HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Veillonella rogosae (GCA_902483375.1)

Select a Genome:
BAKTA Annotations for GCA_902483375.1
Genome Selected: Veillonella rogosae
ContigsBases CDSrRNA tmRNAtRNA
19 2094981 1934 2 1 43
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3994 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:3]    |    Number of Records Found: 3994 [8 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1001 CABTCX010000002.1 GCA902483375_00545 CDS open 114738-116204 _na     488_aa citT Citrate carrier
1002 CABTCX010000002.1 GCA902483375_00546 CDS open 116456-116860 _na     134_aa bTP Bacterial Transmembrane Pair family
1003 CABTCX010000002.1 GCA902483375_00547 CDS open 116919-117422 _na     167_aa ECF transporter S component
1004 CABTCX010000002.1 GCA902483375_00548 CDS open 117574-118707 _na     377_aa metC Cys/Met metabolism PLP-dependent enzyme
1005 CABTCX010000002.1 GCA902483375_00549 CDS open 118718-119902 _na     394_aa malY cysteine-S-conjugate beta-lyase
1006 CABTCX010000002.1 GCA902483375_00550 CDS open 119982-120941 _na     319_aa metA homoserine O-succinyltransferase
1007 CABTCX010000002.1 GCA902483375_00551 CDS open 121219-122490 _na     423_aa mET17 Methionine gamma-lyase
1008 CABTCX010000002.1 GCA902483375_00552 CDS open 122941-123528 _na     195_aa ykoI Peptidase propeptide and YPEB domain protein
1009 CABTCX010000002.1 GCA902483375_00553 CDS open 123892-124458 _na     188_aa bioY Biotin transporter
1010 CABTCX010000002.1 GCA902483375_00554 CDS open 124642-125406 _na     254_aa ycgQ TIGR03943 family putative permease subunit
1011 CABTCX010000002.1 GCA902483375_00555 CDS open 125482-127017 _na     511_aa Permease
1012 CABTCX010000002.1 GCA902483375_00556 CDS open 127014-127883 _na     289_aa yejR Metal chaperone YciC
1013 CABTCX010000002.1 GCA902483375_00557 CDS open 128228-129676 _na     482_aa pepD2 Cytosol non-specific dipeptidase
1014 CABTCX010000002.1 GCA902483375_00558 CDS open 129991-131442 _na     483_aa pncB nicotinate phosphoribosyltransferase
1015 CABTCX010000002.1 GCA902483375_00559 CDS open 131451-132218 _na     255_aa NAD(+) synthase
1016 CABTCX010000002.1 GCA902483375_00560 CDS open 132257-133234 _na     325_aa ansA L-asparaginase
1017 CABTCX010000002.1 GCA902483375_00561 CDS open 133564-134340 _na     258_aa cbiZ Adenosylcobinamide amidohydrolase
1018 CABTCX010000002.1 GCA902483375_00562 CDS open 134505-135434 _na     309_aa Small-conductance mechanosensitive channel
1019 CABTCX010000002.1 GCA902483375_00563 CDS open 135458-136315 _na     285_aa dacB D-alanyl-D-alanine carboxypeptidase DacB
1020 CABTCX010000002.1 GCA902483375_00564 CDS open 136342-136932 _na     196_aa yfbR 5'-deoxynucleotidase
1021 CABTCX010000002.1 GCA902483375_00565 CDS open 137193-138089 _na     298_aa DUF1730 domain-containing protein
1022 CABTCX010000002.1 GCA902483375_00566 CDS open 138028-138201 _na     57_aa hypothetical protein
1023 CABTCX010000002.1 GCA902483375_00567 CDS open 138244-139026 _na     260_aa cutB Nicotinate dehydrogenase FAD-subunit
1024 CABTCX010000002.1 GCA902483375_00568 CDS open 139026-139478 _na     150_aa cutS 2Fe-2S ferredoxin-type domain-containing protein
1025 CABTCX010000002.1 GCA902483375_00569 CDS open 139481-141775 _na     764_aa coxL 4-hydroxybenzoyl-CoA reductase subunit alpha
1026 CABTCX010000002.1 GCA902483375_00570 CDS open 141818-142576 _na     252_aa yqeC selenium cofactor biosynthesis protein YqeC
1027 CABTCX010000002.1 GCA902483375_00571 CDS open 142583-143305 _na     240_aa Nucleotidyltransferase family protein
1028 CABTCX010000002.1 GCA902483375_00572 CDS open 143302-144114 _na     270_aa yqeB selenium-dependent molybdenum cofactor biosynthesis protein YqeB
1029 CABTCX010000002.1 GCA902483375_00573 CDS open 144098-144826 _na     242_aa xdhC Putative xanthine dehydrogenase subunit A
1030 CABTCX010000002.1 GCA902483375_00574 CDS open 144816-145130 _na     104_aa xdhC Putative xanthine dehydrogenase accessory factor
1031 CABTCX010000002.1 GCA902483375_00575 CDS open 145320-146132 _na     270_aa cdaA diadenylate cyclase CdaA
1032 CABTCX010000002.1 GCA902483375_00576 CDS open 146129-147049 _na     306_aa ybbR YbbR-like domain-containing protein
1033 CABTCX010000002.1 GCA902483375_00577 CDS open 147066-147224 _na     52_aa hypothetical protein
1034 CABTCX010000002.1 GCA902483375_00578 CDS open 147325-148923 _na     532_aa FAD-dependent protein C-terminal domain-containing protein
1035 CABTCX010000002.1 GCA902483375_00579 CDS open 149090-150445 _na     451_aa glmM phosphoglucosamine mutase
1036 CABTCX010000002.1 GCA902483375_00580 CDS open 150790-151458 _na     222_aa racX Aspartate racemase
1037 CABTCX010000002.1 GCA902483375_00581 CDS open 151702-152814 _na     370_aa Tetratricopeptide repeat protein
1038 CABTCX010000002.1 GCA902483375_00582 CDS open 152936-154501 _na     521_aa Tat pathway signal sequence domain protein
1039 CABTCX010000002.1 GCA902483375_00583 CDS open 154966-156798 _na     610_aa glmS glutamine--fructose-6-phosphate transaminase (isomerizing)
1040 CABTCX010000002.1 GCA902483375_00584 CDS open 156857-157843 _na     328_aa trpS tryptophan--tRNA ligase
1041 CABTCX010000002.1 GCA902483375_00585 CDS open 157880-158365 _na     161_aa YcxB-like protein domain-containing protein
1042 CABTCX010000002.1 GCA902483375_00586 CDS open 158479-159291 _na     270_aa hisJ Solute-binding protein family 3/N-terminal domain-containing protein
1043 CABTCX010000002.1 GCA902483375_00587 CDS open 159415-160071 _na     218_aa glnP Glutamine transport system permease protein GlnP
