HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Gemella morbillorum (GCA_905371775.1)

Select a Genome:
BAKTA Annotations for GCA_905371775.1
Genome Selected: Gemella morbillorum
ContigsBases CDSrRNA tmRNAtRNA
115 1570595 1515 0 1 21
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3098 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:4]    |    Number of Records Found: 3098 [7 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer
Range
(bp)
Show Sequences
(length) NA / AA
BAKTA
Gene
BAKTA
GeneProduct
1501 CAJPMP010000023.1 GCA905371775_00737 gene open 9649-9852 csbD
1502 CAJPMP010000023.1 GCA905371775_00738 gene open 9880-10083 csbD
1503 CAJPMP010000023.1 GCA905371775_00739 gene open 11023-11841
1504 CAJPMP010000023.1 GCA905371775_00740 gene open 12041-12619 ygaC
1505 CAJPMP010000023.1 GCA905371775_00741 gene open 12606-13418
1506 CAJPMP010000023.1 GCA905371775_00742 gene open 13411-14295
1507 CAJPMP010000023.1 GCA905371775_00743 gene open 14500-14895
1508 CAJPMP010000023.1 GCA905371775_00744 gene open 15178-15567
1509 CAJPMP010000023.1 GCA905371775_00745 gene open 15727-16110
1510 CAJPMP010000023.1 GCA905371775_00746 gene open 16121-16369
1511 CAJPMP010000023.1 GCA905371775_00747 gene open 16464-16865
1512 CAJPMP010000023.1 GCA905371775_00748 gene open 16872-17111
1513 CAJPMP010000023.1 GCA905371775_00749 gene open 17208-17438
1514 CAJPMP010000023.1 GCA905371775_00750 gene open 17602-17820
1515 CAJPMP010000023.1 GCA905371775_00751 gene open 17916-18311
1516 CAJPMP010000023.1 GCA905371775_00752 gene open 18315-18434
1517 CAJPMP010000023.1 GCA905371775_00753 gene open 18571-18840
1518 CAJPMP010000023.1 GCA905371775_00754 gene open 18869-19318
1519 CAJPMP010000024.1 GCA905371775_00755 CDS open 322-1014 _na     230_aa yjbM RelA/SpoT domain-containing protein
1520 CAJPMP010000024.1 GCA905371775_00756 CDS open 1468-3651 _na     727_aa nrdD anaerobic ribonucleoside-triphosphate reductase
1521 CAJPMP010000024.1 GCA905371775_00757 CDS open 3819-4583 _na     254_aa Gas vesicle protein
1522 CAJPMP010000024.1 GCA905371775_00758 CDS open 4640-5065 _na     141_aa HIT domain-containing protein
1523 CAJPMP010000024.1 GCA905371775_00759 CDS open 5078-5902 _na     274_aa purine-nucleoside phosphorylase
1524 CAJPMP010000024.1 GCA905371775_00760 CDS open 6053-7165 _na     370_aa BMP family ABC transporter substrate-binding protein
1525 CAJPMP010000024.1 GCA905371775_00761 CDS open 7627-8736 _na     369_aa BMP family ABC transporter substrate-binding protein
1526 CAJPMP010000024.1 GCA905371775_00762 CDS open 9072-10583 _na     503_aa nupO ABC transporter domain-containing protein
1527 CAJPMP010000024.1 GCA905371775_00763 CDS open 10596-11654 _na     352_aa nupP Branched-chain amino acid ABC transporter%2C permease protein
1528 CAJPMP010000024.1 GCA905371775_00764 CDS open 11655-12575 _na     306_aa nupQ Branched-chain amino acid ABC transporter%2C permease protein
1529 CAJPMP010000024.1 GCA905371775_00765 CDS open 12739-13446 _na     235_aa Lipoprotein
1530 CAJPMP010000024.1 GCA905371775_00766 CDS open 13746-15326 _na     526_aa restriction endonuclease subunit S
1531 CAJPMP010000024.1 GCA905371775_00767 CDS open 15319-17295 _na     658_aa N-6 DNA methylase
1532 CAJPMP010000024.1 GCA905371775_00768 CDS open 17860-18108 _na     82_aa hypothetical protein
1533 CAJPMP010000024.1 GCA905371775_00769 CDS open 18130-18795 _na     221_aa CAAX amino terminal protease family protein
1534 CAJPMP010000024.1 GCA905371775_00755 gene open 322-1014 yjbM
1535 CAJPMP010000024.1 GCA905371775_00756 gene open 1468-3651 nrdD
1536 CAJPMP010000024.1 GCA905371775_00757 gene open 3819-4583
1537 CAJPMP010000024.1 GCA905371775_00758 gene open 4640-5065
1538 CAJPMP010000024.1 GCA905371775_00759 gene open 5078-5902
1539 CAJPMP010000024.1 GCA905371775_00760 gene open 6053-7165
1540 CAJPMP010000024.1 GCA905371775_00761 gene open 7627-8736
1541 CAJPMP010000024.1 GCA905371775_00762 gene open 9072-10583 nupO
1542 CAJPMP010000024.1 GCA905371775_00763 gene open 10596-11654 nupP
1543 CAJPMP010000024.1 GCA905371775_00764 gene open 11655-12575 nupQ
1544 CAJPMP010000024.1 GCA905371775_00765 gene open 12739-13446
1545 CAJPMP010000024.1 GCA905371775_00766 gene open 13746-15326
1546 CAJPMP010000024.1 GCA905371775_00767 gene open 15319-17295
1547 CAJPMP010000024.1 GCA905371775_00768 gene open 17860-18108
1548 CAJPMP010000024.1 GCA905371775_00769 gene open 18130-18795
1549 CAJPMP010000025.1 GCA905371775_00770 CDS open 226-1245 _na     339_aa gap type I glyceraldehyde-3-phosphate dehydrogenase
1550 CAJPMP010000025.1 GCA905371775_00771 CDS open 1604-4081 _na     825_aa YSIRK-type signal peptide-containing protein
1551 CAJPMP010000025.1 GCA905371775_00772 CDS open 4185-7088 _na     967_aa MucBP domain-containing protein
1552 CAJPMP010000025.1 GCA905371775_00773 CDS open 7191-11861 _na     1556_aa leucine-rich repeat domain-containing protein
1553 CAJPMP010000025.1 GCA905371775_00774 CDS open 11906-13675 _na     589_aa Glycerophosphodiester phosphodiesterase
1554 CAJPMP010000025.1 GCA905371775_00775 CDS open 13916-15415 _na     499_aa protein-N(pi)-phosphohistidine--sucrose phosphotransferase
1555 CAJPMP010000025.1 GCA905371775_00776 CDS open 15405-16715 _na     436_aa beta-fructofuranosidase
1556 CAJPMP010000025.1 GCA905371775_00777 CDS open 16717-17655 _na     312_aa pfkB Kinase%2C PfkB family
1557 CAJPMP010000025.1 GCA905371775_00770 gene open 226-1245 gap
1558 CAJPMP010000025.1 GCA905371775_00771 gene open 1604-4081
1559 CAJPMP010000025.1 GCA905371775_00772 gene open 4185-7088
1560 CAJPMP010000025.1 GCA905371775_00773 gene open 7191-11861
