HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Alloprevotella sp. HMT-473 (GCA_902497175.1)

Select a Genome:
BAKTA Annotations for GCA_902497175.1
Genome Selected: Alloprevotella sp. HMT-473
ContigsBases CDSrRNA tmRNAtRNA
81 1,864,341 1356 0 0 31
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 2784 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:1]    |    Number of Records Found: 2784 [6 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1 CABVDX010000001.1 GCA902497175_00001 CDS open 558-1040 _na     160_aa Outer membrane protein beta-barrel domain-containing protein
2 CABVDX010000001.1 GCA902497175_00002 CDS open 1086-1637 _na     183_aa Flavodoxin-like protein
3 CABVDX010000001.1 GCA902497175_00003 CDS open 1887-3344 _na     485_aa trkH Potassium uptake protein%2C TrkH family
4 CABVDX010000001.1 GCA902497175_00004 CDS open 3354-4700 _na     448_aa trkA Trk system potassium transporter TrkA
5 CABVDX010000001.1 GCA902497175_00005 CDS open 4835-6745 _na     636_aa dxs 1-deoxy-D-xylulose-5-phosphate synthase
6 CABVDX010000001.1 GCA902497175_00006 CDS open 6936-7574 _na     212_aa udk uridine kinase
7 CABVDX010000001.1 GCA902497175_00007 CDS open 8016-8519 _na     167_aa DUF3868 domain-containing protein
8 CABVDX010000001.1 GCA902497175_00008 CDS open 8701-9249 _na     182_aa hypothetical protein
9 CABVDX010000001.1 GCA902497175_00009 CDS open 9216-10835 _na     539_aa GDSL-like protein
10 CABVDX010000001.1 GCA902497175_00010 CDS open 11055-12209 _na     384_aa Aspartyl protease
11 CABVDX010000001.1 GCA902497175_00011 CDS open 12247-13722 _na     491_aa Thioredoxin
12 CABVDX010000001.1 GCA902497175_00012 CDS open 13945-14955 _na     336_aa Fibrobacter succinogene major domain protein
13 CABVDX010000001.1 GCA902497175_00013 CDS open 15022-16107 _na     361_aa SusD/RagB family nutrient-binding outer membrane lipoprotein
14 CABVDX010000001.1 GCA902497175_00014 CDS open 16214-17842 _na     542_aa SusD-like N-terminal domain-containing protein
15 CABVDX010000001.1 GCA902497175_00015 CDS open 17925-21191 _na     1088_aa TonB-dependent receptor plug domain protein
16 CABVDX010000001.1 GCA902497175_00016 CDS open 22547-25681 _na     1044_aa TonB-dependent receptor plug domain protein
17 CABVDX010000001.1 GCA902497175_00017 CDS open 25701-27311 _na     536_aa susD SusD family protein
18 CABVDX010000001.1 GCA902497175_00018 CDS open 28493-30133 _na     546_aa Fumarate hydratase class I
19 CABVDX010000001.1 GCA902497175_00019 CDS open 30380-31570 _na     396_aa Smr domain-containing protein
20 CABVDX010000001.1 GCA902497175_00020 CDS open 31578-32690 _na     370_aa RecF/RecN/SMC protein
21 CABVDX010000001.1 GCA902497175_00021 CDS open 32687-33394 _na     235_aa DUF4276 domain-containing protein
22 CABVDX010000001.1 GCA902497175_00022 CDS open 33446-35476 _na     676_aa Dipeptidyl-peptidase
23 CABVDX010000001.1 GCA902497175_00023 CDS open 35473-37056 _na     527_aa NOL1/NOP2/sun family protein
24 CABVDX010000001.1 GCA902497175_00024 CDS open 37227-38162 _na     311_aa prmA 50S ribosomal protein L11 methyltransferase
25 CABVDX010000001.1 GCA902497175_00025 CDS open 38194-38934 _na     246_aa Non-reducing end beta-L-arabinofuranosidase-like GH127 middle domain-containing protein
26 CABVDX010000001.1 GCA902497175_00026 CDS open 39010-40326 _na     438_aa hypothetical protein
27 CABVDX010000001.1 GCA902497175_00027 CDS open 40473-43235 _na     920_aa histidine kinase
28 CABVDX010000001.1 GCA902497175_00028 CDS open 44167-45495 _na     442_aa ompA OmpA family protein
29 CABVDX010000001.1 GCA902497175_00029 CDS open 45681-47480 _na     599_aa Lipoprotein
30 CABVDX010000001.1 GCA902497175_00030 CDS open 47879-50266 _na     795_aa Zinc-dependent metalloprotease
31 CABVDX010000001.1 GCA902497175_00031 CDS open 50543-51163 _na     206_aa hypothetical protein
32 CABVDX010000001.1 GCA902497175_00032 CDS open 51304-52350 _na     348_aa hypothetical protein
33 CABVDX010000001.1 GCA902497175_00033 CDS open 53050-54468 _na     472_aa radA DNA repair protein RadA
34 CABVDX010000001.1 GCA902497175_00034 CDS open 54548-54895 _na     115_aa merR Transcriptional regulator%2C MerR family
35 CABVDX010000001.1 GCA902497175_00035 CDS open 55106-57853 _na     915_aa F5/8 type C domain protein
36 CABVDX010000001.1 GCA902497175_00036 CDS open 58067-60349 _na     760_aa ComEC/Rec2-like protein
37 CABVDX010000001.1 GCA902497175_00037 CDS open 60557-61315 _na     252_aa Acyltransferase
38 CABVDX010000001.1 GCA902497175_00038 CDS open 61352-62695 _na     447_aa dihydroorotase
39 CABVDX010000001.1 GCA902497175_00039 CDS open 62832-63626 _na     264_aa Glycosyltransferase%2C group 2 family protein
40 CABVDX010000001.1 GCA902497175_00040 CDS open 63820-65103 _na     427_aa hypothetical protein
41 CABVDX010000001.1 GCA902497175_00041 CDS open 65310-66428 _na     372_aa cysteine-S-conjugate beta-lyase
42 CABVDX010000001.1 GCA902497175_00042 CDS open 66447-67022 _na     191_aa hypothetical protein
43 CABVDX010000001.1 GCA902497175_00043 CDS open 67304-67792 _na     162_aa DNA protection during starvation protein
44 CABVDX010000001.1 GCA902497175_00044 CDS open 67830-68045 _na     71_aa hypothetical protein
45 CABVDX010000001.1 GCA902497175_00045 CDS open 68452-68715 _na     87_aa rpmA 50S ribosomal protein L27
46 CABVDX010000001.1 GCA902497175_00046 CDS open 68736-69053 _na     105_aa rplU 50S ribosomal protein L21
47 CABVDX010000001.1 GCA902497175_00047 CDS open 69635-71449 _na     604_aa hypothetical protein
48 CABVDX010000001.1 GCA902497175_00048 CDS open 71453-73849 _na     798_aa Major fimbrial subunit protein N-terminal domain-containing protein
49 CABVDX010000001.1 GCA902497175_00049 CDS open 74019-75482 _na     487_aa Major fimbrial subunit protein N-terminal domain-containing protein
