HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Hornefia nodatum (GCA_905372015.1)

Select a Genome:
BAKTA Annotations for GCA_905372015.1
Genome Selected: Hornefia nodatum
ContigsBases CDSrRNA tmRNAtRNA
94 1840341 1674 1 2 24
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3429 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:7]    |    Number of Records Found: 3429 [7 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
3001 CAJPNO010000056.1 GCA905372015_01491 gene open 6576-7133 rnmV
3002 CAJPNO010000056.1 GCA905372015_01492 gene open 7090-7953 rsmA
3003 CAJPNO010000056.1 GCA905372015_01493 gene open 7954-9945
3004 CAJPNO010000056.1 GCA905372015_01494 gene open 10071-10604
3005 CAJPNO010000057.1 GCA905372015_01495 CDS open 25-1152 _na     375_aa Aminotransferase%2C class V
3006 CAJPNO010000057.1 GCA905372015_01496 CDS open 1221-1754 _na     177_aa ECF-type riboflavin transporter%2C S component
3007 CAJPNO010000057.1 GCA905372015_01497 CDS open 1975-2394 _na     139_aa Putative lipoprotein
3008 CAJPNO010000057.1 GCA905372015_01498 CDS open 2479-3171 _na     230_aa Putative membrane protein
3009 CAJPNO010000057.1 GCA905372015_01499 CDS open 3287-3763 _na     158_aa hypothetical protein
3010 CAJPNO010000057.1 GCA905372015_01500 CDS open 3878-4324 _na     148_aa Membrane protein
3011 CAJPNO010000057.1 GCA905372015_01501 CDS open 4326-4742 _na     138_aa PF11070 family protein
3012 CAJPNO010000057.1 GCA905372015_01502 CDS open 4832-5122 _na     96_aa Toxin-antitoxin system%2C toxin component%2C Fic domain protein
3013 CAJPNO010000057.1 GCA905372015_01503 CDS open 5136-5408 _na     90_aa Lipoprotein
3014 CAJPNO010000057.1 GCA905372015_01504 CDS open 5602-5853 _na     83_aa hypothetical protein
3015 CAJPNO010000057.1 GCA905372015_01505 CDS open 6278-6472 _na     64_aa hypothetical protein
3016 CAJPNO010000057.1 GCA905372015_01506 CDS open 6459-6590 _na     43_aa hypothetical protein
3017 CAJPNO010000057.1 GCA905372015_01507 CDS open 6672-7460 _na     262_aa PF06250 family protein
3018 CAJPNO010000057.1 GCA905372015_01508 CDS open 7586-8512 _na     308_aa Virulence protein
3019 CAJPNO010000057.1 GCA905372015_01509 CDS open 8950-9438 _na     162_aa Transposase%2C IS116/IS110/IS902 family
3020 CAJPNO010000057.1 GCA905372015_01495 gene open 25-1152
3021 CAJPNO010000057.1 GCA905372015_01496 gene open 1221-1754
3022 CAJPNO010000057.1 GCA905372015_01497 gene open 1975-2394
3023 CAJPNO010000057.1 GCA905372015_01498 gene open 2479-3171
3024 CAJPNO010000057.1 GCA905372015_01499 gene open 3287-3763
3025 CAJPNO010000057.1 GCA905372015_01500 gene open 3878-4324
3026 CAJPNO010000057.1 GCA905372015_01501 gene open 4326-4742
3027 CAJPNO010000057.1 GCA905372015_01502 gene open 4832-5122
3028 CAJPNO010000057.1 GCA905372015_01503 gene open 5136-5408
3029 CAJPNO010000057.1 GCA905372015_01504 gene open 5602-5853
3030 CAJPNO010000057.1 GCA905372015_01505 gene open 6278-6472
3031 CAJPNO010000057.1 GCA905372015_01506 gene open 6459-6590
3032 CAJPNO010000057.1 GCA905372015_01507 gene open 6672-7460
3033 CAJPNO010000057.1 GCA905372015_01508 gene open 7586-8512
3034 CAJPNO010000057.1 GCA905372015_01509 gene open 8950-9438
3035 CAJPNO010000058.1 GCA905372015_01510 CDS open 119-1174 _na     351_aa IS30 family transposase
3036 CAJPNO010000058.1 GCA905372015_01511 CDS open 1312-1956 _na     214_aa CpXC protein
3037 CAJPNO010000058.1 GCA905372015_01512 CDS open 1977-2570 _na     197_aa scpB SMC-Scp complex subunit ScpB
3038 CAJPNO010000058.1 GCA905372015_01513 CDS open 2560-3342 _na     260_aa Segregation and condensation protein A
3039 CAJPNO010000058.1 GCA905372015_01514 CDS open 3506-4435 _na     309_aa EamA-like transporter family protein
3040 CAJPNO010000058.1 GCA905372015_01515 CDS open 4436-5479 _na     347_aa mtnA S-methyl-5-thioribose-1-phosphate isomerase
3041 CAJPNO010000058.1 GCA905372015_01516 CDS open 5692-6327 _na     211_aa L-2-amino-thiazoline-4-carboxylic acid hydrolase
3042 CAJPNO010000058.1 GCA905372015_01517 CDS open 6348-6941 _na     197_aa Methyltransferase domain protein
3043 CAJPNO010000058.1 GCA905372015_01518 CDS open 6925-7572 _na     215_aa tetR Transcriptional regulator%2C TetR family
3044 CAJPNO010000058.1 GCA905372015_01519 CDS open 7667-8638 _na     323_aa araC Transcriptional regulator%2C AraC family
3045 CAJPNO010000058.1 GCA905372015_01510 gene open 119-1174
3046 CAJPNO010000058.1 GCA905372015_01511 gene open 1312-1956
3047 CAJPNO010000058.1 GCA905372015_01512 gene open 1977-2570 scpB
3048 CAJPNO010000058.1 GCA905372015_01513 gene open 2560-3342
3049 CAJPNO010000058.1 GCA905372015_01514 gene open 3506-4435
