAS010000003.1 | GCA902482805_00650 | CDS | open | 29145-29624 | _na 159_aa | single-stranded DNA-binding protein | |
| 1267 | CABTAS010000003.1 | GCA902482805_00651 | CDS | open | 29621-30427 | _na 268_aa | recT | Recombinase RecT |
| 1268 | CABTAS010000003.1 | GCA902482805_00652 | CDS | open | 30417-30641 | _na 74_aa | hypothetical protein | |
| 1269 | CABTAS010000003.1 | GCA902482805_00653 | CDS | open | 30638-31573 | _na 311_aa | lambda-exonuclease family protein | |
| 1270 | CABTAS010000003.1 | GCA902482805_00654 | CDS | open | 31570-31818 | _na 82_aa | hypothetical protein | |
| 1271 | CABTAS010000003.1 | GCA902482805_00655 | CDS | open | 31815-32258 | _na 147_aa | whiB | WhiB family transcriptional regulator |
| 1272 | CABTAS010000003.1 | GCA902482805_00656 | CDS | open | 32255-32431 | _na 58_aa | hypothetical protein | |
| 1273 | CABTAS010000003.1 | GCA902482805_00657 | CDS | open | 32431-32676 | _na 81_aa | hypothetical protein | |
| 1274 | CABTAS010000003.1 | GCA902482805_00658 | CDS | open | 32828-33043 | _na 71_aa | excisionase family DNA-binding protein | |
| 1275 | CABTAS010000003.1 | GCA902482805_00659 | CDS | open | 33040-33240 | _na 66_aa | hypothetical protein | |
| 1276 | CABTAS010000003.1 | GCA902482805_00660 | CDS | open | 33659-33961 | _na 100_aa | hypothetical protein | |
| 1277 | CABTAS010000003.1 | GCA902482805_00661 | CDS | open | 33958-34755 | _na 265_aa | phage antirepressor | |
| 1278 | CABTAS010000003.1 | GCA902482805_00662 | CDS | open | 35107-35472 | _na 121_aa | helix-turn-helix transcriptional regulator | |
| 1279 | CABTAS010000003.1 | GCA902482805_00663 | CDS | open | 35459-35863 | _na 134_aa | irrE | IrrE N-terminal-like domain-containing protein |
| 1280 | CABTAS010000003.1 | GCA902482805_00664 | CDS | open | 35897-36598 | _na 233_aa | hypothetical protein | |
| 1281 | CABTAS010000003.1 | GCA902482805_00665 | CDS | open | 36729-38069 | _na 446_aa | site-specific integrase | |
| 1282 | CABTAS010000003.1 | GCA902482805_00666 | CDS | open | 38393-38563 | _na 56_aa | hypothetical protein | |
| 1283 | CABTAS010000003.1 | GCA902482805_00667 | CDS | open | 39895-40212 | _na 105_aa | cas2e | type I-E CRISPR-associated endoribonuclease Cas2e |
| 1284 | CABTAS010000003.1 | GCA902482805_00668 | CDS | open | 40214-41143 | _na 309_aa | cas1e | type I-E CRISPR-associated endonuclease Cas1e |
| 1285 | CABTAS010000003.1 | GCA902482805_00669 | CDS | open | 41150-41788 | _na 212_aa | cas6e | type I-E CRISPR-associated protein Cas6/Cse3/CasE |
| 1286 | CABTAS010000003.1 | GCA902482805_00670 | CDS | open | 41785-42486 | _na 233_aa | cas5e | type I-E CRISPR-associated protein Cas5/CasD |
| 1287 | CABTAS010000003.1 | GCA902482805_00671 | CDS | open | 42489-43616 | _na 375_aa | cas7e | type I-E CRISPR-associated protein Cas7/Cse4/CasC |
| 1288 | CABTAS010000003.1 | GCA902482805_00672 | CDS | open | 43662-44282 | _na 206_aa | casB | type I-E CRISPR-associated protein Cse2/CasB |
| 1289 | CABTAS010000003.1 | GCA902482805_00673 | CDS | open | 44275-45948 | _na 557_aa | casA | type I-E CRISPR-associated protein Cse1/CasA |
| 1290 | CABTAS010000003.1 | GCA902482805_00674 | CDS | open | 45994-48828 | _na 944_aa | CRISPR-associated helicase Cas3' | |
| 1291 | CABTAS010000003.1 | GCA902482805_00675 | CDS | open | 49272-50873 | _na 533_aa | LssY-like C-terminal domain-containing protein | |