50 CABVDX010000001.1 GCA902497175_00050 CDS open 75513-77036 _na     507_aa Fimbrial subunit protein C-terminal domain-containing protein
51 CABVDX010000001.1 GCA902497175_00051 CDS open 77192-77338 _na     48_aa hypothetical protein
52 CABVDX010000001.1 GCA902497175_00052 CDS open 78354-78494 _na     46_aa hypothetical protein
53 CABVDX010000001.1 GCA902497175_00053 CDS open 78689-79264 _na     191_aa DUF3575 domain-containing protein
54 CABVDX010000001.1 GCA902497175_00054 CDS open 79421-80845 _na     474_aa OmpA-like domain-containing protein
55 CABVDX010000001.1 GCA902497175_00055 CDS open 80977-82734 _na     585_aa Fimbrial subunit protein C-terminal domain-containing protein
56 CABVDX010000001.1 GCA902497175_00056 CDS open 82931-84085 _na     384_aa hypothetical protein
57 CABVDX010000001.1 GCA902497175_00057 CDS open 84224-84871 _na     215_aa hypothetical protein
58 CABVDX010000001.1 GCA902497175_00058 CDS open 84908-85960 _na     350_aa Fimbrillin-A associated anchor protein Mfa1 and Mfa2
59 CABVDX010000001.1 GCA902497175_00059 CDS open 86065-87702 _na     545_aa Pyridine nucleotide-disulfide oxidoreductase
60 CABVDX010000001.1 GCA902497175_00060 CDS open 88054-89322 _na     422_aa adenylosuccinate synthase
61 CABVDX010000001.1 GCA902497175_00061 CDS open 89509-90837 _na     442_aa Putative dGTPase
62 CABVDX010000001.1 GCA902497175_00062 CDS open 91039-91470 _na     143_aa dut dUTP diphosphatase
63 CABVDX010000001.1 GCA902497175_00063 CDS open 91663-93486 _na     607_aa Tetratricopeptide repeat protein
64 CABVDX010000001.1 GCA902497175_00064 CDS open 93584-94222 _na     212_aa DUF4292 domain-containing protein
65 CABVDX010000001.1 GCA902497175_00065 CDS open 94336-95967 _na     543_aa Peptidase%2C M23 family
66 CABVDX010000001.1 GCA902497175_00066 CDS open 96287-96991 _na     234_aa cmk (d)CMP kinase
67 CABVDX010000001.1 GCA902497175_00067 CDS open 97226-98776 _na     516_aa pglZ PglZ domain protein
68 CABVDX010000001.1 GCA902497175_00068 CDS open 99077-101266 _na     729_aa Alpha-galactosidase
69 CABVDX010000001.1 GCA902497175_00069 CDS open 101476-101589 _na     37_aa hypothetical protein
70 CABVDX010000001.1 GCA902497175_00070 CDS open 101596-102801 _na     401_aa Saccharopine dehydrogenase
71 CABVDX010000001.1 GCA902497175_00071 CDS open 102930-103460 _na     176_aa DUF6621 domain-containing protein
72 CABVDX010000001.1 GCA902497175_00001 gene open 558-1040
73 CABVDX010000001.1 GCA902497175_00002 gene open 1086-1637
74 CABVDX010000001.1 GCA902497175_00003 gene open 1887-3344 trkH
75 CABVDX010000001.1 GCA902497175_00004 gene open 3354-4700 trkA
76 CABVDX010000001.1 GCA902497175_00005 gene open 4835-6745 dxs
77 CABVDX010000001.1 GCA902497175_00006 gene open 6936-7574 udk
78 CABVDX010000001.1 GCA902497175_00007 gene open 8016-8519
79 CABVDX010000001.1 GCA902497175_00008 gene open 8701-9249
80 CABVDX010000001.1 GCA902497175_00009 gene open 9216-10835
81 CABVDX010000001.1 GCA902497175_00010 gene open 11055-12209
82 CABVDX010000001.1 GCA902497175_00011 gene open 12247-13722
83 CABVDX010000001.1 GCA902497175_00012 gene open 13945-14955
84 CABVDX010000001.1 GCA902497175_00013 gene open 15022-16107
85 CABVDX010000001.1 GCA902497175_00014 gene open 16214-17842
86 CABVDX010000001.1 GCA902497175_00015 gene open 17925-21191
87 CABVDX010000001.1 GCA902497175_00016 gene open 22547-25681
88 CABVDX010000001.1 GCA902497175_00017 gene open 25701-27311 susD
89 CABVDX010000001.1 GCA902497175_00018 gene open 28493-30133
90 CABVDX010000001.1 GCA902497175_00019 gene open 30380-31570
91 CABVDX010000001.1 GCA902497175_00020 gene open 31578-32690
92 CABVDX010000001.1 GCA902497175_00021 gene open 32687-33394
93 CABVDX010000001.1 GCA902497175_00022 gene open 33446-35476
94 CABVDX010000001.1 GCA902497175_00023 gene open 35473-37056
95 CABVDX010000001.1 GCA902497175_00024 gene open 37227-38162 prmA
96 CABVDX010000001.1 GCA902497175_00025 gene open 38194-38934
97 CABVDX010000001.1 GCA902497175_00026 gene open 39010-40326
98 CABVDX010000001.1 GCA902497175_00027 gene open 40473-43235
99 CABVDX010000001.1 GCA902497175_00028 gene open 44167-45495 ompA
100 CABVDX010000001.1 GCA902497175_00029 gene open 45681-47480
101 CABVDX010000001.1 GCA902497175_00030 gene open 47879-50266
102 CABVDX010000001.1 GCA902497175_00031 gene open 50543-51163
103 CABVDX010000001.1 GCA902497175_00032 gene open 51304-52350
104 CABVDX010000001.1 GCA902497175_00033 gene open 53050-54468 radA
105 CABVDX010000001.1 GCA902497175_00034 gene open 54548-54895 merR
106 CABVDX010000001.1 GCA902497175_00035 gene open 55106-57853
107 CABVDX010000001.1 GCA902497175_00036 gene open 58067-60349
108 CABVDX010000001.1 GCA902497175_00037 gene open 60557-61315
109 CABVDX010000001.1 GCA902497175_00038 gene open 61352-62695
110 CABVDX010000001.1 GCA902497175_00039 gene open 62832-63626
111 CABVDX010000001.1 GCA902497175_00040 gene open 63820-65103
112 CABVDX010000001.1 GCA902497175_00041 gene open 65310-66428
113 CABVDX010000001.1 GCA902497175_00042 gene open 66447-67022
114 CABVDX010000001.1 GCA902497175_00043 gene open 67304-67792
115 CABVDX010000001.1 GCA902497175_00044 gene open 67830-68045
116 CABVDX010000001.1 GCA902497175_00045 gene open 68452-68715 rpmA
117 CABVDX010000001.1 GCA902497175_00046 gene open 68736-69053 rplU
118 CABVDX010000001.1 GCA902497175_00047 gene open 69635-71449
119 CABVDX010000001.1 GCA902497175_00048 gene open 71453-73849
120 CABVDX010000001.1 GCA902497175_00049 gene open 74019-75482
121 CABVDX010000001.1 GCA902497175_00050 gene open 75513-77036
122 CABVDX010000001.1 GCA902497175_00051 gene open 77192-77338
123 CABVDX010000001.1 GCA902497175_00052 gene open 78354-78494
124 CABVDX010000001.1 GCA902497175_00053 gene open 78689-79264