3050 CAJPNO010000058.1 GCA905372015_01515 gene open 4436-5479 mtnA
3051 CAJPNO010000058.1 GCA905372015_01516 gene open 5692-6327
3052 CAJPNO010000058.1 GCA905372015_01517 gene open 6348-6941
3053 CAJPNO010000058.1 GCA905372015_01518 gene open 6925-7572 tetR
3054 CAJPNO010000058.1 GCA905372015_01519 gene open 7667-8638 araC
3055 CAJPNO010000059.1 GCA905372015_01520 CDS open 123-1769 _na     548_aa cbiK Cobalt chelatase CbiK
3056 CAJPNO010000059.1 GCA905372015_01521 CDS open 1941-3245 _na     434_aa 4-hydroxybutyrate coenzyme A transferase
3057 CAJPNO010000059.1 GCA905372015_01522 CDS open 3347-3865 _na     172_aa corrinoid adenosyltransferase
3058 CAJPNO010000059.1 GCA905372015_01523 CDS open 4002-4361 _na     119_aa hypothetical protein
3059 CAJPNO010000059.1 GCA905372015_01524 CDS open 4623-5948 _na     441_aa NH(3)-dependent NAD(+) synthetase
3060 CAJPNO010000059.1 GCA905372015_01525 CDS open 6019-7143 _na     374_aa PF11187 family protein
3061 CAJPNO010000059.1 GCA905372015_01526 CDS open 7314-8459 _na     381_aa Aminotransferase%2C class V
3062 CAJPNO010000059.1 GCA905372015_01520 gene open 123-1769 cbiK
3063 CAJPNO010000059.1 GCA905372015_01521 gene open 1941-3245
3064 CAJPNO010000059.1 GCA905372015_01522 gene open 3347-3865
3065 CAJPNO010000059.1 GCA905372015_01523 gene open 4002-4361
3066 CAJPNO010000059.1 GCA905372015_01524 gene open 4623-5948
3067 CAJPNO010000059.1 GCA905372015_01525 gene open 6019-7143
3068 CAJPNO010000059.1 GCA905372015_01526 gene open 7314-8459
3069 CAJPNO010000060.1 GCA905372015_01527 CDS open 492-2273 _na     593_aa ABC transporter ATP-binding protein
3070 CAJPNO010000060.1 GCA905372015_01528 CDS open 2393-3043 _na     216_aa Peptidase M15B domain-containing protein
3071 CAJPNO010000060.1 GCA905372015_01529 CDS open 3086-4543 _na     485_aa Radical SAM domain protein
3072 CAJPNO010000060.1 GCA905372015_01530 CDS open 4634-4819 _na     61_aa hypothetical protein
3073 CAJPNO010000060.1 GCA905372015_01531 CDS open 5030-6226 _na     398_aa hypothetical protein
3074 CAJPNO010000060.1 GCA905372015_01532 CDS open 6223-7101 _na     292_aa yxlF Putative ABC transporter ATP-binding protein YxlF
3075 CAJPNO010000060.1 GCA905372015_01533 CDS open 7082-7837 _na     251_aa ABC-2 type transporter domain-containing protein
3076 CAJPNO010000060.1 GCA905372015_01534 CDS open 7827-8363 _na     178_aa RNA polymerase subunit sigma-70
3077 CAJPNO010000060.1 GCA905372015_01527 gene open 492-2273
3078 CAJPNO010000060.1 GCA905372015_01528 gene open 2393-3043
3079 CAJPNO010000060.1 GCA905372015_01529 gene open 3086-4543
3080 CAJPNO010000060.1 GCA905372015_01530 gene open 4634-4819
3081 CAJPNO010000060.1 GCA905372015_01531 gene open 5030-6226
3082 CAJPNO010000060.1 GCA905372015_01532 gene open 6223-7101 yxlF
3083 CAJPNO010000060.1 GCA905372015_01533 gene open 7082-7837
3084 CAJPNO010000060.1 GCA905372015_01534 gene open 7827-8363
3085 CAJPNO010000061.1 GCA905372015_01535 CDS open 9-227 _na     72_aa hypothetical protein
3086 CAJPNO010000061.1 GCA905372015_01536 CDS open 436-1050 _na     204_aa tetR Transcriptional regulator%2C TetR family
3087 CAJPNO010000061.1 GCA905372015_01537 CDS open 1281-3515 _na     744_aa Papain family cysteine protease domain protein
3088 CAJPNO010000061.1 GCA905372015_01538 CDS open 3527-8152 _na     1541_aa Leucine rich repeat protein
3089 CAJPNO010000061.1 GCA905372015_01535 gene open 9-227
3090 CAJPNO010000061.1 GCA905372015_01536 gene open 436-1050 tetR
3091 CAJPNO010000061.1 GCA905372015_01537 gene open 1281-3515
3092 CAJPNO010000061.1 GCA905372015_01538 gene open 3527-8152
3093 CAJPNO010000062.1 GCA905372015_01539 CDS open 71-2707 _na     878_aa ppdK pyruvate%2C phosphate dikinase
3094 CAJPNO010000062.1 GCA905372015_01540 CDS open 2901-3998 _na     365_aa Alanine racemase%2C N-terminal domain protein
3095 CAJPNO010000062.1 GCA905372015_01541 CDS open 4073-5065 _na     330_aa Membrane protein%2C PF03956 family
3096 CAJPNO010000062.1 GCA905372015_01542 CDS open 5203-5874 _na     223_aa lexA transcriptional repressor LexA
3097 CAJPNO010000062.1 GCA905372015_01543 CDS open 6067-7374 _na     435_aa Na+/H+ antiporter family protein
3098 CAJPNO010000062.1 GCA905372015_01544 CDS open 7400-8173 _na     257_aa N-acetylmuramoyl-L-alanine amidase
3099 CAJPNO010000062.1 GCA905372015_01539 gene open 71-2707 ppdK
3100 CAJPNO010000062.1 GCA905372015_01540 gene open 2901-3998
3101 CAJPNO010000062.1 GCA905372015_01541 gene open 4073-5065
3102 CAJPNO010000062.1 GCA905372015_01542 gene open 5203-5874 lexA
3103 CAJPNO010000062.1 GCA905372015_01543 gene open 6067-7374
3104 CAJPNO010000062.1 GCA905372015_01544 gene open 7400-8173
