HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Centipeda periodontii (GCA_905372315.1)

Select a Genome:
BAKTA Annotations for GCA_905372315.1
Genome Selected: Centipeda periodontii
ContigsBases CDSrRNA tmRNAtRNA
173 2403355 2315 0 1 28
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4720 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:5]    |    Number of Records Found: 4720 [10 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
2001 CAJPOY010000019.1 GCA905372315_00989 gene open 12345-12809 ribE
2002 CAJPOY010000019.1 GCA905372315_00990 gene open 12814-13377 yfcE
2003 CAJPOY010000019.1 GCA905372315_00991 gene open 13385-14284 hslO
2004 CAJPOY010000019.1 GCA905372315_00992 gene open 14293-15015
2005 CAJPOY010000019.1 GCA905372315_00993 gene open 15120-15668
2006 CAJPOY010000019.1 GCA905372315_00994 gene open 15753-15944 rpmB
2007 CAJPOY010000019.1 GCA905372315_00995 gene open 16232-17062 codY
2008 CAJPOY010000019.1 GCA905372315_00999 gene open 17512-18123
2009 CAJPOY010000019.1 GCA905372315_01000 gene open 18183-19688
2010 CAJPOY010000019.1 GCA905372315_01001 gene open 19780-20289
2011 CAJPOY010000019.1 GCA905372315_01002 gene open 20351-20800
2012 CAJPOY010000019.1 GCA905372315_01003 gene open 20813-21238
2013 CAJPOY010000019.1 GCA905372315_01004 gene open 21235-22098
2014 CAJPOY010000019.1 GCA905372315_01007 gene open 22485-23798 miaB
2015 CAJPOY010000019.1 GCA905372315_01008 gene open 24101-26692 mutS
2016 CAJPOY010000019.1 GCA905372315_01009 gene open 26689-28572 mutL
2017 CAJPOY010000019.1 GCA905372315_01010 gene open 28572-29369
2018 CAJPOY010000019.1 GCA905372315_01011 gene open 29425-29658
2019 CAJPOY010000019.1 GCA905372315_00996 gene open 17185-17259 trnE
2020 CAJPOY010000019.1 GCA905372315_00997 gene open 17266-17342 trnD
2021 CAJPOY010000019.1 GCA905372315_00998 gene open 17354-17429 trnF
2022 CAJPOY010000019.1 GCA905372315_01005 gene open 22257-22331 trnG
2023 CAJPOY010000019.1 GCA905372315_01006 gene open 22338-22411 trnC
2024 CAJPOY010000019.1 GCA905372315_00996 tRNA open 17185-17259 trnE tRNA-Glu(ttc)
2025 CAJPOY010000019.1 GCA905372315_00997 tRNA open 17266-17342 trnD tRNA-Asp(gtc)
2026 CAJPOY010000019.1 GCA905372315_00998 tRNA open 17354-17429 trnF tRNA-Phe(gaa)
2027 CAJPOY010000019.1 GCA905372315_01005 tRNA open 22257-22331 trnG tRNA-Gly(gcc)
2028 CAJPOY010000019.1 GCA905372315_01006 tRNA open 22338-22411 trnC tRNA-Cys(gca)
2029 CAJPOY010000020.1 regulatory_region open 2692-2922 Cobalamin riboswitch aptamer
2030 CAJPOY010000020.1 GCA905372315_01012 CDS open 85-2268 _na     727_aa methylmalonyl-CoA mutase family protein
2031 CAJPOY010000020.1 GCA905372315_01013 CDS open 3043-3852 _na     269_aa 3D/G5 domain protein
2032 CAJPOY010000020.1 GCA905372315_01014 CDS open 4376-5551 _na     391_aa Mutator family transposase
2033 CAJPOY010000020.1 GCA905372315_01015 CDS open 5651-6046 _na     131_aa Tetratricopeptide repeat protein
2034 CAJPOY010000020.1 GCA905372315_01016 CDS open 6069-6911 _na     280_aa Class II fructose-bisphosphate aldolase family protein
2035 CAJPOY010000020.1 GCA905372315_01017 CDS open 6908-7534 _na     208_aa ATP-binding protein
2036 CAJPOY010000020.1 GCA905372315_01018 CDS open 7625-8404 _na     259_aa Hydrolase
2037 CAJPOY010000020.1 GCA905372315_01019 CDS open 8401-9945 _na     514_aa metG methionine--tRNA ligase
2038 CAJPOY010000020.1 GCA905372315_01020 CDS open 10055-11479 _na     474_aa ATP-binding protein
2039 CAJPOY010000020.1 GCA905372315_01021 CDS open 11560-12444 _na     294_aa rsmI 16S rRNA (cytidine(1402)-2'-O)-methyltransferase
2040 CAJPOY010000020.1 GCA905372315_01022 CDS open 12595-13281 _na     228_aa arlR Response regulator ArlR
2041 CAJPOY010000020.1 GCA905372315_01023 CDS open 13265-14695 _na     476_aa histidine kinase
2042 CAJPOY010000020.1 GCA905372315_01024 CDS open 14787-15641 _na     284_aa rfbD dTDP-4-dehydrorhamnose reductase
2043 CAJPOY010000020.1 GCA905372315_01025 CDS open 15700-17001 _na     433_aa sstT serine/threonine transporter SstT
2044 CAJPOY010000020.1 GCA905372315_01026 CDS open 17068-17622 _na     184_aa Biotin transporter
2045 CAJPOY010000020.1 GCA905372315_01027 CDS open 18035-22063 _na     1342_aa rpoC DNA-directed RNA polymerase subunit beta'
2046 CAJPOY010000020.1 GCA905372315_01028 CDS open 22082-25825 _na     1247_aa rpoB DNA-directed RNA polymerase subunit beta
2047 CAJPOY010000020.1 GCA905372315_01029 CDS open 26123-27523 _na     466_aa hypothetical protein
2048 CAJPOY010000020.1 GCA905372315_01030 CDS open 27611-27850 _na     79_aa hypothetical protein
2049 CAJPOY010000020.1 GCA905372315_01031 CDS open 27947-28237 _na     96_aa iron chelate uptake ABC transporter family permease subunit
2050 CAJPOY010000020.1 GCA905372315_01032 CDS open 28383-28967 _na     194_aa FlxA-like family protein
2051 CAJPOY010000020.1 GCA905372315_01033 CDS open 29263-30009 _na     248_aa DUF3153 domain-containing protein
2052 CAJPOY010000020.1 GCA905372315_01012 gene open 85-2268
2053 CAJPOY010000020.1 GCA905372315_01013 gene open 3043-3852
2054 CAJPOY010000020.1 GCA905372315_01014 gene open 4376-5551
2055 CAJPOY010000020.1 GCA905372315_01015 gene open 5651-6046
2056 CAJPOY010000020.1 GCA905372315_01016 gene open 6069-6911
2057 CAJPOY010000020.1 GCA905372315_01017 gene open 6908-7534
2058 CAJPOY010000020.1 GCA905372315_01018 gene open 7625-8404
2059 CAJPOY010000020.1 GCA905372315_01019 gene open 8401-9945 metG
2060 CAJPOY010000020.1 GCA905372315_01020 gene open 10055-11479
2061 CAJPOY010000020.1 GCA905372315_01021 gene open 11560-12444 rsmI
