HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Centipeda periodontii (GCA_905372315.1)

Select a Genome:
BAKTA Annotations for GCA_905372315.1
Genome Selected: Centipeda periodontii
ContigsBases CDSrRNA tmRNAtRNA
173 2403355 2315 0 1 28
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4720 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:10]    |    Number of Records Found: 4720 [10 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
4501 CAJPOY010000142.1 GCA905372315_02243 CDS open 1515-2078 _na     187_aa Tat pathway signal protein
4502 CAJPOY010000142.1 GCA905372315_02244 CDS open 2081-3382 _na     433_aa Glutathionylspermidine synthase subfamily
4503 CAJPOY010000142.1 GCA905372315_02241 gene open 22-996
4504 CAJPOY010000142.1 GCA905372315_02242 gene open 1072-1503
4505 CAJPOY010000142.1 GCA905372315_02243 gene open 1515-2078
4506 CAJPOY010000142.1 GCA905372315_02244 gene open 2081-3382
4507 CAJPOY010000143.1 GCA905372315_02245 CDS open 66-260 _na     64_aa hypothetical protein
4508 CAJPOY010000143.1 GCA905372315_02246 CDS open 469-783 _na     104_aa hypothetical protein
4509 CAJPOY010000143.1 GCA905372315_02247 CDS open 841-1062 _na     73_aa hypothetical protein
4510 CAJPOY010000143.1 GCA905372315_02248 CDS open 1120-2448 _na     442_aa DNA (cytosine-5-)-methyltransferase
4511 CAJPOY010000143.1 GCA905372315_02249 CDS open 2445-2726 _na     93_aa Prevent-host-death protein
4512 CAJPOY010000143.1 GCA905372315_02250 CDS open 2729-3268 _na     179_aa N-acetylmuramoyl-L-alanine amidase
4513 CAJPOY010000143.1 GCA905372315_02245 gene open 66-260
4514 CAJPOY010000143.1 GCA905372315_02246 gene open 469-783
4515 CAJPOY010000143.1 GCA905372315_02247 gene open 841-1062
4516 CAJPOY010000143.1 GCA905372315_02248 gene open 1120-2448
4517 CAJPOY010000143.1 GCA905372315_02249 gene open 2445-2726
4518 CAJPOY010000143.1 GCA905372315_02250 gene open 2729-3268
4519 CAJPOY010000144.1 GCA905372315_02251 CDS open 58-894 _na     278_aa HAD superfamily hydrolase
4520 CAJPOY010000144.1 GCA905372315_02252 CDS open 1341-1829 _na     162_aa Tat pathway signal sequence domain protein
4521 CAJPOY010000144.1 GCA905372315_02253 CDS open 2328-2666 _na     112_aa Secreted protein
4522 CAJPOY010000144.1 GCA905372315_02254 CDS open 2668-3153 _na     161_aa Trans-hexaprenyltranstransferase subunit I
4523 CAJPOY010000144.1 GCA905372315_02251 gene open 58-894
4524 CAJPOY010000144.1 GCA905372315_02252 gene open 1341-1829
4525 CAJPOY010000144.1 GCA905372315_02253 gene open 2328-2666
4526 CAJPOY010000144.1 GCA905372315_02254 gene open 2668-3153
4527 CAJPOY010000145.1 GCA905372315_02255 CDS open 181-2106 _na     641_aa DNA-directed DNA polymerase
4528 CAJPOY010000145.1 GCA905372315_02256 CDS open 2142-2417 _na     91_aa C2H2-type domain-containing protein
4529 CAJPOY010000145.1 GCA905372315_02257 CDS open 2414-2809 _na     131_aa DUF4406 domain-containing protein
4530 CAJPOY010000145.1 GCA905372315_02258 CDS open 2806-3384 _na     192_aa Restriction endonuclease
4531 CAJPOY010000145.1 GCA905372315_02255 gene open 181-2106
4532 CAJPOY010000145.1 GCA905372315_02256 gene open 2142-2417
4533 CAJPOY010000145.1 GCA905372315_02257 gene open 2414-2809
4534 CAJPOY010000145.1 GCA905372315_02258 gene open 2806-3384