3105 CAJPNO010000063.1 regulatory_region open 1164-1227 pemK RNA
3106 CAJPNO010000063.1 GCA905372015_01545 CDS open 901-1068 _na     55_aa Site-specific DNA recombinase
3107 CAJPNO010000063.1 GCA905372015_01546 CDS open 1556-1972 _na     138_aa RNA polymerase sigma-70 region 4 domain-containing protein
3108 CAJPNO010000063.1 GCA905372015_01547 CDS open 2285-3637 _na     450_aa mepA Multidrug export protein MepA
3109 CAJPNO010000063.1 GCA905372015_01548 CDS open 3669-5414 _na     581_aa ABC transporter%2C ATP-binding protein
3110 CAJPNO010000063.1 GCA905372015_01549 CDS open 5407-7197 _na     596_aa ABC transporter ATP-binding protein
3111 CAJPNO010000063.1 GCA905372015_01550 CDS open 7187-8023 _na     278_aa hypothetical protein
3112 CAJPNO010000063.1 GCA905372015_01545 gene open 901-1068
3113 CAJPNO010000063.1 GCA905372015_01546 gene open 1556-1972
3114 CAJPNO010000063.1 GCA905372015_01547 gene open 2285-3637 mepA
3115 CAJPNO010000063.1 GCA905372015_01548 gene open 3669-5414
3116 CAJPNO010000063.1 GCA905372015_01549 gene open 5407-7197
3117 CAJPNO010000063.1 GCA905372015_01550 gene open 7187-8023
3118 CAJPNO010000064.1 GCA905372015_01551 CDS open 164-595 _na     143_aa hypothetical protein
3119 CAJPNO010000064.1 GCA905372015_01552 CDS open 665-2038 _na     457_aa DNA methylase family protein
3120 CAJPNO010000064.1 GCA905372015_01553 CDS open 2043-2693 _na     216_aa NUDIX domain protein
3121 CAJPNO010000064.1 GCA905372015_01554 CDS open 2729-3151 _na     140_aa Helicase superfamily 3 single-stranded DNA/RNA virus domain-containing protein
3122 CAJPNO010000064.1 GCA905372015_01555 CDS open 3275-4291 _na     338_aa rlmN 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN
3123 CAJPNO010000064.1 GCA905372015_01556 CDS open 4291-7404 _na     1037_aa ileS isoleucine--tRNA ligase
3124 CAJPNO010000064.1 GCA905372015_01551 gene open 164-595
3125 CAJPNO010000064.1 GCA905372015_01552 gene open 665-2038
3126 CAJPNO010000064.1 GCA905372015_01553 gene open 2043-2693
3127 CAJPNO010000064.1 GCA905372015_01554 gene open 2729-3151
3128 CAJPNO010000064.1 GCA905372015_01555 gene open 3275-4291 rlmN
3129 CAJPNO010000064.1 GCA905372015_01556 gene open 4291-7404 ileS
3130 CAJPNO010000065.1 GCA905372015_01557 CDS open 313-2055 _na     580_aa ABC transporter domain-containing protein
3131 CAJPNO010000065.1 GCA905372015_01558 CDS open 2057-3763 _na     568_aa ABC transporter ATP-binding protein
3132 CAJPNO010000065.1 GCA905372015_01559 CDS open 3767-5182 _na     471_aa ccmA heme ABC exporter ATP-binding protein CcmA
3133 CAJPNO010000065.1 GCA905372015_01560 CDS open 5192-5878 _na     228_aa Cobalt transport protein
3134 CAJPNO010000065.1 GCA905372015_01561 CDS open 5881-6474 _na     197_aa TIGR02185 family protein
3135 CAJPNO010000065.1 GCA905372015_01562 CDS open 6602-7213 _na     203_aa HTH tetR-type domain-containing protein
3136 CAJPNO010000065.1 GCA905372015_01557 gene open 313-2055
3137 CAJPNO010000065.1 GCA905372015_01558 gene open 2057-3763
3138 CAJPNO010000065.1 GCA905372015_01559 gene open 3767-5182 ccmA
3139 CAJPNO010000065.1 GCA905372015_01560 gene open 5192-5878
3140 CAJPNO010000065.1 GCA905372015_01561 gene open 5881-6474
3141 CAJPNO010000065.1 GCA905372015_01562 gene open 6602-7213
3142 CAJPNO010000066.1 GCA905372015_01563 CDS open 370-1116 _na     248_aa S4 domain protein
3143 CAJPNO010000066.1 GCA905372015_01564 CDS open 1140-1994 _na     284_aa 4Fe-4S binding domain protein
3144 CAJPNO010000066.1 GCA905372015_01565 CDS open 2053-3714 _na     553_aa Amidohydrolase family protein
3145 CAJPNO010000066.1 GCA905372015_01566 CDS open 3788-4471 _na     227_aa uracil-DNA glycosylase
3146 CAJPNO010000066.1 GCA905372015_01567 CDS open 4782-7295 _na     837_aa ribonucleoside-diphosphate reductase subunit alpha
3147 CAJPNO010000066.1 GCA905372015_01563 gene open 370-1116
3148 CAJPNO010000066.1 GCA905372015_01564 gene open 1140-1994
3149 CAJPNO010000066.1 GCA905372015_01565 gene open 2053-3714
3150 CAJPNO010000066.1 GCA905372015_01566 gene open 3788-4471
3151 CAJPNO010000066.1 GCA905372015_01567 gene open 4782-7295
3152 CAJPNO010000067.1 GCA905372015_01568 CDS open 56-622 _na     188_aa hypothetical protein
3153 CAJPNO010000067.1 GCA905372015_01569 CDS open 776-1024 _na     82_aa Heavy metal-associated domain protein
3154 CAJPNO010000067.1 GCA905372015_01570 CDS open 1435-2184 _na     249_aa exodeoxyribonuclease III
3155 CAJPNO010000067.1 GCA905372015_01571 CDS open 2194-3078 _na     294_aa Calcineurin-like phosphoesterase family protein
3156 CAJPNO010000067.1 GCA905372015_01572 CDS open 3220-3666 _na     148_aa Transcriptional Coactivator p15