125 CABVDX010000001.1 GCA902497175_00054 gene open 79421-80845
126 CABVDX010000001.1 GCA902497175_00055 gene open 80977-82734
127 CABVDX010000001.1 GCA902497175_00056 gene open 82931-84085
128 CABVDX010000001.1 GCA902497175_00057 gene open 84224-84871
129 CABVDX010000001.1 GCA902497175_00058 gene open 84908-85960
130 CABVDX010000001.1 GCA902497175_00059 gene open 86065-87702
131 CABVDX010000001.1 GCA902497175_00060 gene open 88054-89322
132 CABVDX010000001.1 GCA902497175_00061 gene open 89509-90837
133 CABVDX010000001.1 GCA902497175_00062 gene open 91039-91470 dut
134 CABVDX010000001.1 GCA902497175_00063 gene open 91663-93486
135 CABVDX010000001.1 GCA902497175_00064 gene open 93584-94222
136 CABVDX010000001.1 GCA902497175_00065 gene open 94336-95967
137 CABVDX010000001.1 GCA902497175_00066 gene open 96287-96991 cmk
138 CABVDX010000001.1 GCA902497175_00067 gene open 97226-98776 pglZ
139 CABVDX010000001.1 GCA902497175_00068 gene open 99077-101266
140 CABVDX010000001.1 GCA902497175_00069 gene open 101476-101589
141 CABVDX010000001.1 GCA902497175_00070 gene open 101596-102801
142 CABVDX010000001.1 GCA902497175_00071 gene open 102930-103460
143 CABVDX010000001.1 GCA902497175_00072 gene open 104455-104528 trnR
144 CABVDX010000001.1 GCA902497175_00073 gene open 104680-104752 trnF
145 CABVDX010000001.1 GCA902497175_00072 tRNA open 104455-104528 trnR tRNA-Arg(ccg)
146 CABVDX010000001.1 GCA902497175_00073 tRNA open 104680-104752 trnF tRNA-Phe(gaa)
147 CABVDX010000002.1 GCA902497175_00130 gene open 66443-66626 Bacteroidales-1
148 CABVDX010000002.1 GCA902497175_00130 ncRNA open 66443-66626 Bacteroidales-1 6S-Bacteroidales RNA suggested
149 CABVDX010000002.1 repeat_region open 6725-7163 CRISPR array with 7 repeats of length 33%2C consensus sequence GTCGCAGCCCGCTTGGGCTGCGTGAATTGAAAC and spacer length 33
150 CABVDX010000002.1 repeat_region open 7296-7829 CRISPR array with 8 repeats of length 33%2C consensus sequence GTCGCAGCCCGCTTGGGCTGCGTGAATTGAAAC and spacer length 33
151 CABVDX010000002.1 GCA902497175_00074 CDS open 419-709 _na     96_aa cas2 CRISPR-associated endonuclease Cas2
152 CABVDX010000002.1 GCA902497175_00075 CDS open 732-1760 _na     342_aa cas1c type I-C CRISPR-associated endonuclease Cas1c
153 CABVDX010000002.1 GCA902497175_00076 CDS open 1792-2469 _na     225_aa cas4 CRISPR-associated protein Cas4
154 CABVDX010000002.1 GCA902497175_00077 CDS open 2592-3434 _na     280_aa cas7c type I-C CRISPR-associated protein Cas7/Csd2
155 CABVDX010000002.1 GCA902497175_00078 CDS open 3609-5540 _na     643_aa cas8c type I-C CRISPR-associated protein Cas8c/Csd1
156 CABVDX010000002.1 GCA902497175_00079 CDS open 5537-6250 _na     237_aa cas5c type I-C CRISPR-associated protein Cas5c
157 CABVDX010000002.1 GCA902497175_00080 CDS open 6427-6606 _na     59_aa hypothetical protein
158 CABVDX010000002.1 GCA902497175_00081 CDS open 8378-10054 _na     558_aa Glycosyl hydrolase family 25
159 CABVDX010000002.1 GCA902497175_00082 CDS open 10297-11211 _na     304_aa Dihydrodipicolinate synthetase family protein
160 CABVDX010000002.1 GCA902497175_00083 CDS open 11261-11395 _na     44_aa hypothetical protein
161 CABVDX010000002.1 GCA902497175_00084 CDS open 11867-12730 _na     287_aa araC Transcriptional regulator%2C AraC family
162 CABVDX010000002.1 GCA902497175_00085 CDS open 12902-14185 _na     427_aa Outer membrane efflux protein
163 CABVDX010000002.1 GCA902497175_00086 CDS open 14236-15174 _na     312_aa Auxiliary transport protein%2C membrane fusion protein family protein
164 CABVDX010000002.1 GCA902497175_00087 CDS open 15188-16693 _na     501_aa lptB LPS export ABC transporter ATP-binding protein
165 CABVDX010000002.1 GCA902497175_00088 CDS open 16764-17822 _na     352_aa Transport permease protein
166 CABVDX010000002.1 GCA902497175_00089 CDS open 17830-18918 _na     362_aa ABC-2 type transporter
167 CABVDX010000002.1 GCA902497175_00090 CDS open 19130-19849 _na     239_aa TIGR00659 family protein
168 CABVDX010000002.1 GCA902497175_00091 CDS open 19830-20180 _na     116_aa lrgA LrgA family protein
169 CABVDX010000002.1 GCA902497175_00092 CDS open 20437-20928 _na     163_aa Dihydrofolate reductase
170 CABVDX010000002.1 GCA902497175_00093 CDS open 21123-21917 _na     264_aa thymidylate synthase
171 CABVDX010000002.1 GCA902497175_00094 CDS open 21914-22303 _na     129_aa hypothetical protein
172 CABVDX010000002.1 GCA902497175_00095 CDS open 22452-23720 _na     422_aa queA tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA
173 CABVDX010000002.1 GCA902497175_00096 CDS open 23737-24825 _na     362_aa DUF4831 domain-containing protein
174 CABVDX010000002.1 GCA902497175_00097 CDS open 24827-25762 _na     311_aa ADP-dependent (S)-NAD(P)H-hydrate dehydratase
175 CABVDX010000002.1 GCA902497175_00098 CDS open 26066-27379 _na     437_aa der ribosome biogenesis GTPase Der
176 CABVDX010000002.1 GCA902497175_00099 CDS open 27386-27799 _na     137_aa DUF4878 domain-containing protein
177 CABVDX010000002.1 GCA902497175_00100 CDS open 27930-29276 _na     448_aa purB adenylosuccinate lyase
178 CABVDX010000002.1 GCA902497175_00101 CDS open 29521-30873 _na     450_aa pseudouridine synthase
179 CABVDX010000002.1 GCA902497175_00102 CDS open 31037-32431 _na     464_aa asnS asparagine--tRNA ligase
180 CABVDX010000002.1 GCA902497175_00103 CDS open 32672-33208 _na     178_aa FAH family protein
181 CABVDX010000002.1 GCA902497175_00104 CDS open 33456-37370 _na     1304_aa Gingipain domain-containing protein
182 CABVDX010000002.1 GCA902497175_00105 CDS open 37488-38645 _na     385_aa porV type IX secretion system outer membrane channel protein PorV
183 CABVDX010000002.1 GCA902497175_00106 CDS open 38761-39240 _na     159_aa 2-C-methyl-D-erythritol 2%2C4-cyclodiphosphate synthase
