HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Centipeda periodontii (GCA_905372315.1)

Select a Genome:
BAKTA Annotations for GCA_905372315.1
Genome Selected: Centipeda periodontii
ContigsBases CDSrRNA tmRNAtRNA
173 2403355 2315 0 1 28
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4720 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:6]    |    Number of Records Found: 4720 [10 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
2501 CAJPOY010000029.1 GCA905372315_01246 gene open 20217-21179
2502 CAJPOY010000029.1 GCA905372315_01247 gene open 21191-22183
2503 CAJPOY010000029.1 GCA905372315_01248 gene open 22334-23248
2504 CAJPOY010000029.1 GCA905372315_01249 gene open 23408-24532
2505 CAJPOY010000029.1 GCA905372315_01230 gene open 2282-2357 trnA
2506 CAJPOY010000029.1 GCA905372315_01244 gene open 19383-19458 trnT
2507 CAJPOY010000029.1 GCA905372315_01230 tRNA open 2282-2357 trnA tRNA-Ala(cgc)
2508 CAJPOY010000029.1 GCA905372315_01244 tRNA open 19383-19458 trnT tRNA-Thr(cgt)
2509 CAJPOY010000030.1 GCA905372315_01250 CDS open 603-2180 _na     525_aa type I restriction-modification system subunit M
2510 CAJPOY010000030.1 GCA905372315_01251 CDS open 2373-3281 _na     302_aa DNA-binding helix-turn-helix protein
2511 CAJPOY010000030.1 GCA905372315_01252 CDS open 3320-3859 _na     179_aa O-acetyl-ADP-ribose deacetylase
2512 CAJPOY010000030.1 GCA905372315_01253 CDS open 3892-5433 _na     513_aa ABC transporter%2C substrate-binding protein%2C family 5
2513 CAJPOY010000030.1 GCA905372315_01254 CDS open 5558-5806 _na     82_aa hypothetical protein
2514 CAJPOY010000030.1 GCA905372315_01255 CDS open 5827-7122 _na     431_aa TFIIB-type zinc ribbon-containing protein
2515 CAJPOY010000030.1 GCA905372315_01256 CDS open 7321-8859 _na     512_aa Solute-binding protein family 5 domain-containing protein
2516 CAJPOY010000030.1 GCA905372315_01257 CDS open 9240-9782 _na     180_aa hypothetical protein
2517 CAJPOY010000030.1 GCA905372315_01258 CDS open 9795-10655 _na     286_aa DUF3298 domain-containing protein
2518 CAJPOY010000030.1 GCA905372315_01259 CDS open 11021-11401 _na     126_aa hypothetical protein
2519 CAJPOY010000030.1 GCA905372315_01260 CDS open 11636-12757 _na     373_aa Alginate export domain-containing protein
2520 CAJPOY010000030.1 GCA905372315_01261 CDS open 13229-15700 _na     823_aa Histidine kinase N-terminal 7TM region domain-containing protein
2521 CAJPOY010000030.1 GCA905372315_01262 CDS open 15688-17079 _na     463_aa histidine kinase
2522 CAJPOY010000030.1 GCA905372315_01263 CDS open 17072-17692 _na     206_aa Response regulatory domain-containing protein
2523 CAJPOY010000030.1 GCA905372315_01264 CDS open 17857-19188 _na     443_aa SPFH domain-containing protein
2524 CAJPOY010000030.1 GCA905372315_01265 CDS open 19255-20373 _na     372_aa priA Replication restart DNA helicase PriA
2525 CAJPOY010000030.1 GCA905372315_01266 CDS open 20393-20608 _na     71_aa hypothetical protein
2526 CAJPOY010000030.1 GCA905372315_01267 CDS open 20829-21044 _na     71_aa hypothetical protein
2527 CAJPOY010000030.1 GCA905372315_01268 CDS open 21057-21629 _na     190_aa hypothetical protein
2528 CAJPOY010000030.1 GCA905372315_01269 CDS open 21726-22274 _na     182_aa hypothetical protein
2529 CAJPOY010000030.1 GCA905372315_01270 CDS open 22413-23525 _na     370_aa Zinc finger domain protein%2C LSD1 subclass
2530 CAJPOY010000030.1 GCA905372315_01271 CDS open 23637-24713 _na     358_aa hypothetical protein
2531 CAJPOY010000030.1 GCA905372315_01250 gene open 603-2180
2532 CAJPOY010000030.1 GCA905372315_01251 gene open 2373-3281
2533 CAJPOY010000030.1 GCA905372315_01252 gene open 3320-3859
2534 CAJPOY010000030.1 GCA905372315_01253 gene open 3892-5433
2535 CAJPOY010000030.1 GCA905372315_01254 gene open 5558-5806
2536 CAJPOY010000030.1 GCA905372315_01255 gene open 5827-7122
2537 CAJPOY010000030.1 GCA905372315_01256 gene open 7321-8859
2538 CAJPOY010000030.1 GCA905372315_01257 gene open 9240-9782
2539 CAJPOY010000030.1 GCA905372315_01258 gene open 9795-10655
2540 CAJPOY010000030.1 GCA905372315_01259 gene open 11021-11401
2541 CAJPOY010000030.1 GCA905372315_01260 gene open 11636-12757
2542 CAJPOY010000030.1 GCA905372315_01261 gene open 13229-15700
2543 CAJPOY010000030.1 GCA905372315_01262 gene open 15688-17079
2544 CAJPOY010000030.1 GCA905372315_01263 gene open 17072-17692
2545 CAJPOY010000030.1 GCA905372315_01264 gene open 17857-19188