3157 CAJPNO010000067.1 GCA905372015_01573 CDS open 3707-5275 _na     522_aa AAA domain protein
3158 CAJPNO010000067.1 GCA905372015_01574 CDS open 5498-6529 _na     343_aa Beta-eliminating lyase
3159 CAJPNO010000067.1 GCA905372015_01575 CDS open 6762-7139 _na     125_aa Desulfoferrodoxin
3160 CAJPNO010000067.1 GCA905372015_01568 gene open 56-622
3161 CAJPNO010000067.1 GCA905372015_01569 gene open 776-1024
3162 CAJPNO010000067.1 GCA905372015_01570 gene open 1435-2184
3163 CAJPNO010000067.1 GCA905372015_01571 gene open 2194-3078
3164 CAJPNO010000067.1 GCA905372015_01572 gene open 3220-3666
3165 CAJPNO010000067.1 GCA905372015_01573 gene open 3707-5275
3166 CAJPNO010000067.1 GCA905372015_01574 gene open 5498-6529
3167 CAJPNO010000067.1 GCA905372015_01575 gene open 6762-7139
3168 CAJPNO010000068.1 GCA905372015_01576 CDS open 65-1474 _na     469_aa glycine--tRNA ligase
3169 CAJPNO010000068.1 GCA905372015_01577 CDS open 1586-2320 _na     244_aa PF14242 domain protein
3170 CAJPNO010000068.1 GCA905372015_01578 CDS open 2348-3106 _na     252_aa recO DNA repair protein RecO
3171 CAJPNO010000068.1 GCA905372015_01579 CDS open 3106-4008 _na     300_aa era GTPase Era
3172 CAJPNO010000068.1 GCA905372015_01580 CDS open 4036-4413 _na     125_aa cdd cytidine deaminase
3173 CAJPNO010000068.1 GCA905372015_01581 CDS open 4417-4866 _na     149_aa ybeY rRNA maturation RNase YbeY
3174 CAJPNO010000068.1 GCA905372015_01582 CDS open 4872-5831 _na     319_aa PhoH-like protein
3175 CAJPNO010000068.1 GCA905372015_01583 CDS open 6187-6933 _na     248_aa hypothetical protein
3176 CAJPNO010000068.1 GCA905372015_01576 gene open 65-1474
3177 CAJPNO010000068.1 GCA905372015_01577 gene open 1586-2320
3178 CAJPNO010000068.1 GCA905372015_01578 gene open 2348-3106 recO
3179 CAJPNO010000068.1 GCA905372015_01579 gene open 3106-4008 era
3180 CAJPNO010000068.1 GCA905372015_01580 gene open 4036-4413 cdd
3181 CAJPNO010000068.1 GCA905372015_01581 gene open 4417-4866 ybeY
3182 CAJPNO010000068.1 GCA905372015_01582 gene open 4872-5831
3183 CAJPNO010000068.1 GCA905372015_01583 gene open 6187-6933
3184 CAJPNO010000069.1 GCA905372015_01585 CDS open 162-797 _na     211_aa yigZ YigZ family protein
3185 CAJPNO010000069.1 GCA905372015_01586 CDS open 784-2061 _na     425_aa hflX GTPase HflX
3186 CAJPNO010000069.1 GCA905372015_01587 CDS open 2205-2981 _na     258_aa codY GTP-sensing pleiotropic transcriptional regulator CodY
3187 CAJPNO010000069.1 GCA905372015_01588 CDS open 3011-4453 _na     480_aa hslU ATP-dependent protease ATPase subunit HslU
3188 CAJPNO010000069.1 GCA905372015_01589 CDS open 4464-5003 _na     179_aa hslV ATP-dependent protease subunit HslV
3189 CAJPNO010000069.1 GCA905372015_01590 CDS open 5007-7064 _na     685_aa topA type I DNA topoisomerase
3190 CAJPNO010000069.1 GCA905372015_01585 gene open 162-797 yigZ
3191 CAJPNO010000069.1 GCA905372015_01586 gene open 784-2061 hflX
3192 CAJPNO010000069.1 GCA905372015_01587 gene open 2205-2981 codY
3193 CAJPNO010000069.1 GCA905372015_01588 gene open 3011-4453 hslU
3194 CAJPNO010000069.1 GCA905372015_01589 gene open 4464-5003 hslV
3195 CAJPNO010000069.1 GCA905372015_01590 gene open 5007-7064 topA
3196 CAJPNO010000069.1 GCA905372015_01584 gene open 1-71 trnV
3197 CAJPNO010000069.1 GCA905372015_01584 tRNA open 1-71 trnV tRNA-Val(tac)
3198 CAJPNO010000070.1 GCA905372015_01591 CDS open 938-1708 _na     256_aa DUF218 domain-containing protein
3199 CAJPNO010000070.1 GCA905372015_01592 CDS open 1760-2803 _na     347_aa aroB 3-dehydroquinate synthase
3200 CAJPNO010000070.1 GCA905372015_01593 CDS open 2899-4170 _na     423_aa argininosuccinate synthase
3201 CAJPNO010000070.1 GCA905372015_01594 CDS open 4121-5485 _na     454_aa argH argininosuccinate lyase
3202 CAJPNO010000070.1 GCA905372015_01595 CDS open 5624-6007 _na     127_aa Reactive intermediate/imine deaminase
3203 CAJPNO010000070.1 GCA905372015_01596 CDS open 6126-7079 _na     317_aa hypothetical protein
3204 CAJPNO010000070.1 GCA905372015_01591 gene open 938-1708
3205 CAJPNO010000070.1 GCA905372015_01592 gene open 1760-2803 aroB
3206 CAJPNO010000070.1 GCA905372015_01593 gene open 2899-4170
3207 CAJPNO010000070.1 GCA905372015_01594 gene open 4121-5485 argH
3208 CAJPNO010000070.1 GCA905372015_01595 gene open 5624-6007
3209 CAJPNO010000070.1 GCA905372015_01596 gene open 6126-7079
3210 CAJPNO010000071.1 GCA905372015_01597 CDS open 129-350 _na     73_aa hypothetical protein
3211 CAJPNO010000071.1 GCA905372015_01598 CDS open 351-1055 _na     234_aa Cobalt transport protein
3212 CAJPNO010000071.1 GCA905372015_01599 CDS open 1052-2503 _na     483_aa ccmA heme ABC exporter ATP-binding protein CcmA