1561 CAJPMP010000025.1 GCA905371775_00774 gene open 11906-13675
1562 CAJPMP010000025.1 GCA905371775_00775 gene open 13916-15415
1563 CAJPMP010000025.1 GCA905371775_00776 gene open 15405-16715
1564 CAJPMP010000025.1 GCA905371775_00777 gene open 16717-17655 pfkB
1565 CAJPMP010000026.1 GCA905371775_00778 CDS open 60-2426 _na     788_aa DUF4040 domain-containing protein
1566 CAJPMP010000026.1 GCA905371775_00779 CDS open 2416-2841 _na     141_aa mnhB Na+/H+ antiporter MnhB subunit-related protein domain-containing protein
1567 CAJPMP010000026.1 GCA905371775_00780 CDS open 2841-3200 _na     119_aa Na(+)/H(+) antiporter subunit C
1568 CAJPMP010000026.1 GCA905371775_00781 CDS open 3193-4674 _na     493_aa Sodium:proton antiporter
1569 CAJPMP010000026.1 GCA905371775_00782 CDS open 4677-5174 _na     165_aa Na+/H+ antiporter subunit E
1570 CAJPMP010000026.1 GCA905371775_00783 CDS open 5167-5457 _na     96_aa Multiple resistance and pH regulation protein F
1571 CAJPMP010000026.1 GCA905371775_00784 CDS open 5444-5815 _na     123_aa Cation:proton antiporter
1572 CAJPMP010000026.1 GCA905371775_00785 CDS open 5848-7155 _na     435_aa mpfA CBS domain protein
1573 CAJPMP010000026.1 GCA905371775_00786 CDS open 7399-8658 _na     419_aa gdhA Glutamate dehydrogenase
1574 CAJPMP010000026.1 GCA905371775_00787 CDS open 8902-11523 _na     873_aa polA DNA polymerase I
1575 CAJPMP010000026.1 GCA905371775_00788 CDS open 11608-12747 _na     379_aa Glycosyltransferase
1576 CAJPMP010000026.1 GCA905371775_00789 CDS open 12915-13640 _na     241_aa Rhodanese-like domain-containing protein
1577 CAJPMP010000026.1 GCA905371775_00790 CDS open 13794-15320 _na     508_aa ClC family H(+)/Cl(-) exchange transporter
1578 CAJPMP010000026.1 GCA905371775_00791 CDS open 15376-16176 _na     266_aa Cof-type HAD-IIB family hydrolase
1579 CAJPMP010000026.1 GCA905371775_00792 CDS open 16192-17190 _na     332_aa lacI LacI family DNA-binding transcriptional regulator
1580 CAJPMP010000026.1 GCA905371775_00778 gene open 60-2426
1581 CAJPMP010000026.1 GCA905371775_00779 gene open 2416-2841 mnhB
1582 CAJPMP010000026.1 GCA905371775_00780 gene open 2841-3200
1583 CAJPMP010000026.1 GCA905371775_00781 gene open 3193-4674
1584 CAJPMP010000026.1 GCA905371775_00782 gene open 4677-5174
1585 CAJPMP010000026.1 GCA905371775_00783 gene open 5167-5457
1586 CAJPMP010000026.1 GCA905371775_00784 gene open 5444-5815
1587 CAJPMP010000026.1 GCA905371775_00785 gene open 5848-7155 mpfA
1588 CAJPMP010000026.1 GCA905371775_00786 gene open 7399-8658 gdhA
1589 CAJPMP010000026.1 GCA905371775_00787 gene open 8902-11523 polA
1590 CAJPMP010000026.1 GCA905371775_00788 gene open 11608-12747
1591 CAJPMP010000026.1 GCA905371775_00789 gene open 12915-13640
1592 CAJPMP010000026.1 GCA905371775_00790 gene open 13794-15320
1593 CAJPMP010000026.1 GCA905371775_00791 gene open 15376-16176
1594 CAJPMP010000026.1 GCA905371775_00792 gene open 16192-17190 lacI
1595 CAJPMP010000027.1 GCA905371775_00793 CDS open 58-6762 _na     2234_aa spaA SpaA isopeptide-forming pilin-related protein
1596 CAJPMP010000027.1 GCA905371775_00794 CDS open 7214-8818 _na     534_aa SHIRT domain-containing protein
1597 CAJPMP010000027.1 GCA905371775_00795 CDS open 9037-9975 _na     312_aa hypothetical protein
1598 CAJPMP010000027.1 GCA905371775_00796 CDS open 10010-10744 _na     244_aa phosphoserine phosphatase
1599 CAJPMP010000027.1 GCA905371775_00797 CDS open 10873-12564 _na     563_aa M3 family oligoendopeptidase
1600 CAJPMP010000027.1 GCA905371775_00798 CDS open 12832-13452 _na     206_aa fic protein adenylyltransferase Fic
1601 CAJPMP010000027.1 GCA905371775_00799 CDS open 13676-14230 _na     184_aa def peptide deformylase
1602 CAJPMP010000027.1 GCA905371775_00800 CDS open 14364-14810 _na     148_aa yehR YehR family lipoprotein
1603 CAJPMP010000027.1 GCA905371775_00801 CDS open 14849-15967 _na     372_aa prfB peptide chain release factor 2
1604 CAJPMP010000027.1 GCA905371775_00802 CDS open 16126-16569 _na     147_aa Lipoprotein
1605 CAJPMP010000027.1 GCA905371775_00803 CDS open 16594-17037 _na     147_aa DUF1307 domain-containing protein
1606 CAJPMP010000027.1 GCA905371775_00793 gene open 58-6762 spaA
1607 CAJPMP010000027.1 GCA905371775_00794 gene open 7214-8818
1608 CAJPMP010000027.1 GCA905371775_00795 gene open 9037-9975
1609 CAJPMP010000027.1 GCA905371775_00796 gene open 10010-10744
1610 CAJPMP010000027.1 GCA905371775_00797 gene open 10873-12564
1611 CAJPMP010000027.1 GCA905371775_00798 gene open 12832-13452 fic
1612 CAJPMP010000027.1 GCA905371775_00799 gene open 13676-14230 def
1613 CAJPMP010000027.1 GCA905371775_00800 gene open 14364-14810 yehR
1614 CAJPMP010000027.1 GCA905371775_00801 gene open 14849-15967 prfB
1615 CAJPMP010000027.1 GCA905371775_00802 gene open 16126-16569
1616 CAJPMP010000027.1 GCA905371775_00803 gene open 16594-17037
1617 CAJPMP010000028.1 GCA905371775_00804 CDS open 615-1751 _na     378_aa Nuclease SbcCD subunit D
1618 CAJPMP010000028.1 GCA905371775_00805 CDS open 1844-3148 _na     434_aa rseP RIP metalloprotease RseP
1619 CAJPMP010000028.1 GCA905371775_00806 CDS open 3166-3939 _na     257_aa Phosphatidate cytidylyltransferase
1620 CAJPMP010000028.1 GCA905371775_00807 CDS open 3929-4693 _na     254_aa isoprenyl transferase
1621 CAJPMP010000028.1 GCA905371775_00808 CDS open 5224-6243 _na     339_aa ATP-binding cassette domain-containing protein
1622 CAJPMP010000028.1 GCA905371775_00809 CDS open 6233-6913 _na     226_aa metP ABC transmembrane type-1 domain-containing protein
1623 CAJPMP010000028.1 GCA905371775_00810 CDS open 6934-7758 _na     274_aa Lipoprotein