2546 CAJPOY010000030.1 GCA905372315_01265 gene open 19255-20373 priA
2547 CAJPOY010000030.1 GCA905372315_01266 gene open 20393-20608
2548 CAJPOY010000030.1 GCA905372315_01267 gene open 20829-21044
2549 CAJPOY010000030.1 GCA905372315_01268 gene open 21057-21629
2550 CAJPOY010000030.1 GCA905372315_01269 gene open 21726-22274
2551 CAJPOY010000030.1 GCA905372315_01270 gene open 22413-23525
2552 CAJPOY010000030.1 GCA905372315_01271 gene open 23637-24713
2553 CAJPOY010000031.1 GCA905372315_01272 CDS open 75-698 _na     207_aa hypothetical protein
2554 CAJPOY010000031.1 GCA905372315_01273 CDS open 723-1154 _na     143_aa lktC LktC family protein
2555 CAJPOY010000031.1 GCA905372315_01275 CDS open 1588-1980 _na     130_aa hypothetical protein
2556 CAJPOY010000031.1 GCA905372315_01276 CDS open 1995-3152 _na     385_aa HipA-like C-terminal domain-containing protein
2557 CAJPOY010000031.1 GCA905372315_01277 CDS open 3149-3511 _na     120_aa hicB HicB family protein
2558 CAJPOY010000031.1 GCA905372315_01278 CDS open 3894-5321 _na     475_aa Phospholipase D-like domain-containing protein
2559 CAJPOY010000031.1 GCA905372315_01279 CDS open 5321-6184 _na     287_aa Lipoprotein
2560 CAJPOY010000031.1 GCA905372315_01280 CDS open 6336-6878 _na     180_aa 3-hexulose-6-phosphate isomerase
2561 CAJPOY010000031.1 GCA905372315_01281 CDS open 6890-7525 _na     211_aa Hexulose-6-phosphate synthase
2562 CAJPOY010000031.1 GCA905372315_01282 CDS open 7522-8472 _na     316_aa 2-dehydro-3-deoxygluconokinase
2563 CAJPOY010000031.1 GCA905372315_01283 CDS open 8485-8946 _na     153_aa YhcH/YjgK/YiaL family protein
2564 CAJPOY010000031.1 GCA905372315_01284 CDS open 8940-9710 _na     256_aa hypothetical protein
2565 CAJPOY010000031.1 GCA905372315_01285 CDS open 9741-11882 _na     713_aa N-methylhydaintoinase A
2566 CAJPOY010000031.1 GCA905372315_01286 CDS open 11902-13257 _na     451_aa CitMHS family citrate-magnesium (Mg2+):proton (H+) citrate-calcium (Ca2+): proton (H+) symporter
2567 CAJPOY010000031.1 GCA905372315_01287 CDS open 13553-14557 _na     334_aa purR PurR family transcriptional regulator
2568 CAJPOY010000031.1 GCA905372315_01288 CDS open 14913-15191 _na     92_aa RelE/StbE family addiction module toxin
2569 CAJPOY010000031.1 GCA905372315_01289 CDS open 15193-15456 _na     87_aa Addiction module antitoxin RelB/DinJ family
2570 CAJPOY010000031.1 GCA905372315_01290 CDS open 15977-16591 _na     204_aa TNT domain-containing protein
2571 CAJPOY010000031.1 GCA905372315_01291 CDS open 16687-17853 _na     388_aa Major facilitator superfamily (MFS) profile domain-containing protein
2572 CAJPOY010000031.1 GCA905372315_01292 CDS open 17931-19700 _na     589_aa Type II restriction endonuclease
2573 CAJPOY010000031.1 GCA905372315_01293 CDS open 19711-21606 _na     631_aa Site-specific DNA-methyltransferase (adenine-specific)
2574 CAJPOY010000031.1 GCA905372315_01294 CDS open 21695-22000 _na     101_aa Polymerase beta nucleotidyltransferase domain-containing protein
2575 CAJPOY010000031.1 GCA905372315_01295 CDS open 22265-22504 _na     79_aa hypothetical protein
2576 CAJPOY010000031.1 GCA905372315_01296 CDS open 22384-23832 _na     482_aa Lipoprotein
2577 CAJPOY010000031.1 GCA905372315_01297 CDS open 24028-24294 _na     88_aa HAD family acid phosphatase
2578 CAJPOY010000031.1 GCA905372315_01298 CDS open 24424-24603 _na     59_aa hypothetical protein
2579 CAJPOY010000031.1 GCA905372315_01272 gene open 75-698
2580 CAJPOY010000031.1 GCA905372315_01273 gene open 723-1154 lktC
2581 CAJPOY010000031.1 GCA905372315_01275 gene open 1588-1980
2582 CAJPOY010000031.1 GCA905372315_01276 gene open 1995-3152
2583 CAJPOY010000031.1 GCA905372315_01277 gene open 3149-3511 hicB
2584 CAJPOY010000031.1 GCA905372315_01278 gene open 3894-5321
2585 CAJPOY010000031.1 GCA905372315_01279 gene open 5321-6184
2586 CAJPOY010000031.1 GCA905372315_01280 gene open 6336-6878
2587 CAJPOY010000031.1 GCA905372315_01281 gene open 6890-7525
2588 CAJPOY010000031.1 GCA905372315_01282 gene open 7522-8472
2589 CAJPOY010000031.1 GCA905372315_01283 gene open 8485-8946
2590 CAJPOY010000031.1 GCA905372315_01284 gene open 8940-9710
2591 CAJPOY010000031.1 GCA905372315_01285 gene open 9741-11882
2592 CAJPOY010000031.1 GCA905372315_01286 gene open 11902-13257
2593 CAJPOY010000031.1 GCA905372315_01287 gene open 13553-14557 purR
2594 CAJPOY010000031.1 GCA905372315_01288 gene open 14913-15191
2595 CAJPOY010000031.1 GCA905372315_01289 gene open 15193-15456