1044 CABTCX010000002.1 GCA902483375_00588 CDS open 160119-160874 _na     251_aa glnQ ABC transporter%2C ATP-binding protein
1045 CABTCX010000002.1 GCA902483375_00589 CDS open 160883-162154 _na     423_aa hypothetical protein
1046 CABTCX010000002.1 GCA902483375_00590 CDS open 162326-162772 _na     148_aa uspA UspA domain-containing protein
1047 CABTCX010000002.1 GCA902483375_00591 CDS open 162936-163256 _na     106_aa arsR Transcriptional regulator%2C ArsR family
1048 CABTCX010000002.1 GCA902483375_00592 CDS open 163333-164322 _na     329_aa yfdV Transporter
1049 CABTCX010000002.1 GCA902483375_00593 CDS open 164701-165489 _na     262_aa modA molybdate ABC transporter substrate-binding protein
1050 CABTCX010000002.1 GCA902483375_00594 CDS open 165509-166255 _na     248_aa modB molybdate ABC transporter permease subunit
1051 CABTCX010000002.1 GCA902483375_00595 CDS open 166264-166893 _na     209_aa potA Fe(3+) ions import ATP-binding protein FbpC
1052 CABTCX010000002.1 GCA902483375_00596 CDS open 167107-168303 _na     398_aa codB Hydroxymethylpyrimidine transporter CytX
1053 CABTCX010000002.1 GCA902483375_00597 CDS open 168701-169180 _na     159_aa thiW energy coupling factor transporter S component ThiW
1054 CABTCX010000002.1 GCA902483375_00598 CDS open 169180-170022 _na     280_aa thiD Hydroxymethylpyrimidine/phosphomethylpyrimidine kinase
1055 CABTCX010000002.1 GCA902483375_00599 CDS open 170027-171544 _na     505_aa thiM hydroxyethylthiazole kinase
1056 CABTCX010000002.1 GCA902483375_00600 CDS open 171736-172281 _na     181_aa rbr rubrerythrin
1057 CABTCX010000002.1 GCA902483375_00601 CDS open 173085-173288 _na     67_aa DUF951 domain-containing protein
1058 CABTCX010000002.1 GCA902483375_00602 CDS open 173298-174329 _na     343_aa selD selenide%2C water dikinase SelD
1059 CABTCX010000002.1 GCA902483375_00603 CDS open 174492-175091 _na     199_aa yedF sulfurtransferase-like selenium metabolism protein YedF
1060 CABTCX010000002.1 GCA902483375_00604 CDS open 175146-175460 _na     104_aa Putative Se/S carrier protein-like domain-containing protein
1061 CABTCX010000002.1 GCA902483375_00605 CDS open 175571-176281 _na     236_aa nfnB NAD(P)H nitroreductase YfkO
1062 CABTCX010000002.1 GCA902483375_00606 CDS open 176434-176673 _na     79_aa yeaQ General stress protein GlsB
1063 CABTCX010000002.1 GCA902483375_00607 CDS open 176739-176975 _na     78_aa csbD CsbD family protein
1064 CABTCX010000002.1 GCA902483375_00608 CDS open 177056-178162 _na     368_aa ychF redox-regulated ATPase YchF
1065 CABTCX010000002.1 GCA902483375_00609 CDS open 178615-179586 _na     323_aa diaminopimelate dehydrogenase
1066 CABTCX010000002.1 GCA902483375_00610 CDS open 179870-181099 _na     409_aa aspB LL-diaminopimelate aminotransferase
1067 CABTCX010000002.1 GCA902483375_00611 CDS open 181266-182486 _na     406_aa Bcr/CflA family efflux transporter
1068 CABTCX010000002.1 GCA902483375_00612 CDS open 182628-182912 _na     94_aa rpsF 30S ribosomal protein S6
1069 CABTCX010000002.1 GCA902483375_00613 CDS open 182932-183330 _na     132_aa ssb Single-stranded DNA-binding protein
1070 CABTCX010000002.1 GCA902483375_00614 CDS open 183370-183600 _na     76_aa rpsR 30S ribosomal protein S18
1071 CABTCX010000002.1 GCA902483375_00615 CDS open 184018-184881 _na     287_aa modA Tat pathway signal sequence domain protein
1072 CABTCX010000002.1 GCA902483375_00616 CDS open 184874-185680 _na     268_aa napH 4Fe-4S binding protein
1073 CABTCX010000002.1 GCA902483375_00617 CDS open 185683-186513 _na     276_aa nifB nitrogenase cofactor biosynthesis protein NifB
1074 CABTCX010000002.1 GCA902483375_00618 CDS open 186562-187719 _na     385_aa cysteine desulfurase
1075 CABTCX010000002.1 GCA902483375_00619 CDS open 187840-188901 _na     353_aa yedE YedE family putative selenium transporter
1076 CABTCX010000002.1 GCA902483375_00620 CDS open 188919-189167 _na     82_aa Putative Se/S carrier protein-like domain-containing protein
1077 CABTCX010000002.1 GCA902483375_00621 CDS open 189608-190318 _na     236_aa Carboxymuconolactone decarboxylase family protein
1078 CABTCX010000002.1 GCA902483375_00622 CDS open 190481-191140 _na     219_aa trmB tRNA (guanosine(46)-N7)-methyltransferase TrmB
1079 CABTCX010000002.1 GCA902483375_00623 CDS open 191142-192485 _na     447_aa ftsW putative peptidoglycan glycosyltransferase FtsW
1080 CABTCX010000002.1 GCA902483375_00624 CDS open 192596-193879 _na     427_aa uraA uracil permease
1081 CABTCX010000002.1 GCA902483375_00625 CDS open 194094-194558 _na     154_aa nfeD NfeD-like C-terminal domain-containing protein
1082 CABTCX010000002.1 GCA902483375_00626 CDS open 194595-195551 _na     318_aa floA flotillin-like protein FloA
1083 CABTCX010000002.1 GCA902483375_00627 CDS open 195560-196162 _na     200_aa traG Conjugal transfer protein TraG
1084 CABTCX010000002.1 GCA902483375_00628 CDS open 196410-197141 _na     243_aa Sortase
1085 CABTCX010000002.1 GCA902483375_00629 CDS open 197196-198134 _na     312_aa Membrane transporter protein
1086 CABTCX010000002.1 GCA902483375_00630 CDS open 198280-198873 _na     197_aa Uracil-DNA glycosylase family protein
1087 CABTCX010000002.1 GCA902483375_00631 CDS open 199148-200398 _na     416_aa Major facilitator superfamily (MFS) profile domain-containing protein
1088 CABTCX010000002.1 GCA902483375_00632 CDS open 200583-201806 _na     407_aa pepT peptidase T
1089 CABTCX010000002.1 GCA902483375_00633 CDS open 202052-203986 _na     644_aa oPT OPT family oligopeptide transporter
1090 CABTCX010000002.1 GCA902483375_00634 CDS open 204116-204277 _na     53_aa hypothetical protein