3213 CAJPNO010000071.1 GCA905372015_01600 CDS open 2563-4323 _na     586_aa ABC transporter%2C ATP-binding protein
3214 CAJPNO010000071.1 GCA905372015_01601 CDS open 4320-6074 _na     584_aa mdlB ABC transporter%2C ATP-binding protein
3215 CAJPNO010000071.1 GCA905372015_01602 CDS open 6071-6655 _na     194_aa L-2-amino-thiazoline-4-carboxylic acid hydrolase
3216 CAJPNO010000071.1 GCA905372015_01597 gene open 129-350
3217 CAJPNO010000071.1 GCA905372015_01598 gene open 351-1055
3218 CAJPNO010000071.1 GCA905372015_01599 gene open 1052-2503 ccmA
3219 CAJPNO010000071.1 GCA905372015_01600 gene open 2563-4323
3220 CAJPNO010000071.1 GCA905372015_01601 gene open 4320-6074 mdlB
3221 CAJPNO010000071.1 GCA905372015_01602 gene open 6071-6655
3222 CAJPNO010000072.1 GCA905372015_01603 CDS open 2172-3038 _na     288_aa EamA-like transporter family protein
3223 CAJPNO010000072.1 GCA905372015_01604 CDS open 3371-4492 _na     373_aa hemW radical SAM family heme chaperone HemW
3224 CAJPNO010000072.1 GCA905372015_01605 CDS open 4552-6360 _na     602_aa lepA translation elongation factor 4
3225 CAJPNO010000072.1 GCA905372015_01603 gene open 2172-3038
3226 CAJPNO010000072.1 GCA905372015_01604 gene open 3371-4492 hemW
3227 CAJPNO010000072.1 GCA905372015_01605 gene open 4552-6360 lepA
3228 CAJPNO010000073.1 GCA905372015_01606 CDS open 16-627 _na     203_aa ltrA group II intron reverse transcriptase/maturase
3229 CAJPNO010000073.1 GCA905372015_01607 CDS open 664-1308 _na     214_aa Group II intron reverse transcriptase/maturase
3230 CAJPNO010000073.1 GCA905372015_01608 CDS open 1885-3318 _na     477_aa Peptidoglycan binding domain protein
3231 CAJPNO010000073.1 GCA905372015_01609 CDS open 3444-5162 _na     572_aa ABC transporter%2C ATP-binding protein
3232 CAJPNO010000073.1 GCA905372015_01606 gene open 16-627 ltrA
3233 CAJPNO010000073.1 GCA905372015_01607 gene open 664-1308
3234 CAJPNO010000073.1 GCA905372015_01608 gene open 1885-3318
3235 CAJPNO010000073.1 GCA905372015_01609 gene open 3444-5162
3236 CAJPNO010000074.1 GCA905372015_01610 CDS open 226-1959 _na     577_aa aspT aspartate-alanine antiporter
3237 CAJPNO010000074.1 GCA905372015_01611 CDS open 1976-3574 _na     532_aa aspB bifunctional aspartate transaminase/aspartate 4-decarboxylase
3238 CAJPNO010000074.1 GCA905372015_01612 CDS open 3716-3892 _na     58_aa tnpW Transposon-encoded protein TnpW
3239 CAJPNO010000074.1 GCA905372015_01613 CDS open 4154-4441 _na     95_aa tnpA IS200/IS605 family transposase
3240 CAJPNO010000074.1 GCA905372015_01610 gene open 226-1959 aspT
3241 CAJPNO010000074.1 GCA905372015_01611 gene open 1976-3574 aspB
3242 CAJPNO010000074.1 GCA905372015_01612 gene open 3716-3892 tnpW
3243 CAJPNO010000074.1 GCA905372015_01613 gene open 4154-4441 tnpA
3244 CAJPNO010000075.1 GCA905372015_01614 CDS open 610-840 _na     76_aa hypothetical protein
3245 CAJPNO010000075.1 GCA905372015_01615 CDS open 931-1161 _na     76_aa hypothetical protein
3246 CAJPNO010000075.1 GCA905372015_01616 CDS open 1242-2624 _na     460_aa ccmA heme ABC exporter ATP-binding protein CcmA
3247 CAJPNO010000075.1 GCA905372015_01617 CDS open 2617-3330 _na     237_aa Cobalt transport protein
3248 CAJPNO010000075.1 GCA905372015_01618 CDS open 3330-3926 _na     198_aa TIGR02185 family protein
3249 CAJPNO010000075.1 GCA905372015_01619 CDS open 3979-4584 _na     201_aa tetR Transcriptional regulator%2C TetR family
3250 CAJPNO010000075.1 GCA905372015_01614 gene open 610-840
3251 CAJPNO010000075.1 GCA905372015_01615 gene open 931-1161
3252 CAJPNO010000075.1 GCA905372015_01616 gene open 1242-2624 ccmA
3253 CAJPNO010000075.1 GCA905372015_01617 gene open 2617-3330
3254 CAJPNO010000075.1 GCA905372015_01618 gene open 3330-3926
3255 CAJPNO010000075.1 GCA905372015_01619 gene open 3979-4584 tetR
3256 CAJPNO010000076.1 GCA905372015_01620 CDS open 340-1050 _na     236_aa rbbA ATP-binding cassette domain-containing protein
3257 CAJPNO010000076.1 GCA905372015_01621 CDS open 1047-1199 _na     50_aa Lipoprotein
3258 CAJPNO010000076.1 GCA905372015_01622 CDS open 1226-2563 _na     445_aa skfB Radical SAM core domain-containing protein
3259 CAJPNO010000076.1 GCA905372015_01623 CDS open 2665-2841 _na     58_aa Subtilosin A family bacteriocin
3260 CAJPNO010000076.1 GCA905372015_01624 CDS open 3200-4477 _na     425_aa IS110 family transposase
3261 CAJPNO010000076.1 GCA905372015_01620 gene open 340-1050 rbbA
3262 CAJPNO010000076.1 GCA905372015_01621 gene open 1047-1199
3263 CAJPNO010000076.1 GCA905372015_01622 gene open 1226-2563 skfB
3264 CAJPNO010000076.1 GCA905372015_01623 gene open 2665-2841
3265 CAJPNO010000076.1 GCA905372015_01624 gene open 3200-4477
3266 CAJPNO010000077.1 regulatory_region open 2598-2645 uup RNA