2062 CAJPOY010000020.1 GCA905372315_01022 gene open 12595-13281 arlR
2063 CAJPOY010000020.1 GCA905372315_01023 gene open 13265-14695
2064 CAJPOY010000020.1 GCA905372315_01024 gene open 14787-15641 rfbD
2065 CAJPOY010000020.1 GCA905372315_01025 gene open 15700-17001 sstT
2066 CAJPOY010000020.1 GCA905372315_01026 gene open 17068-17622
2067 CAJPOY010000020.1 GCA905372315_01027 gene open 18035-22063 rpoC
2068 CAJPOY010000020.1 GCA905372315_01028 gene open 22082-25825 rpoB
2069 CAJPOY010000020.1 GCA905372315_01029 gene open 26123-27523
2070 CAJPOY010000020.1 GCA905372315_01030 gene open 27611-27850
2071 CAJPOY010000020.1 GCA905372315_01031 gene open 27947-28237
2072 CAJPOY010000020.1 GCA905372315_01032 gene open 28383-28967
2073 CAJPOY010000020.1 GCA905372315_01033 gene open 29263-30009
2074 CAJPOY010000021.1 GCA905372315_01034 CDS open 3-1994 _na     663_aa DNA polymerase I
2075 CAJPOY010000021.1 GCA905372315_01035 CDS open 1996-2601 _na     201_aa coaE dephospho-CoA kinase
2076 CAJPOY010000021.1 GCA905372315_01036 CDS open 2588-3163 _na     191_aa Transglycosylase
2077 CAJPOY010000021.1 GCA905372315_01037 CDS open 3160-6927 _na     1255_aa PolC-type DNA polymerase III
2078 CAJPOY010000021.1 GCA905372315_01038 CDS open 7087-7386 _na     99_aa RelB/DinJ family addiction module antitoxin
2079 CAJPOY010000021.1 GCA905372315_01039 CDS open 7370-7651 _na     93_aa Type II toxin-antitoxin system mRNA interferase toxin%2C RelE/StbE family
2080 CAJPOY010000021.1 GCA905372315_01040 CDS open 8064-8381 _na     105_aa DUF2442 domain-containing protein
2081 CAJPOY010000021.1 GCA905372315_01041 CDS open 8415-8666 _na     83_aa DUF4160 domain-containing protein
2082 CAJPOY010000021.1 GCA905372315_01042 CDS open 9115-10635 _na     506_aa Outer membrane efflux protein
2083 CAJPOY010000021.1 GCA905372315_01043 CDS open 10645-14976 _na     1443_aa DUF490 domain-containing protein
2084 CAJPOY010000021.1 GCA905372315_01044 CDS open 15000-15626 _na     208_aa Deoxyuridine 5'-triphosphate nucleotidohydrolase
2085 CAJPOY010000021.1 GCA905372315_01045 CDS open 15877-16407 _na     176_aa secG Preprotein translocase subunit SecG
2086 CAJPOY010000021.1 GCA905372315_01046 CDS open 16481-18445 _na     654_aa bamA outer membrane protein assembly factor BamA
2087 CAJPOY010000021.1 GCA905372315_01047 CDS open 18445-19755 _na     436_aa Acylphosphatase
2088 CAJPOY010000021.1 GCA905372315_01048 CDS open 19775-20731 _na     318_aa Group 2 glycosyl transferase
2089 CAJPOY010000021.1 GCA905372315_01049 CDS open 20724-22184 _na     486_aa Dolichyl-phosphate-mannose-protein mannosyltransferase
2090 CAJPOY010000021.1 GCA905372315_01050 CDS open 22277-22678 _na     133_aa Lipoprotein
2091 CAJPOY010000021.1 GCA905372315_01051 CDS open 22764-23228 _na     154_aa Outer membrane protein
2092 CAJPOY010000021.1 GCA905372315_01052 CDS open 23302-24351 _na     349_aa ompH OmpH family outer membrane protein
2093 CAJPOY010000021.1 GCA905372315_01053 CDS open 24410-24841 _na     143_aa ompH OmpH family outer membrane protein
2094 CAJPOY010000021.1 GCA905372315_01054 CDS open 24855-25880 _na     341_aa UDP-3-O-acylglucosamine N-acyltransferase
2095 CAJPOY010000021.1 GCA905372315_01055 CDS open 25882-26754 _na     290_aa Lipid A biosynthesis lauroyl acyltransferase
2096 CAJPOY010000021.1 GCA905372315_01056 CDS open 26887-28116 _na     409_aa AAA+ superfamily ATPase
2097 CAJPOY010000021.1 GCA905372315_01057 CDS open 28321-29187 _na     288_aa hypothetical protein
2098 CAJPOY010000021.1 GCA905372315_01034 gene open 3-1994
2099 CAJPOY010000021.1 GCA905372315_01035 gene open 1996-2601 coaE
2100 CAJPOY010000021.1 GCA905372315_01036 gene open 2588-3163
2101 CAJPOY010000021.1 GCA905372315_01037 gene open 3160-6927
2102 CAJPOY010000021.1 GCA905372315_01038 gene open 7087-7386
2103 CAJPOY010000021.1 GCA905372315_01039 gene open 7370-7651
2104 CAJPOY010000021.1 GCA905372315_01040 gene open 8064-8381
2105 CAJPOY010000021.1 GCA905372315_01041 gene open 8415-8666
2106 CAJPOY010000021.1 GCA905372315_01042 gene open 9115-10635
2107 CAJPOY010000021.1 GCA905372315_01043 gene open 10645-14976
2108 CAJPOY010000021.1 GCA905372315_01044 gene open 15000-15626
2109 CAJPOY010000021.1 GCA905372315_01045 gene open 15877-16407 secG
2110 CAJPOY010000021.1 GCA905372315_01046 gene open 16481-18445 bamA
2111 CAJPOY010000021.1 GCA905372315_01047 gene open 18445-19755
2112 CAJPOY010000021.1 GCA905372315_01048 gene open 19775-20731
2113 CAJPOY010000021.1 GCA905372315_01049 gene open 20724-22184
2114 CAJPOY010000021.1 GCA905372315_01050 gene open 22277-22678
2115 CAJPOY010000021.1 GCA905372315_01051 gene open 22764-23228
2116 CAJPOY010000021.1 GCA905372315_01052 gene open 23302-24351 ompH
2117 CAJPOY010000021.1 GCA905372315_01053 gene open 24410-24841 ompH
2118 CAJPOY010000021.1 GCA905372315_01054 gene open 24855-25880
2119 CAJPOY010000021.1 GCA905372315_01055 gene open 25882-26754
2120 CAJPOY010000021.1 GCA905372315_01056 gene open 26887-28116
2121 CAJPOY010000021.1 GCA905372315_01057 gene open 28321-29187
2122 CAJPOY010000022.1 GCA905372315_01058 CDS open 44-646 _na     200_aa GTP cyclohydrolase 1
2123 CAJPOY010000022.1 GCA905372315_01059 CDS open 719-1606 _na     295_aa dapA 4-hydroxy-tetrahydrodipicolinate synthase
2124 CAJPOY010000022.1 GCA905372315_01060 CDS open 1675-4596 _na     973_aa Peptidase M16C associated domain-containing protein
2125 CAJPOY010000022.1 GCA905372315_01061 CDS open 4713-5531 _na     272_aa Flagellar assembly protein H
2126 CAJPOY010000022.1 GCA905372315_01062 CDS open 5604-6479 _na     291_aa truB tRNA pseudouridine(55) synthase TruB