2596 CAJPOY010000031.1 GCA905372315_01290 gene open 15977-16591
2597 CAJPOY010000031.1 GCA905372315_01291 gene open 16687-17853
2598 CAJPOY010000031.1 GCA905372315_01292 gene open 17931-19700
2599 CAJPOY010000031.1 GCA905372315_01293 gene open 19711-21606
2600 CAJPOY010000031.1 GCA905372315_01294 gene open 21695-22000
2601 CAJPOY010000031.1 GCA905372315_01295 gene open 22265-22504
2602 CAJPOY010000031.1 GCA905372315_01296 gene open 22384-23832
2603 CAJPOY010000031.1 GCA905372315_01297 gene open 24028-24294
2604 CAJPOY010000031.1 GCA905372315_01298 gene open 24424-24603
2605 CAJPOY010000031.1 GCA905372315_01274 gene open 1203-1276 trnG
2606 CAJPOY010000031.1 GCA905372315_01274 tRNA open 1203-1276 trnG tRNA-Gly(ccc)
2607 CAJPOY010000032.1 repeat_region open 22366-23708 CRISPR array with 19 repeats of length 37%2C consensus sequence CTTGCACCACAAACAAAGCCGCGAGCGGCATTGAAAC and spacer length 35
2608 CAJPOY010000032.1 GCA905372315_01299 CDS open 383-1072 _na     229_aa MotA/TolQ/ExbB proton channel domain-containing protein
2609 CAJPOY010000032.1 GCA905372315_01300 CDS open 1069-1467 _na     132_aa exbD Biopolymer transporter ExbD
2610 CAJPOY010000032.1 GCA905372315_01301 CDS open 1532-2293 _na     253_aa Nucleotidyl transferase AbiEii/AbiGii toxin family protein
2611 CAJPOY010000032.1 GCA905372315_01302 CDS open 2360-2953 _na     197_aa Transcriptional regulator
2612 CAJPOY010000032.1 GCA905372315_01303 CDS open 3080-4771 _na     563_aa DUF4127 domain-containing protein
2613 CAJPOY010000032.1 GCA905372315_01304 CDS open 4977-5816 _na     279_aa viperin family antiviral radical SAM protein
2614 CAJPOY010000032.1 GCA905372315_01305 CDS open 5896-7743 _na     615_aa CRISPR-associated protein
2615 CAJPOY010000032.1 GCA905372315_01306 CDS open 7745-9517 _na     590_aa CRISPR-associated protein%2C TM1812 family
2616 CAJPOY010000032.1 GCA905372315_01307 CDS open 9514-9879 _na     121_aa CRISPR-associated protein
2617 CAJPOY010000032.1 GCA905372315_01308 CDS open 9876-12347 _na     823_aa WYL domain-containing protein
2618 CAJPOY010000032.1 GCA905372315_01309 CDS open 12423-13244 _na     273_aa Putative CRISPR-associated endoribonuclease Cas6
2619 CAJPOY010000032.1 GCA905372315_01310 CDS open 13341-14930 _na     529_aa Cas10/Cmr2 second palm domain-containing protein
2620 CAJPOY010000032.1 GCA905372315_01311 CDS open 14933-15790 _na     285_aa CRISPR-associated protein
2621 CAJPOY010000032.1 GCA905372315_01312 CDS open 15790-17394 _na     534_aa CRISPR-associated RAMP protein
2622 CAJPOY010000032.1 GCA905372315_01313 CDS open 17391-18770 _na     459_aa CRISPR-associated protein
2623 CAJPOY010000032.1 GCA905372315_01314 CDS open 18767-19372 _na     201_aa CRISPR-associated protein
2624 CAJPOY010000032.1 GCA905372315_01315 CDS open 19365-21158 _na     597_aa CRISPR-associated protein
2625 CAJPOY010000032.1 GCA905372315_01316 CDS open 21532-21771 _na     79_aa hypothetical protein
2626 CAJPOY010000032.1 GCA905372315_01317 CDS open 21823-22035 _na     70_aa hypothetical protein
2627 CAJPOY010000032.1 GCA905372315_01299 gene open 383-1072
2628 CAJPOY010000032.1 GCA905372315_01300 gene open 1069-1467 exbD
2629 CAJPOY010000032.1 GCA905372315_01301 gene open 1532-2293
2630 CAJPOY010000032.1 GCA905372315_01302 gene open 2360-2953
2631 CAJPOY010000032.1 GCA905372315_01303 gene open 3080-4771
2632 CAJPOY010000032.1 GCA905372315_01304 gene open 4977-5816
2633 CAJPOY010000032.1 GCA905372315_01305 gene open 5896-7743
2634 CAJPOY010000032.1 GCA905372315_01306 gene open 7745-9517
2635 CAJPOY010000032.1 GCA905372315_01307 gene open 9514-9879
2636 CAJPOY010000032.1 GCA905372315_01308 gene open 9876-12347
2637 CAJPOY010000032.1 GCA905372315_01309 gene open 12423-13244
2638 CAJPOY010000032.1 GCA905372315_01310 gene open 13341-14930
2639 CAJPOY010000032.1 GCA905372315_01311 gene open 14933-15790
2640 CAJPOY010000032.1 GCA905372315_01312 gene open 15790-17394
2641 CAJPOY010000032.1 GCA905372315_01313 gene open 17391-18770
2642 CAJPOY010000032.1 GCA905372315_01314 gene open 18767-19372
2643 CAJPOY010000032.1 GCA905372315_01315 gene open 19365-21158
2644 CAJPOY010000032.1 GCA905372315_01316 gene open 21532-21771
2645 CAJPOY010000032.1 GCA905372315_01317 gene open 21823-22035
2646 CAJPOY010000033.1 GCA905372315_01318 CDS open 33-326 _na     97_aa hypothetical protein
2647 CAJPOY010000033.1 GCA905372315_01319 CDS open 413-1333 _na     306_aa HipA-like C-terminal domain-containing protein