1091 CABTCX010000002.1 GCA902483375_00635 CDS open 204267-205052 _na     261_aa hisJ Glutamine-binding periplasmic protein
1092 CABTCX010000002.1 GCA902483375_00636 CDS open 205126-206151 _na     341_aa mmuM homocysteine S-methyltransferase
1093 CABTCX010000002.1 GCA902483375_00638 CDS open 206491-207726 _na     411_aa norV Flavodoxin-like domain-containing protein
1094 CABTCX010000002.1 GCA902483375_00639 CDS open 207890-211630 _na     1246_aa purL2 phosphoribosylformylglycinamidine synthase
1095 CABTCX010000002.1 GCA902483375_00640 CDS open 211899-212804 _na     301_aa lysR LysR substrate binding domain protein
1096 CABTCX010000002.1 GCA902483375_00641 CDS open 213047-213622 _na     191_aa apt xanthine phosphoribosyltransferase
1097 CABTCX010000002.1 GCA902483375_00642 CDS open 213649-214095 _na     148_aa Bacterial sensory transduction regulator
1098 CABTCX010000002.1 GCA902483375_00643 CDS open 214107-214547 _na     146_aa Bacterial sensory transduction regulator
1099 CABTCX010000002.1 GCA902483375_00644 CDS open 214837-214953 _na     38_aa hypothetical protein
1100 CABTCX010000002.1 GCA902483375_00645 CDS open 214980-215471 _na     163_aa purE N5-carboxyaminoimidazole ribonucleotide mutase
1101 CABTCX010000002.1 GCA902483375_00646 CDS open 215538-216266 _na     242_aa purC phosphoribosylaminoimidazolesuccinocarboxamide synthase
1102 CABTCX010000002.1 GCA902483375_00647 CDS open 216276-217694 _na     472_aa purF amidophosphoribosyltransferase
1103 CABTCX010000002.1 GCA902483375_00648 CDS open 217681-218742 _na     353_aa Phosphoribosylformylglycinamidine cyclo-ligase
1104 CABTCX010000002.1 GCA902483375_00649 CDS open 218735-219352 _na     205_aa purN phosphoribosylglycinamide formyltransferase
1105 CABTCX010000002.1 GCA902483375_00650 CDS open 219377-220906 _na     509_aa purH bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase
1106 CABTCX010000002.1 GCA902483375_00651 CDS open 221038-222300 _na     420_aa purD Phosphoribosylamine--glycine ligase
1107 CABTCX010000002.1 GCA902483375_00652 CDS open 222627-223769 _na     380_aa isochorismate synthase
1108 CABTCX010000002.1 GCA902483375_00653 CDS open 223810-225576 _na     588_aa menD 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase
1109 CABTCX010000002.1 GCA902483375_00654 CDS open 225573-226433 _na     286_aa menH 2-succinyl-6-hydroxy-2%2C4-cyclohexadiene-1-carboxylate synthase
1110 CABTCX010000002.1 GCA902483375_00655 CDS open 226438-227280 _na     280_aa menB 1%2C4-dihydroxy-2-naphthoyl-CoA synthase
1111 CABTCX010000002.1 GCA902483375_00656 CDS open 227439-228824 _na     461_aa menE o-succinylbenzoate--CoA ligase
1112 CABTCX010000002.1 GCA902483375_00657 CDS open 228832-229983 _na     383_aa menC o-succinylbenzoate synthase
1113 CABTCX010000002.1 GCA902483375_00658 CDS open 229980-230357 _na     125_aa Thioesterase domain-containing protein
1114 CABTCX010000002.1 GCA902483375_00659 CDS open 230525-231166 _na     213_aa DUF2939 domain-containing protein
1115 CABTCX010000002.1 GCA902483375_00663 CDS open 231841-232470 _na     209_aa DUF4178 domain-containing protein
1116 CABTCX010000002.1 GCA902483375_00664 CDS open 232566-233936 _na     456_aa pgtP phosphoglycerate transporter PgtP
1117 CABTCX010000002.1 GCA902483375_00665 CDS open 234242-235132 _na     296_aa pstS Phosphate-binding protein PstS
1118 CABTCX010000002.1 GCA902483375_00666 CDS open 235190-236071 _na     293_aa pstC phosphate ABC transporter permease subunit PstC
1119 CABTCX010000002.1 GCA902483375_00667 CDS open 236058-236876 _na     272_aa ABC transporter permease subunit
1120 CABTCX010000002.1 GCA902483375_00668 CDS open 236876-237619 _na     247_aa pstB Phosphate import ATP-binding protein PstB
1121 CABTCX010000002.1 GCA902483375_00669 CDS open 238004-238225 _na     73_aa relB type II toxin-antitoxin system RelB family antitoxin
1122 CABTCX010000002.1 GCA902483375_00670 CDS open 238215-238481 _na     88_aa Type II toxin-antitoxin system RelE/ParE family toxin
1123 CABTCX010000002.1 GCA902483375_00671 CDS open 238492-238704 _na     70_aa hypothetical protein
1124 CABTCX010000002.1 GCA902483375_00672 CDS open 238640-238837 _na     65_aa hypothetical protein
1125 CABTCX010000002.1 GCA902483375_00673 CDS open 238888-239679 _na     263_aa nit1 CN hydrolase domain-containing protein
1126 CABTCX010000002.1 GCA902483375_00674 CDS open 239917-240720 _na     267_aa pgaB Poly-beta-1%2C6-N-acetyl-D-glucosamine N-deacetylase
1127 CABTCX010000002.1 GCA902483375_00675 CDS open 240765-241670 _na     301_aa nAGPA Phosphodiester glycosidase domain-containing protein
1128 CABTCX010000002.1 GCA902483375_00676 CDS open 241679-242626 _na     315_aa Dipeptidylpeptidase IV N-terminal domain-containing protein
1129 CABTCX010000002.1 GCA902483375_00677 CDS open 242695-243867 _na     390_aa Lipopolysaccharide heptosyltransferase
1130 CABTCX010000002.1 GCA902483375_00678 CDS open 243854-244180 _na     108_aa hypothetical protein
1131 CABTCX010000002.1 GCA902483375_00679 CDS open 244724-246076 _na     450_aa oadA1 Pyruvate carboxyltransferase domain-containing protein
1132 CABTCX010000002.1 GCA902483375_00681 CDS open 246254-246703 _na     149_aa tnpA IS200/IS605 family transposase
1133 CABTCX010000002.1 GCA902483375_00682 CDS open 247177-248517 _na     446_aa baeS histidine kinase
1134 CABTCX010000002.1 GCA902483375_00683 CDS open 248514-249203 _na     229_aa ompR Sensory transduction protein regX3
1135 CABTCX010000002.1 GCA902483375_00684 CDS open 249786-250883 _na     365_aa degQ Serine protease Do-like HtrB
1136 CABTCX010000002.1 GCA902483375_00685 CDS open 251044-251547 _na     167_aa padR Transcriptional regulator%2C PadR family