184 CABVDX010000002.1 GCA902497175_00107 CDS open 39291-40103 _na     270_aa indole-3-glycerol-phosphate synthase
185 CABVDX010000002.1 GCA902497175_00108 CDS open 40240-41496 _na     418_aa tetrahydrofolate synthase
186 CABVDX010000002.1 GCA902497175_00109 CDS open 41529-42692 _na     387_aa dnaJ molecular chaperone DnaJ
187 CABVDX010000002.1 GCA902497175_00110 CDS open 42746-43336 _na     196_aa grpE Protein GrpE
188 CABVDX010000002.1 GCA902497175_00111 CDS open 43459-45084 _na     541_aa ABC transporter%2C ATP-binding protein
189 CABVDX010000002.1 GCA902497175_00112 CDS open 45927-46493 _na     188_aa Glutamine amidotransferase%2C class I
190 CABVDX010000002.1 GCA902497175_00113 CDS open 46553-47749 _na     398_aa trpB tryptophan synthase subunit beta
191 CABVDX010000002.1 GCA902497175_00114 CDS open 48095-48625 _na     176_aa UPF0114 protein HMPREF9999_01604
192 CABVDX010000002.1 GCA902497175_00115 CDS open 48793-49344 _na     183_aa Peptidyl-prolyl cis-trans isomerase
193 CABVDX010000002.1 GCA902497175_00116 CDS open 49354-49614 _na     86_aa Sugar efflux transporter for intercellular exchange
194 CABVDX010000002.1 GCA902497175_00117 CDS open 49895-51553 _na     552_aa AMP-binding enzyme
195 CABVDX010000002.1 GCA902497175_00118 CDS open 51893-52591 _na     232_aa RNA pseudouridine synthase
196 CABVDX010000002.1 GCA902497175_00119 CDS open 52754-53500 _na     248_aa fabG 3-oxoacyl-[acyl-carrier-protein] reductase
197 CABVDX010000002.1 GCA902497175_00120 CDS open 53536-54132 _na     198_aa tetR Transcriptional regulator%2C TetR family
198 CABVDX010000002.1 GCA902497175_00121 CDS open 54696-55427 _na     243_aa yjdF Membrane protein YjdF
199 CABVDX010000002.1 GCA902497175_00122 CDS open 55732-56544 _na     270_aa purine-nucleoside phosphorylase
200 CABVDX010000002.1 GCA902497175_00123 CDS open 56507-57577 _na     356_aa lpxK tetraacyldisaccharide 4'-kinase
201 CABVDX010000002.1 GCA902497175_00124 CDS open 57645-59426 _na     593_aa sppA signal peptide peptidase SppA
202 CABVDX010000002.1 GCA902497175_00125 CDS open 59494-60246 _na     250_aa exodeoxyribonuclease III
203 CABVDX010000002.1 GCA902497175_00126 CDS open 60320-61324 _na     334_aa murB UDP-N-acetylmuramate dehydrogenase
204 CABVDX010000002.1 GCA902497175_00127 CDS open 61384-62229 _na     281_aa DUF4348 domain-containing protein
205 CABVDX010000002.1 GCA902497175_00128 CDS open 62400-64979 _na     859_aa Peptidase%2C S9A/B/C family%2C catalytic domain protein
206 CABVDX010000002.1 GCA902497175_00131 CDS open 66710-67552 _na     280_aa DEAD/DEAH box helicase
207 CABVDX010000002.1 GCA902497175_00132 CDS open 67524-68069 _na     181_aa Helicase
208 CABVDX010000002.1 GCA902497175_00133 CDS open 68168-70111 _na     647_aa Peptidase%2C S9A/B/C family%2C catalytic domain protein
209 CABVDX010000002.1 GCA902497175_00134 CDS open 70420-72189 _na     589_aa Tetratricopeptide repeat protein
210 CABVDX010000002.1 GCA902497175_00135 CDS open 72204-72851 _na     215_aa rpe ribulose-phosphate 3-epimerase
211 CABVDX010000002.1 GCA902497175_00136 CDS open 73032-74072 _na     346_aa DHHA1 domain protein
212 CABVDX010000002.1 GCA902497175_00137 CDS open 74732-76372 _na     546_aa Outer membrane protein transport protein%2C Ompp1/FadL/TodX family
213 CABVDX010000002.1 GCA902497175_00138 CDS open 76498-77613 _na     371_aa hypothetical protein
214 CABVDX010000002.1 GCA902497175_00139 CDS open 77804-78712 _na     302_aa Pseudouridine synthase
215 CABVDX010000002.1 GCA902497175_00140 CDS open 78924-80126 _na     400_aa Aminotransferase%2C class I/II
216 CABVDX010000002.1 GCA902497175_00141 CDS open 80228-81514 _na     428_aa Efflux ABC transporter%2C permease protein
217 CABVDX010000002.1 GCA902497175_00143 CDS open 81899-83296 _na     465_aa fumC class II fumarate hydratase
218 CABVDX010000002.1 GCA902497175_00144 CDS open 83545-84450 _na     301_aa Peptidoglycan hydrolase
219 CABVDX010000002.1 GCA902497175_00145 CDS open 84543-85208 _na     221_aa 4'-phosphopantetheinyl transferase family protein
220 CABVDX010000002.1 GCA902497175_00146 CDS open 85284-85664 _na     126_aa Single-stranded DNA-binding protein
221 CABVDX010000002.1 GCA902497175_00147 CDS open 85781-86302 _na     173_aa DUF4293 domain-containing protein
222 CABVDX010000002.1 GCA902497175_00148 CDS open 86490-86834 _na     114_aa DNA-directed RNA polymerase subunit omega
223 CABVDX010000002.1 GCA902497175_00149 CDS open 86899-87747 _na     282_aa yfiO Outer membrane assembly lipoprotein YfiO
224 CABVDX010000002.1 GCA902497175_00074 gene open 419-709 cas2
225 CABVDX010000002.1 GCA902497175_00075 gene open 732-1760 cas1c
226 CABVDX010000002.1 GCA902497175_00076 gene open 1792-2469 cas4
227 CABVDX010000002.1 GCA902497175_00077 gene open 2592-3434 cas7c
228 CABVDX010000002.1 GCA902497175_00078 gene open 3609-5540 cas8c
229 CABVDX010000002.1 GCA902497175_00079 gene open 5537-6250 cas5c
230 CABVDX010000002.1 GCA902497175_00080 gene open 6427-6606
231 CABVDX010000002.1 GCA902497175_00081 gene open 8378-10054
232 CABVDX010000002.1 GCA902497175_00082 gene open 10297-11211
233 CABVDX010000002.1 GCA902497175_00083 gene open 11261-11395
234 CABVDX010000002.1 GCA902497175_00084 gene open 11867-12730 araC
235 CABVDX010000002.1 GCA902497175_00085 gene open 12902-14185
236 CABVDX010000002.1 GCA902497175_00086 gene open 14236-15174
237 CABVDX010000002.1 GCA902497175_00087 gene open 15188-16693 lptB
238 CABVDX010000002.1 GCA902497175_00088 gene open 16764-17822
239 CABVDX010000002.1 GCA902497175_00089 gene open 17830-18918
240 CABVDX010000002.1 GCA902497175_00090 gene open 19130-19849
241 CABVDX010000002.1 GCA902497175_00091 gene open 19830-20180 lrgA
242 CABVDX010000002.1 GCA902497175_00092 gene open 20437-20928