4535 CAJPOY010000146.1 GCA905372315_02259 CDS open 171-1031 _na     286_aa Brp/Blh family beta-carotene 15%2C15'-monooxygenase
4536 CAJPOY010000146.1 GCA905372315_02260 CDS open 1024-2403 _na     459_aa Sensor histidine kinase NatK-like C-terminal domain-containing protein
4537 CAJPOY010000146.1 GCA905372315_02261 CDS open 2471-3196 _na     241_aa Response regulatory domain-containing protein
4538 CAJPOY010000146.1 GCA905372315_02259 gene open 171-1031
4539 CAJPOY010000146.1 GCA905372315_02260 gene open 1024-2403
4540 CAJPOY010000146.1 GCA905372315_02261 gene open 2471-3196
4541 CAJPOY010000147.1 GCA905372315_02262 CDS open 387-2012 _na     541_aa OMP85 family outer membrane protein
4542 CAJPOY010000147.1 GCA905372315_02263 CDS open 2404-3129 _na     241_aa hypothetical protein
4543 CAJPOY010000147.1 GCA905372315_02262 gene open 387-2012
4544 CAJPOY010000147.1 GCA905372315_02263 gene open 2404-3129
4545 CAJPOY010000148.1 GCA905372315_02264 CDS open 318-878 _na     186_aa rfbC dTDP-4-dehydrorhamnose 3%2C5-epimerase
4546 CAJPOY010000148.1 GCA905372315_02265 CDS open 890-1765 _na     291_aa rfbA glucose-1-phosphate thymidylyltransferase RfbA
4547 CAJPOY010000148.1 GCA905372315_02266 CDS open 1976-2749 _na     257_aa Solute-binding protein family 3/N-terminal domain-containing protein
4548 CAJPOY010000148.1 GCA905372315_02267 CDS open 2846-3142 _na     98_aa putative zinc-binding domain-containing protein
4549 CAJPOY010000148.1 GCA905372315_02264 gene open 318-878 rfbC
4550 CAJPOY010000148.1 GCA905372315_02265 gene open 890-1765 rfbA
4551 CAJPOY010000148.1 GCA905372315_02266 gene open 1976-2749
4552 CAJPOY010000148.1 GCA905372315_02267 gene open 2846-3142
4553 CAJPOY010000149.1 repeat_region open 38-326 CRISPR array with 4 repeats of length 37%2C consensus sequence GTCCCGACACACACAATGCCGCGTGCGGCATTGAAAC and spacer length 35
4554 CAJPOY010000149.1 GCA905372315_02268 CDS open 514-867 _na     117_aa Deacetylase sirtuin-type domain-containing protein
4555 CAJPOY010000149.1 GCA905372315_02269 CDS open 1471-2253 _na     260_aa protein-ADP-ribose hydrolase
4556 CAJPOY010000149.1 GCA905372315_02270 CDS open 2271-2900 _na     209_aa NAD(P)-dependent oxidoreductase
4557 CAJPOY010000149.1 GCA905372315_02271 CDS open 2945-3217 _na     90_aa hypothetical protein
4558 CAJPOY010000149.1 GCA905372315_02268 gene open 514-867
4559 CAJPOY010000149.1 GCA905372315_02269 gene open 1471-2253
4560 CAJPOY010000149.1 GCA905372315_02270 gene open 2271-2900
4561 CAJPOY010000149.1 GCA905372315_02271 gene open 2945-3217
4562 CAJPOY010000150.1 GCA905372315_02272 CDS open 190-861 _na     223_aa Putative N-acetylmannosamine-6-phosphate 2-epimerase
4563 CAJPOY010000150.1 GCA905372315_02273 CDS open 986-2149 _na     387_aa nagA N-acetylglucosamine-6-phosphate deacetylase
4564 CAJPOY010000150.1 GCA905372315_02274 CDS open 2146-2895 _na     249_aa nagB glucosamine-6-phosphate deaminase
4565 CAJPOY010000150.1 GCA905372315_02272 gene open 190-861
4566 CAJPOY010000150.1 GCA905372315_02273 gene open 986-2149 nagA
4567 CAJPOY010000150.1 GCA905372315_02274 gene open 2146-2895 nagB
4568 CAJPOY010000151.1 GCA905372315_02275 CDS open 42-323 _na     93_aa Prevent-host-death family protein