1624 CAJPMP010000028.1 GCA905371775_00811 CDS open 7779-8951 _na     390_aa Aminotransferase
1625 CAJPMP010000028.1 GCA905371775_00812 CDS open 8995-9480 _na     161_aa lysM LysM peptidoglycan-binding domain-containing protein
1626 CAJPMP010000028.1 GCA905371775_00813 CDS open 9497-9673 _na     58_aa DUF6501 domain-containing protein
1627 CAJPMP010000028.1 GCA905371775_00814 CDS open 9784-11226 _na     480_aa panF sodium/pantothenate symporter
1628 CAJPMP010000028.1 GCA905371775_00815 CDS open 11226-11471 _na     81_aa DUF997 domain-containing protein
1629 CAJPMP010000028.1 GCA905371775_00816 CDS open 11459-12067 _na     202_aa Phosphatase PAP2 family protein
1630 CAJPMP010000028.1 GCA905371775_00817 CDS open 12069-13151 _na     360_aa undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase
1631 CAJPMP010000028.1 GCA905371775_00818 CDS open 13154-13645 _na     163_aa coaD pantetheine-phosphate adenylyltransferase
1632 CAJPMP010000028.1 GCA905371775_00819 CDS open 13648-14199 _na     183_aa rsmD 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD
1633 CAJPMP010000028.1 GCA905371775_00820 CDS open 14324-14596 _na     90_aa DUF2129 domain-containing protein
1634 CAJPMP010000028.1 GCA905371775_00821 CDS open 14605-16692 _na     695_aa pnp polyribonucleotide nucleotidyltransferase
1635 CAJPMP010000028.1 GCA905371775_00804 gene open 615-1751
1636 CAJPMP010000028.1 GCA905371775_00805 gene open 1844-3148 rseP
1637 CAJPMP010000028.1 GCA905371775_00806 gene open 3166-3939
1638 CAJPMP010000028.1 GCA905371775_00807 gene open 3929-4693
1639 CAJPMP010000028.1 GCA905371775_00808 gene open 5224-6243
1640 CAJPMP010000028.1 GCA905371775_00809 gene open 6233-6913 metP
1641 CAJPMP010000028.1 GCA905371775_00810 gene open 6934-7758
1642 CAJPMP010000028.1 GCA905371775_00811 gene open 7779-8951
1643 CAJPMP010000028.1 GCA905371775_00812 gene open 8995-9480 lysM
1644 CAJPMP010000028.1 GCA905371775_00813 gene open 9497-9673
1645 CAJPMP010000028.1 GCA905371775_00814 gene open 9784-11226 panF
1646 CAJPMP010000028.1 GCA905371775_00815 gene open 11226-11471
1647 CAJPMP010000028.1 GCA905371775_00816 gene open 11459-12067
1648 CAJPMP010000028.1 GCA905371775_00817 gene open 12069-13151
1649 CAJPMP010000028.1 GCA905371775_00818 gene open 13154-13645 coaD
1650 CAJPMP010000028.1 GCA905371775_00819 gene open 13648-14199 rsmD
1651 CAJPMP010000028.1 GCA905371775_00820 gene open 14324-14596
1652 CAJPMP010000028.1 GCA905371775_00821 gene open 14605-16692 pnp
1653 CAJPMP010000029.1 GCA905371775_00822 CDS open 838-2511 _na     557_aa DUF2971 domain-containing protein
1654 CAJPMP010000029.1 GCA905371775_00823 CDS open 2647-3888 _na     413_aa site-specific integrase
1655 CAJPMP010000029.1 GCA905371775_00824 CDS open 3888-4088 _na     66_aa DUF3173 domain-containing protein
1656 CAJPMP010000029.1 GCA905371775_00825 CDS open 4299-5999 _na     566_aa DUF927 domain-containing protein
1657 CAJPMP010000029.1 GCA905371775_00826 CDS open 5989-6408 _na     139_aa hypothetical protein
1658 CAJPMP010000029.1 GCA905371775_00827 CDS open 6612-8423 _na     603_aa hypothetical protein
1659 CAJPMP010000029.1 GCA905371775_00828 CDS open 8457-8963 _na     168_aa DUF1643 domain-containing protein
1660 CAJPMP010000029.1 GCA905371775_00829 CDS open 9071-9361 _na     96_aa hypothetical protein
1661 CAJPMP010000029.1 GCA905371775_00830 CDS open 9355-9813 _na     152_aa radC RadC family protein
1662 CAJPMP010000029.1 GCA905371775_00831 CDS open 9888-11099 _na     403_aa prsW PrsW family intramembrane metalloprotease
1663 CAJPMP010000029.1 GCA905371775_00832 CDS open 11256-12239 _na     327_aa zinc-ribbon domain-containing protein
1664 CAJPMP010000029.1 GCA905371775_00833 CDS open 12394-13245 _na     283_aa hypothetical protein
1665 CAJPMP010000029.1 GCA905371775_00834 CDS open 13238-13534 _na     98_aa Mor transcription activator family protein
1666 CAJPMP010000029.1 GCA905371775_00835 CDS open 13831-14514 _na     227_aa DUF5986 domain-containing protein
1667 CAJPMP010000029.1 GCA905371775_00836 CDS open 14527-15687 _na     386_aa XRE family transcriptional regulator
1668 CAJPMP010000029.1 GCA905371775_00837 CDS open 15679-16281 _na     200_aa Helix-turn-helix domain-containing protein
1669 CAJPMP010000029.1 GCA905371775_00838 CDS open 16442-16879 _na     145_aa tipC TipC family immunity protein
1670 CAJPMP010000029.1 GCA905371775_00822 gene open 838-2511
1671 CAJPMP010000029.1 GCA905371775_00823 gene open 2647-3888
1672 CAJPMP010000029.1 GCA905371775_00824 gene open 3888-4088
1673 CAJPMP010000029.1 GCA905371775_00825 gene open 4299-5999
1674 CAJPMP010000029.1 GCA905371775_00826 gene open 5989-6408
1675 CAJPMP010000029.1 GCA905371775_00827 gene open 6612-8423
1676 CAJPMP010000029.1 GCA905371775_00828 gene open 8457-8963
1677 CAJPMP010000029.1 GCA905371775_00829 gene open 9071-9361
1678 CAJPMP010000029.1 GCA905371775_00830 gene open 9355-9813 radC
1679 CAJPMP010000029.1 GCA905371775_00831 gene open 9888-11099 prsW
1680 CAJPMP010000029.1 GCA905371775_00832 gene open 11256-12239
1681 CAJPMP010000029.1 GCA905371775_00833 gene open 12394-13245
1682 CAJPMP010000029.1 GCA905371775_00834 gene open 13238-13534
1683 CAJPMP010000029.1 GCA905371775_00835 gene open 13831-14514
1684 CAJPMP010000029.1 GCA905371775_00836 gene open 14527-15687
1685 CAJPMP010000029.1 GCA905371775_00837 gene open 15679-16281
1686 CAJPMP010000029.1 GCA905371775_00838 gene open 16442-16879 tipC
1687 CAJPMP010000030.1 GCA905371775_00855 gene open 14768-14832 Bacilli-1
1688 CAJPMP010000030.1 GCA905371775_00855 ncRNA open 14768-14832 Bacilli-1 RNA