| 1292 | CABTAS010000003.1 | GCA902482805_00676 | CDS | open | 51170-54322 | _na 1050_aa | Minor extracellular protease vpr | |
| 1293 | CABTAS010000003.1 | GCA902482805_00677 | CDS | open | 54545-55951 | _na 468_aa | Trehalose-phosphate synthase | |
| 1294 | CABTAS010000003.1 | GCA902482805_00678 | CDS | open | 55986-56948 | _na 320_aa | otsB | trehalose-phosphatase |
| 1295 | CABTAS010000003.1 | GCA902482805_00679 | CDS | open | 56958-58394 | _na 478_aa | Transcriptional regulator | |
| 1296 | CABTAS010000003.1 | GCA902482805_00680 | CDS | open | 58517-59425 | _na 302_aa | pdxS | pyridoxal 5'-phosphate synthase lyase subunit PdxS |
| 1297 | CABTAS010000003.1 | GCA902482805_00681 | CDS | open | 59419-59988 | _na 189_aa | pdxT | pyridoxal 5'-phosphate synthase glutaminase subunit PdxT |
| 1298 | CABTAS010000003.1 | GCA902482805_00682 | CDS | open | 60234-61664 | _na 476_aa | DUF1994 domain-containing protein | |
| 1299 | CABTAS010000003.1 | GCA902482805_00683 | CDS | open | 61966-62541 | _na 191_aa | hypothetical protein | |
| 1300 | CABTAS010000003.1 | GCA902482805_00684 | CDS | open | 62690-62974 | _na 94_aa | copG | CopG family transcriptional regulator |
| 1301 | CABTAS010000003.1 | GCA902482805_00685 | CDS | open | 63408-63887 | _na 159_aa | hypothetical protein | |
| 1302 | CABTAS010000003.1 | GCA902482805_00687 | CDS | open | 64399-65226 | _na 275_aa | HMP-PP phosphatase | |
| 1303 | CABTAS010000003.1 | GCA902482805_00688 | CDS | open | 65226-66134 | _na 302_aa | hypothetical protein | |
| 1304 | CABTAS010000003.1 | GCA902482805_00689 | CDS | open | 66278-67411 | _na 377_aa | ATPase family associated with various cellular activities (AAA) | |
| 1305 | CABTAS010000003.1 | GCA902482805_00690 | CDS | open | 67419-68465 | _na 348_aa | DUF58 domain-containing protein | |
| 1306 | CABTAS010000003.1 | GCA902482805_00691 | CDS | open | 68462-69466 | _na 334_aa | von Willebrand factor type A domain-containing protein | |
| 1307 | CABTAS010000003.1 | GCA902482805_00692 | CDS | open | 69469-70425 | _na 318_aa | Magnesium chelatase | |
| 1308 | CABTAS010000003.1 | GCA902482805_00693 | CDS | open | 70441-71148 | _na 235_aa | Pyridoxal phosphate homeostasis protein | |
| 1309 | CABTAS010000003.1 | GCA902482805_00694 | CDS | open | 71368-71874 | _na 168_aa | DUF3145 domain-containing protein | |
| 1310 | CABTAS010000003.1 | GCA902482805_00695 | CDS | open | 72087-73361 | _na 424_aa | 3-oxoacyl-ACP synthase | |
| 1311 | CABTAS010000003.1 | GCA902482805_00696 | CDS | open | 73391-73636 | _na 81_aa | acyl carrier protein | |
| 1312 | CABTAS010000003.1 | GCA902482805_00697 | CDS | open | 73732-74736 | _na 334_aa | 3-oxoacyl-[acyl-carrier-protein] synthase 3 | |
| 1313 | CABTAS010000003.1 | GCA902482805_00698 | CDS | open | 74733-75674 | _na 313_aa | [acyl-carrier-protein] S-malonyltransferase | |
| 1314 | CABTAS010000003.1 | GCA902482805_00699 | CDS | open | 75819-76745 | _na 308_aa | 2-dehydropantoate 2-reductase | |
| 1315 | CABTAS010000003.1 | GCA902482805_00700 | CDS | open | 76742-77089 | _na 115_aa | Dinitrogenase iron-molybdenum cofactor | |
| 1316 | CABTAS010000003.1 | GCA902482805_00701 | CDS | open | 77094-78377 | _na 427_aa | pucR | PucR family transcriptional regulator |