2648 CAJPOY010000033.1 GCA905372315_01320 CDS open 1326-1553 _na     75_aa Complexin-2
2649 CAJPOY010000033.1 GCA905372315_01321 CDS open 1607-2506 _na     299_aa hypothetical protein
2650 CAJPOY010000033.1 GCA905372315_01322 CDS open 2592-4583 _na     663_aa Peptidase M23 domain-containing protein
2651 CAJPOY010000033.1 GCA905372315_01323 CDS open 4673-4993 _na     106_aa hypothetical protein
2652 CAJPOY010000033.1 GCA905372315_01324 CDS open 5034-6587 _na     517_aa trbL P-type conjugative transfer protein TrbL
2653 CAJPOY010000033.1 GCA905372315_01325 CDS open 6674-7450 _na     258_aa trbJ P-type conjugative transfer protein TrbJ
2654 CAJPOY010000033.1 GCA905372315_01326 CDS open 7471-8802 _na     443_aa parA ParA family protein
2655 CAJPOY010000033.1 GCA905372315_01327 CDS open 8814-9038 _na     74_aa L-PSP family endoribonuclease
2656 CAJPOY010000033.1 GCA905372315_01328 CDS open 9035-10132 _na     365_aa hypothetical protein
2657 CAJPOY010000033.1 GCA905372315_01329 CDS open 10509-11384 _na     291_aa hypothetical protein
2658 CAJPOY010000033.1 GCA905372315_01330 CDS open 11462-11566 _na     34_aa hypothetical protein
2659 CAJPOY010000033.1 GCA905372315_01331 CDS open 11579-11890 _na     103_aa hypothetical protein
2660 CAJPOY010000033.1 GCA905372315_01332 CDS open 11989-12948 _na     319_aa hypothetical protein
2661 CAJPOY010000033.1 GCA905372315_01333 CDS open 13148-14125 _na     325_aa trbB P-type conjugative transfer ATPase TrbB
2662 CAJPOY010000033.1 GCA905372315_01334 CDS open 14115-16538 _na     807_aa type IV secretory system conjugative DNA transfer family protein
2663 CAJPOY010000033.1 GCA905372315_01335 CDS open 16540-17310 _na     256_aa hypothetical protein
2664 CAJPOY010000033.1 GCA905372315_01336 CDS open 17681-18043 _na     120_aa hypothetical protein
2665 CAJPOY010000033.1 GCA905372315_01337 CDS open 18101-18862 _na     253_aa Nucleotidyl transferase AbiEii/AbiGii toxin family protein
2666 CAJPOY010000033.1 GCA905372315_01338 CDS open 18887-19303 _na     138_aa mlpA MlpA
2667 CAJPOY010000033.1 GCA905372315_01339 CDS open 19375-21474 _na     699_aa Relaxation protein
2668 CAJPOY010000033.1 GCA905372315_01340 CDS open 21576-22235 _na     219_aa hypothetical protein
2669 CAJPOY010000033.1 GCA905372315_01318 gene open 33-326
2670 CAJPOY010000033.1 GCA905372315_01319 gene open 413-1333
2671 CAJPOY010000033.1 GCA905372315_01320 gene open 1326-1553
2672 CAJPOY010000033.1 GCA905372315_01321 gene open 1607-2506
2673 CAJPOY010000033.1 GCA905372315_01322 gene open 2592-4583
2674 CAJPOY010000033.1 GCA905372315_01323 gene open 4673-4993
2675 CAJPOY010000033.1 GCA905372315_01324 gene open 5034-6587 trbL
2676 CAJPOY010000033.1 GCA905372315_01325 gene open 6674-7450 trbJ
2677 CAJPOY010000033.1 GCA905372315_01326 gene open 7471-8802 parA
2678 CAJPOY010000033.1 GCA905372315_01327 gene open 8814-9038
2679 CAJPOY010000033.1 GCA905372315_01328 gene open 9035-10132
2680 CAJPOY010000033.1 GCA905372315_01329 gene open 10509-11384
2681 CAJPOY010000033.1 GCA905372315_01330 gene open 11462-11566
2682 CAJPOY010000033.1 GCA905372315_01331 gene open 11579-11890
2683 CAJPOY010000033.1 GCA905372315_01332 gene open 11989-12948
2684 CAJPOY010000033.1 GCA905372315_01333 gene open 13148-14125 trbB
2685 CAJPOY010000033.1 GCA905372315_01334 gene open 14115-16538
2686 CAJPOY010000033.1 GCA905372315_01335 gene open 16540-17310
2687 CAJPOY010000033.1 GCA905372315_01336 gene open 17681-18043
2688 CAJPOY010000033.1 GCA905372315_01337 gene open 18101-18862
2689 CAJPOY010000033.1 GCA905372315_01338 gene open 18887-19303 mlpA
2690 CAJPOY010000033.1 GCA905372315_01339 gene open 19375-21474
2691 CAJPOY010000033.1 GCA905372315_01340 gene open 21576-22235
2692 CAJPOY010000034.1 GCA905372315_01341 CDS open 8-592 _na     194_aa hypothetical protein
2693 CAJPOY010000034.1 GCA905372315_01342 CDS open 657-1424 _na     255_aa Cyclase
2694 CAJPOY010000034.1 GCA905372315_01343 CDS open 1718-2803 _na     361_aa mqnE aminofutalosine synthase MqnE
2695 CAJPOY010000034.1 GCA905372315_01344 CDS open 2872-3501 _na     209_aa LUD domain-containing protein
2696 CAJPOY010000034.1 GCA905372315_01345 CDS open 3578-3847 _na     89_aa Addiction module antitoxin%2C RelB/DinJ family
2697 CAJPOY010000034.1 GCA905372315_01346 CDS open 4256-6466 _na     736_aa TonB-dependent receptor
2698 CAJPOY010000034.1 GCA905372315_01347 CDS open 6529-7806 _na     425_aa PepSY-associated TM helix superfamily protein