1137 CABTCX010000002.1 GCA902483375_00686 CDS open 251540-252094 _na     184_aa DUF1700 domain-containing protein
1138 CABTCX010000002.1 GCA902483375_00687 CDS open 252139-252615 _na     158_aa Acid shock protein
1139 CABTCX010000002.1 GCA902483375_00688 CDS open 252789-253118 _na     109_aa padR Transcription regulator PadR N-terminal domain-containing protein
1140 CABTCX010000002.1 GCA902483375_00689 CDS open 253105-253680 _na     191_aa DUF1700 domain-containing protein
1141 CABTCX010000002.1 GCA902483375_00690 CDS open 253690-254076 _na     128_aa Transcriptional regulator
1142 CABTCX010000002.1 GCA902483375_00691 CDS open 254277-254864 _na     195_aa pyrE orotate phosphoribosyltransferase
1143 CABTCX010000002.1 GCA902483375_00692 CDS open 254861-255580 _na     239_aa pyrF orotidine-5'-phosphate decarboxylase
1144 CABTCX010000002.1 GCA902483375_00693 CDS open 255769-256398 _na     209_aa dnaQ DNA polymerase III polC-type
1145 CABTCX010000002.1 GCA902483375_00694 CDS open 256413-257075 _na     220_aa deoC deoxyribose-phosphate aldolase
1146 CABTCX010000002.1 GCA902483375_00695 CDS open 257129-258430 _na     433_aa thymidine phosphorylase
1147 CABTCX010000002.1 GCA902483375_00696 CDS open 258441-258836 _na     131_aa cytidine deaminase
1148 CABTCX010000002.1 GCA902483375_00697 CDS open 258894-259718 _na     274_aa nlpA Lipoprotein
1149 CABTCX010000002.1 GCA902483375_00698 CDS open 259937-260833 _na     298_aa menA 1%2C4-dihydroxy-2-naphthoate octaprenyltransferase
1150 CABTCX010000002.1 GCA902483375_00699 CDS open 261044-261988 _na     314_aa DUF5105 domain-containing protein
1151 CABTCX010000002.1 GCA902483375_00700 CDS open 261990-262781 _na     263_aa hypothetical protein
1152 CABTCX010000002.1 GCA902483375_00701 CDS open 262897-263268 _na     123_aa ridA Putative endoribonuclease L-PSP
1153 CABTCX010000002.1 GCA902483375_00702 CDS open 263270-264517 _na     415_aa cdsB UPF0597 protein VEIDISOL_01963
1154 CABTCX010000002.1 GCA902483375_00703 CDS open 264672-265304 _na     210_aa hypothetical protein
1155 CABTCX010000002.1 GCA902483375_00704 CDS open 265373-266560 _na     395_aa narK Major facilitator superfamily (MFS) profile domain-containing protein
1156 CABTCX010000002.1 GCA902483375_00705 CDS open 266876-267106 _na     76_aa hypothetical protein
1157 CABTCX010000002.1 GCA902483375_00707 CDS open 268008-268703 _na     231_aa yadS Glycine transporter domain-containing protein
1158 CABTCX010000002.1 GCA902483375_00708 CDS open 268847-270664 _na     605_aa DUF4127 domain-containing protein
1159 CABTCX010000002.1 GCA902483375_00709 CDS open 270681-271796 _na     371_aa Acyltransferase 3 domain-containing protein
1160 CABTCX010000002.1 GCA902483375_00710 CDS open 271978-272835 _na     285_aa ilvE D-alanine aminotransferase
1161 CABTCX010000002.1 GCA902483375_00711 CDS open 272857-273939 _na     360_aa metN Methionine import ATP-binding protein MetN
1162 CABTCX010000002.1 GCA902483375_00712 CDS open 273920-274573 _na     217_aa metP D-methionine transport system permease protein metI
1163 CABTCX010000002.1 GCA902483375_00713 CDS open 274583-274879 _na     98_aa yerC TrpR-like protein YerC/YecD
1164 CABTCX010000002.1 GCA902483375_00714 CDS open 274945-275739 _na     264_aa tauE putative membrane transporter protein
1165 CABTCX010000002.1 GCA902483375_00715 CDS open 275751-276518 _na     255_aa fabG 3-oxoacyl-[acyl-carrier-protein] reductase FabG
1166 CABTCX010000002.1 GCA902483375_00716 CDS open 276656-277507 _na     283_aa Late embryogenesis abundant protein
1167 CABTCX010000002.1 GCA902483375_00717 CDS open 277527-277871 _na     114_aa ykvA DUF1232 domain-containing protein
1168 CABTCX010000002.1 GCA902483375_00718 CDS open 277988-278407 _na     139_aa fadM Acyl-CoA thioester hydrolase YbgC
1169 CABTCX010000002.1 GCA902483375_00719 CDS open 278400-279203 _na     267_aa murI glutamate racemase
1170 CABTCX010000002.1 GCA902483375_00720 CDS open 279216-279755 _na     179_aa DUF58 domain-containing protein
1171 CABTCX010000002.1 GCA902483375_00721 CDS open 279768-280418 _na     216_aa Coenzyme F420:L-glutamate ligase-like domain-containing protein
1172 CABTCX010000002.1 GCA902483375_00722 CDS open 280484-282214 _na     576_aa Hydantoinase/oxoprolinase
1173 CABTCX010000002.1 GCA902483375_00723 CDS open 282204-283634 _na     476_aa acuC Histone deacetylase-like amidohydrolase
1174 CABTCX010000002.1 GCA902483375_00724 CDS open 283804-284559 _na     251_aa rph ribonuclease PH
1175 CABTCX010000002.1 GCA902483375_00725 CDS open 284561-285136 _na     191_aa rdgB XTP/dITP diphosphatase
1176 CABTCX010000002.1 GCA902483375_00726 CDS open 285202-285699 _na     165_aa yfcE Phosphoesterase
1177 CABTCX010000002.1 GCA902483375_00727 CDS open 285776-286558 _na     260_aa speD adenosylmethionine decarboxylase
1178 CABTCX010000002.1 GCA902483375_00728 CDS open 286827-288032 _na     401_aa sfcA NAD-dependent malic enzyme
1179 CABTCX010000002.1 GCA902483375_00732 CDS open 288785-289951 _na     388_aa hsdR type I restriction enzyme HsdR N-terminal domain-containing protein
1180 CABTCX010000002.1 GCA902483375_00733 CDS open 290015-290500 _na     161_aa hsdR type I restriction enzyme HsdR N-terminal domain-containing protein
1181 CABTCX010000002.1 GCA902483375_00734 CDS open 290537-291208 _na     223_aa hsdR type I restriction enzyme HsdR N-terminal domain-containing protein
1182 CABTCX010000002.1 GCA902483375_00735 CDS open 291502-293688 _na     728_aa clpA Putative ATP-dependent Clp protease ATP-binding subunit
1183 CABTCX010000002.1 GCA902483375_00736 CDS open 293875-294648 _na     257_aa 5-oxoprolinase subunit A