| 1317 | CABTAS010000003.1 | GCA902482805_00702 | CDS | open | 78730-79134 | _na 134_aa | DUF3052 domain-containing protein | |
| 1318 | CABTAS010000003.1 | GCA902482805_00703 | CDS | open | 79292-80305 | _na 337_aa | Aldo/keto reductase | |
| 1319 | CABTAS010000003.1 | GCA902482805_00704 | CDS | open | 80423-80884 | _na 153_aa | GatB/Yqey protein | |
| 1320 | CABTAS010000003.1 | GCA902482805_00705 | CDS | open | 81241-81807 | _na 188_aa | pyrR | bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR |
| 1321 | CABTAS010000003.1 | GCA902482805_00706 | CDS | open | 81804-82748 | _na 314_aa | aspartate carbamoyltransferase catalytic subunit | |
| 1322 | CABTAS010000003.1 | GCA902482805_00707 | CDS | open | 82745-84046 | _na 433_aa | Dihydroorotase | |
| 1323 | CABTAS010000003.1 | GCA902482805_00708 | CDS | open | 84043-85140 | _na 365_aa | carbamoyl phosphate synthase small subunit | |
| 1324 | CABTAS010000003.1 | GCA902482805_00709 | CDS | open | 85140-88328 | _na 1062_aa | carB | carbamoyl-phosphate synthase large subunit |
| 1325 | CABTAS010000003.1 | GCA902482805_00710 | CDS | open | 88342-89106 | _na 254_aa | Dihydroorotate dehydrogenase B (NAD(+))%2C electron transfer subunit | |
| 1326 | CABTAS010000003.1 | GCA902482805_00711 | CDS | open | 89103-90035 | _na 310_aa | dihydroorotate dehydrogenase | |
| 1327 | CABTAS010000003.1 | GCA902482805_00712 | CDS | open | 90156-90866 | _na 236_aa | pyrF | orotidine-5'-phosphate decarboxylase |
| 1328 | CABTAS010000003.1 | GCA902482805_00713 | CDS | open | 90917-91567 | _na 216_aa | Orotate phosphoribosyltransferase | |
| 1329 | CABTAS010000003.1 | GCA902482805_00714 | CDS | open | 91685-92467 | _na 260_aa | Fructosamine kinase | |
| 1330 | CABTAS010000003.1 | GCA902482805_00715 | CDS | open | 92599-93981 | _na 460_aa | YibE/F family protein | |
| 1331 | CABTAS010000003.1 | GCA902482805_00716 | CDS | open | 94155-95714 | _na 519_aa | rimO | 30S ribosomal protein S12 methylthiotransferase RimO |
| 1332 | CABTAS010000003.1 | GCA902482805_00717 | CDS | open | 95803-96390 | _na 195_aa | pgsA | CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase |
| 1333 | CABTAS010000003.1 | GCA902482805_00718 | CDS | open | 96470-96970 | _na 166_aa | Competence protein | |
| 1334 | CABTAS010000003.1 | GCA902482805_00719 | CDS | open | 97033-97308 | _na 91_aa | DNA-binding protein | |
| 1335 | CABTAS010000003.1 | GCA902482805_00720 | CDS | open | 97310-98143 | _na 277_aa | Alkaline phosphatase | |
| 1336 | CABTAS010000003.1 | GCA902482805_00721 | CDS | open | 98713-99774 | _na 353_aa | recA | recombinase RecA |
| 1337 | CABTAS010000003.1 | GCA902482805_00722 | CDS | open | 99927-100376 | _na 149_aa | recX | Regulatory protein RecX |
| 1338 | CABTAS010000003.1 | GCA902482805_00723 | CDS | open | 100486-101958 | _na 490_aa | rny | ribonuclease Y |
| 1339 | CABTAS010000003.1 | GCA902482805_00724 | CDS | open | 102193-103095 | _na 300_aa | Aldose 1-epimerase | |
| 1340 | CABTAS010000003.1 | GCA902482805_00725 | CDS | open | 103158-104627 | _na 489_aa | miaB | tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB |
| 1341 | CABTAS010000003.1 | GCA902482805_00726 | CDS | open | 104824-105024 | _na 66_aa | Antitoxin | |
| 1342 | CABTAS010000003.1 | GCA902482805_00727 | CDS | open | 105171-106103 | _na 310_aa | miaA | tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA |
| 1343 | CABTAS010000003.1 | GCA902482805_00728 | CDS | open | 106097-106951 | _na 284_aa | dapF | diaminopimelate epimerase |
| 1344 | CABTAS010000003.1 | GCA902482805_00729 | CDS | open | 106948-108405 | _na 485_aa | hflX | GTPase HflX |
| 1345 | CABTAS010000003.1 | GCA902482805_00730 | CDS | open | 108405-110423 | _na 672_aa | Putative ATP-dependent helicase | |
| 1346 | CABTAS010000003.1 | GCA902482805_00731 | CDS | open | 110606-111328 | _na 240_aa | lexA | transcriptional repressor LexA |
| 1347 | CABTAS010000003.1 | GCA902482805_00732 | CDS | open | 111666-112145 | _na 159_aa | hypothetical protein | |
| 1348 | CABTAS010000003.1 | GCA902482805_00733 | CDS | open | 112303-112818 | _na 171_aa | nrdR | transcriptional regulator NrdR |
| 1349 | CABTAS010000003.1 | GCA902482805_00734 | CDS | open | 112891-115743 | _na 950_aa | vitamin B12-dependent ribonucleotide reductase | |
| 1350 | CABTAS010000003.1 | GCA902482805_00735 | CDS | open | 116266-117225 | _na 319_aa | ybjN | YbjN domain-containing protein |
| 1351 | CABTAS010000003.1 | GCA902482805_00736 | CDS | open | 117335-117760 | _na 141_aa | Pyridoxamine 5'-phosphate oxidase family protein | |
| 1352 | CABTAS010000003.1 | GCA902482805_00737 | CDS | open | 117795-118676 | _na 293_aa | Universal stress family protein | |
| 1353 | CABTAS010000003.1 | GCA902482805_00738 | CDS | open | 118866-123023 | _na 1385_aa | hrpA | ATP-dependent RNA helicase HrpA |
| 1354 | CABTAS010000003.1 | GCA902482805_00739 | CDS | open | 123057-123944 | _na 295_aa | Acyl-CoA thioesterase | |
| 1355 | CABTAS010000003.1 | GCA902482805_00740 | CDS | open | 124093-125031 | _na 312_aa | hrdD | RNA polymerase principal sigma factor HrdD |
| 1356 | CABTAS010000003.1 | GCA902482805_00741 | CDS | open | 125278-125703 | _na 141_aa | hypothetical protein | |
| 1357 | CABTAS010000003.1 | GCA902482805_00742 | CDS | open | 125774-126886 | _na 370_aa | RNA polymerase sigma factor | |
| 1358 | CABTAS010000003.1 | GCA902482805_00743 | CDS | open | 127127-127660 | _na 177_aa | Putative phage-associated protein | |
| 1359 | CABTAS010000003.1 | GCA902482805_00744 | CDS | open | 127852-129081 | _na 409_aa | BD-FAE-like domain-containing protein | |
| 1360 | CABTAS010000003.1 | GCA902482805_00745 | CDS | open | 129124-129657 | _na 177_aa | Acetyltransferase%2C GNAT family protein | |
| 1361 | CABTAS010000003.1 | GCA902482805_00746 | CDS | open | 129742-129939 | _na 65_aa | hypothetical protein | |
| 1362 | CABTAS010000003.1 | GCA902482805_00747 | CDS | open | 130283-132442 | _na 719_aa | DNA topoisomerase (ATP-hydrolyzing) | |
| 1363 | CABTAS010000003.1 | GCA902482805_00748 | CDS | open | 132953-135574 | _na 873_aa | DNA topoisomerase (ATP-hydrolyzing) | |
| 1364 | CABTAS010000003.1 | GCA902482805_00749 | CDS | open | 135797-136837 | _na 346_aa | Phosphatidate phosphatase APP1 catalytic domain-containing protein | |
| 1365 | CABTAS010000003.1 | GCA902482805_00750 | CDS | open | 137068-138231 | _na 387_aa | Type I phosphodiesterase / nucleotide pyrophosphatase | |
| 1366 | CABTAS010000003.1 | GCA902482805_00751 | CDS | open | 138236-139009 | _na 257_aa | thymidine kinase | |
| 1367 | CABTAS010000003.1 | GCA902482805_00752 | CDS | open | 139058-140257 | _na 399_aa | sepH | septation protein SepH |