2699 CAJPOY010000034.1 GCA905372315_01348 CDS open 7902-10433 _na     843_aa Tetratricopeptide repeat family protein
2700 CAJPOY010000034.1 GCA905372315_01349 CDS open 10450-12420 _na     656_aa DUF4253 domain-containing protein
2701 CAJPOY010000034.1 GCA905372315_01350 CDS open 12398-12829 _na     143_aa hypothetical protein
2702 CAJPOY010000034.1 GCA905372315_01351 CDS open 12839-13924 _na     361_aa DUF1963 domain-containing protein
2703 CAJPOY010000034.1 GCA905372315_01352 CDS open 14015-14200 _na     61_aa Motility protein
2704 CAJPOY010000034.1 GCA905372315_01353 CDS open 14212-15063 _na     283_aa Flagellar hook-associated protein 2 C-terminal domain-containing protein
2705 CAJPOY010000034.1 GCA905372315_01354 CDS open 15208-16494 _na     428_aa mtaB tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB
2706 CAJPOY010000034.1 GCA905372315_01356 CDS open 16828-17460 _na     210_aa tetR TetR family transcriptional regulator
2707 CAJPOY010000034.1 GCA905372315_01357 CDS open 17500-18690 _na     396_aa nirJ1 putative heme d1 biosynthesis radical SAM protein NirJ1
2708 CAJPOY010000034.1 GCA905372315_01358 CDS open 18699-19874 _na     391_aa mftC Putative mycofactocin radical SAM maturase MftC
2709 CAJPOY010000034.1 GCA905372315_01359 CDS open 20287-21420 _na     377_aa hypothetical protein
2710 CAJPOY010000034.1 GCA905372315_01341 gene open 8-592
2711 CAJPOY010000034.1 GCA905372315_01342 gene open 657-1424
2712 CAJPOY010000034.1 GCA905372315_01343 gene open 1718-2803 mqnE
2713 CAJPOY010000034.1 GCA905372315_01344 gene open 2872-3501
2714 CAJPOY010000034.1 GCA905372315_01345 gene open 3578-3847
2715 CAJPOY010000034.1 GCA905372315_01346 gene open 4256-6466
2716 CAJPOY010000034.1 GCA905372315_01347 gene open 6529-7806
2717 CAJPOY010000034.1 GCA905372315_01348 gene open 7902-10433
2718 CAJPOY010000034.1 GCA905372315_01349 gene open 10450-12420
2719 CAJPOY010000034.1 GCA905372315_01350 gene open 12398-12829
2720 CAJPOY010000034.1 GCA905372315_01351 gene open 12839-13924
2721 CAJPOY010000034.1 GCA905372315_01352 gene open 14015-14200
2722 CAJPOY010000034.1 GCA905372315_01353 gene open 14212-15063
2723 CAJPOY010000034.1 GCA905372315_01354 gene open 15208-16494 mtaB
2724 CAJPOY010000034.1 GCA905372315_01356 gene open 16828-17460 tetR
2725 CAJPOY010000034.1 GCA905372315_01357 gene open 17500-18690 nirJ1
2726 CAJPOY010000034.1 GCA905372315_01358 gene open 18699-19874 mftC
2727 CAJPOY010000034.1 GCA905372315_01359 gene open 20287-21420
2728 CAJPOY010000034.1 GCA905372315_01355 gene open 16574-16651 trnR
2729 CAJPOY010000034.1 GCA905372315_01355 tRNA open 16574-16651 trnR tRNA-Arg(acg)
2730 CAJPOY010000035.1 GCA905372315_01360 CDS open 1-267 _na     88_aa hypothetical protein
2731 CAJPOY010000035.1 GCA905372315_01361 CDS open 336-1298 _na     320_aa Transporter
2732 CAJPOY010000035.1 GCA905372315_01362 CDS open 1305-2261 _na     318_aa Transporter
2733 CAJPOY010000035.1 GCA905372315_01363 CDS open 2527-4206 _na     559_aa LktB-like protein
2734 CAJPOY010000035.1 GCA905372315_01364 CDS open 4207-4839 _na     210_aa hypothetical protein
2735 CAJPOY010000035.1 GCA905372315_01365 CDS open 5032-7056 _na     674_aa hypothetical protein
2736 CAJPOY010000035.1 GCA905372315_01366 CDS open 7117-7746 _na     209_aa hypothetical protein
2737 CAJPOY010000035.1 GCA905372315_01367 CDS open 7930-12681 _na     1583_aa hypothetical protein
2738 CAJPOY010000035.1 GCA905372315_01368 CDS open 13084-14820 _na     578_aa hypothetical protein
2739 CAJPOY010000035.1 GCA905372315_01369 CDS open 14923-15342 _na     139_aa hypothetical protein
2740 CAJPOY010000035.1 GCA905372315_01370 CDS open 15541-16335 _na     264_aa hypothetical protein
2741 CAJPOY010000035.1 GCA905372315_01371 CDS open 16339-16476 _na     45_aa hypothetical protein
2742 CAJPOY010000035.1 GCA905372315_01372 CDS open 16501-17265 _na     254_aa hypothetical protein
2743 CAJPOY010000035.1 GCA905372315_01373 CDS open 17623-21090 _na     1155_aa hypothetical protein
2744 CAJPOY010000035.1 GCA905372315_01360 gene open 1-267
2745 CAJPOY010000035.1 GCA905372315_01361 gene open 336-1298
2746 CAJPOY010000035.1 GCA905372315_01362 gene open 1305-2261
2747 CAJPOY010000035.1 GCA905372315_01363 gene open 2527-4206
2748 CAJPOY010000035.1 GCA905372315_01364 gene open 4207-4839
2749 CAJPOY010000035.1 GCA905372315_01365 gene open 5032-7056
2750 CAJPOY010000035.1 GCA905372315_01366 gene open 7117-7746