1184 CABTCX010000002.1 GCA902483375_00737 CDS open 294686-295882 _na     398_aa mntH Metal ion (Mn2+/Fe2+) transporter (Nramp) family metal ion transporter
1185 CABTCX010000002.1 GCA902483375_00738 CDS open 295957-296700 _na     247_aa pxpB 5-oxoprolinase subunit PxpB
1186 CABTCX010000002.1 GCA902483375_00739 CDS open 296687-297721 _na     344_aa Biotin-dependent carboxyltransferase family protein
1187 CABTCX010000002.1 GCA902483375_00740 CDS open 298515-298709 _na     64_aa hypothetical protein
1188 CABTCX010000002.1 GCA902483375_00741 CDS open 299670-299909 _na     79_aa hypothetical protein
1189 CABTCX010000002.1 GCA902483375_00742 CDS open 299943-300194 _na     83_aa hypothetical protein
1190 CABTCX010000002.1 GCA902483375_00743 CDS open 300249-300596 _na     115_aa hypothetical protein
1191 CABTCX010000002.1 GCA902483375_00446 gene open 303-959
1192 CABTCX010000002.1 GCA902483375_00447 gene open 1118-2848
1193 CABTCX010000002.1 GCA902483375_00448 gene open 2858-3172
1194 CABTCX010000002.1 GCA902483375_00449 gene open 3175-3645
1195 CABTCX010000002.1 GCA902483375_00450 gene open 3638-5212
1196 CABTCX010000002.1 GCA902483375_00451 gene open 5319-5783
1197 CABTCX010000002.1 GCA902483375_00452 gene open 5961-6488
1198 CABTCX010000002.1 GCA902483375_00453 gene open 6639-7565
1199 CABTCX010000002.1 GCA902483375_00454 gene open 7942-10776 ileS
1200 CABTCX010000002.1 GCA902483375_00455 gene open 10817-11080
1201 CABTCX010000002.1 GCA902483375_00456 gene open 11286-13658
1202 CABTCX010000002.1 GCA902483375_00457 gene open 13918-14700 hisJ
1203 CABTCX010000002.1 GCA902483375_00458 gene open 14942-16123 abgB
1204 CABTCX010000002.1 GCA902483375_00459 gene open 16116-16442
1205 CABTCX010000002.1 GCA902483375_00460 gene open 16610-17770
1206 CABTCX010000002.1 GCA902483375_00461 gene open 18009-18236
1207 CABTCX010000002.1 GCA902483375_00462 gene open 18496-20031 guaA
1208 CABTCX010000002.1 GCA902483375_00463 gene open 20340-21872
1209 CABTCX010000002.1 GCA902483375_00464 gene open 21995-23071
1210 CABTCX010000002.1 GCA902483375_00465 gene open 23288-24481
1211 CABTCX010000002.1 GCA902483375_00466 gene open 24524-25810
1212 CABTCX010000002.1 GCA902483375_00467 gene open 25813-28953
1213 CABTCX010000002.1 GCA902483375_00468 gene open 29090-30832
1214 CABTCX010000002.1 GCA902483375_00469 gene open 31009-31959
1215 CABTCX010000002.1 GCA902483375_00470 gene open 32197-32613
1216 CABTCX010000002.1 GCA902483375_00471 gene open 32615-32938
1217 CABTCX010000002.1 GCA902483375_00472 gene open 32991-33410 yhbS
1218 CABTCX010000002.1 GCA902483375_00473 gene open 33546-34034
1219 CABTCX010000002.1 GCA902483375_00474 gene open 34651-35823 fepB
1220 CABTCX010000002.1 GCA902483375_00475 gene open 35840-36889 fepD
1221 CABTCX010000002.1 GCA902483375_00476 gene open 36886-37662 fepC
1222 CABTCX010000002.1 GCA902483375_00477 gene open 37789-38889 znuB
1223 CABTCX010000002.1 GCA902483375_00478 gene open 38886-39851 znuB
1224 CABTCX010000002.1 GCA902483375_00479 gene open 39848-40579 znuC
1225 CABTCX010000002.1 GCA902483375_00480 gene open 40743-41684 znuA
1226 CABTCX010000002.1 GCA902483375_00481 gene open 41822-41917
1227 CABTCX010000002.1 GCA902483375_00482 gene open 42095-42472 tonB
1228 CABTCX010000002.1 GCA902483375_00483 gene open 42483-42824 tonB
1229 CABTCX010000002.1 GCA902483375_00484 gene open 42975-44588
1230 CABTCX010000002.1 GCA902483375_00485 gene open 44934-46562 pckA
1231 CABTCX010000002.1 GCA902483375_00486 gene open 46827-47732
1232 CABTCX010000002.1 GCA902483375_00487 gene open 48124-50319 cooS
1233 CABTCX010000002.1 GCA902483375_00488 gene open 50490-51275 ulaG
1234 CABTCX010000002.1 GCA902483375_00489 gene open 51437-52036 acrR
1235 CABTCX010000002.1 GCA902483375_00490 gene open 52494-52856
1236 CABTCX010000002.1 GCA902483375_00491 gene open 52980-54008 bioB
1237 CABTCX010000002.1 GCA902483375_00492 gene open 54349-55620 yhaO
1238 CABTCX010000002.1 GCA902483375_00493 gene open 55607-58492 yhaN
1239 CABTCX010000002.1 GCA902483375_00494 gene open 58630-59673 hemE
1240 CABTCX010000002.1 GCA902483375_00495 gene open 59636-60577 hemH
1241 CABTCX010000002.1 GCA902483375_00496 gene open 60574-62223 hemG
1242 CABTCX010000002.1 GCA902483375_00497 gene open 62343-63074 hemQ
1243 CABTCX010000002.1 GCA902483375_00498 gene open 63667-65004 narK
1244 CABTCX010000002.1 GCA902483375_00499 gene open 65323-66048 crp
1245 CABTCX010000002.1 GCA902483375_00500 gene open 66065-69796 narG
1246 CABTCX010000002.1 GCA902483375_00501 gene open 69786-71213 narH
1247 CABTCX010000002.1 GCA902483375_00502 gene open 71213-71737 narJ
1248 CABTCX010000002.1 GCA902483375_00503 gene open 71734-72405 narI
1249 CABTCX010000002.1 GCA902483375_00504 gene open 72741-73343
1250 CABTCX010000002.1 GCA902483375_00505 gene open 73588-74859
1251 CABTCX010000002.1 GCA902483375_00506 gene open 75005-75610
1252 CABTCX010000002.1 GCA902483375_00507 gene open 75799-77007
1253 CABTCX010000002.1 GCA902483375_00508 gene open 77208-78092 lysR
1254 CABTCX010000002.1 GCA902483375_00509 gene open 78160-78774 lysE
1255 CABTCX010000002.1 GCA902483375_00510 gene open 78909-79949 yeiH
1256 CABTCX010000002.1 GCA902483375_00511 gene open 80296-80841 cynT
1257 CABTCX010000002.1 GCA902483375_00512 gene open 81391-82143 bioD
1258 CABTCX010000002.1 GCA902483375_00513 gene open 82300-83688 bioA
1259 CABTCX010000002.1 GCA902483375_00514 gene open 83939-85279 dcuA
1260 CABTCX010000002.1 GCA902483375_00515 gene open 85372-85782
1261 CABTCX010000002.1 GCA902483375_00516 gene open 85940-86758 znuB
1262 CABTCX010000002.1 GCA902483375_00517 gene open 86751-87542 znuC