| 1368 | CABTAS010000003.1 | GCA902482805_00753 | CDS | open | 140416-140712 | _na 98_aa | PF13834 domain protein | |
| 1369 | CABTAS010000003.1 | GCA902482805_00754 | CDS | open | 141011-141319 | _na 102_aa | DUF4235 domain-containing protein | |
| 1370 | CABTAS010000003.1 | GCA902482805_00755 | CDS | open | 141502-141933 | _na 143_aa | dut | dUTP diphosphatase |
| 1371 | CABTAS010000003.1 | GCA902482805_00756 | CDS | open | 142058-142837 | _na 259_aa | DUF3710 domain-containing protein | |
| 1372 | CABTAS010000003.1 | GCA902482805_00757 | CDS | open | 143224-144378 | _na 384_aa | rlmD | 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD |
| 1373 | CABTAS010000003.1 | GCA902482805_00758 | CDS | open | 144489-145031 | _na 180_aa | Glutathione peroxidase | |
| 1374 | CABTAS010000003.1 | GCA902482805_00759 | CDS | open | 145028-145483 | _na 151_aa | HTH marR-type domain-containing protein | |
| 1375 | CABTAS010000003.1 | GCA902482805_00760 | CDS | open | 145637-148303 | _na 888_aa | acnA | aconitate hydratase AcnA |
| 1376 | CABTAS010000003.1 | GCA902482805_00761 | CDS | open | 148491-150356 | _na 621_aa | dxs | 1-deoxy-D-xylulose-5-phosphate synthase |
| 1377 | CABTAS010000003.1 | GCA902482805_00762 | CDS | open | 150418-151713 | _na 431_aa | 3'-5' exonuclease | |
| 1378 | CABTAS010000003.1 | GCA902482805_00763 | CDS | open | 151753-152328 | _na 191_aa | DUF3000 domain-containing protein | |
| 1379 | CABTAS010000003.1 | GCA902482805_00764 | CDS | open | 152445-152888 | _na 147_aa | peptide-methionine (R)-S-oxide reductase | |
| 1380 | CABTAS010000003.1 | GCA902482805_00765 | CDS | open | 153039-153902 | _na 287_aa | Phosphate:nucleotide phosphotransferase | |
| 1381 | CABTAS010000003.1 | GCA902482805_00766 | CDS | open | 153888-154640 | _na 250_aa | cbiX | Cobalamin biosynthesis protein CbiX |
| 1382 | CABTAS010000003.1 | GCA902482805_00767 | CDS | open | 154657-154881 | _na 74_aa | hypothetical protein | |
| 1383 | CABTAS010000003.1 | GCA902482805_00772 | CDS | open | 155774-156838 | _na 354_aa | alcohol dehydrogenase (NADP(+)) | |
| 1384 | CABTAS010000003.1 | GCA902482805_00773 | CDS | open | 156972-157085 | _na 37_aa | hypothetical protein | |
| 1385 | CABTAS010000003.1 | GCA902482805_00774 | CDS | open | 157069-159204 | _na 711_aa | thrS | threonine--tRNA ligase |
| 1386 | CABTAS010000003.1 | GCA902482805_00775 | CDS | open | 159210-159848 | _na 212_aa | HIT family hydrolase | |
| 1387 | CABTAS010000003.1 | GCA902482805_00776 | CDS | open | 159841-160464 | _na 207_aa | pgsA | phosphatidylinositol phosphate synthase |
| 1388 | CABTAS010000003.1 | GCA902482805_00777 | CDS | open | 160466-161380 | _na 304_aa | Phosphatidylinositol mannoside acyltransferase | |
| 1389 | CABTAS010000003.1 | GCA902482805_00778 | CDS | open | 161380-162678 | _na 432_aa | GDP-mannose-dependent alpha-(1-2)-phosphatidylinositol mannosyltransferase | |
| 1390 | CABTAS010000003.1 | GCA902482805_00779 | CDS | open | 162675-163325 | _na 216_aa | CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase | |
| 1391 | CABTAS010000003.1 | GCA902482805_00780 | CDS | open | 163327-164274 | _na 315_aa | Membrane associated protein | |
| 1392 | CABTAS010000003.1 | GCA902482805_00781 | CDS | open | 164331-164663 | _na 110_aa | Membrane protein | |