3267 CAJPNO010000077.1 GCA905372015_01625 CDS open 164-772 _na     202_aa DUF4368 domain-containing protein
3268 CAJPNO010000077.1 GCA905372015_01626 CDS open 860-1384 _na     174_aa padR Transcriptional regulator
3269 CAJPNO010000077.1 GCA905372015_01627 CDS open 1381-2046 _na     221_aa HEAT repeat domain-containing protein
3270 CAJPNO010000077.1 GCA905372015_01628 CDS open 2030-2494 _na     154_aa SpoVT-AbrB domain-containing protein
3271 CAJPNO010000077.1 GCA905372015_01629 CDS open 2890-4242 _na     450_aa mepA Multidrug export protein MepA
3272 CAJPNO010000077.1 GCA905372015_01625 gene open 164-772
3273 CAJPNO010000077.1 GCA905372015_01626 gene open 860-1384 padR
3274 CAJPNO010000077.1 GCA905372015_01627 gene open 1381-2046
3275 CAJPNO010000077.1 GCA905372015_01628 gene open 2030-2494
3276 CAJPNO010000077.1 GCA905372015_01629 gene open 2890-4242 mepA
3277 CAJPNO010000078.1 GCA905372015_01630 CDS open 614-1327 _na     237_aa Cobalt transport protein
3278 CAJPNO010000078.1 GCA905372015_01631 CDS open 1317-1913 _na     198_aa TIGR02185 family protein
3279 CAJPNO010000078.1 GCA905372015_01632 CDS open 2041-2679 _na     212_aa HTH tetR-type domain-containing protein
3280 CAJPNO010000078.1 GCA905372015_01633 CDS open 2918-4198 _na     426_aa Integrase catalytic domain-containing protein
3281 CAJPNO010000078.1 GCA905372015_01630 gene open 614-1327
3282 CAJPNO010000078.1 GCA905372015_01631 gene open 1317-1913
3283 CAJPNO010000078.1 GCA905372015_01632 gene open 2041-2679
3284 CAJPNO010000078.1 GCA905372015_01633 gene open 2918-4198
3285 CAJPNO010000079.1 GCA905372015_01634 CDS open 116-589 _na     157_aa copG Ribbon-helix-helix protein%2C CopG family
3286 CAJPNO010000079.1 GCA905372015_01635 CDS open 586-1131 _na     181_aa Transcriptional regulator
3287 CAJPNO010000079.1 GCA905372015_01636 CDS open 1153-2523 _na     456_aa Recombinase family protein
3288 CAJPNO010000079.1 GCA905372015_01637 CDS open 2830-3141 _na     103_aa DUF2089 domain-containing protein
3289 CAJPNO010000079.1 GCA905372015_01638 CDS open 3134-3433 _na     99_aa hypothetical protein
3290 CAJPNO010000079.1 GCA905372015_01639 CDS open 3454-4269 _na     271_aa hypothetical protein
3291 CAJPNO010000079.1 GCA905372015_01634 gene open 116-589 copG
3292 CAJPNO010000079.1 GCA905372015_01635 gene open 586-1131
3293 CAJPNO010000079.1 GCA905372015_01636 gene open 1153-2523
3294 CAJPNO010000079.1 GCA905372015_01637 gene open 2830-3141
3295 CAJPNO010000079.1 GCA905372015_01638 gene open 3134-3433
3296 CAJPNO010000079.1 GCA905372015_01639 gene open 3454-4269
3297 CAJPNO010000080.1 repeat_region open 26-398 CRISPR array with 6 repeats of length 30%2C consensus sequence ATTTACATTTCATTATGCTTCTATTAAAAC and spacer length 36
3298 CAJPNO010000080.1 GCA905372015_01640 CDS open 976-1254 _na     92_aa cas2 CRISPR-associated endonuclease Cas2
3299 CAJPNO010000080.1 GCA905372015_01641 CDS open 1260-1856 _na     198_aa CRISPR-associated endonuclease Cas1
3300 CAJPNO010000080.1 GCA905372015_01642 CDS open 1837-2256 _na     139_aa hypothetical protein
3301 CAJPNO010000080.1 GCA905372015_01643 CDS open 2267-2989 _na     240_aa cas6 CRISPR-associated endoribonuclease Cas6
3302 CAJPNO010000080.1 GCA905372015_01644 CDS open 3339-4292 _na     317_aa Peptidase C1A papain C-terminal domain-containing protein
3303 CAJPNO010000080.1 GCA905372015_01645 CDS open 4311-4430 _na     39_aa hypothetical protein
3304 CAJPNO010000080.1 GCA905372015_01640 gene open 976-1254 cas2
3305 CAJPNO010000080.1 GCA905372015_01641 gene open 1260-1856
3306 CAJPNO010000080.1 GCA905372015_01642 gene open 1837-2256
3307 CAJPNO010000080.1 GCA905372015_01643 gene open 2267-2989 cas6
3308 CAJPNO010000080.1 GCA905372015_01644 gene open 3339-4292
3309 CAJPNO010000080.1 GCA905372015_01645 gene open 4311-4430
3310 CAJPNO010000081.1 GCA905372015_01646 CDS open 235-876 _na     213_aa HTH tetR-type domain-containing protein
3311 CAJPNO010000081.1 GCA905372015_01647 CDS open 934-2685 _na     583_aa Multidrug ABC transporter permease
3312 CAJPNO010000081.1 GCA905372015_01648 CDS open 2686-4410 _na     574_aa mdlB ABC transporter
3313 CAJPNO010000081.1 GCA905372015_01646 gene open 235-876
3314 CAJPNO010000081.1 GCA905372015_01647 gene open 934-2685
3315 CAJPNO010000081.1 GCA905372015_01648 gene open 2686-4410 mdlB
3316 CAJPNO010000082.1 GCA905372015_01649 CDS open 23-517 _na     164_aa TIGR02185 family protein
3317 CAJPNO010000082.1 GCA905372015_01650 CDS open 518-1222 _na     234_aa Cobalt transport domain protein
3318 CAJPNO010000082.1 GCA905372015_01651 CDS open 1219-2682 _na     487_aa energy-coupling factor transporter ATPase