243 CABVDX010000002.1 GCA902497175_00093 gene open 21123-21917
244 CABVDX010000002.1 GCA902497175_00094 gene open 21914-22303
245 CABVDX010000002.1 GCA902497175_00095 gene open 22452-23720 queA
246 CABVDX010000002.1 GCA902497175_00096 gene open 23737-24825
247 CABVDX010000002.1 GCA902497175_00097 gene open 24827-25762
248 CABVDX010000002.1 GCA902497175_00098 gene open 26066-27379 der
249 CABVDX010000002.1 GCA902497175_00099 gene open 27386-27799
250 CABVDX010000002.1 GCA902497175_00100 gene open 27930-29276 purB
251 CABVDX010000002.1 GCA902497175_00101 gene open 29521-30873
252 CABVDX010000002.1 GCA902497175_00102 gene open 31037-32431 asnS
253 CABVDX010000002.1 GCA902497175_00103 gene open 32672-33208
254 CABVDX010000002.1 GCA902497175_00104 gene open 33456-37370
255 CABVDX010000002.1 GCA902497175_00105 gene open 37488-38645 porV
256 CABVDX010000002.1 GCA902497175_00106 gene open 38761-39240
257 CABVDX010000002.1 GCA902497175_00107 gene open 39291-40103
258 CABVDX010000002.1 GCA902497175_00108 gene open 40240-41496
259 CABVDX010000002.1 GCA902497175_00109 gene open 41529-42692 dnaJ
260 CABVDX010000002.1 GCA902497175_00110 gene open 42746-43336 grpE
261 CABVDX010000002.1 GCA902497175_00111 gene open 43459-45084
262 CABVDX010000002.1 GCA902497175_00112 gene open 45927-46493
263 CABVDX010000002.1 GCA902497175_00113 gene open 46553-47749 trpB
264 CABVDX010000002.1 GCA902497175_00114 gene open 48095-48625
265 CABVDX010000002.1 GCA902497175_00115 gene open 48793-49344
266 CABVDX010000002.1 GCA902497175_00116 gene open 49354-49614
267 CABVDX010000002.1 GCA902497175_00117 gene open 49895-51553
268 CABVDX010000002.1 GCA902497175_00118 gene open 51893-52591
269 CABVDX010000002.1 GCA902497175_00119 gene open 52754-53500 fabG
270 CABVDX010000002.1 GCA902497175_00120 gene open 53536-54132 tetR
271 CABVDX010000002.1 GCA902497175_00121 gene open 54696-55427 yjdF
272 CABVDX010000002.1 GCA902497175_00122 gene open 55732-56544
273 CABVDX010000002.1 GCA902497175_00123 gene open 56507-57577 lpxK
274 CABVDX010000002.1 GCA902497175_00124 gene open 57645-59426 sppA
275 CABVDX010000002.1 GCA902497175_00125 gene open 59494-60246
276 CABVDX010000002.1 GCA902497175_00126 gene open 60320-61324 murB
277 CABVDX010000002.1 GCA902497175_00127 gene open 61384-62229
278 CABVDX010000002.1 GCA902497175_00128 gene open 62400-64979
279 CABVDX010000002.1 GCA902497175_00131 gene open 66710-67552
280 CABVDX010000002.1 GCA902497175_00132 gene open 67524-68069
281 CABVDX010000002.1 GCA902497175_00133 gene open 68168-70111
282 CABVDX010000002.1 GCA902497175_00134 gene open 70420-72189
283 CABVDX010000002.1 GCA902497175_00135 gene open 72204-72851 rpe
284 CABVDX010000002.1 GCA902497175_00136 gene open 73032-74072
285 CABVDX010000002.1 GCA902497175_00137 gene open 74732-76372
286 CABVDX010000002.1 GCA902497175_00138 gene open 76498-77613
287 CABVDX010000002.1 GCA902497175_00139 gene open 77804-78712
288 CABVDX010000002.1 GCA902497175_00140 gene open 78924-80126
289 CABVDX010000002.1 GCA902497175_00141 gene open 80228-81514
290 CABVDX010000002.1 GCA902497175_00143 gene open 81899-83296 fumC
291 CABVDX010000002.1 GCA902497175_00144 gene open 83545-84450
292 CABVDX010000002.1 GCA902497175_00145 gene open 84543-85208
293 CABVDX010000002.1 GCA902497175_00146 gene open 85284-85664
294 CABVDX010000002.1 GCA902497175_00147 gene open 85781-86302
295 CABVDX010000002.1 GCA902497175_00148 gene open 86490-86834
296 CABVDX010000002.1 GCA902497175_00149 gene open 86899-87747 yfiO
297 CABVDX010000002.1 GCA902497175_00129 gene open 66069-66139 trnC
298 CABVDX010000002.1 GCA902497175_00142 gene open 81592-81664 trnP
299 CABVDX010000002.1 GCA902497175_00129 tRNA open 66069-66139 trnC tRNA-Cys(gca)
300 CABVDX010000002.1 GCA902497175_00142 tRNA open 81592-81664 trnP tRNA-Pro(tgg)
301 CABVDX010000003.1 GCA902497175_00150 CDS open 332-3205 _na     957_aa uvrA excinuclease ABC subunit UvrA
302 CABVDX010000003.1 GCA902497175_00151 CDS open 3198-4535 _na     445_aa Na+/H+ antiporter family protein
303 CABVDX010000003.1 GCA902497175_00152 CDS open 4886-6541 _na     551_aa putative transporter
304 CABVDX010000003.1 GCA902497175_00153 CDS open 6874-7452 _na     192_aa asnC Putative regulatory protein AsnC
305 CABVDX010000003.1 GCA902497175_00154 CDS open 7795-8151 _na     118_aa DUF4491 domain-containing protein
306 CABVDX010000003.1 GCA902497175_00155 CDS open 8341-10119 _na     592_aa Renal dipeptidase family protein
307 CABVDX010000003.1 GCA902497175_00156 CDS open 10181-11176 _na     331_aa Peptidase%2C M28 family
308 CABVDX010000003.1 GCA902497175_00157 CDS open 11237-11659 _na     140_aa Fe-S metabolism associated domain protein
309 CABVDX010000003.1 GCA902497175_00158 CDS open 11753-12640 _na     295_aa Restriction endonuclease
310 CABVDX010000003.1 GCA902497175_00159 CDS open 13182-13280 _na     32_aa hypothetical protein
311 CABVDX010000003.1 GCA902497175_00160 CDS open 13365-14309 _na     314_aa xerA site-specific tyrosine recombinase/integron integrase
312 CABVDX010000003.1 GCA902497175_00161 CDS open 14484-14930 _na     148_aa aroQ type II 3-dehydroquinate dehydratase
313 CABVDX010000003.1 GCA902497175_00162 CDS open 14986-16434 _na     482_aa miaB tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB
314 CABVDX010000003.1 GCA902497175_00163 CDS open 16611-19295 _na     894_aa calcium-translocating P-type ATPase%2C PMCA-type
315 CABVDX010000003.1 GCA902497175_00164 CDS open 19427-20437 _na     336_aa Thioredoxin domain-containing protein
316 CABVDX010000003.1 GCA902497175_00165 CDS open 20567-22243 _na     558_aa Tetratricopeptide repeat protein
317 CABVDX010000003.1 GCA902497175_00166 CDS open 22431-23267 _na     278_aa lgt prolipoprotein diacylglyceryl transferase