| 1393 | CABTAS010000003.1 | GCA902482805_00782 | CDS | open | 164656-165396 | _na 246_aa | Division initiation protein | |
| 1394 | CABTAS010000003.1 | GCA902482805_00783 | CDS | open | 165483-166013 | _na 176_aa | FHA domain-containing protein | |
| 1395 | CABTAS010000003.1 | GCA902482805_00784 | CDS | open | 166013-166708 | _na 231_aa | merR | MerR family transcriptional regulator |
| 1396 | CABTAS010000003.1 | GCA902482805_00785 | CDS | open | 166726-167184 | _na 152_aa | BFN domain-containing protein | |
| 1397 | CABTAS010000003.1 | GCA902482805_00786 | CDS | open | 167396-167965 | _na 189_aa | Transcriptional regulator | |
| 1398 | CABTAS010000003.1 | GCA902482805_00787 | CDS | open | 168098-169474 | _na 458_aa | yhjD | Inner membrane protein yhjD |
| 1399 | CABTAS010000003.1 | GCA902482805_00788 | CDS | open | 169559-170761 | _na 400_aa | pyrophosphate--fructose-6-phosphate 1-phosphotransferase | |
| 1400 | CABTAS010000003.1 | GCA902482805_00789 | CDS | open | 170929-171330 | _na 133_aa | TadE-like protein | |
| 1401 | CABTAS010000003.1 | GCA902482805_00790 | CDS | open | 171386-172006 | _na 206_aa | L-threonylcarbamoyladenylate synthase | |
| 1402 | CABTAS010000003.1 | GCA902482805_00791 | CDS | open | 172085-172834 | _na 249_aa | 5'-methylthioadenosine/adenosylhomocysteine nucleosidase | |
| 1403 | CABTAS010000003.1 | GCA902482805_00792 | CDS | open | 172930-173958 | _na 342_aa | DAGKc domain-containing protein | |
| 1404 | CABTAS010000003.1 | GCA902482805_00793 | CDS | open | 174007-174816 | _na 269_aa | Impact N-terminal domain-containing protein | |
| 1405 | CABTAS010000003.1 | GCA902482805_00794 | CDS | open | 174871-178269 | _na 1132_aa | RNA-directed RNA polymerase | |
| 1406 | CABTAS010000003.1 | GCA902482805_00795 | CDS | open | 178306-180084 | _na 592_aa | Integral membrane bound transporter domain-containing protein | |
| 1407 | CABTAS010000003.1 | GCA902482805_00796 | CDS | open | 180081-181580 | _na 499_aa | dnaK | DnaK family protein |
| 1408 | CABTAS010000003.1 | GCA902482805_00797 | CDS | open | 181734-182891 | _na 385_aa | PAC2 family | |
| 1409 | CABTAS010000003.1 | GCA902482805_00798 | CDS | open | 183152-183658 | _na 168_aa | Arginine repressor | |
| 1410 | CABTAS010000003.1 | GCA902482805_00799 | CDS | open | 183766-185478 | _na 570_aa | C4-dicarboxylate anaerobic carrier | |
| 1411 | CABTAS010000003.1 | GCA902482805_00800 | CDS | open | 185734-186639 | _na 301_aa | arcC | carbamate kinase |
| 1412 | CABTAS010000003.1 | GCA902482805_00801 | CDS | open | 186655-187659 | _na 334_aa | ornithine carbamoyltransferase | |
| 1413 | CABTAS010000003.1 | GCA902482805_00802 | CDS | open | 188089-189069 | _na 326_aa | Integral membrane protein | |
| 1414 | CABTAS010000003.1 | GCA902482805_00615 | gene | open | 224-673 | |||
| 1415 | CABTAS010000003.1 | GCA902482805_00616 | gene | open | 737-1156 | |||
| 1416 | CABTAS010000003.1 | GCA902482805_00617 | gene | open | 1391-1696 | |||
| 1417 | CABTAS010000003.1 | GCA902482805_00618 | gene | open | 1698-2534 | |||
| 1418 | CABTAS010000003.1 | GCA902482805_00619 | gene | open | 2621-3130 | |||
| 1419 | CABTAS010000003.1 | GCA902482805_00620 | gene | open | 3127-3513 | |||
| 1420 | CABTAS010000003.1 | GCA902482805_00621 | gene | open | 3524-5536 | |||
| 1421 | CABTAS010000003.1 | GCA902482805_00622 | gene | open | 5536-6705 | |||