2127 CAJPOY010000022.1 GCA905372315_01063 CDS open 6483-7430 _na     315_aa DHHA1 domain-containing protein
2128 CAJPOY010000022.1 GCA905372315_01064 CDS open 7427-7801 _na     124_aa rbfA 30S ribosome-binding factor RbfA
2129 CAJPOY010000022.1 GCA905372315_01065 CDS open 7889-10498 _na     869_aa infB translation initiation factor IF-2
2130 CAJPOY010000022.1 GCA905372315_01066 CDS open 10498-10830 _na     110_aa Ribosomal protein eL8/eL30/eS12/Gadd45 domain-containing protein
2131 CAJPOY010000022.1 GCA905372315_01067 CDS open 10827-11105 _na     92_aa ylxR YlxR domain-containing protein
2132 CAJPOY010000022.1 GCA905372315_01068 CDS open 11105-12247 _na     380_aa nusA Transcription termination/antitermination protein NusA
2133 CAJPOY010000022.1 GCA905372315_01069 CDS open 12262-12711 _na     149_aa rimP Ribosome maturation factor RimP
2134 CAJPOY010000022.1 GCA905372315_01070 CDS open 12839-13222 _na     127_aa Peptidase M48
2135 CAJPOY010000022.1 GCA905372315_01071 CDS open 13239-14789 _na     516_aa Core-binding (CB) domain-containing protein
2136 CAJPOY010000022.1 GCA905372315_01072 CDS open 14917-16065 _na     382_aa dnaJ molecular chaperone DnaJ
2137 CAJPOY010000022.1 GCA905372315_01073 CDS open 16075-17934 _na     619_aa dnaK molecular chaperone DnaK
2138 CAJPOY010000022.1 GCA905372315_01074 CDS open 17977-18549 _na     190_aa grpE nucleotide exchange factor GrpE
2139 CAJPOY010000022.1 GCA905372315_01075 CDS open 18543-19577 _na     344_aa hrcA heat-inducible transcriptional repressor HrcA
2140 CAJPOY010000022.1 GCA905372315_01076 CDS open 19942-28791 _na     2949_aa MBG domain-containing protein
2141 CAJPOY010000022.1 GCA905372315_01058 gene open 44-646
2142 CAJPOY010000022.1 GCA905372315_01059 gene open 719-1606 dapA
2143 CAJPOY010000022.1 GCA905372315_01060 gene open 1675-4596
2144 CAJPOY010000022.1 GCA905372315_01061 gene open 4713-5531
2145 CAJPOY010000022.1 GCA905372315_01062 gene open 5604-6479 truB
2146 CAJPOY010000022.1 GCA905372315_01063 gene open 6483-7430
2147 CAJPOY010000022.1 GCA905372315_01064 gene open 7427-7801 rbfA
2148 CAJPOY010000022.1 GCA905372315_01065 gene open 7889-10498 infB
2149 CAJPOY010000022.1 GCA905372315_01066 gene open 10498-10830
2150 CAJPOY010000022.1 GCA905372315_01067 gene open 10827-11105 ylxR
2151 CAJPOY010000022.1 GCA905372315_01068 gene open 11105-12247 nusA
2152 CAJPOY010000022.1 GCA905372315_01069 gene open 12262-12711 rimP
2153 CAJPOY010000022.1 GCA905372315_01070 gene open 12839-13222
2154 CAJPOY010000022.1 GCA905372315_01071 gene open 13239-14789
2155 CAJPOY010000022.1 GCA905372315_01072 gene open 14917-16065 dnaJ
2156 CAJPOY010000022.1 GCA905372315_01073 gene open 16075-17934 dnaK
2157 CAJPOY010000022.1 GCA905372315_01074 gene open 17977-18549 grpE
2158 CAJPOY010000022.1 GCA905372315_01075 gene open 18543-19577 hrcA
2159 CAJPOY010000022.1 GCA905372315_01076 gene open 19942-28791
2160 CAJPOY010000023.1 GCA905372315_01077 CDS open 56-1342 _na     428_aa TRAP transporter large permease protein
2161 CAJPOY010000023.1 GCA905372315_01078 CDS open 1339-1863 _na     174_aa TRAP transporter small permease
2162 CAJPOY010000023.1 GCA905372315_01079 CDS open 1880-2392 _na     170_aa hypothetical protein
2163 CAJPOY010000023.1 GCA905372315_01080 CDS open 2637-3884 _na     415_aa D-galactonate dehydratase family member Dd703_0947
2164 CAJPOY010000023.1 GCA905372315_01081 CDS open 3971-4729 _na     252_aa FCD domain protein
2165 CAJPOY010000023.1 GCA905372315_01082 CDS open 5084-5323 _na     79_aa DUF1653 domain-containing protein
2166 CAJPOY010000023.1 GCA905372315_01083 CDS open 5378-5767 _na     129_aa hypothetical protein
2167 CAJPOY010000023.1 GCA905372315_01084 CDS open 6469-7002 _na     177_aa O-acetyl-ADP-ribose deacetylase
2168 CAJPOY010000023.1 GCA905372315_01085 CDS open 7134-8477 _na     447_aa TFIIB-type zinc ribbon-containing protein
2169 CAJPOY010000023.1 GCA905372315_01086 CDS open 8594-10129 _na     511_aa ABC transporter%2C substrate-binding protein%2C family 5
2170 CAJPOY010000023.1 GCA905372315_01087 CDS open 10170-10922 _na     250_aa Lipoprotein
2171 CAJPOY010000023.1 GCA905372315_01088 CDS open 11205-11750 _na     181_aa hypothetical protein
2172 CAJPOY010000023.1 GCA905372315_01089 CDS open 11844-12209 _na     121_aa hypothetical protein
2173 CAJPOY010000023.1 GCA905372315_01090 CDS open 12426-13283 _na     285_aa DUF3298 domain-containing protein
2174 CAJPOY010000023.1 GCA905372315_01091 CDS open 13622-14575 _na     317_aa hypothetical protein
2175 CAJPOY010000023.1 GCA905372315_01092 CDS open 14993-17425 _na     810_aa Histidine kinase N-terminal 7TM region domain-containing protein
2176 CAJPOY010000023.1 GCA905372315_01093 CDS open 17413-18801 _na     462_aa histidine kinase
2177 CAJPOY010000023.1 GCA905372315_01094 CDS open 18798-19418 _na     206_aa Response regulator
2178 CAJPOY010000023.1 GCA905372315_01095 CDS open 19591-21000 _na     469_aa SPFH domain-containing protein
2179 CAJPOY010000023.1 GCA905372315_01096 CDS open 21030-22148 _na     372_aa Zinc finger domain protein%2C LSD1 subclass
2180 CAJPOY010000023.1 GCA905372315_01097 CDS open 22161-22994 _na     277_aa TPM domain-containing protein
2181 CAJPOY010000023.1 GCA905372315_01098 CDS open 23119-23691 _na     190_aa DUF3862 domain-containing protein
2182 CAJPOY010000023.1 GCA905372315_01099 CDS open 23878-24378 _na     166_aa hypothetical protein
2183 CAJPOY010000023.1 GCA905372315_01100 CDS open 24535-25365 _na     276_aa Helix-turn-helix domain-containing protein