318 CABVDX010000003.1 GCA902497175_00167 CDS open 23345-24448 _na     367_aa ychF redox-regulated ATPase YchF
319 CABVDX010000003.1 GCA902497175_00168 CDS open 24724-25368 _na     214_aa DUF4294 domain-containing protein
320 CABVDX010000003.1 GCA902497175_00169 CDS open 25588-26166 _na     192_aa Lipocalin-like domain-containing protein
321 CABVDX010000003.1 GCA902497175_00170 CDS open 26408-27604 _na     398_aa Putative carbohydrate metabolism domain-containing protein
322 CABVDX010000003.1 GCA902497175_00171 CDS open 27701-28486 _na     261_aa Outer membrane protein beta-barrel domain-containing protein
323 CABVDX010000003.1 GCA902497175_00173 CDS open 29026-30075 _na     349_aa NAD dependent epimerase/dehydratase family protein
324 CABVDX010000003.1 GCA902497175_00174 CDS open 30222-31628 _na     468_aa Aminopeptidase
325 CABVDX010000003.1 GCA902497175_00175 CDS open 31836-33494 _na     552_aa Phosphoribulokinase/uridine kinase family protein
326 CABVDX010000003.1 GCA902497175_00176 CDS open 33777-33950 _na     57_aa hypothetical protein
327 CABVDX010000003.1 GCA902497175_00177 CDS open 34400-34525 _na     41_aa hypothetical protein
328 CABVDX010000003.1 GCA902497175_00178 CDS open 34724-35692 _na     322_aa Leucine Rich repeat-containing domain protein
329 CABVDX010000003.1 GCA902497175_00179 CDS open 35807-38512 _na     901_aa yfhO YfhO family protein
330 CABVDX010000003.1 GCA902497175_00180 CDS open 38694-39395 _na     233_aa 5'-methylthioadenosine/adenosylhomocysteine nucleosidase
331 CABVDX010000003.1 GCA902497175_00181 CDS open 39556-40035 _na     159_aa S-ribosylhomocysteine lyase
332 CABVDX010000003.1 GCA902497175_00182 CDS open 40048-40803 _na     251_aa UPF0246 protein HMPREF9999_00857
333 CABVDX010000003.1 GCA902497175_00183 CDS open 40831-41439 _na     202_aa Cyclic nucleotide-binding domain protein
334 CABVDX010000003.1 GCA902497175_00184 CDS open 41497-43407 _na     636_aa BACON domain-containing protein
335 CABVDX010000003.1 GCA902497175_00185 CDS open 43500-45434 _na     644_aa Arylsulfatase
336 CABVDX010000003.1 GCA902497175_00186 CDS open 45520-47388 _na     622_aa 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase
337 CABVDX010000003.1 GCA902497175_00187 CDS open 47532-48035 _na     167_aa N5-carboxyaminoimidazole ribonucleotide mutase
338 CABVDX010000003.1 GCA902497175_00188 CDS open 48141-48779 _na     212_aa Phosphatidic acid phosphatase type 2/haloperoxidase domain-containing protein
339 CABVDX010000003.1 GCA902497175_00189 CDS open 48831-50324 _na     497_aa rpoN RNA polymerase factor sigma-54
340 CABVDX010000003.1 GCA902497175_00190 CDS open 50486-52633 _na     715_aa 7TM receptor with intracellular HD hydrolase
341 CABVDX010000003.1 GCA902497175_00191 CDS open 52710-54056 _na     448_aa Transglutaminase-like domain-containing protein
342 CABVDX010000003.1 GCA902497175_00192 CDS open 54143-54955 _na     270_aa hypothetical protein
343 CABVDX010000003.1 GCA902497175_00193 CDS open 55104-55325 _na     73_aa DUF2795 domain-containing protein
344 CABVDX010000003.1 GCA902497175_00194 CDS open 55483-56469 _na     328_aa Glycosyltransferase%2C group 2 family protein
345 CABVDX010000003.1 GCA902497175_00195 CDS open 56500-57429 _na     309_aa oxyR Putative oxidative stress regulatory protein OxyR
346 CABVDX010000003.1 GCA902497175_00196 CDS open 57603-58121 _na     172_aa ompH OmpH family outer membrane protein
347 CABVDX010000003.1 GCA902497175_00197 CDS open 58271-58780 _na     169_aa Outer membrane protein
348 CABVDX010000003.1 GCA902497175_00198 CDS open 58970-60292 _na     440_aa dacB D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase
349 CABVDX010000003.1 GCA902497175_00199 CDS open 60551-63244 _na     897_aa DUF5117 domain-containing protein
350 CABVDX010000003.1 GCA902497175_00200 CDS open 63254-65938 _na     894_aa Zinc-dependent metalloprotease
351 CABVDX010000003.1 GCA902497175_00201 CDS open 66152-67642 _na     496_aa Bacteroidetes PKD-like domain-containing protein
352 CABVDX010000003.1 GCA902497175_00202 CDS open 67648-68382 _na     244_aa DUF4843 domain-containing protein
353 CABVDX010000003.1 GCA902497175_00203 CDS open 68467-69909 _na     480_aa SusD-like N-terminal domain-containing protein
354 CABVDX010000003.1 GCA902497175_00204 CDS open 69930-72956 _na     1008_aa TonB-dependent receptor plug domain protein
355 CABVDX010000003.1 GCA902497175_00205 CDS open 74402-77182 _na     926_aa Ig-like domain-containing protein
356 CABVDX010000003.1 GCA902497175_00206 CDS open 77306-77638 _na     110_aa hypothetical protein
357 CABVDX010000003.1 GCA902497175_00207 CDS open 77746-80580 _na     944_aa leuS leucine--tRNA ligase
358 CABVDX010000003.1 GCA902497175_00208 CDS open 80783-81796 _na     337_aa DUF2179 domain-containing protein
359 CABVDX010000003.1 GCA902497175_00209 CDS open 82011-82589 _na     192_aa non-canonical purine NTP diphosphatase
360 CABVDX010000003.1 GCA902497175_00210 CDS open 82641-85028 _na     795_aa Two component regulator propeller
361 CABVDX010000003.1 GCA902497175_00211 CDS open 85234-85500 _na     88_aa DNA-binding protein HU-alpha
362 CABVDX010000003.1 GCA902497175_00212 CDS open 85747-86751 _na     334_aa Putative membrane protein
363 CABVDX010000003.1 GCA902497175_00213 CDS open 86799-87290 _na     163_aa DUF2141 domain-containing protein
364 CABVDX010000003.1 GCA902497175_00150 gene open 332-3205 uvrA
365 CABVDX010000003.1 GCA902497175_00151 gene open 3198-4535
366 CABVDX010000003.1 GCA902497175_00152 gene open 4886-6541
367 CABVDX010000003.1 GCA902497175_00153 gene open 6874-7452 asnC
368 CABVDX010000003.1 GCA902497175_00154 gene open 7795-8151
369 CABVDX010000003.1 GCA902497175_00155 gene open 8341-10119
370 CABVDX010000003.1 GCA902497175_00156 gene open 10181-11176