| 1422 | CABTAS010000003.1 | GCA902482805_00623 | gene | open | 6702-8546 | |||
| 1423 | CABTAS010000003.1 | GCA902482805_00624 | gene | open | 8543-13036 | |||
| 1424 | CABTAS010000003.1 | GCA902482805_00625 | gene | open | 13039-13356 | |||
| 1425 | CABTAS010000003.1 | GCA902482805_00626 | gene | open | 13398-13670 | |||
| 1426 | CABTAS010000003.1 | GCA902482805_00627 | gene | open | 13750-14352 | |||
| 1427 | CABTAS010000003.1 | GCA902482805_00628 | gene | open | 14362-14742 | |||
| 1428 | CABTAS010000003.1 | GCA902482805_00629 | gene | open | 14739-15044 | |||
| 1429 | CABTAS010000003.1 | GCA902482805_00630 | gene | open | 15037-15366 | |||
| 1430 | CABTAS010000003.1 | GCA902482805_00631 | gene | open | 15363-15737 | |||
| 1431 | CABTAS010000003.1 | GCA902482805_00632 | gene | open | 15740-16690 | |||
| 1432 | CABTAS010000003.1 | GCA902482805_00633 | gene | open | 16709-17161 | |||
| 1433 | CABTAS010000003.1 | GCA902482805_00634 | gene | open | 17307-18056 | |||
| 1434 | CABTAS010000003.1 | GCA902482805_00635 | gene | open | 18056-19507 | |||
| 1435 | CABTAS010000003.1 | GCA902482805_00636 | gene | open | 19504-20940 | |||
| 1436 | CABTAS010000003.1 | GCA902482805_00637 | gene | open | 20933-21241 | |||
| 1437 | CABTAS010000003.1 | GCA902482805_00638 | gene | open | 21821-22546 | |||
| 1438 | CABTAS010000003.1 | GCA902482805_00639 | gene | open | 22596-22970 | |||
| 1439 | CABTAS010000003.1 | GCA902482805_00640 | gene | open | 23224-24186 | |||
| 1440 | CABTAS010000003.1 | GCA902482805_00641 | gene | open | 24188-24922 | |||
| 1441 | CABTAS010000003.1 | GCA902482805_00642 | gene | open | 24870-25130 | |||
| 1442 | CABTAS010000003.1 | GCA902482805_00643 | gene | open | 25121-25711 | |||
| 1443 | CABTAS010000003.1 | GCA902482805_00644 | gene | open | 25708-26601 | |||
| 1444 | CABTAS010000003.1 | GCA902482805_00645 | gene | open | 26601-26990 | |||
| 1445 | CABTAS010000003.1 | GCA902482805_00646 | gene | open | 26987-27706 | tniQ | ||
| 1446 | CABTAS010000003.1 | GCA902482805_00647 | gene | open | 27703-28272 | |||
| 1447 | CABTAS010000003.1 | GCA902482805_00648 | gene | open | 28269-28637 | |||
| 1448 | CABTAS010000003.1 | GCA902482805_00649 | gene | open | 28634-29077 | |||
| 1449 | CABTAS010000003.1 | GCA902482805_00650 | gene | open | 29145-29624 | |||
| 1450 | CABTAS010000003.1 | GCA902482805_00651 | gene | open | 29621-30427 | recT | ||
| 1451 | CABTAS010000003.1 | GCA902482805_00652 | gene | open | 30417-30641 | |||
| 1452 | CABTAS010000003.1 | GCA902482805_00653 | gene | open | 30638-31573 | |||
| 1453 | CABTAS010000003.1 | GCA902482805_00654 | gene | open | 31570-31818 | |||
| 1454 | CABTAS010000003.1 | GCA902482805_00655 | gene | open | 31815-32258 | whiB | ||
| 1455 | CABTAS010000003.1 | GCA902482805_00656 | gene | open | 32255-32431 | |||
| 1456 | CABTAS010000003.1 | GCA902482805_00657 | gene | open | 32431-32676 | |||
| 1457 | CABTAS010000003.1 | GCA902482805_00658 | gene | open | 32828-33043 | |||
| 1458 | CABTAS010000003.1 | GCA902482805_00659 | gene | open | 33040-33240 | |||
| 1459 | CABTAS010000003.1 | GCA902482805_00660 | gene | open | 33659-33961 | |||
| 1460 | CABTAS010000003.1 | GCA902482805_00661 | gene | open | 33958-34755 | |||
| 1461 | CABTAS010000003.1 | GCA902482805_00662 | gene | open | 35107-35472 | |||