2184 CAJPOY010000023.1 GCA905372315_01101 CDS open 25676-25819 _na     47_aa hypothetical protein
2185 CAJPOY010000023.1 GCA905372315_01102 CDS open 25894-26142 _na     82_aa KTSC domain-containing protein
2186 CAJPOY010000023.1 GCA905372315_01103 CDS open 26155-26976 _na     273_aa S-adenosylmethionine-dependent nucleotide dehydratase
2187 CAJPOY010000023.1 GCA905372315_01104 CDS open 27088-27243 _na     51_aa hypothetical protein
2188 CAJPOY010000023.1 GCA905372315_01105 CDS open 27524-28255 _na     243_aa ADP-ribosylglycohydrolase
2189 CAJPOY010000023.1 GCA905372315_01077 gene open 56-1342
2190 CAJPOY010000023.1 GCA905372315_01078 gene open 1339-1863
2191 CAJPOY010000023.1 GCA905372315_01079 gene open 1880-2392
2192 CAJPOY010000023.1 GCA905372315_01080 gene open 2637-3884
2193 CAJPOY010000023.1 GCA905372315_01081 gene open 3971-4729
2194 CAJPOY010000023.1 GCA905372315_01082 gene open 5084-5323
2195 CAJPOY010000023.1 GCA905372315_01083 gene open 5378-5767
2196 CAJPOY010000023.1 GCA905372315_01084 gene open 6469-7002
2197 CAJPOY010000023.1 GCA905372315_01085 gene open 7134-8477
2198 CAJPOY010000023.1 GCA905372315_01086 gene open 8594-10129
2199 CAJPOY010000023.1 GCA905372315_01087 gene open 10170-10922
2200 CAJPOY010000023.1 GCA905372315_01088 gene open 11205-11750
2201 CAJPOY010000023.1 GCA905372315_01089 gene open 11844-12209
2202 CAJPOY010000023.1 GCA905372315_01090 gene open 12426-13283
2203 CAJPOY010000023.1 GCA905372315_01091 gene open 13622-14575
2204 CAJPOY010000023.1 GCA905372315_01092 gene open 14993-17425
2205 CAJPOY010000023.1 GCA905372315_01093 gene open 17413-18801
2206 CAJPOY010000023.1 GCA905372315_01094 gene open 18798-19418
2207 CAJPOY010000023.1 GCA905372315_01095 gene open 19591-21000
2208 CAJPOY010000023.1 GCA905372315_01096 gene open 21030-22148
2209 CAJPOY010000023.1 GCA905372315_01097 gene open 22161-22994
2210 CAJPOY010000023.1 GCA905372315_01098 gene open 23119-23691
2211 CAJPOY010000023.1 GCA905372315_01099 gene open 23878-24378
2212 CAJPOY010000023.1 GCA905372315_01100 gene open 24535-25365
2213 CAJPOY010000023.1 GCA905372315_01101 gene open 25676-25819
2214 CAJPOY010000023.1 GCA905372315_01102 gene open 25894-26142
2215 CAJPOY010000023.1 GCA905372315_01103 gene open 26155-26976
2216 CAJPOY010000023.1 GCA905372315_01104 gene open 27088-27243
2217 CAJPOY010000023.1 GCA905372315_01105 gene open 27524-28255
2218 CAJPOY010000024.1 GCA905372315_01106 CDS open 33-2234 _na     733_aa hypothetical protein
2219 CAJPOY010000024.1 GCA905372315_01107 CDS open 2626-3981 _na     451_aa Phosphomannomutase
2220 CAJPOY010000024.1 GCA905372315_01108 CDS open 4013-5461 _na     482_aa Glucose-6-phosphate isomerase
2221 CAJPOY010000024.1 GCA905372315_01109 CDS open 5592-6143 _na     183_aa gspC Type II secretion system protein GspC N-terminal domain-containing protein
2222 CAJPOY010000024.1 GCA905372315_01110 CDS open 6150-7442 _na     430_aa Type II and III secretion system protein
2223 CAJPOY010000024.1 GCA905372315_01111 CDS open 7476-8147 _na     223_aa Response regulator receiver domain-containing protein
2224 CAJPOY010000024.1 GCA905372315_01112 CDS open 8288-9157 _na     289_aa PD-(D/E)XK nuclease family transposase
2225 CAJPOY010000024.1 GCA905372315_01113 CDS open 9181-10032 _na     283_aa PD-(D/E)XK nuclease family transposase
2226 CAJPOY010000024.1 GCA905372315_01114 CDS open 10107-10886 _na     259_aa ZIP zinc transporter
2227 CAJPOY010000024.1 GCA905372315_01115 CDS open 11546-12850 _na     434_aa eno phosphopyruvate hydratase
2228 CAJPOY010000024.1 GCA905372315_01116 CDS open 12919-13431 _na     170_aa Nitroreductase domain-containing protein
2229 CAJPOY010000024.1 GCA905372315_01117 CDS open 13591-14439 _na     282_aa hypothetical protein
2230 CAJPOY010000024.1 GCA905372315_01118 CDS open 14578-16398 _na     606_aa Peptidase M48 domain-containing protein
2231 CAJPOY010000024.1 GCA905372315_01119 CDS open 16616-18304 _na     562_aa ilvB biosynthetic-type acetolactate synthase large subunit
2232 CAJPOY010000024.1 GCA905372315_01120 CDS open 18306-18806 _na     166_aa ilvN acetolactate synthase small subunit
2233 CAJPOY010000024.1 GCA905372315_01121 CDS open 18830-19750 _na     306_aa Sugar-binding domain protein
2234 CAJPOY010000024.1 GCA905372315_01122 CDS open 19764-21488 _na     574_aa Methyl-accepting chemotaxis sensory transducer
2235 CAJPOY010000024.1 GCA905372315_01123 CDS open 21735-22016 _na     93_aa groES co-chaperone GroES
2236 CAJPOY010000024.1 GCA905372315_01124 CDS open 22041-23669 _na     542_aa groL chaperonin GroEL
2237 CAJPOY010000024.1 GCA905372315_01125 CDS open 23781-24248 _na     155_aa Mannose-6-phosphate isomerase
2238 CAJPOY010000024.1 GCA905372315_01126 CDS open 24416-25738 _na     440_aa Homoserine dehydrogenase
2239 CAJPOY010000024.1 GCA905372315_01127 CDS open 25806-26183 _na     125_aa Protein of hypothetical function UPF0150
2240 CAJPOY010000024.1 GCA905372315_01128 CDS open 26637-27242 _na     201_aa Cytidylate kinase
2241 CAJPOY010000024.1 GCA905372315_01106 gene open 33-2234
2242 CAJPOY010000024.1 GCA905372315_01107 gene open 2626-3981
2243 CAJPOY010000024.1 GCA905372315_01108 gene open 4013-5461
2244 CAJPOY010000024.1 GCA905372315_01109 gene open 5592-6143 gspC
2245 CAJPOY010000024.1 GCA905372315_01110 gene open 6150-7442
2246 CAJPOY010000024.1 GCA905372315_01111 gene open 7476-8147
2247 CAJPOY010000024.1 GCA905372315_01112 gene open 8288-9157
2248 CAJPOY010000024.1 GCA905372315_01113 gene open 9181-10032
2249 CAJPOY010000024.1 GCA905372315_01114 gene open 10107-10886