2751 CAJPOY010000035.1 GCA905372315_01367 gene open 7930-12681
2752 CAJPOY010000035.1 GCA905372315_01368 gene open 13084-14820
2753 CAJPOY010000035.1 GCA905372315_01369 gene open 14923-15342
2754 CAJPOY010000035.1 GCA905372315_01370 gene open 15541-16335
2755 CAJPOY010000035.1 GCA905372315_01371 gene open 16339-16476
2756 CAJPOY010000035.1 GCA905372315_01372 gene open 16501-17265
2757 CAJPOY010000035.1 GCA905372315_01373 gene open 17623-21090
2758 CAJPOY010000036.1 GCA905372315_01374 CDS open 140-997 _na     285_aa Rpn family recombination-promoting nuclease/putative transposase
2759 CAJPOY010000036.1 GCA905372315_01375 CDS open 1099-1410 _na     103_aa Branched-chain amino acid transporter
2760 CAJPOY010000036.1 GCA905372315_01376 CDS open 1403-2143 _na     246_aa azlC LIV-E family branched chain amino acid permease AzlC
2761 CAJPOY010000036.1 GCA905372315_01377 CDS open 2286-2810 _na     174_aa hypothetical protein
2762 CAJPOY010000036.1 GCA905372315_01378 CDS open 2953-5595 _na     880_aa copZ copper chaperone CopZ
2763 CAJPOY010000036.1 GCA905372315_01379 CDS open 5911-6345 _na     144_aa flavodoxin
2764 CAJPOY010000036.1 GCA905372315_01380 CDS open 6420-6695 _na     91_aa Acetyltransferase
2765 CAJPOY010000036.1 GCA905372315_01381 CDS open 6713-7009 _na     98_aa Txe/YoeB family addiction module toxin
2766 CAJPOY010000036.1 GCA905372315_01382 CDS open 7009-7263 _na     84_aa Antitoxin
2767 CAJPOY010000036.1 GCA905372315_01383 CDS open 7385-8707 _na     440_aa SLH domain protein
2768 CAJPOY010000036.1 GCA905372315_01384 CDS open 8923-9291 _na     122_aa hypothetical protein
2769 CAJPOY010000036.1 GCA905372315_01385 CDS open 9441-11069 _na     542_aa malolactic enzyme
2770 CAJPOY010000036.1 GCA905372315_01386 CDS open 11140-12405 _na     421_aa SLH domain-containing protein
2771 CAJPOY010000036.1 GCA905372315_01387 CDS open 12675-13874 _na     399_aa dpaL diaminopropionate ammonia-lyase
2772 CAJPOY010000036.1 GCA905372315_01388 CDS open 14083-14535 _na     150_aa PIN domain-containing protein
2773 CAJPOY010000036.1 GCA905372315_01389 CDS open 14522-14722 _na     66_aa hypothetical protein
2774 CAJPOY010000036.1 GCA905372315_01390 CDS open 14772-15017 _na     81_aa hypothetical protein
2775 CAJPOY010000036.1 GCA905372315_01391 CDS open 15176-17197 _na     673_aa Restriction endonuclease subunit M
2776 CAJPOY010000036.1 GCA905372315_01392 CDS open 17191-18663 _na     490_aa Restriction endonuclease subunit S
2777 CAJPOY010000036.1 GCA905372315_01393 CDS open 18754-19656 _na     300_aa Lipoprotein LPP20-like domain-containing protein
2778 CAJPOY010000036.1 GCA905372315_01374 gene open 140-997
2779 CAJPOY010000036.1 GCA905372315_01375 gene open 1099-1410
2780 CAJPOY010000036.1 GCA905372315_01376 gene open 1403-2143 azlC
2781 CAJPOY010000036.1 GCA905372315_01377 gene open 2286-2810
2782 CAJPOY010000036.1 GCA905372315_01378 gene open 2953-5595 copZ
2783 CAJPOY010000036.1 GCA905372315_01379 gene open 5911-6345
2784 CAJPOY010000036.1 GCA905372315_01380 gene open 6420-6695
2785 CAJPOY010000036.1 GCA905372315_01381 gene open 6713-7009
2786 CAJPOY010000036.1 GCA905372315_01382 gene open 7009-7263
2787 CAJPOY010000036.1 GCA905372315_01383 gene open 7385-8707
2788 CAJPOY010000036.1 GCA905372315_01384 gene open 8923-9291
2789 CAJPOY010000036.1 GCA905372315_01385 gene open 9441-11069
2790 CAJPOY010000036.1 GCA905372315_01386 gene open 11140-12405
2791 CAJPOY010000036.1 GCA905372315_01387 gene open 12675-13874 dpaL
2792 CAJPOY010000036.1 GCA905372315_01388 gene open 14083-14535
2793 CAJPOY010000036.1 GCA905372315_01389 gene open 14522-14722
2794 CAJPOY010000036.1 GCA905372315_01390 gene open 14772-15017
2795 CAJPOY010000036.1 GCA905372315_01391 gene open 15176-17197
2796 CAJPOY010000036.1 GCA905372315_01392 gene open 17191-18663
2797 CAJPOY010000036.1 GCA905372315_01393 gene open 18754-19656
2798 CAJPOY010000037.1 GCA905372315_01394 CDS open 136-246 _na     36_aa hypothetical protein
2799 CAJPOY010000037.1 GCA905372315_01395 CDS open 515-2416 _na     633_aa PTS system fructose-specific EIIABC component
2800 CAJPOY010000037.1 GCA905372315_01396 CDS open 2691-3599 _na     302_aa pfkB 1-phosphofructokinase
2801 CAJPOY010000037.1 GCA905372315_01397 CDS open 3770-4690 _na     306_aa DUF2179 domain-containing protein
2802 CAJPOY010000037.1 GCA905372315_01398 CDS open 4886-6433 _na     515_aa Gluconokinase