1689 CAJPMP010000030.1 GCA905371775_00839 CDS open 81-2480 _na     799_aa LPXTG cell wall anchor domain-containing protein
1690 CAJPMP010000030.1 GCA905371775_00840 CDS open 2546-2950 _na     134_aa F0F1 ATP synthase subunit epsilon
1691 CAJPMP010000030.1 GCA905371775_00841 CDS open 2970-4385 _na     471_aa atpD F0F1 ATP synthase subunit beta
1692 CAJPMP010000030.1 GCA905371775_00842 CDS open 4426-5295 _na     289_aa atpG ATP synthase F1 subunit gamma
1693 CAJPMP010000030.1 GCA905371775_00843 CDS open 5327-6829 _na     500_aa atpA F0F1 ATP synthase subunit alpha
1694 CAJPMP010000030.1 GCA905371775_00844 CDS open 6857-7396 _na     179_aa atpH ATP synthase F1 subunit delta
1695 CAJPMP010000030.1 GCA905371775_00845 CDS open 7396-7920 _na     174_aa atpF F0F1 ATP synthase subunit B
1696 CAJPMP010000030.1 GCA905371775_00846 CDS open 7973-8188 _na     71_aa atpE F0F1 ATP synthase subunit C
1697 CAJPMP010000030.1 GCA905371775_00847 CDS open 8271-8999 _na     242_aa atpB F0F1 ATP synthase subunit A
1698 CAJPMP010000030.1 GCA905371775_00848 CDS open 9161-9790 _na     209_aa upp uracil phosphoribosyltransferase
1699 CAJPMP010000030.1 GCA905371775_00849 CDS open 9978-10295 _na     105_aa hypothetical protein
1700 CAJPMP010000030.1 GCA905371775_00850 CDS open 10313-10840 _na     175_aa Polymerase
1701 CAJPMP010000030.1 GCA905371775_00851 CDS open 10890-11522 _na     210_aa Peptidase
1702 CAJPMP010000030.1 GCA905371775_00852 CDS open 11704-13047 _na     447_aa histidine kinase
1703 CAJPMP010000030.1 GCA905371775_00853 CDS open 13031-13702 _na     223_aa Response regulator
1704 CAJPMP010000030.1 GCA905371775_00854 CDS open 14117-14638 _na     173_aa PBECR4 domain-containing protein
1705 CAJPMP010000030.1 GCA905371775_00856 CDS open 15435-16190 _na     251_aa RNA polymerase sigma factor%2C sigma-70 family
1706 CAJPMP010000030.1 GCA905371775_00857 CDS open 16232-16459 _na     75_aa hypothetical protein
1707 CAJPMP010000030.1 GCA905371775_00839 gene open 81-2480
1708 CAJPMP010000030.1 GCA905371775_00840 gene open 2546-2950
1709 CAJPMP010000030.1 GCA905371775_00841 gene open 2970-4385 atpD
1710 CAJPMP010000030.1 GCA905371775_00842 gene open 4426-5295 atpG
1711 CAJPMP010000030.1 GCA905371775_00843 gene open 5327-6829 atpA
1712 CAJPMP010000030.1 GCA905371775_00844 gene open 6857-7396 atpH
1713 CAJPMP010000030.1 GCA905371775_00845 gene open 7396-7920 atpF
1714 CAJPMP010000030.1 GCA905371775_00846 gene open 7973-8188 atpE
1715 CAJPMP010000030.1 GCA905371775_00847 gene open 8271-8999 atpB
1716 CAJPMP010000030.1 GCA905371775_00848 gene open 9161-9790 upp
1717 CAJPMP010000030.1 GCA905371775_00849 gene open 9978-10295
1718 CAJPMP010000030.1 GCA905371775_00850 gene open 10313-10840
1719 CAJPMP010000030.1 GCA905371775_00851 gene open 10890-11522
1720 CAJPMP010000030.1 GCA905371775_00852 gene open 11704-13047
1721 CAJPMP010000030.1 GCA905371775_00853 gene open 13031-13702
1722 CAJPMP010000030.1 GCA905371775_00854 gene open 14117-14638
1723 CAJPMP010000030.1 GCA905371775_00856 gene open 15435-16190
1724 CAJPMP010000030.1 GCA905371775_00857 gene open 16232-16459
1725 CAJPMP010000031.1 GCA905371775_00858 CDS open 46-2136 _na     696_aa LPXTG cell wall anchor domain-containing protein
1726 CAJPMP010000031.1 GCA905371775_00859 CDS open 2273-2641 _na     122_aa Single-stranded DNA-binding protein
1727 CAJPMP010000031.1 GCA905371775_00860 CDS open 2694-2978 _na     94_aa DUF1637 domain-containing protein
1728 CAJPMP010000031.1 GCA905371775_00861 CDS open 3034-3789 _na     251_aa class I SAM-dependent methyltransferase
1729 CAJPMP010000031.1 GCA905371775_00862 CDS open 4098-4742 _na     214_aa NAD(P)H-binding protein
1730 CAJPMP010000031.1 GCA905371775_00863 CDS open 4759-5118 _na     119_aa DUF1304 domain-containing protein
1731 CAJPMP010000031.1 GCA905371775_00864 CDS open 5133-5546 _na     137_aa sarZ HTH-type transcriptional regulator SarZ
1732 CAJPMP010000031.1 GCA905371775_00865 CDS open 5799-6455 _na     218_aa DNA alkylation repair protein
1733 CAJPMP010000031.1 GCA905371775_00866 CDS open 6458-8059 _na     533_aa pyrG CTP synthase
1734 CAJPMP010000031.1 GCA905371775_00867 CDS open 8206-8808 _na     200_aa lepB signal peptidase I
1735 CAJPMP010000031.1 GCA905371775_00868 CDS open 9168-9452 _na     94_aa Thiamine-binding protein domain-containing protein
1736 CAJPMP010000031.1 GCA905371775_00869 CDS open 9427-10212 _na     261_aa tauC ABC transmembrane type-1 domain-containing protein
1737 CAJPMP010000031.1 GCA905371775_00870 CDS open 10193-11188 _na     331_aa tauA SsuA/THI5-like domain-containing protein
1738 CAJPMP010000031.1 GCA905371775_00871 CDS open 11188-11907 _na     239_aa ATP-binding cassette domain-containing protein
1739 CAJPMP010000031.1 GCA905371775_00872 CDS open 12088-12702 _na     204_aa Lipoprotein
1740 CAJPMP010000031.1 GCA905371775_00873 CDS open 12847-13995 _na     382_aa Chloride channel protein
1741 CAJPMP010000031.1 GCA905371775_00874 CDS open 14068-14976 _na     302_aa DUF2179 domain-containing protein
1742 CAJPMP010000031.1 GCA905371775_00875 CDS open 15157-15675 _na     172_aa pssA CDP-diacylglycerol--serine O-phosphatidyltransferase
1743 CAJPMP010000031.1 GCA905371775_00876 CDS open 15722-16483 _na     253_aa Alpha/beta fold hydrolase
1744 CAJPMP010000031.1 GCA905371775_00858 gene open 46-2136
1745 CAJPMP010000031.1 GCA905371775_00859 gene open 2273-2641
1746 CAJPMP010000031.1 GCA905371775_00860 gene open 2694-2978
1747 CAJPMP010000031.1 GCA905371775_00861 gene open 3034-3789
1748 CAJPMP010000031.1 GCA905371775_00862 gene open 4098-4742