2250 CAJPOY010000024.1 GCA905372315_01115 gene open 11546-12850 eno
2251 CAJPOY010000024.1 GCA905372315_01116 gene open 12919-13431
2252 CAJPOY010000024.1 GCA905372315_01117 gene open 13591-14439
2253 CAJPOY010000024.1 GCA905372315_01118 gene open 14578-16398
2254 CAJPOY010000024.1 GCA905372315_01119 gene open 16616-18304 ilvB
2255 CAJPOY010000024.1 GCA905372315_01120 gene open 18306-18806 ilvN
2256 CAJPOY010000024.1 GCA905372315_01121 gene open 18830-19750
2257 CAJPOY010000024.1 GCA905372315_01122 gene open 19764-21488
2258 CAJPOY010000024.1 GCA905372315_01123 gene open 21735-22016 groES
2259 CAJPOY010000024.1 GCA905372315_01124 gene open 22041-23669 groL
2260 CAJPOY010000024.1 GCA905372315_01125 gene open 23781-24248
2261 CAJPOY010000024.1 GCA905372315_01126 gene open 24416-25738
2262 CAJPOY010000024.1 GCA905372315_01127 gene open 25806-26183
2263 CAJPOY010000024.1 GCA905372315_01128 gene open 26637-27242
2264 CAJPOY010000025.1 regulatory_region open 8195-8352 glmS glucosamine-6-phosphate activated ribozyme aptamer
2265 CAJPOY010000025.1 GCA905372315_01129 CDS open 17-148 _na     43_aa hypothetical protein
2266 CAJPOY010000025.1 GCA905372315_01130 CDS open 117-1343 _na     408_aa jetD Wadjet protein JetD C-terminal domain-containing protein
2267 CAJPOY010000025.1 GCA905372315_01131 CDS open 1419-2174 _na     251_aa Metallo-beta-lactamase domain-containing protein
2268 CAJPOY010000025.1 GCA905372315_01132 CDS open 2191-3294 _na     367_aa PDZ domain-containing protein
2269 CAJPOY010000025.1 GCA905372315_01133 CDS open 3291-3770 _na     159_aa rlmH 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH
2270 CAJPOY010000025.1 GCA905372315_01134 CDS open 3928-5277 _na     449_aa gdhA NADP-specific glutamate dehydrogenase
2271 CAJPOY010000025.1 GCA905372315_01135 CDS open 5399-6244 _na     281_aa undecaprenyl-diphosphate phosphatase
2272 CAJPOY010000025.1 GCA905372315_01136 CDS open 6248-6886 _na     212_aa pth aminoacyl-tRNA hydrolase
2273 CAJPOY010000025.1 GCA905372315_01137 CDS open 6840-8117 _na     425_aa Radical SAM domain protein
2274 CAJPOY010000025.1 GCA905372315_01138 CDS open 8393-10222 _na     609_aa glmS glutamine--fructose-6-phosphate transaminase (isomerizing)
2275 CAJPOY010000025.1 GCA905372315_01139 CDS open 10371-11651 _na     426_aa Threonine/serine exporter-like N-terminal domain-containing protein
2276 CAJPOY010000025.1 GCA905372315_01140 CDS open 11648-12859 _na     403_aa Bcr/CflA family efflux transporter
2277 CAJPOY010000025.1 GCA905372315_01141 CDS open 12980-13657 _na     225_aa irlR Two component response regulator IrlR
2278 CAJPOY010000025.1 GCA905372315_01142 CDS open 13654-14955 _na     433_aa histidine kinase
2279 CAJPOY010000025.1 GCA905372315_01143 CDS open 14969-15811 _na     280_aa energy-coupling factor transporter ATPase
2280 CAJPOY010000025.1 GCA905372315_01144 CDS open 15796-16647 _na     283_aa energy-coupling factor transporter ATPase
2281 CAJPOY010000025.1 GCA905372315_01145 CDS open 16867-18078 _na     403_aa HDIG domain protein
2282 CAJPOY010000025.1 GCA905372315_01146 CDS open 18306-19793 _na     495_aa Cell envelope-related transcriptional attenuator
2283 CAJPOY010000025.1 GCA905372315_01147 CDS open 19795-21717 _na     640_aa abc-f ribosomal protection-like ABC-F family protein
2284 CAJPOY010000025.1 GCA905372315_01148 CDS open 21719-23887 _na     722_aa ATP-dependent RecD-like DNA helicase
2285 CAJPOY010000025.1 GCA905372315_01149 CDS open 23955-24677 _na     240_aa hypothetical protein
2286 CAJPOY010000025.1 GCA905372315_01150 CDS open 25022-25336 _na     104_aa Transposase
2287 CAJPOY010000025.1 GCA905372315_01151 CDS open 25350-26267 _na     305_aa Rpn family recombination-promoting nuclease/putative transposase
2288 CAJPOY010000025.1 GCA905372315_01152 CDS open 26270-26407 _na     45_aa hypothetical protein
2289 CAJPOY010000025.1 GCA905372315_01153 CDS open 26511-27431 _na     306_aa Rpn family recombination-promoting nuclease/putative transposase
2290 CAJPOY010000025.1 GCA905372315_01129 gene open 17-148
2291 CAJPOY010000025.1 GCA905372315_01130 gene open 117-1343 jetD
2292 CAJPOY010000025.1 GCA905372315_01131 gene open 1419-2174
2293 CAJPOY010000025.1 GCA905372315_01132 gene open 2191-3294
2294 CAJPOY010000025.1 GCA905372315_01133 gene open 3291-3770 rlmH
2295 CAJPOY010000025.1 GCA905372315_01134 gene open 3928-5277 gdhA
2296 CAJPOY010000025.1 GCA905372315_01135 gene open 5399-6244
2297 CAJPOY010000025.1 GCA905372315_01136 gene open 6248-6886 pth
2298 CAJPOY010000025.1 GCA905372315_01137 gene open 6840-8117
2299 CAJPOY010000025.1 GCA905372315_01138 gene open 8393-10222 glmS
2300 CAJPOY010000025.1 GCA905372315_01139 gene open 10371-11651
2301 CAJPOY010000025.1 GCA905372315_01140 gene open 11648-12859
2302 CAJPOY010000025.1 GCA905372315_01141 gene open 12980-13657 irlR
2303 CAJPOY010000025.1 GCA905372315_01142 gene open 13654-14955
2304 CAJPOY010000025.1 GCA905372315_01143 gene open 14969-15811
2305 CAJPOY010000025.1 GCA905372315_01144 gene open 15796-16647
2306 CAJPOY010000025.1 GCA905372315_01145 gene open 16867-18078
2307 CAJPOY010000025.1 GCA905372315_01146 gene open 18306-19793
2308 CAJPOY010000025.1 GCA905372315_01147 gene open 19795-21717 abc-f
2309 CAJPOY010000025.1 GCA905372315_01148 gene open 21719-23887
2310 CAJPOY010000025.1 GCA905372315_01149 gene open 23955-24677
2311 CAJPOY010000025.1 GCA905372315_01150 gene open 25022-25336
2312 CAJPOY010000025.1 GCA905372315_01151 gene open 25350-26267
2313 CAJPOY010000025.1 GCA905372315_01152 gene open 26270-26407