1263 CABTCX010000002.1 GCA902483375_00518 gene open 87690-88595
1264 CABTCX010000002.1 GCA902483375_00519 gene open 88960-89247 tnpA
1265 CABTCX010000002.1 GCA902483375_00520 gene open 89581-90150
1266 CABTCX010000002.1 GCA902483375_00521 gene open 90322-91038
1267 CABTCX010000002.1 GCA902483375_00522 gene open 91090-91761
1268 CABTCX010000002.1 GCA902483375_00523 gene open 91944-92627
1269 CABTCX010000002.1 GCA902483375_00524 gene open 92791-93420
1270 CABTCX010000002.1 GCA902483375_00525 gene open 93571-94179
1271 CABTCX010000002.1 GCA902483375_00526 gene open 94228-95124 fliB
1272 CABTCX010000002.1 GCA902483375_00527 gene open 95284-95847
1273 CABTCX010000002.1 GCA902483375_00528 gene open 96363-96905
1274 CABTCX010000002.1 GCA902483375_00529 gene open 97064-97342
1275 CABTCX010000002.1 GCA902483375_00530 gene open 97837-98949 alr
1276 CABTCX010000002.1 GCA902483375_00531 gene open 99247-100197 ldhA
1277 CABTCX010000002.1 GCA902483375_00532 gene open 100212-100775 acrR
1278 CABTCX010000002.1 GCA902483375_00533 gene open 100976-102871 zntA
1279 CABTCX010000002.1 GCA902483375_00534 gene open 102991-103767 pflA
1280 CABTCX010000002.1 GCA902483375_00535 gene open 103780-104019 grcA3
1281 CABTCX010000002.1 GCA902483375_00536 gene open 104095-106212 pflB
1282 CABTCX010000002.1 GCA902483375_00537 gene open 106695-107561 eamA
1283 CABTCX010000002.1 GCA902483375_00538 gene open 107814-108836 abcC
1284 CABTCX010000002.1 GCA902483375_00539 gene open 108836-109507 metP
1285 CABTCX010000002.1 GCA902483375_00540 gene open 109562-110386 metQ
1286 CABTCX010000002.1 GCA902483375_00541 gene open 110449-110766
1287 CABTCX010000002.1 GCA902483375_00542 gene open 110714-110908
1288 CABTCX010000002.1 GCA902483375_00543 gene open 110884-112707
1289 CABTCX010000002.1 GCA902483375_00544 gene open 112704-114527
1290 CABTCX010000002.1 GCA902483375_00545 gene open 114738-116204 citT
1291 CABTCX010000002.1 GCA902483375_00546 gene open 116456-116860 bTP
1292 CABTCX010000002.1 GCA902483375_00547 gene open 116919-117422
1293 CABTCX010000002.1 GCA902483375_00548 gene open 117574-118707 metC
1294 CABTCX010000002.1 GCA902483375_00549 gene open 118718-119902 malY
1295 CABTCX010000002.1 GCA902483375_00550 gene open 119982-120941 metA
1296 CABTCX010000002.1 GCA902483375_00551 gene open 121219-122490 mET17
1297 CABTCX010000002.1 GCA902483375_00552 gene open 122941-123528 ykoI
1298 CABTCX010000002.1 GCA902483375_00553 gene open 123892-124458 bioY
1299 CABTCX010000002.1 GCA902483375_00554 gene open 124642-125406 ycgQ
1300 CABTCX010000002.1 GCA902483375_00555 gene open 125482-127017
1301 CABTCX010000002.1 GCA902483375_00556 gene open 127014-127883 yejR
1302 CABTCX010000002.1 GCA902483375_00557 gene open 128228-129676 pepD2
1303 CABTCX010000002.1 GCA902483375_00558 gene open 129991-131442 pncB
1304 CABTCX010000002.1 GCA902483375_00559 gene open 131451-132218
1305 CABTCX010000002.1 GCA902483375_00560 gene open 132257-133234 ansA
1306 CABTCX010000002.1 GCA902483375_00561 gene open 133564-134340 cbiZ
1307 CABTCX010000002.1 GCA902483375_00562 gene open 134505-135434
1308 CABTCX010000002.1 GCA902483375_00563 gene open 135458-136315 dacB
1309 CABTCX010000002.1 GCA902483375_00564 gene open 136342-136932 yfbR
1310 CABTCX010000002.1 GCA902483375_00565 gene open 137193-138089
1311 CABTCX010000002.1 GCA902483375_00566 gene open 138028-138201
1312 CABTCX010000002.1 GCA902483375_00567 gene open 138244-139026 cutB
1313 CABTCX010000002.1 GCA902483375_00568 gene open 139026-139478 cutS
1314 CABTCX010000002.1 GCA902483375_00569 gene open 139481-141775 coxL
1315 CABTCX010000002.1 GCA902483375_00570 gene open 141818-142576 yqeC
1316 CABTCX010000002.1 GCA902483375_00571 gene open 142583-143305
1317 CABTCX010000002.1 GCA902483375_00572 gene open 143302-144114 yqeB
1318 CABTCX010000002.1 GCA902483375_00573 gene open 144098-144826 xdhC
1319 CABTCX010000002.1 GCA902483375_00574 gene open 144816-145130 xdhC
1320 CABTCX010000002.1 GCA902483375_00575 gene open 145320-146132 cdaA
1321 CABTCX010000002.1 GCA902483375_00576 gene open 146129-147049 ybbR
1322 CABTCX010000002.1 GCA902483375_00577 gene open 147066-147224
1323 CABTCX010000002.1 GCA902483375_00578 gene open 147325-148923
1324 CABTCX010000002.1 GCA902483375_00579 gene open 149090-150445 glmM
1325 CABTCX010000002.1 GCA902483375_00580 gene open 150790-151458 racX
1326 CABTCX010000002.1 GCA902483375_00581 gene open 151702-152814
1327 CABTCX010000002.1 GCA902483375_00582 gene open 152936-154501
1328 CABTCX010000002.1 GCA902483375_00583 gene open 154966-156798 glmS
1329 CABTCX010000002.1 GCA902483375_00584 gene open 156857-157843 trpS
1330 CABTCX010000002.1 GCA902483375_00585 gene open 157880-158365
1331 CABTCX010000002.1 GCA902483375_00586 gene open 158479-159291 hisJ
1332 CABTCX010000002.1 GCA902483375_00587 gene open 159415-160071 glnP
1333 CABTCX010000002.1 GCA902483375_00588 gene open 160119-160874 glnQ
1334 CABTCX010000002.1 GCA902483375_00589 gene open 160883-162154
1335 CABTCX010000002.1 GCA902483375_00590 gene open 162326-162772 uspA
1336 CABTCX010000002.1 GCA902483375_00591 gene open 162936-163256 arsR
1337 CABTCX010000002.1 GCA902483375_00592 gene open 163333-164322 yfdV
1338 CABTCX010000002.1 GCA902483375_00593 gene open 164701-165489 modA
1339 CABTCX010000002.1 GCA902483375_00594 gene open 165509-166255 modB
1340 CABTCX010000002.1 GCA902483375_00595 gene open 166264-166893 potA
1341 CABTCX010000002.1 GCA902483375_00596 gene open 167107-168303 codB
1342 CABTCX010000002.1 GCA902483375_00597 gene open 168701-169180 thiW
1343 CABTCX010000002.1 GCA902483375_00598 gene open 169180-170022 thiD