371 CABVDX010000003.1 GCA902497175_00157 gene open 11237-11659
372 CABVDX010000003.1 GCA902497175_00158 gene open 11753-12640
373 CABVDX010000003.1 GCA902497175_00159 gene open 13182-13280
374 CABVDX010000003.1 GCA902497175_00160 gene open 13365-14309 xerA
375 CABVDX010000003.1 GCA902497175_00161 gene open 14484-14930 aroQ
376 CABVDX010000003.1 GCA902497175_00162 gene open 14986-16434 miaB
377 CABVDX010000003.1 GCA902497175_00163 gene open 16611-19295
378 CABVDX010000003.1 GCA902497175_00164 gene open 19427-20437
379 CABVDX010000003.1 GCA902497175_00165 gene open 20567-22243
380 CABVDX010000003.1 GCA902497175_00166 gene open 22431-23267 lgt
381 CABVDX010000003.1 GCA902497175_00167 gene open 23345-24448 ychF
382 CABVDX010000003.1 GCA902497175_00168 gene open 24724-25368
383 CABVDX010000003.1 GCA902497175_00169 gene open 25588-26166
384 CABVDX010000003.1 GCA902497175_00170 gene open 26408-27604
385 CABVDX010000003.1 GCA902497175_00171 gene open 27701-28486
386 CABVDX010000003.1 GCA902497175_00173 gene open 29026-30075
387 CABVDX010000003.1 GCA902497175_00174 gene open 30222-31628
388 CABVDX010000003.1 GCA902497175_00175 gene open 31836-33494
389 CABVDX010000003.1 GCA902497175_00176 gene open 33777-33950
390 CABVDX010000003.1 GCA902497175_00177 gene open 34400-34525
391 CABVDX010000003.1 GCA902497175_00178 gene open 34724-35692
392 CABVDX010000003.1 GCA902497175_00179 gene open 35807-38512 yfhO
393 CABVDX010000003.1 GCA902497175_00180 gene open 38694-39395
394 CABVDX010000003.1 GCA902497175_00181 gene open 39556-40035
395 CABVDX010000003.1 GCA902497175_00182 gene open 40048-40803
396 CABVDX010000003.1 GCA902497175_00183 gene open 40831-41439
397 CABVDX010000003.1 GCA902497175_00184 gene open 41497-43407
398 CABVDX010000003.1 GCA902497175_00185 gene open 43500-45434
399 CABVDX010000003.1 GCA902497175_00186 gene open 45520-47388
400 CABVDX010000003.1 GCA902497175_00187 gene open 47532-48035
401 CABVDX010000003.1 GCA902497175_00188 gene open 48141-48779
402 CABVDX010000003.1 GCA902497175_00189 gene open 48831-50324 rpoN
403 CABVDX010000003.1 GCA902497175_00190 gene open 50486-52633
404 CABVDX010000003.1 GCA902497175_00191 gene open 52710-54056
405 CABVDX010000003.1 GCA902497175_00192 gene open 54143-54955
406 CABVDX010000003.1 GCA902497175_00193 gene open 55104-55325
407 CABVDX010000003.1 GCA902497175_00194 gene open 55483-56469
408 CABVDX010000003.1 GCA902497175_00195 gene open 56500-57429 oxyR
409 CABVDX010000003.1 GCA902497175_00196 gene open 57603-58121 ompH
410 CABVDX010000003.1 GCA902497175_00197 gene open 58271-58780
411 CABVDX010000003.1 GCA902497175_00198 gene open 58970-60292 dacB
412 CABVDX010000003.1 GCA902497175_00199 gene open 60551-63244
413 CABVDX010000003.1 GCA902497175_00200 gene open 63254-65938
414 CABVDX010000003.1 GCA902497175_00201 gene open 66152-67642
415 CABVDX010000003.1 GCA902497175_00202 gene open 67648-68382
416 CABVDX010000003.1 GCA902497175_00203 gene open 68467-69909
417 CABVDX010000003.1 GCA902497175_00204 gene open 69930-72956
418 CABVDX010000003.1 GCA902497175_00205 gene open 74402-77182
419 CABVDX010000003.1 GCA902497175_00206 gene open 77306-77638
420 CABVDX010000003.1 GCA902497175_00207 gene open 77746-80580 leuS
421 CABVDX010000003.1 GCA902497175_00208 gene open 80783-81796
422 CABVDX010000003.1 GCA902497175_00209 gene open 82011-82589
423 CABVDX010000003.1 GCA902497175_00210 gene open 82641-85028
424 CABVDX010000003.1 GCA902497175_00211 gene open 85234-85500
425 CABVDX010000003.1 GCA902497175_00212 gene open 85747-86751
426 CABVDX010000003.1 GCA902497175_00213 gene open 86799-87290
427 CABVDX010000003.1 GCA902497175_00172 gene open 28695-28768 trnP
428 CABVDX010000003.1 GCA902497175_00172 tRNA open 28695-28768 trnP tRNA-Pro(ggg)
429 CABVDX010000004.1 regulatory_region open 62970-63028 SAM-II riboswitch aptamer (SAM-II long loop)
430 CABVDX010000004.1 GCA902497175_00214 CDS open 165-689 _na     174_aa hypothetical protein
431 CABVDX010000004.1 GCA902497175_00215 CDS open 1383-2234 _na     283_aa Polysaccharide biosynthesis/export protein
432 CABVDX010000004.1 GCA902497175_00216 CDS open 2247-2771 _na     174_aa hypothetical protein
433 CABVDX010000004.1 GCA902497175_00217 CDS open 2731-4662 _na     643_aa Tyrosine kinase G-rich domain-containing protein
434 CABVDX010000004.1 GCA902497175_00218 CDS open 4798-5613 _na     271_aa hypothetical protein
435 CABVDX010000004.1 GCA902497175_00219 CDS open 5632-6630 _na     332_aa Glycosyltransferase%2C group 2 family protein
436 CABVDX010000004.1 GCA902497175_00220 CDS open 7191-8750 _na     519_aa MATE domain protein
437 CABVDX010000004.1 GCA902497175_00221 CDS open 8798-9778 _na     326_aa Glycosyltransferase%2C family 8
438 CABVDX010000004.1 GCA902497175_00222 CDS open 9984-10937 _na     317_aa Glycosyltransferase%2C family 8
439 CABVDX010000004.1 GCA902497175_00223 CDS open 10945-11985 _na     346_aa Glycosyltransferase%2C group 2 family protein
440 CABVDX010000004.1 GCA902497175_00224 CDS open 11955-13160 _na     401_aa Glycosyltransferase%2C group 1 family protein
441 CABVDX010000004.1 GCA902497175_00225 CDS open 13108-13227 _na     39_aa hypothetical protein
442 CABVDX010000004.1 GCA902497175_00226 CDS open 13224-14228 _na     334_aa Acyltransferase 3 domain-containing protein
443 CABVDX010000004.1 GCA902497175_00227 CDS open 14242-14985 _na     247_aa Glycosyltransferase sugar-binding region containing DXD motif
444 CABVDX010000004.1 GCA902497175_00228 CDS open 15124-16104 _na     326_aa epsG EpsG family protein
445 CABVDX010000004.1 GCA902497175_00229 CDS open 16131-17024 _na     297_aa Glycosyltransferase%2C group 2 family protein
446 CABVDX010000004.1 GCA902497175_00230 CDS open 17006-17992 _na     328_aa Glycosyltransferase 2-like domain-containing protein