3319 CAJPNO010000082.1 GCA905372015_01652 CDS open 2679-3266 _na     195_aa L-2-amino-thiazoline-4-carboxylic acid hydrolase
3320 CAJPNO010000082.1 GCA905372015_01653 CDS open 3437-3661 _na     74_aa hypothetical protein
3321 CAJPNO010000082.1 GCA905372015_01649 gene open 23-517
3322 CAJPNO010000082.1 GCA905372015_01650 gene open 518-1222
3323 CAJPNO010000082.1 GCA905372015_01651 gene open 1219-2682
3324 CAJPNO010000082.1 GCA905372015_01652 gene open 2679-3266
3325 CAJPNO010000082.1 GCA905372015_01653 gene open 3437-3661
3326 CAJPNO010000083.1 GCA905372015_01654 CDS open 133-405 _na     90_aa hypothetical protein
3327 CAJPNO010000083.1 GCA905372015_01655 CDS open 417-941 _na     174_aa hypothetical protein
3328 CAJPNO010000083.1 GCA905372015_01656 CDS open 931-1515 _na     194_aa hypothetical protein
3329 CAJPNO010000083.1 GCA905372015_01657 CDS open 1505-1966 _na     153_aa DUF1064 domain-containing protein
3330 CAJPNO010000083.1 GCA905372015_01658 CDS open 1984-2196 _na     70_aa hypothetical protein
3331 CAJPNO010000083.1 GCA905372015_01659 CDS open 2198-2590 _na     130_aa Single-stranded DNA-binding protein
3332 CAJPNO010000083.1 GCA905372015_01660 CDS open 2609-2923 _na     104_aa hypothetical protein
3333 CAJPNO010000083.1 GCA905372015_01661 CDS open 2920-3429 _na     169_aa NERD domain-containing protein
3334 CAJPNO010000083.1 GCA905372015_01662 CDS open 3426-3827 _na     133_aa hypothetical protein
3335 CAJPNO010000083.1 GCA905372015_01663 CDS open 3840-4247 _na     135_aa hypothetical protein
3336 CAJPNO010000083.1 GCA905372015_01654 gene open 133-405
3337 CAJPNO010000083.1 GCA905372015_01655 gene open 417-941
3338 CAJPNO010000083.1 GCA905372015_01656 gene open 931-1515
3339 CAJPNO010000083.1 GCA905372015_01657 gene open 1505-1966
3340 CAJPNO010000083.1 GCA905372015_01658 gene open 1984-2196
3341 CAJPNO010000083.1 GCA905372015_01659 gene open 2198-2590
3342 CAJPNO010000083.1 GCA905372015_01660 gene open 2609-2923
3343 CAJPNO010000083.1 GCA905372015_01661 gene open 2920-3429
3344 CAJPNO010000083.1 GCA905372015_01662 gene open 3426-3827
3345 CAJPNO010000083.1 GCA905372015_01663 gene open 3840-4247
3346 CAJPNO010000084.1 GCA905372015_01664 CDS open 175-1407 _na     410_aa Nucleotidyltransferase
3347 CAJPNO010000084.1 GCA905372015_01665 CDS open 1404-2087 _na     227_aa SEC-C motif-containing protein
3348 CAJPNO010000084.1 GCA905372015_01666 CDS open 2104-2925 _na     273_aa hypothetical protein
3349 CAJPNO010000084.1 GCA905372015_01667 CDS open 3146-4078 _na     310_aa DUF1848 domain-containing protein
3350 CAJPNO010000084.1 GCA905372015_01664 gene open 175-1407
3351 CAJPNO010000084.1 GCA905372015_01665 gene open 1404-2087
3352 CAJPNO010000084.1 GCA905372015_01666 gene open 2104-2925
3353 CAJPNO010000084.1 GCA905372015_01667 gene open 3146-4078
3354 CAJPNO010000085.1 GCA905372015_01668 CDS open 98-2044 _na     648_aa Resolvase%2C N-terminal domain protein
3355 CAJPNO010000085.1 GCA905372015_01669 CDS open 2081-2227 _na     48_aa hypothetical protein
3356 CAJPNO010000085.1 GCA905372015_01670 CDS open 2373-2894 _na     173_aa mRNA interferase
3357 CAJPNO010000085.1 GCA905372015_01671 CDS open 2936-3199 _na     87_aa Transcriptional coactivator p15 (PC4) C-terminal domain-containing protein
3358 CAJPNO010000085.1 GCA905372015_01672 CDS open 3219-3704 _na     161_aa MPN domain-containing protein
3359 CAJPNO010000085.1 GCA905372015_01673 CDS open 3685-3819 _na     44_aa hypothetical protein
3360 CAJPNO010000085.1 GCA905372015_01668 gene open 98-2044
3361 CAJPNO010000085.1 GCA905372015_01669 gene open 2081-2227
3362 CAJPNO010000085.1 GCA905372015_01670 gene open 2373-2894
3363 CAJPNO010000085.1 GCA905372015_01671 gene open 2936-3199
3364 CAJPNO010000085.1 GCA905372015_01672 gene open 3219-3704
3365 CAJPNO010000085.1 GCA905372015_01673 gene open 3685-3819
3366 CAJPNO010000086.1 GCA905372015_01674 CDS open 95-862 _na     255_aa AB hydrolase-1 domain-containing protein
3367 CAJPNO010000086.1 GCA905372015_01675 CDS open 901-1839 _na     312_aa Alpha/beta hydrolase fold-3 domain-containing protein
3368 CAJPNO010000086.1 GCA905372015_01676 CDS open 1895-2392 _na     165_aa DUF3899 domain-containing protein
3369 CAJPNO010000086.1 GCA905372015_01677 CDS open 2442-3245 _na     267_aa TIGR00027 family methyltransferase
3370 CAJPNO010000086.1 GCA905372015_01678 CDS open 3394-3723 _na     109_aa DUF3847 domain-containing protein
3371 CAJPNO010000086.1 GCA905372015_01674 gene open 95-862
3372 CAJPNO010000086.1 GCA905372015_01675 gene open 901-1839
3373 CAJPNO010000086.1 GCA905372015_01676 gene open 1895-2392
3374 CAJPNO010000086.1 GCA905372015_01677 gene open 2442-3245