1344 CABTCX010000002.1 GCA902483375_00599 gene open 170027-171544 thiM
1345 CABTCX010000002.1 GCA902483375_00600 gene open 171736-172281 rbr
1346 CABTCX010000002.1 GCA902483375_00601 gene open 173085-173288
1347 CABTCX010000002.1 GCA902483375_00602 gene open 173298-174329 selD
1348 CABTCX010000002.1 GCA902483375_00603 gene open 174492-175091 yedF
1349 CABTCX010000002.1 GCA902483375_00604 gene open 175146-175460
1350 CABTCX010000002.1 GCA902483375_00605 gene open 175571-176281 nfnB
1351 CABTCX010000002.1 GCA902483375_00606 gene open 176434-176673 yeaQ
1352 CABTCX010000002.1 GCA902483375_00607 gene open 176739-176975 csbD
1353 CABTCX010000002.1 GCA902483375_00608 gene open 177056-178162 ychF
1354 CABTCX010000002.1 GCA902483375_00609 gene open 178615-179586
1355 CABTCX010000002.1 GCA902483375_00610 gene open 179870-181099 aspB
1356 CABTCX010000002.1 GCA902483375_00611 gene open 181266-182486
1357 CABTCX010000002.1 GCA902483375_00612 gene open 182628-182912 rpsF
1358 CABTCX010000002.1 GCA902483375_00613 gene open 182932-183330 ssb
1359 CABTCX010000002.1 GCA902483375_00614 gene open 183370-183600 rpsR
1360 CABTCX010000002.1 GCA902483375_00615 gene open 184018-184881 modA
1361 CABTCX010000002.1 GCA902483375_00616 gene open 184874-185680 napH
1362 CABTCX010000002.1 GCA902483375_00617 gene open 185683-186513 nifB
1363 CABTCX010000002.1 GCA902483375_00618 gene open 186562-187719
1364 CABTCX010000002.1 GCA902483375_00619 gene open 187840-188901 yedE
1365 CABTCX010000002.1 GCA902483375_00620 gene open 188919-189167
1366 CABTCX010000002.1 GCA902483375_00621 gene open 189608-190318
1367 CABTCX010000002.1 GCA902483375_00622 gene open 190481-191140 trmB
1368 CABTCX010000002.1 GCA902483375_00623 gene open 191142-192485 ftsW
1369 CABTCX010000002.1 GCA902483375_00624 gene open 192596-193879 uraA
1370 CABTCX010000002.1 GCA902483375_00625 gene open 194094-194558 nfeD
1371 CABTCX010000002.1 GCA902483375_00626 gene open 194595-195551 floA
1372 CABTCX010000002.1 GCA902483375_00627 gene open 195560-196162 traG
1373 CABTCX010000002.1 GCA902483375_00628 gene open 196410-197141
1374 CABTCX010000002.1 GCA902483375_00629 gene open 197196-198134
1375 CABTCX010000002.1 GCA902483375_00630 gene open 198280-198873
1376 CABTCX010000002.1 GCA902483375_00631 gene open 199148-200398
1377 CABTCX010000002.1 GCA902483375_00632 gene open 200583-201806 pepT
1378 CABTCX010000002.1 GCA902483375_00633 gene open 202052-203986 oPT
1379 CABTCX010000002.1 GCA902483375_00634 gene open 204116-204277
1380 CABTCX010000002.1 GCA902483375_00635 gene open 204267-205052 hisJ
1381 CABTCX010000002.1 GCA902483375_00636 gene open 205126-206151 mmuM
1382 CABTCX010000002.1 GCA902483375_00638 gene open 206491-207726 norV
1383 CABTCX010000002.1 GCA902483375_00639 gene open 207890-211630 purL2
1384 CABTCX010000002.1 GCA902483375_00640 gene open 211899-212804 lysR
1385 CABTCX010000002.1 GCA902483375_00641 gene open 213047-213622 apt
1386 CABTCX010000002.1 GCA902483375_00642 gene open 213649-214095
1387 CABTCX010000002.1 GCA902483375_00643 gene open 214107-214547
1388 CABTCX010000002.1 GCA902483375_00644 gene open 214837-214953
1389 CABTCX010000002.1 GCA902483375_00645 gene open 214980-215471 purE
1390 CABTCX010000002.1 GCA902483375_00646 gene open 215538-216266 purC
1391 CABTCX010000002.1 GCA902483375_00647 gene open 216276-217694 purF
1392 CABTCX010000002.1 GCA902483375_00648 gene open 217681-218742
1393 CABTCX010000002.1 GCA902483375_00649 gene open 218735-219352 purN
1394 CABTCX010000002.1 GCA902483375_00650 gene open 219377-220906 purH
1395 CABTCX010000002.1 GCA902483375_00651 gene open 221038-222300 purD
1396 CABTCX010000002.1 GCA902483375_00652 gene open 222627-223769
1397 CABTCX010000002.1 GCA902483375_00653 gene open 223810-225576 menD
1398 CABTCX010000002.1 GCA902483375_00654 gene open 225573-226433 menH
1399 CABTCX010000002.1 GCA902483375_00655 gene open 226438-227280 menB
1400 CABTCX010000002.1 GCA902483375_00656 gene open 227439-228824 menE
1401 CABTCX010000002.1 GCA902483375_00657 gene open 228832-229983 menC
1402 CABTCX010000002.1 GCA902483375_00658 gene open 229980-230357
1403 CABTCX010000002.1 GCA902483375_00659 gene open 230525-231166
1404 CABTCX010000002.1 GCA902483375_00663 gene open 231841-232470
1405 CABTCX010000002.1 GCA902483375_00664 gene open 232566-233936 pgtP
1406 CABTCX010000002.1 GCA902483375_00665 gene open 234242-235132 pstS
1407 CABTCX010000002.1 GCA902483375_00666 gene open 235190-236071 pstC
1408 CABTCX010000002.1 GCA902483375_00667 gene open 236058-236876
1409 CABTCX010000002.1 GCA902483375_00668 gene open 236876-237619 pstB
1410 CABTCX010000002.1 GCA902483375_00669 gene open 238004-238225 relB
1411 CABTCX010000002.1 GCA902483375_00670 gene open 238215-238481
1412 CABTCX010000002.1 GCA902483375_00671 gene open 238492-238704
1413 CABTCX010000002.1 GCA902483375_00672 gene open 238640-238837
1414 CABTCX010000002.1 GCA902483375_00673 gene open 238888-239679 nit1
1415 CABTCX010000002.1 GCA902483375_00674 gene open 239917-240720 pgaB
1416 CABTCX010000002.1 GCA902483375_00675 gene open 240765-241670 nAGPA
1417 CABTCX010000002.1 GCA902483375_00676 gene open 241679-242626
1418 CABTCX010000002.1 GCA902483375_00677 gene open 242695-243867
1419 CABTCX010000002.1 GCA902483375_00678 gene open 243854-244180
1420 CABTCX010000002.1 GCA902483375_00679 gene open 244724-246076 oadA1
1421 CABTCX010000002.1 GCA902483375_00681 gene open 246254-246703 tnpA
1422 CABTCX010000002.1 GCA902483375_00682 gene open 247177-248517 baeS
1423 CABTCX010000002.1 GCA902483375_00683 gene open 248514-249203 ompR