4569 CAJPOY010000151.1 GCA905372315_02276 CDS open 323-1927 _na     534_aa DNA (cytosine-5-)-methyltransferase
4570 CAJPOY010000151.1 GCA905372315_02277 CDS open 1985-2095 _na     36_aa hypothetical protein
4571 CAJPOY010000151.1 GCA905372315_02278 CDS open 2203-2811 _na     202_aa hypothetical protein
4572 CAJPOY010000151.1 GCA905372315_02279 CDS open 2795-3031 _na     78_aa DUF4314 domain-containing protein
4573 CAJPOY010000151.1 GCA905372315_02280 CDS open 3028-3204 _na     58_aa DUF5049 domain-containing protein
4574 CAJPOY010000151.1 GCA905372315_02275 gene open 42-323
4575 CAJPOY010000151.1 GCA905372315_02276 gene open 323-1927
4576 CAJPOY010000151.1 GCA905372315_02277 gene open 1985-2095
4577 CAJPOY010000151.1 GCA905372315_02278 gene open 2203-2811
4578 CAJPOY010000151.1 GCA905372315_02279 gene open 2795-3031
4579 CAJPOY010000151.1 GCA905372315_02280 gene open 3028-3204
4580 CAJPOY010000152.1 GCA905372315_02281 CDS open 568-963 _na     131_aa HicB-like antitoxin of toxin-antitoxin system domain-containing protein
4581 CAJPOY010000152.1 GCA905372315_02282 CDS open 1131-2411 _na     426_aa Mce/MlaD domain-containing protein
4582 CAJPOY010000152.1 GCA905372315_02283 CDS open 2408-3154 _na     248_aa ABC transporter domain-containing protein
4583 CAJPOY010000152.1 GCA905372315_02281 gene open 568-963
4584 CAJPOY010000152.1 GCA905372315_02282 gene open 1131-2411
4585 CAJPOY010000152.1 GCA905372315_02283 gene open 2408-3154
4586 CAJPOY010000153.1 GCA905372315_02284 CDS open 130-825 _na     231_aa hypothetical protein
4587 CAJPOY010000153.1 GCA905372315_02285 CDS open 859-1182 _na     107_aa hypothetical protein
4588 CAJPOY010000153.1 GCA905372315_02286 CDS open 1245-1589 _na     114_aa copG Ribbon-helix-helix protein CopG domain-containing protein
4589 CAJPOY010000153.1 GCA905372315_02287 CDS open 1822-3057 _na     411_aa Glycine hydroxymethyltransferase
4590 CAJPOY010000153.1 GCA905372315_02284 gene open 130-825
4591 CAJPOY010000153.1 GCA905372315_02285 gene open 859-1182
4592 CAJPOY010000153.1 GCA905372315_02286 gene open 1245-1589 copG
4593 CAJPOY010000153.1 GCA905372315_02287 gene open 1822-3057
4594 CAJPOY010000154.1 GCA905372315_02288 CDS open 18-518 _na     166_aa hypothetical protein
4595 CAJPOY010000154.1 GCA905372315_02289 CDS open 545-1831 _na     428_aa adenylosuccinate synthase
4596 CAJPOY010000154.1 GCA905372315_02290 CDS open 2467-2772 _na     101_aa XRE family transcriptional regulator
4597 CAJPOY010000154.1 GCA905372315_02291 CDS open 2813-3148 _na     111_aa hypothetical protein
4598 CAJPOY010000154.1 GCA905372315_02288 gene open 18-518
4599 CAJPOY010000154.1 GCA905372315_02289 gene open 545-1831
4600 CAJPOY010000154.1 GCA905372315_02290 gene open 2467-2772
4601 CAJPOY010000154.1 GCA905372315_02291 gene open 2813-3148
4602 CAJPOY010000155.1 regulatory_region open 148-254 TPP riboswitch aptamer (THI element)
4603 CAJPOY010000155.1 GCA905372315_02292 CDS open 28-138 _na     36_aa hypothetical protein
4604 CAJPOY010000155.1 GCA905372315_02293 CDS open 367-1542 _na     391_aa cytX Hydroxymethylpyrimidine transporter CytX
4605 CAJPOY010000155.1 GCA905372315_02294 CDS open 1757-2578 _na     273_aa thiM hydroxyethylthiazole kinase
4606 CAJPOY010000155.1 GCA905372315_02292 gene open 28-138