1749 CAJPMP010000031.1 GCA905371775_00863 gene open 4759-5118
1750 CAJPMP010000031.1 GCA905371775_00864 gene open 5133-5546 sarZ
1751 CAJPMP010000031.1 GCA905371775_00865 gene open 5799-6455
1752 CAJPMP010000031.1 GCA905371775_00866 gene open 6458-8059 pyrG
1753 CAJPMP010000031.1 GCA905371775_00867 gene open 8206-8808 lepB
1754 CAJPMP010000031.1 GCA905371775_00868 gene open 9168-9452
1755 CAJPMP010000031.1 GCA905371775_00869 gene open 9427-10212 tauC
1756 CAJPMP010000031.1 GCA905371775_00870 gene open 10193-11188 tauA
1757 CAJPMP010000031.1 GCA905371775_00871 gene open 11188-11907
1758 CAJPMP010000031.1 GCA905371775_00872 gene open 12088-12702
1759 CAJPMP010000031.1 GCA905371775_00873 gene open 12847-13995
1760 CAJPMP010000031.1 GCA905371775_00874 gene open 14068-14976
1761 CAJPMP010000031.1 GCA905371775_00875 gene open 15157-15675 pssA
1762 CAJPMP010000031.1 GCA905371775_00876 gene open 15722-16483
1763 CAJPMP010000032.1 GCA905371775_00877 CDS open 33-800 _na     255_aa phage tail tip lysozyme
1764 CAJPMP010000032.1 GCA905371775_00878 CDS open 961-1770 _na     269_aa yqxC Ribosomal RNA large subunit methyltransferase J
1765 CAJPMP010000032.1 GCA905371775_00879 CDS open 1782-3482 _na     566_aa recN DNA repair protein RecN
1766 CAJPMP010000032.1 GCA905371775_00880 CDS open 3508-4389 _na     293_aa rsgA ribosome small subunit-dependent GTPase A
1767 CAJPMP010000032.1 GCA905371775_00881 CDS open 4392-5036 _na     214_aa rpe ribulose-phosphate 3-epimerase
1768 CAJPMP010000032.1 GCA905371775_00882 CDS open 5036-5671 _na     211_aa thiamine diphosphokinase
1769 CAJPMP010000032.1 GCA905371775_00883 CDS open 5688-6533 _na     281_aa tauE putative membrane transporter protein
1770 CAJPMP010000032.1 GCA905371775_00884 CDS open 6535-6888 _na     117_aa DUF1634 domain-containing protein
1771 CAJPMP010000032.1 GCA905371775_00885 CDS open 7061-8443 _na     460_aa appC Bacterial cytochrome ubiquinol oxidase
1772 CAJPMP010000032.1 GCA905371775_00886 CDS open 8445-9473 _na     342_aa cydB cytochrome d ubiquinol oxidase subunit II
1773 CAJPMP010000032.1 GCA905371775_00887 CDS open 9477-11192 _na     571_aa cydD thiol reductant ABC exporter subunit CydD
1774 CAJPMP010000032.1 GCA905371775_00888 CDS open 11182-12921 _na     579_aa cydC thiol reductant ABC exporter subunit CydC
1775 CAJPMP010000032.1 GCA905371775_00889 CDS open 13134-15959 _na     941_aa uvrA excinuclease ABC subunit UvrA
1776 CAJPMP010000032.1 GCA905371775_00877 gene open 33-800
1777 CAJPMP010000032.1 GCA905371775_00878 gene open 961-1770 yqxC
1778 CAJPMP010000032.1 GCA905371775_00879 gene open 1782-3482 recN
1779 CAJPMP010000032.1 GCA905371775_00880 gene open 3508-4389 rsgA
1780 CAJPMP010000032.1 GCA905371775_00881 gene open 4392-5036 rpe
1781 CAJPMP010000032.1 GCA905371775_00882 gene open 5036-5671
1782 CAJPMP010000032.1 GCA905371775_00883 gene open 5688-6533 tauE
1783 CAJPMP010000032.1 GCA905371775_00884 gene open 6535-6888
1784 CAJPMP010000032.1 GCA905371775_00885 gene open 7061-8443 appC
1785 CAJPMP010000032.1 GCA905371775_00886 gene open 8445-9473 cydB
1786 CAJPMP010000032.1 GCA905371775_00887 gene open 9477-11192 cydD
1787 CAJPMP010000032.1 GCA905371775_00888 gene open 11182-12921 cydC
1788 CAJPMP010000032.1 GCA905371775_00889 gene open 13134-15959 uvrA
1789 CAJPMP010000033.1 repeat_region open 7916-8555 CRISPR array with 10 repeats of length 36%2C consensus sequence GTTTGAGAGATATGTAAATTTTGAATTCTACAAAAC and spacer length 29
1790 CAJPMP010000033.1 GCA905371775_00890 CDS open 131-1609 _na     492_aa Aldehyde dehydrogenase
1791 CAJPMP010000033.1 GCA905371775_00891 CDS open 1798-5964 _na     1388_aa cas9 type II CRISPR RNA-guided endonuclease Cas9
1792 CAJPMP010000033.1 GCA905371775_00892 CDS open 5939-6814 _na     291_aa cas1 type II CRISPR-associated endonuclease Cas1
1793 CAJPMP010000033.1 GCA905371775_00893 CDS open 6819-7124 _na     101_aa cas2 CRISPR-associated endonuclease Cas2
1794 CAJPMP010000033.1 GCA905371775_00894 CDS open 7121-7750 _na     209_aa csn2 type II-A CRISPR-associated protein Csn2
1795 CAJPMP010000033.1 GCA905371775_00895 CDS open 8868-10226 _na     452_aa UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase
1796 CAJPMP010000033.1 GCA905371775_00896 CDS open 10236-11303 _na     355_aa D-alanine--D-alanine ligase
1797 CAJPMP010000033.1 GCA905371775_00897 CDS open 11479-12534 _na     351_aa hrtB Putative hemin transport system permease protein HrtB
1798 CAJPMP010000033.1 GCA905371775_00898 CDS open 12545-13219 _na     224_aa hrtA Putative hemin import ATP-binding protein HrtA
1799 CAJPMP010000033.1 GCA905371775_00899 CDS open 13309-15306 _na     665_aa uvrB excinuclease ABC subunit UvrB
1800 CAJPMP010000033.1 GCA905371775_00900 CDS open 15507-15863 _na     118_aa hypothetical protein
1801 CAJPMP010000033.1 GCA905371775_00890 gene open 131-1609
1802 CAJPMP010000033.1 GCA905371775_00891 gene open 1798-5964 cas9
1803 CAJPMP010000033.1 GCA905371775_00892 gene open 5939-6814 cas1
1804 CAJPMP010000033.1 GCA905371775_00893 gene open 6819-7124 cas2
1805 CAJPMP010000033.1 GCA905371775_00894 gene open 7121-7750 csn2
1806 CAJPMP010000033.1 GCA905371775_00895 gene open 8868-10226
1807 CAJPMP010000033.1 GCA905371775_00896 gene open 10236-11303
1808 CAJPMP010000033.1 GCA905371775_00897 gene open 11479-12534 hrtB
1809 CAJPMP010000033.1 GCA905371775_00898 gene open 12545-13219 hrtA
1810 CAJPMP010000033.1 GCA905371775_00899 gene open 13309-15306 uvrB
1811 CAJPMP010000033.1 GCA905371775_00900 gene open 15507-15863
1812 CAJPMP010000034.1 GCA905371775_00901 CDS open 61-2091 _na     676_aa Heavy metal translocating P-type ATPase