2314 CAJPOY010000025.1 GCA905372315_01153 gene open 26511-27431
2315 CAJPOY010000026.1 GCA905372315_01154 CDS open 128-2350 _na     740_aa Outer membrane receptor
2316 CAJPOY010000026.1 GCA905372315_01155 CDS open 2419-3189 _na     256_aa Methyltransferase domain-containing protein
2317 CAJPOY010000026.1 GCA905372315_01156 CDS open 3247-3390 _na     47_aa hypothetical protein
2318 CAJPOY010000026.1 GCA905372315_01157 CDS open 3502-3726 _na     74_aa Addiction module antitoxin%2C RelB/DinJ family
2319 CAJPOY010000026.1 GCA905372315_01158 CDS open 3819-4469 _na     216_aa RNA polymerase%2C sigma-24 subunit%2C ECF subfamily protein
2320 CAJPOY010000026.1 GCA905372315_01159 CDS open 4790-6973 _na     727_aa EAL domain-containing protein
2321 CAJPOY010000026.1 GCA905372315_01160 CDS open 6988-8040 _na     350_aa hypothetical protein
2322 CAJPOY010000026.1 GCA905372315_01161 CDS open 8155-8856 _na     233_aa rsmG 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG
2323 CAJPOY010000026.1 GCA905372315_01162 CDS open 9412-13665 _na     1417_aa Autotransporter domain-containing protein
2324 CAJPOY010000026.1 GCA905372315_01163 CDS open 14073-14987 _na     304_aa Flagellar assembly protein H
2325 CAJPOY010000026.1 GCA905372315_01164 CDS open 15045-16283 _na     412_aa Hydroxypyruvate reductase
2326 CAJPOY010000026.1 GCA905372315_01165 CDS open 16518-18179 _na     553_aa treC alpha%2Calpha-phosphotrehalase
2327 CAJPOY010000026.1 GCA905372315_01166 CDS open 18220-18666 _na     148_aa Membrane-bound metal-dependent hydrolase
2328 CAJPOY010000026.1 GCA905372315_01167 CDS open 18832-20016 _na     394_aa NADH-dependent butanol dehydrogenase A
2329 CAJPOY010000026.1 GCA905372315_01168 CDS open 20186-21733 _na     515_aa sdcS Sodium-dependent dicarboxylate transporter SdcS
2330 CAJPOY010000026.1 GCA905372315_01169 CDS open 21822-22274 _na     150_aa DUF3601 domain-containing protein
2331 CAJPOY010000026.1 GCA905372315_01170 CDS open 22411-23373 _na     320_aa Glycerate dehydrogenase
2332 CAJPOY010000026.1 GCA905372315_01171 CDS open 23407-24261 _na     284_aa Aldo/keto reductase family oxidoreductase
2333 CAJPOY010000026.1 GCA905372315_01172 CDS open 24588-25847 _na     419_aa Citrate transporter-like domain-containing protein
2334 CAJPOY010000026.1 GCA905372315_01173 CDS open 26007-27323 _na     438_aa Glycine hydroxymethyltransferase
2335 CAJPOY010000026.1 GCA905372315_01154 gene open 128-2350
2336 CAJPOY010000026.1 GCA905372315_01155 gene open 2419-3189
2337 CAJPOY010000026.1 GCA905372315_01156 gene open 3247-3390
2338 CAJPOY010000026.1 GCA905372315_01157 gene open 3502-3726
2339 CAJPOY010000026.1 GCA905372315_01158 gene open 3819-4469
2340 CAJPOY010000026.1 GCA905372315_01159 gene open 4790-6973
2341 CAJPOY010000026.1 GCA905372315_01160 gene open 6988-8040
2342 CAJPOY010000026.1 GCA905372315_01161 gene open 8155-8856 rsmG
2343 CAJPOY010000026.1 GCA905372315_01162 gene open 9412-13665
2344 CAJPOY010000026.1 GCA905372315_01163 gene open 14073-14987
2345 CAJPOY010000026.1 GCA905372315_01164 gene open 15045-16283
2346 CAJPOY010000026.1 GCA905372315_01165 gene open 16518-18179 treC
2347 CAJPOY010000026.1 GCA905372315_01166 gene open 18220-18666
2348 CAJPOY010000026.1 GCA905372315_01167 gene open 18832-20016
2349 CAJPOY010000026.1 GCA905372315_01168 gene open 20186-21733 sdcS
2350 CAJPOY010000026.1 GCA905372315_01169 gene open 21822-22274
2351 CAJPOY010000026.1 GCA905372315_01170 gene open 22411-23373
2352 CAJPOY010000026.1 GCA905372315_01171 gene open 23407-24261
2353 CAJPOY010000026.1 GCA905372315_01172 gene open 24588-25847
2354 CAJPOY010000026.1 GCA905372315_01173 gene open 26007-27323
2355 CAJPOY010000027.1 GCA905372315_01174 CDS open 629-1369 _na     246_aa hypothetical protein
2356 CAJPOY010000027.1 GCA905372315_01175 CDS open 1449-3446 _na     665_aa traC DNA primase TraC
2357 CAJPOY010000027.1 GCA905372315_01176 CDS open 3549-3662 _na     37_aa hypothetical protein
2358 CAJPOY010000027.1 GCA905372315_01177 CDS open 3790-3981 _na     63_aa carD CarD family transcriptional regulator
2359 CAJPOY010000027.1 GCA905372315_01178 CDS open 4048-4593 _na     181_aa PepSY domain-containing protein
2360 CAJPOY010000027.1 GCA905372315_01179 CDS open 4623-5444 _na     273_aa UDP-N-acetylglucosamine kinase
2361 CAJPOY010000027.1 GCA905372315_01180 CDS open 5413-5709 _na     98_aa Antitoxin epsilon/PezA domain-containing protein
2362 CAJPOY010000027.1 GCA905372315_01181 CDS open 5787-6674 _na     295_aa Band 7 domain-containing protein
2363 CAJPOY010000027.1 GCA905372315_01182 CDS open 6742-8655 _na     637_aa M23B family peptidase
2364 CAJPOY010000027.1 GCA905372315_01183 CDS open 8738-9034 _na     98_aa hypothetical protein
2365 CAJPOY010000027.1 GCA905372315_01184 CDS open 9074-10663 _na     529_aa TrbL/VirB6 conjugal transfer protein
2366 CAJPOY010000027.1 GCA905372315_01185 CDS open 10774-11562 _na     262_aa trbJ P-type conjugative transfer protein TrbJ
2367 CAJPOY010000027.1 GCA905372315_01186 CDS open 11579-13447 _na     622_aa hypothetical protein
2368 CAJPOY010000027.1 GCA905372315_01187 CDS open 13453-13674 _na     73_aa L-PSP family endoribonuclease
2369 CAJPOY010000027.1 GCA905372315_01188 CDS open 13671-16154 _na     827_aa trbE Conjugal transfer protein TrbE
2370 CAJPOY010000027.1 GCA905372315_01189 CDS open 16141-17265 _na     374_aa ATPase
2371 CAJPOY010000027.1 GCA905372315_01190 CDS open 17279-17560 _na     93_aa virB3 Type IV secretion system protein VirB3
2372 CAJPOY010000027.1 GCA905372315_01191 CDS open 17570-17992 _na     140_aa TrbC/VIRB2 pilin