447 CABVDX010000004.1 GCA902497175_00231 CDS open 18018-19106 _na     362_aa Glycosyltransferase%2C group 1 family protein
448 CABVDX010000004.1 GCA902497175_00232 CDS open 19119-20282 _na     387_aa Glycosyltransferase%2C group 1 family protein
449 CABVDX010000004.1 GCA902497175_00233 CDS open 20279-20890 _na     203_aa N-acetyltransferase domain-containing protein
450 CABVDX010000004.1 GCA902497175_00234 CDS open 21053-21532 _na     159_aa Bacterial sugar transferase
451 CABVDX010000004.1 GCA902497175_00235 CDS open 21529-22683 _na     384_aa DegT/DnrJ/EryC1/StrS aminotransferase family protein
452 CABVDX010000004.1 GCA902497175_00236 CDS open 22908-24488 _na     526_aa wbiI Epimerase/dehydratase WbiI domain protein
453 CABVDX010000004.1 GCA902497175_00237 CDS open 24533-26347 _na     604_aa ompA OmpA family protein
454 CABVDX010000004.1 GCA902497175_00238 CDS open 26532-26849 _na     105_aa UPF0145 protein HMPREF9999_02345
455 CABVDX010000004.1 GCA902497175_00239 CDS open 26961-27626 _na     221_aa ribonuclease HII
456 CABVDX010000004.1 GCA902497175_00240 CDS open 27642-30125 _na     827_aa priA primosomal protein N'
457 CABVDX010000004.1 GCA902497175_00241 CDS open 30314-30730 _na     138_aa DUF2946 domain-containing protein
458 CABVDX010000004.1 GCA902497175_00242 CDS open 30984-33320 _na     778_aa TonB-dependent receptor
459 CABVDX010000004.1 GCA902497175_00243 CDS open 33377-34150 _na     257_aa Lipoprotein
460 CABVDX010000004.1 GCA902497175_00244 CDS open 34179-35228 _na     349_aa Lipoprotein
461 CABVDX010000004.1 GCA902497175_00245 CDS open 35354-36691 _na     445_aa NADP-specific glutamate dehydrogenase
462 CABVDX010000004.1 GCA902497175_00246 CDS open 36946-37938 _na     330_aa Lactate/malate dehydrogenase%2C NAD binding domain protein
463 CABVDX010000004.1 GCA902497175_00247 CDS open 38046-38537 _na     163_aa hypothetical protein
464 CABVDX010000004.1 GCA902497175_00249 CDS open 39994-41475 _na     493_aa Polysaccharide biosynthesis protein
465 CABVDX010000004.1 GCA902497175_00250 CDS open 41628-42947 _na     439_aa Peptidase M16 inactive domain protein
466 CABVDX010000004.1 GCA902497175_00251 CDS open 43196-45406 _na     736_aa pnp polyribonucleotide nucleotidyltransferase
467 CABVDX010000004.1 GCA902497175_00252 CDS open 45924-47354 _na     476_aa ATPase family protein
468 CABVDX010000004.1 GCA902497175_00253 CDS open 47347-48708 _na     453_aa McrBC 5-methylcytosine restriction system component
469 CABVDX010000004.1 GCA902497175_00254 CDS open 49374-50915 _na     513_aa glycine--tRNA ligase
470 CABVDX010000004.1 GCA902497175_00255 CDS open 50982-51710 _na     242_aa Peptidyl-prolyl cis-trans isomerase
471 CABVDX010000004.1 GCA902497175_00256 CDS open 51781-51876 _na     31_aa hypothetical protein
472 CABVDX010000004.1 GCA902497175_00257 CDS open 51901-52653 _na     250_aa sufC Fe-S cluster assembly ATPase SufC
473 CABVDX010000004.1 GCA902497175_00258 CDS open 52752-54122 _na     456_aa sufD Fe-S cluster assembly protein SufD
474 CABVDX010000004.1 GCA902497175_00259 CDS open 54292-55497 _na     401_aa Cysteine desulfurase
475 CABVDX010000004.1 GCA902497175_00260 CDS open 56125-56250 _na     41_aa 50S ribosomal protein L29 domain protein
476 CABVDX010000004.1 GCA902497175_00261 CDS open 57648-60605 _na     985_aa PEP/pyruvate-binding domain-containing protein
477 CABVDX010000004.1 GCA902497175_00262 CDS open 60971-62029 _na     352_aa rsgA ribosome small subunit-dependent GTPase A
478 CABVDX010000004.1 GCA902497175_00263 CDS open 62123-62683 _na     186_aa frr ribosome recycling factor
479 CABVDX010000004.1 GCA902497175_00264 CDS open 63206-64501 _na     431_aa metK methionine adenosyltransferase
480 CABVDX010000004.1 GCA902497175_00265 CDS open 64624-65199 _na     191_aa Cytokinin riboside 5'-monophosphate phosphoribohydrolase
481 CABVDX010000004.1 GCA902497175_00266 CDS open 65319-66308 _na     329_aa DUF4271 domain-containing protein
482 CABVDX010000004.1 GCA902497175_00267 CDS open 66366-67100 _na     244_aa Tetrapyrrole biosynthesis uroporphyrinogen III synthase domain-containing protein
483 CABVDX010000004.1 GCA902497175_00268 CDS open 67287-67751 _na     154_aa Ribonuclease P protein component
484 CABVDX010000004.1 GCA902497175_00269 CDS open 67766-68002 _na     78_aa yidD membrane protein insertion efficiency factor YidD
485 CABVDX010000004.1 GCA902497175_00270 CDS open 68142-68711 _na     189_aa tatD Hydrolase%2C TatD family
486 CABVDX010000004.1 GCA902497175_00271 CDS open 69203-71017 _na     604_aa AMP-binding enzyme
487 CABVDX010000004.1 GCA902497175_00272 CDS open 71242-71838 _na     198_aa hypothetical protein
488 CABVDX010000004.1 GCA902497175_00273 CDS open 71838-74069 _na     743_aa Peptidase M16 inactive domain protein
489 CABVDX010000004.1 GCA902497175_00274 CDS open 74343-78035 _na     1230_aa hypothetical protein
490 CABVDX010000004.1 GCA902497175_00275 CDS open 78861-79121 _na     86_aa hypothetical protein
491 CABVDX010000004.1 GCA902497175_00276 CDS open 79275-80570 _na     431_aa tyrS tyrosine--tRNA ligase
492 CABVDX010000004.1 GCA902497175_00277 CDS open 80775-81893 _na     372_aa murG undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase
493 CABVDX010000004.1 GCA902497175_00214 gene open 165-689
494 CABVDX010000004.1 GCA902497175_00215 gene open 1383-2234
495 CABVDX010000004.1 GCA902497175_00216 gene open 2247-2771
496 CABVDX010000004.1 GCA902497175_00217 gene open 2731-4662
497 CABVDX010000004.1 GCA902497175_00218 gene open 4798-5613
498 CABVDX010000004.1 GCA902497175_00219 gene open 5632-6630
499 CABVDX010000004.1 GCA902497175_00220 gene open 7191-8750
500 CABVDX010000004.1 GCA902497175_00221 gene open 8798-9778