1813 CAJPMP010000034.1 GCA905371775_00902 CDS open 2234-2548 _na     104_aa Metalloregulator ArsR/SmtB family transcription factor
1814 CAJPMP010000034.1 GCA905371775_00903 CDS open 2567-3715 _na     382_aa yhiN BaiN-like insert domain-containing protein
1815 CAJPMP010000034.1 GCA905371775_00904 CDS open 3887-4816 _na     309_aa Alpha/beta fold hydrolase
1816 CAJPMP010000034.1 GCA905371775_00905 CDS open 4900-5979 _na     359_aa Creatinase
1817 CAJPMP010000034.1 GCA905371775_00906 CDS open 6166-7554 _na     462_aa MFS transporter
1818 CAJPMP010000034.1 GCA905371775_00907 CDS open 7836-8801 _na     321_aa pip prolyl aminopeptidase
1819 CAJPMP010000034.1 GCA905371775_00908 CDS open 8824-10647 _na     607_aa pepP Creatinase
1820 CAJPMP010000034.1 GCA905371775_00909 CDS open 10807-12036 _na     409_aa Aminopeptidase
1821 CAJPMP010000034.1 GCA905371775_00910 CDS open 12175-12435 _na     86_aa hslR RNA-binding S4 domain-containing protein
1822 CAJPMP010000034.1 GCA905371775_00911 CDS open 12437-13024 _na     195_aa Septum formation initiator
1823 CAJPMP010000034.1 GCA905371775_00912 CDS open 13156-14598 _na     480_aa nicotinate phosphoribosyltransferase
1824 CAJPMP010000034.1 GCA905371775_00913 CDS open 14610-15431 _na     273_aa nadE ammonia-dependent NAD(+) synthetase
1825 CAJPMP010000034.1 GCA905371775_00901 gene open 61-2091
1826 CAJPMP010000034.1 GCA905371775_00902 gene open 2234-2548
1827 CAJPMP010000034.1 GCA905371775_00903 gene open 2567-3715 yhiN
1828 CAJPMP010000034.1 GCA905371775_00904 gene open 3887-4816
1829 CAJPMP010000034.1 GCA905371775_00905 gene open 4900-5979
1830 CAJPMP010000034.1 GCA905371775_00906 gene open 6166-7554
1831 CAJPMP010000034.1 GCA905371775_00907 gene open 7836-8801 pip
1832 CAJPMP010000034.1 GCA905371775_00908 gene open 8824-10647 pepP
1833 CAJPMP010000034.1 GCA905371775_00909 gene open 10807-12036
1834 CAJPMP010000034.1 GCA905371775_00910 gene open 12175-12435 hslR
1835 CAJPMP010000034.1 GCA905371775_00911 gene open 12437-13024
1836 CAJPMP010000034.1 GCA905371775_00912 gene open 13156-14598
1837 CAJPMP010000034.1 GCA905371775_00913 gene open 14610-15431 nadE
1838 CAJPMP010000035.1 GCA905371775_00914 CDS open 74-304 _na     76_aa tipC TipC family immunity protein
1839 CAJPMP010000035.1 GCA905371775_00915 CDS open 423-575 _na     50_aa TIGR04197 family type VII secretion effector
1840 CAJPMP010000035.1 GCA905371775_00916 CDS open 767-1141 _na     124_aa hypothetical protein
1841 CAJPMP010000035.1 GCA905371775_00917 CDS open 1131-1352 _na     73_aa hypothetical protein
1842 CAJPMP010000035.1 GCA905371775_00918 CDS open 1475-1636 _na     53_aa hypothetical protein
1843 CAJPMP010000035.1 GCA905371775_00919 CDS open 1931-2923 _na     330_aa DUF2232 domain-containing protein
1844 CAJPMP010000035.1 GCA905371775_00920 CDS open 2925-4880 _na     651_aa Cyclic-di-AMP phosphodiesterase
1845 CAJPMP010000035.1 GCA905371775_00921 CDS open 4937-5380 _na     147_aa rplI 50S ribosomal protein L9
1846 CAJPMP010000035.1 GCA905371775_00922 CDS open 5403-6764 _na     453_aa dnaB replicative DNA helicase
1847 CAJPMP010000035.1 GCA905371775_00923 CDS open 6813-7784 _na     323_aa sppA Signal peptide peptidase SppA
1848 CAJPMP010000035.1 GCA905371775_00924 CDS open 7798-8502 _na     234_aa RDD family protein
1849 CAJPMP010000035.1 GCA905371775_00925 CDS open 8557-9393 _na     278_aa degV DegV family EDD domain-containing protein
1850 CAJPMP010000035.1 GCA905371775_00926 CDS open 9685-12759 _na     1024_aa DUF3533 domain-containing protein
1851 CAJPMP010000035.1 GCA905371775_00927 CDS open 13323-15233 _na     636_aa PRD domain-containing protein
1852 CAJPMP010000035.1 GCA905371775_00914 gene open 74-304 tipC
1853 CAJPMP010000035.1 GCA905371775_00915 gene open 423-575
1854 CAJPMP010000035.1 GCA905371775_00916 gene open 767-1141
1855 CAJPMP010000035.1 GCA905371775_00917 gene open 1131-1352
1856 CAJPMP010000035.1 GCA905371775_00918 gene open 1475-1636
1857 CAJPMP010000035.1 GCA905371775_00919 gene open 1931-2923
1858 CAJPMP010000035.1 GCA905371775_00920 gene open 2925-4880
1859 CAJPMP010000035.1 GCA905371775_00921 gene open 4937-5380 rplI
1860 CAJPMP010000035.1 GCA905371775_00922 gene open 5403-6764 dnaB
1861 CAJPMP010000035.1 GCA905371775_00923 gene open 6813-7784 sppA
1862 CAJPMP010000035.1 GCA905371775_00924 gene open 7798-8502
1863 CAJPMP010000035.1 GCA905371775_00925 gene open 8557-9393 degV
1864 CAJPMP010000035.1 GCA905371775_00926 gene open 9685-12759
1865 CAJPMP010000035.1 GCA905371775_00927 gene open 13323-15233
1866 CAJPMP010000036.1 GCA905371775_00938 gene open 11258-11635 RNaseP_bact_b
1867 CAJPMP010000036.1 GCA905371775_00938 ncRNA open 11258-11635 Bacterial RNase P class B
1868 CAJPMP010000036.1 GCA905371775_00928 CDS open 882-1415 _na     177_aa cvpA CvpA family protein
1869 CAJPMP010000036.1 GCA905371775_00929 CDS open 1521-3170 _na     549_aa dhaL DhaL domain-containing protein
1870 CAJPMP010000036.1 GCA905371775_00930 CDS open 3182-3541 _na     119_aa yloU Asp23/Gls24 family envelope stress response protein
1871 CAJPMP010000036.1 GCA905371775_00931 CDS open 3693-4625 _na     310_aa 2-dehydropantoate 2-reductase
1872 CAJPMP010000036.1 GCA905371775_00932 CDS open 4843-5889 _na     348_aa PTS transporter subunit IIC
1873 CAJPMP010000036.1 GCA905371775_00933 CDS open 6036-6752 _na     238_aa rsmG 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG
1874 CAJPMP010000036.1 GCA905371775_00934 CDS open 6745-8628 _na     627_aa mnmG tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG
1875 CAJPMP010000036.1 GCA905371775_00935 CDS open 8995-9441 _na     148_aa flavodoxin