2373 CAJPOY010000027.1 GCA905372315_01192 CDS open 18147-18848 _na     233_aa Nucleotidyl transferase AbiEii/AbiGii toxin family protein
2374 CAJPOY010000027.1 GCA905372315_01193 CDS open 18808-19254 _na     148_aa hypothetical protein
2375 CAJPOY010000027.1 GCA905372315_01194 CDS open 19345-20709 _na     454_aa hypothetical protein
2376 CAJPOY010000027.1 GCA905372315_01195 CDS open 20715-21866 _na     383_aa trbG Conjugal transfer protein trbG
2377 CAJPOY010000027.1 GCA905372315_01196 CDS open 21892-22647 _na     251_aa Conjugal transfer protein
2378 CAJPOY010000027.1 GCA905372315_01197 CDS open 22651-23202 _na     183_aa hypothetical protein
2379 CAJPOY010000027.1 GCA905372315_01198 CDS open 23234-23740 _na     168_aa hypothetical protein
2380 CAJPOY010000027.1 GCA905372315_01199 CDS open 23750-24301 _na     183_aa S26 family signal peptidase
2381 CAJPOY010000027.1 GCA905372315_01200 CDS open 24355-25104 _na     249_aa hypothetical protein
2382 CAJPOY010000027.1 GCA905372315_01201 CDS open 25127-25459 _na     110_aa hypothetical protein
2383 CAJPOY010000027.1 GCA905372315_01202 CDS open 25694-26182 _na     162_aa hypothetical protein
2384 CAJPOY010000027.1 GCA905372315_01203 CDS open 26394-26591 _na     65_aa EF-hand domain-containing protein
2385 CAJPOY010000027.1 GCA905372315_01204 CDS open 26600-26914 _na     104_aa Phage protein
2386 CAJPOY010000027.1 GCA905372315_01205 CDS open 26948-27178 _na     76_aa hypothetical protein
2387 CAJPOY010000027.1 GCA905372315_01174 gene open 629-1369
2388 CAJPOY010000027.1 GCA905372315_01175 gene open 1449-3446 traC
2389 CAJPOY010000027.1 GCA905372315_01176 gene open 3549-3662
2390 CAJPOY010000027.1 GCA905372315_01177 gene open 3790-3981 carD
2391 CAJPOY010000027.1 GCA905372315_01178 gene open 4048-4593
2392 CAJPOY010000027.1 GCA905372315_01179 gene open 4623-5444
2393 CAJPOY010000027.1 GCA905372315_01180 gene open 5413-5709
2394 CAJPOY010000027.1 GCA905372315_01181 gene open 5787-6674
2395 CAJPOY010000027.1 GCA905372315_01182 gene open 6742-8655
2396 CAJPOY010000027.1 GCA905372315_01183 gene open 8738-9034
2397 CAJPOY010000027.1 GCA905372315_01184 gene open 9074-10663
2398 CAJPOY010000027.1 GCA905372315_01185 gene open 10774-11562 trbJ
2399 CAJPOY010000027.1 GCA905372315_01186 gene open 11579-13447
2400 CAJPOY010000027.1 GCA905372315_01187 gene open 13453-13674
2401 CAJPOY010000027.1 GCA905372315_01188 gene open 13671-16154 trbE
2402 CAJPOY010000027.1 GCA905372315_01189 gene open 16141-17265
2403 CAJPOY010000027.1 GCA905372315_01190 gene open 17279-17560 virB3
2404 CAJPOY010000027.1 GCA905372315_01191 gene open 17570-17992
2405 CAJPOY010000027.1 GCA905372315_01192 gene open 18147-18848
2406 CAJPOY010000027.1 GCA905372315_01193 gene open 18808-19254
2407 CAJPOY010000027.1 GCA905372315_01194 gene open 19345-20709
2408 CAJPOY010000027.1 GCA905372315_01195 gene open 20715-21866 trbG
2409 CAJPOY010000027.1 GCA905372315_01196 gene open 21892-22647
2410 CAJPOY010000027.1 GCA905372315_01197 gene open 22651-23202
2411 CAJPOY010000027.1 GCA905372315_01198 gene open 23234-23740
2412 CAJPOY010000027.1 GCA905372315_01199 gene open 23750-24301
2413 CAJPOY010000027.1 GCA905372315_01200 gene open 24355-25104
2414 CAJPOY010000027.1 GCA905372315_01201 gene open 25127-25459
2415 CAJPOY010000027.1 GCA905372315_01202 gene open 25694-26182
2416 CAJPOY010000027.1 GCA905372315_01203 gene open 26394-26591
2417 CAJPOY010000027.1 GCA905372315_01204 gene open 26600-26914
2418 CAJPOY010000027.1 GCA905372315_01205 gene open 26948-27178
2419 CAJPOY010000028.1 repeat_region open 21754-23164 CRISPR array with 20 repeats of length 35%2C consensus sequence ATTTCAAAACCACATCCCCGTAAGGGGACGGAAAC and spacer length 36
2420 CAJPOY010000028.1 repeat_region open 23468-23661 CRISPR array with 3 repeats of length 36%2C consensus sequence ATTTCAAAACCACATCCCCGCAAGGGGACGGAAACT and spacer length 38
2421 CAJPOY010000028.1 GCA905372315_01206 CDS open 382-864 _na     160_aa Competence protein comEB
2422 CAJPOY010000028.1 GCA905372315_01207 CDS open 926-2809 _na     627_aa mnmG tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG
2423 CAJPOY010000028.1 GCA905372315_01208 CDS open 2922-3020 _na     32_aa hypothetical protein
2424 CAJPOY010000028.1 GCA905372315_01209 CDS open 3105-4097 _na     330_aa RND efflux pump membrane fusion protein barrel-sandwich domain-containing protein
2425 CAJPOY010000028.1 GCA905372315_01210 CDS open 4087-5007 _na     306_aa ABC transporter%2C ATP-binding protein
2426 CAJPOY010000028.1 GCA905372315_01211 CDS open 5004-6116 _na     370_aa Transport permease protein
2427 CAJPOY010000028.1 GCA905372315_01212 CDS open 6328-7359 _na     343_aa Low specificity L-threonine aldolase
2428 CAJPOY010000028.1 GCA905372315_01213 CDS open 7510-7917 _na     135_aa Head fiber protein
2429 CAJPOY010000028.1 GCA905372315_01214 CDS open 7999-10974 _na     991_aa Autotransporter domain-containing protein
2430 CAJPOY010000028.1 GCA905372315_01215 CDS open 11552-13075 _na     507_aa KWG Leptospira repeat protein
2431 CAJPOY010000028.1 GCA905372315_01216 CDS open 13110-14009 _na     299_aa Glutamate 5-kinase
2432 CAJPOY010000028.1 GCA905372315_01217 CDS open 14011-15393 _na     460_aa Extradiol ring-cleavage dioxygenase class III protein subunit B
2433 CAJPOY010000028.1 GCA905372315_01218 CDS open 15603-16115 _na     170_aa DUF4309 domain-containing protein
2434 CAJPOY010000028.1 GCA905372315_01219 CDS open 16198-17541 _na     447_aa norM putative multidrug resistance protein NorM