4607 CAJPOY010000155.1 GCA905372315_02293 gene open 367-1542 cytX
4608 CAJPOY010000155.1 GCA905372315_02294 gene open 1757-2578 thiM
4609 CAJPOY010000156.1 GCA905372315_02295 CDS open 303-2369 _na     688_aa recG ATP-dependent DNA helicase RecG
4610 CAJPOY010000156.1 GCA905372315_02296 CDS open 2436-2630 _na     64_aa ycfA YcfA family protein
4611 CAJPOY010000156.1 GCA905372315_02297 CDS open 2641-3060 _na     139_aa hicB HicB family toxin-antitoxin system
4612 CAJPOY010000156.1 GCA905372315_02295 gene open 303-2369 recG
4613 CAJPOY010000156.1 GCA905372315_02296 gene open 2436-2630 ycfA
4614 CAJPOY010000156.1 GCA905372315_02297 gene open 2641-3060 hicB
4615 CAJPOY010000157.1 GCA905372315_02299 CDS open 352-750 _na     132_aa 8-oxo-dGTP diphosphatase
4616 CAJPOY010000157.1 GCA905372315_02300 CDS open 754-1734 _na     326_aa Glycerol-3-phosphate dehydrogenase
4617 CAJPOY010000157.1 GCA905372315_02301 CDS open 1731-2465 _na     244_aa hypB Hydrogenase accessory protein HypB
4618 CAJPOY010000157.1 GCA905372315_02302 CDS open 2560-2976 _na     138_aa uspA UspA domain-containing protein
4619 CAJPOY010000157.1 GCA905372315_02299 gene open 352-750
4620 CAJPOY010000157.1 GCA905372315_02300 gene open 754-1734
4621 CAJPOY010000157.1 GCA905372315_02301 gene open 1731-2465 hypB
4622 CAJPOY010000157.1 GCA905372315_02302 gene open 2560-2976 uspA
4623 CAJPOY010000157.1 GCA905372315_02298 gene open 213-299 trnL
4624 CAJPOY010000157.1 GCA905372315_02298 tRNA open 213-299 trnL tRNA-Leu(caa)
4625 CAJPOY010000158.1 GCA905372315_02303 CDS open 220-852 _na     210_aa hypothetical protein
4626 CAJPOY010000158.1 GCA905372315_02304 CDS open 1185-2909 _na     574_aa msbA lipid A export permease/ATP-binding protein MsbA
4627 CAJPOY010000158.1 GCA905372315_02303 gene open 220-852
4628 CAJPOY010000158.1 GCA905372315_02304 gene open 1185-2909 msbA
4629 CAJPOY010000159.1 GCA905372315_02305 CDS open 96-1019 _na     307_aa Ppx/GppA phosphatase N-terminal domain-containing protein
4630 CAJPOY010000159.1 GCA905372315_02306 CDS open 1023-2024 _na     333_aa Threonine synthase
4631 CAJPOY010000159.1 GCA905372315_02307 CDS open 2337-2885 _na     182_aa hypothetical protein
4632 CAJPOY010000159.1 GCA905372315_02305 gene open 96-1019
4633 CAJPOY010000159.1 GCA905372315_02306 gene open 1023-2024
4634 CAJPOY010000159.1 GCA905372315_02307 gene open 2337-2885
4635 CAJPOY010000160.1 GCA905372315_02308 CDS open 89-1138 _na     349_aa Calcium-transporting ATPase 1
4636 CAJPOY010000160.1 GCA905372315_02309 CDS open 1132-2814 _na     560_aa HAD-IC family P-type ATPase
4637 CAJPOY010000160.1 GCA905372315_02308 gene open 89-1138
4638 CAJPOY010000160.1 GCA905372315_02309 gene open 1132-2814
4639 CAJPOY010000161.1 GCA905372315_02310 CDS open 608-1714 _na     368_aa glgD glucose-1-phosphate adenylyltransferase subunit GlgD
4640 CAJPOY010000161.1 GCA905372315_02311 CDS open 1745-2875 _na     376_aa glucose-1-phosphate adenylyltransferase
4641 CAJPOY010000161.1 GCA905372315_02310 gene open 608-1714 glgD
4642 CAJPOY010000161.1 GCA905372315_02311 gene open 1745-2875
4643 CAJPOY010000162.1 GCA905372315_02312 CDS open 52-561 _na     169_aa hypothetical protein
4644 CAJPOY010000162.1 GCA905372315_02313 CDS open 634-1425 _na     263_aa flgG flagellar basal-body rod protein FlgG