3375 CAJPNO010000086.1 GCA905372015_01678 gene open 3394-3723
3376 CAJPNO010000087.1 GCA905372015_01679 CDS open 78-263 _na     61_aa hypothetical protein
3377 CAJPNO010000087.1 GCA905372015_01680 CDS open 211-384 _na     57_aa hypothetical protein
3378 CAJPNO010000087.1 GCA905372015_01681 CDS open 390-518 _na     42_aa hypothetical protein
3379 CAJPNO010000087.1 GCA905372015_01682 CDS open 494-1264 _na     256_aa Methyltransferase
3380 CAJPNO010000087.1 GCA905372015_01683 CDS open 1275-2579 _na     434_aa Type II restriction endonuclease
3381 CAJPNO010000087.1 GCA905372015_01684 CDS open 2572-3444 _na     290_aa site-specific DNA-methyltransferase (adenine-specific)
3382 CAJPNO010000087.1 GCA905372015_01679 gene open 78-263
3383 CAJPNO010000087.1 GCA905372015_01680 gene open 211-384
3384 CAJPNO010000087.1 GCA905372015_01681 gene open 390-518
3385 CAJPNO010000087.1 GCA905372015_01682 gene open 494-1264
3386 CAJPNO010000087.1 GCA905372015_01683 gene open 1275-2579
3387 CAJPNO010000087.1 GCA905372015_01684 gene open 2572-3444
3388 CAJPNO010000088.1 GCA905372015_01685 CDS open 147-827 _na     226_aa TIGR00266 family protein
3389 CAJPNO010000088.1 GCA905372015_01686 CDS open 1070-1648 _na     192_aa Glycoside-hydrolase family GH114
3390 CAJPNO010000088.1 GCA905372015_01687 CDS open 1651-1872 _na     73_aa hypothetical protein
3391 CAJPNO010000088.1 GCA905372015_01688 CDS open 2479-2658 _na     59_aa hypothetical protein
3392 CAJPNO010000088.1 GCA905372015_01685 gene open 147-827
3393 CAJPNO010000088.1 GCA905372015_01686 gene open 1070-1648
3394 CAJPNO010000088.1 GCA905372015_01687 gene open 1651-1872
3395 CAJPNO010000088.1 GCA905372015_01688 gene open 2479-2658
3396 CAJPNO010000089.1 GCA905372015_01689 CDS open 17-1531 _na     504_aa ccmA heme ABC exporter ATP-binding protein CcmA
3397 CAJPNO010000089.1 GCA905372015_01690 CDS open 1531-2232 _na     233_aa ecfT Cobalt transport protein
3398 CAJPNO010000089.1 GCA905372015_01691 CDS open 2250-2831 _na     193_aa TIGR02185 family protein
3399 CAJPNO010000089.1 GCA905372015_01692 CDS open 3015-3185 _na     56_aa hypothetical protein
3400 CAJPNO010000089.1 GCA905372015_01689 gene open 17-1531 ccmA
3401 CAJPNO010000089.1 GCA905372015_01690 gene open 1531-2232 ecfT
3402 CAJPNO010000089.1 GCA905372015_01691 gene open 2250-2831
3403 CAJPNO010000089.1 GCA905372015_01692 gene open 3015-3185
3404 CAJPNO010000090.1 GCA905372015_01693 CDS open 91-405 _na     104_aa hypothetical protein
3405 CAJPNO010000090.1 GCA905372015_01694 CDS open 430-1443 _na     337_aa Peptidase A2 domain-containing protein
3406 CAJPNO010000090.1 GCA905372015_01695 CDS open 1470-1793 _na     107_aa TipAS antibiotic-recognition domain-containing protein
3407 CAJPNO010000090.1 GCA905372015_01696 CDS open 1901-2707 _na     268_aa DUF4261 domain-containing protein
3408 CAJPNO010000090.1 GCA905372015_01693 gene open 91-405
3409 CAJPNO010000090.1 GCA905372015_01694 gene open 430-1443
3410 CAJPNO010000090.1 GCA905372015_01695 gene open 1470-1793
3411 CAJPNO010000090.1 GCA905372015_01696 gene open 1901-2707
3412 CAJPNO010000091.1 GCA905372015_01697 CDS open 54-1910 _na     618_aa Metallo-beta-lactamase domain protein
3413 CAJPNO010000091.1 GCA905372015_01698 CDS open 1924-3006 _na     360_aa Acyltransferase 3 domain-containing protein
3414 CAJPNO010000091.1 GCA905372015_01697 gene open 54-1910
3415 CAJPNO010000091.1 GCA905372015_01698 gene open 1924-3006
3416 CAJPNO010000092.1 GCA905372015_01699 CDS open 544-1059 _na     171_aa DUF2500 domain-containing protein
3417 CAJPNO010000092.1 GCA905372015_01700 CDS open 1286-2008 _na     240_aa hypothetical protein
3418 CAJPNO010000092.1 GCA905372015_01701 CDS open 2024-2437 _na     137_aa Toxin-antitoxin system%2C toxin component%2C Fic domain protein
3419 CAJPNO010000092.1 GCA905372015_01699 gene open 544-1059
3420 CAJPNO010000092.1 GCA905372015_01700 gene open 1286-2008
3421 CAJPNO010000092.1 GCA905372015_01701 gene open 2024-2437
3422 CAJPNO010000093.1 GCA905372015_01702 CDS open 551-1519 _na     322_aa caspase family protein
3423 CAJPNO010000093.1 GCA905372015_01703 CDS open 1563-1976 _na     137_aa TIR domain-containing protein
3424 CAJPNO010000093.1 GCA905372015_01704 CDS open 2148-2513 _na     121_aa Cysteine-rich VLP domain-containing protein
3425 CAJPNO010000093.1 GCA905372015_01702 gene open 551-1519
3426 CAJPNO010000093.1 GCA905372015_01703 gene open 1563-1976
3427 CAJPNO010000093.1 GCA905372015_01704 gene open 2148-2513
3428 CAJPNO010000094.1 GCA905372015_01705 CDS open 6-1145 _na     379_aa ABC transporter ATP-binding protein
3429 CAJPNO010000094.1 GCA905372015_01705 gene open 6-1145