2435 CAJPOY010000028.1 GCA905372315_01220 CDS open 18170-18811 _na     213_aa 2-dehydro-3-deoxy-phosphogluconate aldolase
2436 CAJPOY010000028.1 GCA905372315_01221 CDS open 18804-19088 _na     94_aa hypothetical protein
2437 CAJPOY010000028.1 GCA905372315_01222 CDS open 19333-20049 _na     238_aa DUF554 domain-containing protein
2438 CAJPOY010000028.1 GCA905372315_01223 CDS open 20194-21555 _na     453_aa Amino acid carrier protein
2439 CAJPOY010000028.1 GCA905372315_01224 CDS open 24092-24388 _na     98_aa hypothetical protein
2440 CAJPOY010000028.1 GCA905372315_01225 CDS open 24672-24851 _na     59_aa Chaperonin
2441 CAJPOY010000028.1 GCA905372315_01226 CDS open 25108-25281 _na     57_aa Holin
2442 CAJPOY010000028.1 GCA905372315_01227 CDS open 25278-25910 _na     210_aa N-acetylmuramoyl-L-alanine amidase domain-containing protein
2443 CAJPOY010000028.1 GCA905372315_01228 CDS open 26063-26347 _na     94_aa sipA Cell invasion protein SipA
2444 CAJPOY010000028.1 GCA905372315_01206 gene open 382-864
2445 CAJPOY010000028.1 GCA905372315_01207 gene open 926-2809 mnmG
2446 CAJPOY010000028.1 GCA905372315_01208 gene open 2922-3020
2447 CAJPOY010000028.1 GCA905372315_01209 gene open 3105-4097
2448 CAJPOY010000028.1 GCA905372315_01210 gene open 4087-5007
2449 CAJPOY010000028.1 GCA905372315_01211 gene open 5004-6116
2450 CAJPOY010000028.1 GCA905372315_01212 gene open 6328-7359
2451 CAJPOY010000028.1 GCA905372315_01213 gene open 7510-7917
2452 CAJPOY010000028.1 GCA905372315_01214 gene open 7999-10974
2453 CAJPOY010000028.1 GCA905372315_01215 gene open 11552-13075
2454 CAJPOY010000028.1 GCA905372315_01216 gene open 13110-14009
2455 CAJPOY010000028.1 GCA905372315_01217 gene open 14011-15393
2456 CAJPOY010000028.1 GCA905372315_01218 gene open 15603-16115
2457 CAJPOY010000028.1 GCA905372315_01219 gene open 16198-17541 norM
2458 CAJPOY010000028.1 GCA905372315_01220 gene open 18170-18811
2459 CAJPOY010000028.1 GCA905372315_01221 gene open 18804-19088
2460 CAJPOY010000028.1 GCA905372315_01222 gene open 19333-20049
2461 CAJPOY010000028.1 GCA905372315_01223 gene open 20194-21555
2462 CAJPOY010000028.1 GCA905372315_01224 gene open 24092-24388
2463 CAJPOY010000028.1 GCA905372315_01225 gene open 24672-24851
2464 CAJPOY010000028.1 GCA905372315_01226 gene open 25108-25281
2465 CAJPOY010000028.1 GCA905372315_01227 gene open 25278-25910
2466 CAJPOY010000028.1 GCA905372315_01228 gene open 26063-26347 sipA
2467 CAJPOY010000029.1 GCA905372315_01229 CDS open 160-1917 _na     585_aa 1-deoxy-D-xylulose-5-phosphate synthase
2468 CAJPOY010000029.1 GCA905372315_01231 CDS open 2421-2909 _na     162_aa nimA 5-nitroimidazole resistance protein NimA
2469 CAJPOY010000029.1 GCA905372315_01232 CDS open 2979-7373 _na     1464_aa DNA helicase
2470 CAJPOY010000029.1 GCA905372315_01233 CDS open 7360-8787 _na     475_aa Succinate-semialdehyde dehydrogenase
2471 CAJPOY010000029.1 GCA905372315_01234 CDS open 9396-10427 _na     343_aa ABC transporter
2472 CAJPOY010000029.1 GCA905372315_01235 CDS open 10424-11197 _na     257_aa ABC transporter%2C ATP-binding protein
2473 CAJPOY010000029.1 GCA905372315_01236 CDS open 11194-12228 _na     344_aa Iron(III) ABC superfamily ATP binding cassette transporter%2C iron(III)-binding protein
2474 CAJPOY010000029.1 GCA905372315_01237 CDS open 12244-14178 _na     644_aa TonB-dependent receptor
2475 CAJPOY010000029.1 GCA905372315_01238 CDS open 14267-15667 _na     466_aa ltrA group II intron reverse transcriptase/maturase
2476 CAJPOY010000029.1 GCA905372315_01239 CDS open 15724-15849 _na     41_aa hypothetical protein
2477 CAJPOY010000029.1 GCA905372315_01240 CDS open 16493-16891 _na     132_aa hypothetical protein
2478 CAJPOY010000029.1 GCA905372315_01241 CDS open 17059-17202 _na     47_aa hypothetical protein
2479 CAJPOY010000029.1 GCA905372315_01242 CDS open 17520-18251 _na     243_aa NAD-dependent protein deacylase
2480 CAJPOY010000029.1 GCA905372315_01243 CDS open 18376-19260 _na     294_aa Drug/metabolite exporter family protein
2481 CAJPOY010000029.1 GCA905372315_01245 CDS open 19557-20075 _na     172_aa hypothetical protein
2482 CAJPOY010000029.1 GCA905372315_01246 CDS open 20217-21179 _na     320_aa Tetratricopeptide repeat protein
2483 CAJPOY010000029.1 GCA905372315_01247 CDS open 21191-22183 _na     330_aa Tetratricopeptide repeat protein
2484 CAJPOY010000029.1 GCA905372315_01248 CDS open 22334-23248 _na     304_aa DUF3829 domain-containing protein
2485 CAJPOY010000029.1 GCA905372315_01249 CDS open 23408-24532 _na     374_aa Flagellar assembly protein T N-terminal domain-containing protein
2486 CAJPOY010000029.1 GCA905372315_01229 gene open 160-1917
2487 CAJPOY010000029.1 GCA905372315_01231 gene open 2421-2909 nimA
2488 CAJPOY010000029.1 GCA905372315_01232 gene open 2979-7373
2489 CAJPOY010000029.1 GCA905372315_01233 gene open 7360-8787
2490 CAJPOY010000029.1 GCA905372315_01234 gene open 9396-10427
2491 CAJPOY010000029.1 GCA905372315_01235 gene open 10424-11197
2492 CAJPOY010000029.1 GCA905372315_01236 gene open 11194-12228
2493 CAJPOY010000029.1 GCA905372315_01237 gene open 12244-14178
2494 CAJPOY010000029.1 GCA905372315_01238 gene open 14267-15667 ltrA
2495 CAJPOY010000029.1 GCA905372315_01239 gene open 15724-15849
2496 CAJPOY010000029.1 GCA905372315_01240 gene open 16493-16891
2497 CAJPOY010000029.1 GCA905372315_01241 gene open 17059-17202
2498 CAJPOY010000029.1 GCA905372315_01242 gene open 17520-18251
2499 CAJPOY010000029.1 GCA905372315_01243 gene open 18376-19260
2500 CAJPOY010000029.1 GCA905372315_01245 gene open 19557-20075