1876 CAJPMP010000036.1 GCA905371775_00936 CDS open 9483-9986 _na     167_aa Rrf2 family transcriptional regulator
1877 CAJPMP010000036.1 GCA905371775_00937 CDS open 10075-11202 _na     375_aa rlmL THUMP domain-containing protein
1878 CAJPMP010000036.1 GCA905371775_00939 CDS open 11681-11878 _na     65_aa rpoZ DNA-directed RNA polymerase subunit omega
1879 CAJPMP010000036.1 GCA905371775_00940 CDS open 11888-12508 _na     206_aa gmk guanylate kinase
1880 CAJPMP010000036.1 GCA905371775_00941 CDS open 12643-14313 _na     556_aa rqcH Rqc2-like protein RqcH
1881 CAJPMP010000036.1 GCA905371775_00942 CDS open 14427-15191 _na     254_aa terC TerC family protein
1882 CAJPMP010000036.1 GCA905371775_00943 CDS open 15205-15522 _na     105_aa hypothetical protein
1883 CAJPMP010000036.1 GCA905371775_00928 gene open 882-1415 cvpA
1884 CAJPMP010000036.1 GCA905371775_00929 gene open 1521-3170 dhaL
1885 CAJPMP010000036.1 GCA905371775_00930 gene open 3182-3541 yloU
1886 CAJPMP010000036.1 GCA905371775_00931 gene open 3693-4625
1887 CAJPMP010000036.1 GCA905371775_00932 gene open 4843-5889
1888 CAJPMP010000036.1 GCA905371775_00933 gene open 6036-6752 rsmG
1889 CAJPMP010000036.1 GCA905371775_00934 gene open 6745-8628 mnmG
1890 CAJPMP010000036.1 GCA905371775_00935 gene open 8995-9441
1891 CAJPMP010000036.1 GCA905371775_00936 gene open 9483-9986
1892 CAJPMP010000036.1 GCA905371775_00937 gene open 10075-11202 rlmL
1893 CAJPMP010000036.1 GCA905371775_00939 gene open 11681-11878 rpoZ
1894 CAJPMP010000036.1 GCA905371775_00940 gene open 11888-12508 gmk
1895 CAJPMP010000036.1 GCA905371775_00941 gene open 12643-14313 rqcH
1896 CAJPMP010000036.1 GCA905371775_00942 gene open 14427-15191 terC
1897 CAJPMP010000036.1 GCA905371775_00943 gene open 15205-15522
1898 CAJPMP010000037.1 GCA905371775_00944 CDS open 210-1535 _na     441_aa brnQ branched-chain amino acid transport system II carrier protein
1899 CAJPMP010000037.1 GCA905371775_00945 CDS open 1754-3805 _na     683_aa topA type I DNA topoisomerase
1900 CAJPMP010000037.1 GCA905371775_00946 CDS open 3883-4644 _na     253_aa map type I methionyl aminopeptidase
1901 CAJPMP010000037.1 GCA905371775_00947 CDS open 4660-5190 _na     176_aa HAD hydrolase-like protein
1902 CAJPMP010000037.1 GCA905371775_00948 CDS open 5528-6304 _na     258_aa Phosphotransferase
1903 CAJPMP010000037.1 GCA905371775_00949 CDS open 6532-7929 _na     465_aa pepV dipeptidase PepV
1904 CAJPMP010000037.1 GCA905371775_00950 CDS open 7944-8651 _na     235_aa Pseudouridine synthase
1905 CAJPMP010000037.1 GCA905371775_00951 CDS open 8651-10240 _na     529_aa Oligosaccharide flippase family protein
1906 CAJPMP010000037.1 GCA905371775_00952 CDS open 10279-10470 _na     63_aa hypothetical protein
1907 CAJPMP010000037.1 GCA905371775_00953 CDS open 10768-11151 _na     127_aa merR MerR family transcriptional regulator
1908 CAJPMP010000037.1 GCA905371775_00954 CDS open 11184-12521 _na     445_aa glnA type I glutamate--ammonia ligase
1909 CAJPMP010000037.1 GCA905371775_00955 CDS open 12613-12918 _na     101_aa trxA thioredoxin
1910 CAJPMP010000037.1 GCA905371775_00956 CDS open 13001-14605 _na     534_aa groL chaperonin GroEL
1911 CAJPMP010000037.1 GCA905371775_00957 CDS open 14614-14889 _na     91_aa 10 kDa chaperonin
1912 CAJPMP010000037.1 GCA905371775_00944 gene open 210-1535 brnQ
1913 CAJPMP010000037.1 GCA905371775_00945 gene open 1754-3805 topA
1914 CAJPMP010000037.1 GCA905371775_00946 gene open 3883-4644 map
1915 CAJPMP010000037.1 GCA905371775_00947 gene open 4660-5190
1916 CAJPMP010000037.1 GCA905371775_00948 gene open 5528-6304
1917 CAJPMP010000037.1 GCA905371775_00949 gene open 6532-7929 pepV
1918 CAJPMP010000037.1 GCA905371775_00950 gene open 7944-8651
1919 CAJPMP010000037.1 GCA905371775_00951 gene open 8651-10240
1920 CAJPMP010000037.1 GCA905371775_00952 gene open 10279-10470
1921 CAJPMP010000037.1 GCA905371775_00953 gene open 10768-11151 merR
1922 CAJPMP010000037.1 GCA905371775_00954 gene open 11184-12521 glnA
1923 CAJPMP010000037.1 GCA905371775_00955 gene open 12613-12918 trxA
1924 CAJPMP010000037.1 GCA905371775_00956 gene open 13001-14605 groL
1925 CAJPMP010000037.1 GCA905371775_00957 gene open 14614-14889
1926 CAJPMP010000038.1 GCA905371775_00958 CDS open 112-1611 _na     499_aa lysS lysine--tRNA ligase
1927 CAJPMP010000038.1 GCA905371775_00959 CDS open 1676-2722 _na     348_aa ftsY signal recognition particle-docking protein FtsY
1928 CAJPMP010000038.1 GCA905371775_00960 CDS open 2882-3385 _na     167_aa PTS glucose transporter subunit IIA
1929 CAJPMP010000038.1 GCA905371775_00961 CDS open 3424-4863 _na     479_aa Tetratricopeptide repeat protein
1930 CAJPMP010000038.1 GCA905371775_00962 CDS open 4856-5077 _na     73_aa DUF910 domain-containing protein
1931 CAJPMP010000038.1 GCA905371775_00963 CDS open 5088-5372 _na     94_aa DUF1507 domain-containing protein
1932 CAJPMP010000038.1 GCA905371775_00964 CDS open 5375-6577 _na     400_aa ftsW putative peptidoglycan glycosyltransferase FtsW
1933 CAJPMP010000038.1 GCA905371775_00965 CDS open 6701-7729 _na     342_aa queA tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA
1934 CAJPMP010000038.1 GCA905371775_00966 CDS open 7749-8903 _na     384_aa tgt tRNA guanosine(34) transglycosylase Tgt
1935 CAJPMP010000038.1 GCA905371775_00967 CDS open 8981-9244 _na     87_aa yajC preprotein translocase subunit YajC
1936 CAJPMP010000038.1 GCA905371775_00968 CDS open 9404-9553 _na     49_aa hypothetical protein
1937 CAJPMP010000038.1 GCA905371775_00969 CDS open 9635-12910 _na     1091_aa YSIRK-type signal peptide-containing protein