1424 CABTCX010000002.1 GCA902483375_00684 gene open 249786-250883 degQ
1425 CABTCX010000002.1 GCA902483375_00685 gene open 251044-251547 padR
1426 CABTCX010000002.1 GCA902483375_00686 gene open 251540-252094
1427 CABTCX010000002.1 GCA902483375_00687 gene open 252139-252615
1428 CABTCX010000002.1 GCA902483375_00688 gene open 252789-253118 padR
1429 CABTCX010000002.1 GCA902483375_00689 gene open 253105-253680
1430 CABTCX010000002.1 GCA902483375_00690 gene open 253690-254076
1431 CABTCX010000002.1 GCA902483375_00691 gene open 254277-254864 pyrE
1432 CABTCX010000002.1 GCA902483375_00692 gene open 254861-255580 pyrF
1433 CABTCX010000002.1 GCA902483375_00693 gene open 255769-256398 dnaQ
1434 CABTCX010000002.1 GCA902483375_00694 gene open 256413-257075 deoC
1435 CABTCX010000002.1 GCA902483375_00695 gene open 257129-258430
1436 CABTCX010000002.1 GCA902483375_00696 gene open 258441-258836
1437 CABTCX010000002.1 GCA902483375_00697 gene open 258894-259718 nlpA
1438 CABTCX010000002.1 GCA902483375_00698 gene open 259937-260833 menA
1439 CABTCX010000002.1 GCA902483375_00699 gene open 261044-261988
1440 CABTCX010000002.1 GCA902483375_00700 gene open 261990-262781
1441 CABTCX010000002.1 GCA902483375_00701 gene open 262897-263268 ridA
1442 CABTCX010000002.1 GCA902483375_00702 gene open 263270-264517 cdsB
1443 CABTCX010000002.1 GCA902483375_00703 gene open 264672-265304
1444 CABTCX010000002.1 GCA902483375_00704 gene open 265373-266560 narK
1445 CABTCX010000002.1 GCA902483375_00705 gene open 266876-267106
1446 CABTCX010000002.1 GCA902483375_00707 gene open 268008-268703 yadS
1447 CABTCX010000002.1 GCA902483375_00708 gene open 268847-270664
1448 CABTCX010000002.1 GCA902483375_00709 gene open 270681-271796
1449 CABTCX010000002.1 GCA902483375_00710 gene open 271978-272835 ilvE
1450 CABTCX010000002.1 GCA902483375_00711 gene open 272857-273939 metN
1451 CABTCX010000002.1 GCA902483375_00712 gene open 273920-274573 metP
1452 CABTCX010000002.1 GCA902483375_00713 gene open 274583-274879 yerC
1453 CABTCX010000002.1 GCA902483375_00714 gene open 274945-275739 tauE
1454 CABTCX010000002.1 GCA902483375_00715 gene open 275751-276518 fabG
1455 CABTCX010000002.1 GCA902483375_00716 gene open 276656-277507
1456 CABTCX010000002.1 GCA902483375_00717 gene open 277527-277871 ykvA
1457 CABTCX010000002.1 GCA902483375_00718 gene open 277988-278407 fadM
1458 CABTCX010000002.1 GCA902483375_00719 gene open 278400-279203 murI
1459 CABTCX010000002.1 GCA902483375_00720 gene open 279216-279755
1460 CABTCX010000002.1 GCA902483375_00721 gene open 279768-280418
1461 CABTCX010000002.1 GCA902483375_00722 gene open 280484-282214
1462 CABTCX010000002.1 GCA902483375_00723 gene open 282204-283634 acuC
1463 CABTCX010000002.1 GCA902483375_00724 gene open 283804-284559 rph
1464 CABTCX010000002.1 GCA902483375_00725 gene open 284561-285136 rdgB
1465 CABTCX010000002.1 GCA902483375_00726 gene open 285202-285699 yfcE
1466 CABTCX010000002.1 GCA902483375_00727 gene open 285776-286558 speD
1467 CABTCX010000002.1 GCA902483375_00728 gene open 286827-288032 sfcA
1468 CABTCX010000002.1 GCA902483375_00732 gene open 288785-289951 hsdR
1469 CABTCX010000002.1 GCA902483375_00733 gene open 290015-290500 hsdR
1470 CABTCX010000002.1 GCA902483375_00734 gene open 290537-291208 hsdR
1471 CABTCX010000002.1 GCA902483375_00735 gene open 291502-293688 clpA
1472 CABTCX010000002.1 GCA902483375_00736 gene open 293875-294648
1473 CABTCX010000002.1 GCA902483375_00737 gene open 294686-295882 mntH
1474 CABTCX010000002.1 GCA902483375_00738 gene open 295957-296700 pxpB
1475 CABTCX010000002.1 GCA902483375_00739 gene open 296687-297721
1476 CABTCX010000002.1 GCA902483375_00740 gene open 298515-298709
1477 CABTCX010000002.1 GCA902483375_00741 gene open 299670-299909
1478 CABTCX010000002.1 GCA902483375_00742 gene open 299943-300194
1479 CABTCX010000002.1 GCA902483375_00743 gene open 300249-300596
1480 CABTCX010000002.1 GCA902483375_00637 gene open 206255-206345 trnS
1481 CABTCX010000002.1 GCA902483375_00660 gene open 231453-231528 trnD
1482 CABTCX010000002.1 GCA902483375_00661 gene open 231534-231609 trnF
1483 CABTCX010000002.1 GCA902483375_00662 gene open 231622-231707 trnL
1484 CABTCX010000002.1 GCA902483375_00706 gene open 267404-267494 trnS
1485 CABTCX010000002.1 GCA902483375_00729 gene open 288296-288372 trnP
1486 CABTCX010000002.1 GCA902483375_00730 gene open 288383-288456 trnG
1487 CABTCX010000002.1 GCA902483375_00731 gene open 288554-288630 trnR
1488 CABTCX010000002.1 GCA902483375_00637 tRNA open 206255-206345 trnS tRNA-Ser(gga)
1489 CABTCX010000002.1 GCA902483375_00660 tRNA open 231453-231528 trnD tRNA-Asp(gtc)
1490 CABTCX010000002.1 GCA902483375_00661 tRNA open 231534-231609 trnF tRNA-Phe(gaa)
1491 CABTCX010000002.1 GCA902483375_00662 tRNA open 231622-231707 trnL tRNA-Leu(gag)
1492 CABTCX010000002.1 GCA902483375_00706 tRNA open 267404-267494 trnS tRNA-Ser(cga)
1493 CABTCX010000002.1 GCA902483375_00729 tRNA open 288296-288372 trnP tRNA-Pro(tgg)
1494 CABTCX010000002.1 GCA902483375_00730 tRNA open 288383-288456 trnG tRNA-Gly(tcc)
1495 CABTCX010000002.1 GCA902483375_00731 tRNA open 288554-288630 trnR tRNA-Arg(tct)
1496 CABTCX010000003.1 rep_origin open 92156-92429
1497 CABTCX010000003.1 regulatory_region open 188202-188377 Cobalamin riboswitch aptamer
1498 CABTCX010000003.1 regulatory_region open 228341-228447 TPP riboswitch aptamer (THI element)
1499 CABTCX010000003.1 repeat_region open 210975-211679 CRISPR array with 11 repeats of length 36%2C consensus sequence GTTTTAGTACTCTGTAATTTTTCGCTATGATAAAAC and spacer length 29
1500 CABTCX010000003.1 GCA902483375_00744 CDS open 1362-2162 _na     266_aa Serine protease