4645 CAJPOY010000162.1 GCA905372315_02314 CDS open 1440-2174 _na     244_aa flgA Flagella basal body P-ring formation protein FlgA
4646 CAJPOY010000162.1 GCA905372315_02315 CDS open 2187-2792 _na     201_aa Flagellar L-ring protein
4647 CAJPOY010000162.1 GCA905372315_02312 gene open 52-561
4648 CAJPOY010000162.1 GCA905372315_02313 gene open 634-1425 flgG
4649 CAJPOY010000162.1 GCA905372315_02314 gene open 1440-2174 flgA
4650 CAJPOY010000162.1 GCA905372315_02315 gene open 2187-2792
4651 CAJPOY010000163.1 GCA905372315_02316 CDS open 113-763 _na     216_aa hypothetical protein
4652 CAJPOY010000163.1 GCA905372315_02317 CDS open 667-1593 _na     308_aa hypothetical protein
4653 CAJPOY010000163.1 GCA905372315_02318 CDS open 1777-2211 _na     144_aa flavodoxin
4654 CAJPOY010000163.1 GCA905372315_02319 CDS open 2261-2827 _na     188_aa DUF3793 domain-containing protein
4655 CAJPOY010000163.1 GCA905372315_02316 gene open 113-763
4656 CAJPOY010000163.1 GCA905372315_02317 gene open 667-1593
4657 CAJPOY010000163.1 GCA905372315_02318 gene open 1777-2211
4658 CAJPOY010000163.1 GCA905372315_02319 gene open 2261-2827
4659 CAJPOY010000164.1 GCA905372315_02320 CDS open 460-1185 _na     241_aa pyrH UMP kinase
4660 CAJPOY010000164.1 GCA905372315_02321 CDS open 1306-2172 _na     288_aa tsf translation elongation factor Ts
4661 CAJPOY010000164.1 GCA905372315_02322 CDS open 2245-2808 _na     187_aa hypothetical protein
4662 CAJPOY010000164.1 GCA905372315_02320 gene open 460-1185 pyrH
4663 CAJPOY010000164.1 GCA905372315_02321 gene open 1306-2172 tsf
4664 CAJPOY010000164.1 GCA905372315_02322 gene open 2245-2808
4665 CAJPOY010000165.1 GCA905372315_02323 CDS open 42-1085 _na     347_aa UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2%2C6-diaminopimelate ligase
4666 CAJPOY010000165.1 GCA905372315_02324 CDS open 1087-2493 _na     468_aa UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase
4667 CAJPOY010000165.1 GCA905372315_02325 CDS open 2550-2774 _na     74_aa hypothetical protein
4668 CAJPOY010000165.1 GCA905372315_02323 gene open 42-1085
4669 CAJPOY010000165.1 GCA905372315_02324 gene open 1087-2493
4670 CAJPOY010000165.1 GCA905372315_02325 gene open 2550-2774
4671 CAJPOY010000166.1 GCA905372315_02326 CDS open 28-552 _na     174_aa peptide-methionine (S)-S-oxide reductase
4672 CAJPOY010000166.1 GCA905372315_02327 CDS open 694-1896 _na     400_aa mcpA Methyl-accepting chemotaxis protein McpA
4673 CAJPOY010000166.1 GCA905372315_02326 gene open 28-552
4674 CAJPOY010000166.1 GCA905372315_02327 gene open 694-1896 mcpA
4675 CAJPOY010000167.1 GCA905372315_02328 CDS open 59-433 _na     124_aa hypothetical protein
4676 CAJPOY010000167.1 GCA905372315_02329 CDS open 635-913 _na     92_aa hypothetical protein
4677 CAJPOY010000167.1 GCA905372315_02330 CDS open 1087-1878 _na     263_aa hrpE Flagellar assembly protein FliH/Type III secretion system HrpE domain-containing protein
4678 CAJPOY010000167.1 GCA905372315_02331 CDS open 1871-2683 _na     270_aa hypothetical protein
4679 CAJPOY010000167.1 GCA905372315_02328 gene open 59-433
4680 CAJPOY010000167.1 GCA905372315_02329 gene open 635-913
4681 CAJPOY010000167.1 GCA905372315_02330 gene open 1087-1878 hrpE