1938 CAJPMP010000038.1 GCA905371775_00970 CDS open 13012-13482 _na     156_aa luxS S-ribosylhomocysteine lyase
1939 CAJPMP010000038.1 GCA905371775_00971 CDS open 13583-14902 _na     439_aa Purine permease
1940 CAJPMP010000038.1 GCA905371775_00958 gene open 112-1611 lysS
1941 CAJPMP010000038.1 GCA905371775_00959 gene open 1676-2722 ftsY
1942 CAJPMP010000038.1 GCA905371775_00960 gene open 2882-3385
1943 CAJPMP010000038.1 GCA905371775_00961 gene open 3424-4863
1944 CAJPMP010000038.1 GCA905371775_00962 gene open 4856-5077
1945 CAJPMP010000038.1 GCA905371775_00963 gene open 5088-5372
1946 CAJPMP010000038.1 GCA905371775_00964 gene open 5375-6577 ftsW
1947 CAJPMP010000038.1 GCA905371775_00965 gene open 6701-7729 queA
1948 CAJPMP010000038.1 GCA905371775_00966 gene open 7749-8903 tgt
1949 CAJPMP010000038.1 GCA905371775_00967 gene open 8981-9244 yajC
1950 CAJPMP010000038.1 GCA905371775_00968 gene open 9404-9553
1951 CAJPMP010000038.1 GCA905371775_00969 gene open 9635-12910
1952 CAJPMP010000038.1 GCA905371775_00970 gene open 13012-13482 luxS
1953 CAJPMP010000038.1 GCA905371775_00971 gene open 13583-14902
1954 CAJPMP010000039.1 GCA905371775_00972 CDS open 676-897 _na     73_aa Putative transposase for insertion sequence element
1955 CAJPMP010000039.1 GCA905371775_00973 CDS open 851-1072 _na     73_aa hypothetical protein
1956 CAJPMP010000039.1 GCA905371775_00974 CDS open 1262-1741 _na     159_aa hypothetical protein
1957 CAJPMP010000039.1 GCA905371775_00975 CDS open 1745-2290 _na     181_aa ImmA/IrrE family metallo-endopeptidase
1958 CAJPMP010000039.1 GCA905371775_00976 CDS open 2482-3444 _na     320_aa DDE-type integrase/transposase/recombinase
1959 CAJPMP010000039.1 GCA905371775_00977 CDS open 3628-4665 _na     345_aa hypothetical protein
1960 CAJPMP010000039.1 GCA905371775_00978 CDS open 5746-7140 _na     464_aa SMODS-associated and fused to various effectors domain-containing protein
1961 CAJPMP010000039.1 GCA905371775_00979 CDS open 7580-7717 _na     45_aa hypothetical protein
1962 CAJPMP010000039.1 GCA905371775_00980 CDS open 8164-8322 _na     52_aa hypothetical protein
1963 CAJPMP010000039.1 GCA905371775_00981 CDS open 8385-8645 _na     86_aa Insertion element IS150 protein InsJ-like helix-turn-helix domain-containing protein
1964 CAJPMP010000039.1 GCA905371775_00982 CDS open 8945-10372 _na     475_aa gatB Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB
1965 CAJPMP010000039.1 GCA905371775_00983 CDS open 10386-11843 _na     485_aa gatA Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA
1966 CAJPMP010000039.1 GCA905371775_00984 CDS open 11862-12152 _na     96_aa gatC Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC
1967 CAJPMP010000039.1 GCA905371775_00985 CDS open 12869-13390 _na     173_aa Isochorismatase family protein
1968 CAJPMP010000039.1 GCA905371775_00986 CDS open 13640-14575 _na     311_aa prmA 50S ribosomal protein L11 methyltransferase
1969 CAJPMP010000039.1 GCA905371775_00972 gene open 676-897
1970 CAJPMP010000039.1 GCA905371775_00973 gene open 851-1072
1971 CAJPMP010000039.1 GCA905371775_00974 gene open 1262-1741
1972 CAJPMP010000039.1 GCA905371775_00975 gene open 1745-2290
1973 CAJPMP010000039.1 GCA905371775_00976 gene open 2482-3444
1974 CAJPMP010000039.1 GCA905371775_00977 gene open 3628-4665
1975 CAJPMP010000039.1 GCA905371775_00978 gene open 5746-7140
1976 CAJPMP010000039.1 GCA905371775_00979 gene open 7580-7717
1977 CAJPMP010000039.1 GCA905371775_00980 gene open 8164-8322
1978 CAJPMP010000039.1 GCA905371775_00981 gene open 8385-8645
1979 CAJPMP010000039.1 GCA905371775_00982 gene open 8945-10372 gatB
1980 CAJPMP010000039.1 GCA905371775_00983 gene open 10386-11843 gatA
1981 CAJPMP010000039.1 GCA905371775_00984 gene open 11862-12152 gatC
1982 CAJPMP010000039.1 GCA905371775_00985 gene open 12869-13390
1983 CAJPMP010000039.1 GCA905371775_00986 gene open 13640-14575 prmA
1984 CAJPMP010000040.1 regulatory_region open 9916-10013 TPP riboswitch aptamer (THI element)
1985 CAJPMP010000040.1 GCA905371775_00987 CDS open 880-1644 _na     254_aa fepC ABC transporter domain-containing protein
1986 CAJPMP010000040.1 GCA905371775_00988 CDS open 1644-2618 _na     324_aa fepD putative heme-iron transport system permease protein IsdF
1987 CAJPMP010000040.1 GCA905371775_00989 CDS open 2725-3684 _na     319_aa isdE heme ABC transporter substrate-binding protein IsdE
1988 CAJPMP010000040.1 GCA905371775_00990 CDS open 3695-5011 _na     438_aa Cell surface protein Shp haem-binding domain-containing protein
1989 CAJPMP010000040.1 GCA905371775_00991 CDS open 5122-6531 _na     469_aa hypothetical protein
1990 CAJPMP010000040.1 GCA905371775_00992 CDS open 6618-9587 _na     989_aa Iron transport-associated domain protein
1991 CAJPMP010000040.1 GCA905371775_00993 CDS open 10151-10831 _na     226_aa tenA thiaminase II
1992 CAJPMP010000040.1 GCA905371775_00994 CDS open 10835-11623 _na     262_aa bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase
1993 CAJPMP010000040.1 GCA905371775_00995 CDS open 11653-12441 _na     262_aa thiM hydroxyethylthiazole kinase
1994 CAJPMP010000040.1 GCA905371775_00996 CDS open 12434-13081 _na     215_aa thiamine phosphate synthase
1995 CAJPMP010000040.1 GCA905371775_00997 CDS open 13177-13944 _na     255_aa Alpha/beta fold hydrolase
1996 CAJPMP010000040.1 GCA905371775_00987 gene open 880-1644 fepC
1997 CAJPMP010000040.1 GCA905371775_00988 gene open 1644-2618 fepD
1998 CAJPMP010000040.1 GCA905371775_00989 gene open 2725-3684 isdE
1999 CAJPMP010000040.1 GCA905371775_00990 gene open 3695-5011
2000 CAJPMP010000040.1 GCA905371775_00991 gene open 5122-6531