2803 CAJPOY010000037.1 GCA905372315_01399 CDS open 6449-7873 _na     474_aa gndA NADP-dependent phosphogluconate dehydrogenase
2804 CAJPOY010000037.1 GCA905372315_01400 CDS open 8102-9421 _na     439_aa gntP GntP family gluconate:proton (H+) symporter
2805 CAJPOY010000037.1 GCA905372315_01401 CDS open 9464-10978 _na     504_aa Carbohydrate kinase FGGY
2806 CAJPOY010000037.1 GCA905372315_01402 CDS open 10990-11346 _na     118_aa Protein-N(Pi)-phosphohistidine--sugar phosphotransferase
2807 CAJPOY010000037.1 GCA905372315_01403 CDS open 11357-12421 _na     354_aa 4-phosphoerythronate dehydrogenase
2808 CAJPOY010000037.1 GCA905372315_01404 CDS open 12435-13532 _na     365_aa GroES-like protein
2809 CAJPOY010000037.1 GCA905372315_01405 CDS open 13797-14645 _na     282_aa rpiR RpiR family transcriptional regulator
2810 CAJPOY010000037.1 GCA905372315_01406 CDS open 14684-16762 _na     692_aa Choline sulfatase
2811 CAJPOY010000037.1 GCA905372315_01407 CDS open 16867-17928 _na     353_aa rfbG CDP-glucose 4%2C6-dehydratase
2812 CAJPOY010000037.1 GCA905372315_01408 CDS open 18198-19085 _na     295_aa NAD-dependent epimerase/dehydratase domain-containing protein
2813 CAJPOY010000037.1 GCA905372315_01394 gene open 136-246
2814 CAJPOY010000037.1 GCA905372315_01395 gene open 515-2416
2815 CAJPOY010000037.1 GCA905372315_01396 gene open 2691-3599 pfkB
2816 CAJPOY010000037.1 GCA905372315_01397 gene open 3770-4690
2817 CAJPOY010000037.1 GCA905372315_01398 gene open 4886-6433
2818 CAJPOY010000037.1 GCA905372315_01399 gene open 6449-7873 gndA
2819 CAJPOY010000037.1 GCA905372315_01400 gene open 8102-9421 gntP
2820 CAJPOY010000037.1 GCA905372315_01401 gene open 9464-10978
2821 CAJPOY010000037.1 GCA905372315_01402 gene open 10990-11346
2822 CAJPOY010000037.1 GCA905372315_01403 gene open 11357-12421
2823 CAJPOY010000037.1 GCA905372315_01404 gene open 12435-13532
2824 CAJPOY010000037.1 GCA905372315_01405 gene open 13797-14645 rpiR
2825 CAJPOY010000037.1 GCA905372315_01406 gene open 14684-16762
2826 CAJPOY010000037.1 GCA905372315_01407 gene open 16867-17928 rfbG
2827 CAJPOY010000037.1 GCA905372315_01408 gene open 18198-19085
2828 CAJPOY010000038.1 GCA905372315_01409 CDS open 14-2056 _na     680_aa cheA Chemotaxis protein CheA
2829 CAJPOY010000038.1 GCA905372315_01410 CDS open 2075-2701 _na     208_aa protein-glutamate methylesterase
2830 CAJPOY010000038.1 GCA905372315_01411 CDS open 2694-3386 _na     230_aa ycgR Flagellar protein YcgR
2831 CAJPOY010000038.1 GCA905372315_01412 CDS open 3405-4301 _na     298_aa fleN Flagellar synthesis regulator FleN
2832 CAJPOY010000038.1 GCA905372315_01413 CDS open 4303-5691 _na     462_aa flhF flagellar biosynthesis protein FlhF
2833 CAJPOY010000038.1 GCA905372315_01414 CDS open 5692-7821 _na     709_aa flhA flagellar biosynthesis protein FlhA
2834 CAJPOY010000038.1 GCA905372315_01415 CDS open 7909-9039 _na     376_aa flhB flagellar biosynthesis protein FlhB
2835 CAJPOY010000038.1 GCA905372315_01416 CDS open 8993-9775 _na     260_aa fliR flagellar biosynthetic protein FliR
2836 CAJPOY010000038.1 GCA905372315_01417 CDS open 9791-10018 _na     75_aa fliQ flagellar biosynthesis protein FliQ
2837 CAJPOY010000038.1 GCA905372315_01418 CDS open 10076-10858 _na     260_aa fliP flagellar type III secretion system pore protein FliP
2838 CAJPOY010000038.1 GCA905372315_01419 CDS open 10855-11367 _na     170_aa Flagellar protein
2839 CAJPOY010000038.1 GCA905372315_01420 CDS open 11367-11729 _na     120_aa spo0F Chemotaxis protein CheY
2840 CAJPOY010000038.1 GCA905372315_01421 CDS open 11889-13070 _na     393_aa fliY flagellar motor switch phosphatase FliY
2841 CAJPOY010000038.1 GCA905372315_01422 CDS open 13063-14064 _na     333_aa fliM flagellar motor switch protein FliM
2842 CAJPOY010000038.1 GCA905372315_01423 CDS open 14104-14625 _na     173_aa fliL Flagellar protein FliL
2843 CAJPOY010000038.1 GCA905372315_01424 CDS open 14746-14964 _na     72_aa flbD Flagellar FlbD family protein
2844 CAJPOY010000038.1 GCA905372315_01425 CDS open 15098-15829 _na     243_aa recO DNA repair protein RecO
2845 CAJPOY010000038.1 GCA905372315_01426 CDS open 15830-16495 _na     221_aa DUF502 domain-containing protein
2846 CAJPOY010000038.1 GCA905372315_01427 CDS open 16517-17413 _na     298_aa era GTPase Era
2847 CAJPOY010000038.1 GCA905372315_01409 gene open 14-2056 cheA
2848 CAJPOY010000038.1 GCA905372315_01410 gene open 2075-2701
2849 CAJPOY010000038.1 GCA905372315_01411 gene open 2694-3386 ycgR