| 1462 | CABTAS010000003.1 | GCA902482805_00663 | gene | open | 35459-35863 | irrE | ||
| 1463 | CABTAS010000003.1 | GCA902482805_00664 | gene | open | 35897-36598 | |||
| 1464 | CABTAS010000003.1 | GCA902482805_00665 | gene | open | 36729-38069 | |||
| 1465 | CABTAS010000003.1 | GCA902482805_00666 | gene | open | 38393-38563 | |||
| 1466 | CABTAS010000003.1 | GCA902482805_00667 | gene | open | 39895-40212 | cas2e | ||
| 1467 | CABTAS010000003.1 | GCA902482805_00668 | gene | open | 40214-41143 | cas1e | ||
| 1468 | CABTAS010000003.1 | GCA902482805_00669 | gene | open | 41150-41788 | cas6e | ||
| 1469 | CABTAS010000003.1 | GCA902482805_00670 | gene | open | 41785-42486 | cas5e | ||
| 1470 | CABTAS010000003.1 | GCA902482805_00671 | gene | open | 42489-43616 | cas7e | ||
| 1471 | CABTAS010000003.1 | GCA902482805_00672 | gene | open | 43662-44282 | casB | ||
| 1472 | CABTAS010000003.1 | GCA902482805_00673 | gene | open | 44275-45948 | casA | ||
| 1473 | CABTAS010000003.1 | GCA902482805_00674 | gene | open | 45994-48828 | |||
| 1474 | CABTAS010000003.1 | GCA902482805_00675 | gene | open | 49272-50873 | |||
| 1475 | CABTAS010000003.1 | GCA902482805_00676 | gene | open | 51170-54322 | |||
| 1476 | CABTAS010000003.1 | GCA902482805_00677 | gene | open | 54545-55951 | |||
| 1477 | CABTAS010000003.1 | GCA902482805_00678 | gene | open | 55986-56948 | otsB | ||
| 1478 | CABTAS010000003.1 | GCA902482805_00679 | gene | open | 56958-58394 | |||
| 1479 | CABTAS010000003.1 | GCA902482805_00680 | gene | open | 58517-59425 | pdxS | ||
| 1480 | CABTAS010000003.1 | GCA902482805_00681 | gene | open | 59419-59988 | pdxT | ||
| 1481 | CABTAS010000003.1 | GCA902482805_00682 | gene | open | 60234-61664 | |||
| 1482 | CABTAS010000003.1 | GCA902482805_00683 | gene | open | 61966-62541 | |||
| 1483 | CABTAS010000003.1 | GCA902482805_00684 | gene | open | 62690-62974 | copG | ||
| 1484 | CABTAS010000003.1 | GCA902482805_00685 | gene | open | 63408-63887 | |||
| 1485 | CABTAS010000003.1 | GCA902482805_00687 | gene | open | 64399-65226 | |||
| 1486 | CABTAS010000003.1 | GCA902482805_00688 | gene | open | 65226-66134 | |||
| 1487 | CABTAS010000003.1 | GCA902482805_00689 | gene | open | 66278-67411 | |||
| 1488 | CABTAS010000003.1 | GCA902482805_00690 | gene | open | 67419-68465 | |||
| 1489 | CABTAS010000003.1 | GCA902482805_00691 | gene | open | 68462-69466 | |||
| 1490 | CABTAS010000003.1 | GCA902482805_00692 | gene | open | 69469-70425 | |||
| 1491 | CABTAS010000003.1 | GCA902482805_00693 | gene | open | 70441-71148 | |||
| 1492 | CABTAS010000003.1 | GCA902482805_00694 | gene | open | 71368-71874 | |||
| 1493 | CABTAS010000003.1 | GCA902482805_00695 | gene | open | 72087-73361 | |||
| 1494 | CABTAS010000003.1 | GCA902482805_00696 | gene | open | 73391-73636 | |||
| 1495 | CABTAS010000003.1 | GCA902482805_00697 | gene | open | 73732-74736 | |||
| 1496 | CABTAS010000003.1 | GCA902482805_00698 | gene | open | 74733-75674 | |||
| 1497 | CABTAS010000003.1 | GCA902482805_00699 | gene | open | 75819-76745 | |||
| 1498 | CABTAS010000003.1 | GCA902482805_00700 | gene | open | 76742-77089 | |||
| 1499 | CABTAS010000003.1 | GCA902482805_00701 | gene | open | 77094-78377 | pucR | ||
| 1500 | CABTAS010000003.1 | GCA902482805_00702 | gene | open | 78730-79134 |