4682 CAJPOY010000167.1 GCA905372315_02331 gene open 1871-2683
4683 CAJPOY010000168.1 GCA905372315_02332 CDS open 160-783 _na     207_aa hypothetical protein
4684 CAJPOY010000168.1 GCA905372315_02333 CDS open 963-1874 _na     303_aa rapZ RNase adapter RapZ
4685 CAJPOY010000168.1 GCA905372315_02334 CDS open 1885-2679 _na     264_aa HAD superfamily hydrolase
4686 CAJPOY010000168.1 GCA905372315_02332 gene open 160-783
4687 CAJPOY010000168.1 GCA905372315_02333 gene open 963-1874 rapZ
4688 CAJPOY010000168.1 GCA905372315_02334 gene open 1885-2679
4689 CAJPOY010000169.1 GCA905372315_02335 CDS open 99-455 _na     118_aa yajD Putative HNH nuclease YajD
4690 CAJPOY010000169.1 GCA905372315_02336 CDS open 591-1031 _na     146_aa rinA Phage transcriptional regulator%2C RinA family
4691 CAJPOY010000169.1 GCA905372315_02337 CDS open 1028-1240 _na     70_aa Transposase
4692 CAJPOY010000169.1 GCA905372315_02338 CDS open 1237-2481 _na     414_aa SNF2 domain protein
4693 CAJPOY010000169.1 GCA905372315_02339 CDS open 2491-2586 _na     31_aa SNF2 N-terminal domain-containing protein
4694 CAJPOY010000169.1 GCA905372315_02335 gene open 99-455 yajD
4695 CAJPOY010000169.1 GCA905372315_02336 gene open 591-1031 rinA
4696 CAJPOY010000169.1 GCA905372315_02337 gene open 1028-1240
4697 CAJPOY010000169.1 GCA905372315_02338 gene open 1237-2481
4698 CAJPOY010000169.1 GCA905372315_02339 gene open 2491-2586
4699 CAJPOY010000170.1 GCA905372315_02340 CDS open 176-1330 _na     384_aa Cystathionine beta-lyase
4700 CAJPOY010000170.1 GCA905372315_02341 CDS open 1336-2505 _na     389_aa cysteine-S-conjugate beta-lyase
4701 CAJPOY010000170.1 GCA905372315_02340 gene open 176-1330
4702 CAJPOY010000170.1 GCA905372315_02341 gene open 1336-2505
4703 CAJPOY010000171.1 GCA905372315_02342 CDS open 131-2017 _na     628_aa hypothetical protein
4704 CAJPOY010000171.1 GCA905372315_02343 CDS open 2054-2536 _na     160_aa hypothetical protein
4705 CAJPOY010000171.1 GCA905372315_02342 gene open 131-2017
4706 CAJPOY010000171.1 GCA905372315_02343 gene open 2054-2536
4707 CAJPOY010000172.1 GCA905372315_02344 CDS open 113-1180 _na     355_aa UDP-glucose--hexose-1-phosphate uridylyltransferase
4708 CAJPOY010000172.1 GCA905372315_02345 CDS open 1196-2218 _na     340_aa HTH lacI-type domain-containing protein
4709 CAJPOY010000172.1 GCA905372315_02346 CDS open 2077-2562 _na     161_aa hypothetical protein
4710 CAJPOY010000172.1 GCA905372315_02344 gene open 113-1180
4711 CAJPOY010000172.1 GCA905372315_02345 gene open 1196-2218
4712 CAJPOY010000172.1 GCA905372315_02346 gene open 2077-2562
4713 CAJPOY010000173.1 GCA905372315_02347 CDS open 23-634 _na     203_aa hypothetical protein
4714 CAJPOY010000173.1 GCA905372315_02348 CDS open 905-1249 _na     114_aa hypothetical protein
4715 CAJPOY010000173.1 GCA905372315_02349 CDS open 1268-1480 _na     70_aa hypothetical protein
4716 CAJPOY010000173.1 GCA905372315_02350 CDS open 1915-2301 _na     128_aa GtrA/DPMS transmembrane domain-containing protein
4717 CAJPOY010000173.1 GCA905372315_02347 gene open 23-634
4718 CAJPOY010000173.1 GCA905372315_02348 gene open 905-1249
4719 CAJPOY010000173.1 GCA905372315_02349 gene open 1268-1480
4720 CAJPOY010000173.1 GCA905372315_02350 gene open 1915-2301