2850 CAJPOY010000038.1 GCA905372315_01412 gene open 3405-4301 fleN
2851 CAJPOY010000038.1 GCA905372315_01413 gene open 4303-5691 flhF
2852 CAJPOY010000038.1 GCA905372315_01414 gene open 5692-7821 flhA
2853 CAJPOY010000038.1 GCA905372315_01415 gene open 7909-9039 flhB
2854 CAJPOY010000038.1 GCA905372315_01416 gene open 8993-9775 fliR
2855 CAJPOY010000038.1 GCA905372315_01417 gene open 9791-10018 fliQ
2856 CAJPOY010000038.1 GCA905372315_01418 gene open 10076-10858 fliP
2857 CAJPOY010000038.1 GCA905372315_01419 gene open 10855-11367
2858 CAJPOY010000038.1 GCA905372315_01420 gene open 11367-11729 spo0F
2859 CAJPOY010000038.1 GCA905372315_01421 gene open 11889-13070 fliY
2860 CAJPOY010000038.1 GCA905372315_01422 gene open 13063-14064 fliM
2861 CAJPOY010000038.1 GCA905372315_01423 gene open 14104-14625 fliL
2862 CAJPOY010000038.1 GCA905372315_01424 gene open 14746-14964 flbD
2863 CAJPOY010000038.1 GCA905372315_01425 gene open 15098-15829 recO
2864 CAJPOY010000038.1 GCA905372315_01426 gene open 15830-16495
2865 CAJPOY010000038.1 GCA905372315_01427 gene open 16517-17413 era
2866 CAJPOY010000039.1 GCA905372315_01428 CDS open 249-1076 _na     275_aa rRNA methylase
2867 CAJPOY010000039.1 GCA905372315_01429 CDS open 1153-1464 _na     103_aa trxA thioredoxin
2868 CAJPOY010000039.1 GCA905372315_01430 CDS open 1686-3377 _na     563_aa hypothetical protein
2869 CAJPOY010000039.1 GCA905372315_01431 CDS open 3377-3868 _na     163_aa queF preQ(1) synthase
2870 CAJPOY010000039.1 GCA905372315_01432 CDS open 3868-4698 _na     276_aa pyridoxamine kinase
2871 CAJPOY010000039.1 GCA905372315_01433 CDS open 4770-5429 _na     219_aa Radical SAM core domain-containing protein
2872 CAJPOY010000039.1 GCA905372315_01434 CDS open 5432-6085 _na     217_aa thiT energy-coupled thiamine transporter ThiT
2873 CAJPOY010000039.1 GCA905372315_01435 CDS open 6340-7368 _na     342_aa pheS phenylalanine--tRNA ligase subunit alpha
2874 CAJPOY010000039.1 GCA905372315_01436 CDS open 7381-9816 _na     811_aa pheT phenylalanine--tRNA ligase subunit beta
2875 CAJPOY010000039.1 GCA905372315_01437 CDS open 9832-10089 _na     85_aa zapA Cell division protein ZapA
2876 CAJPOY010000039.1 GCA905372315_01438 CDS open 10145-10981 _na     278_aa tonB Periplasmic protein TonB
2877 CAJPOY010000039.1 GCA905372315_01439 CDS open 10986-11393 _na     135_aa exbD Biopolymer transporter ExbD
2878 CAJPOY010000039.1 GCA905372315_01440 CDS open 11390-12013 _na     207_aa MotA/TolQ/ExbB proton channel domain-containing protein
2879 CAJPOY010000039.1 GCA905372315_01441 CDS open 12036-14477 _na     813_aa TonB-dependent receptor plug domain protein
2880 CAJPOY010000039.1 GCA905372315_01442 CDS open 14562-15851 _na     429_aa TRAM domain-containing protein
2881 CAJPOY010000039.1 GCA905372315_01443 CDS open 15806-16582 _na     258_aa hypothetical protein
2882 CAJPOY010000039.1 GCA905372315_01428 gene open 249-1076
2883 CAJPOY010000039.1 GCA905372315_01429 gene open 1153-1464 trxA
2884 CAJPOY010000039.1 GCA905372315_01430 gene open 1686-3377
2885 CAJPOY010000039.1 GCA905372315_01431 gene open 3377-3868 queF
2886 CAJPOY010000039.1 GCA905372315_01432 gene open 3868-4698
2887 CAJPOY010000039.1 GCA905372315_01433 gene open 4770-5429
2888 CAJPOY010000039.1 GCA905372315_01434 gene open 5432-6085 thiT
2889 CAJPOY010000039.1 GCA905372315_01435 gene open 6340-7368 pheS
2890 CAJPOY010000039.1 GCA905372315_01436 gene open 7381-9816 pheT
2891 CAJPOY010000039.1 GCA905372315_01437 gene open 9832-10089 zapA
2892 CAJPOY010000039.1 GCA905372315_01438 gene open 10145-10981 tonB
2893 CAJPOY010000039.1 GCA905372315_01439 gene open 10986-11393 exbD
2894 CAJPOY010000039.1 GCA905372315_01440 gene open 11390-12013
2895 CAJPOY010000039.1 GCA905372315_01441 gene open 12036-14477
2896 CAJPOY010000039.1 GCA905372315_01442 gene open 14562-15851
2897 CAJPOY010000039.1 GCA905372315_01443 gene open 15806-16582
2898 CAJPOY010000040.1 GCA905372315_01444 CDS open 90-551 _na     153_aa XRE family transcriptional regulator
2899 CAJPOY010000040.1 GCA905372315_01445 CDS open 763-1698 _na     311_aa cysK cysteine synthase A
2900 CAJPOY010000040.1 GCA905372315_01446 CDS open 1906-2181 _na     91_aa hypothetical protein
2901 CAJPOY010000040.1 GCA905372315_01447 CDS open 2268-2780 _na     170_aa Glutathione reductase
2902 CAJPOY010000040.1 GCA905372315_01448 CDS open 3067-3786 _na     239_aa 4-hydroxy-2-oxoglutarate aldolase
2903 CAJPOY010000040.1 GCA905372315_01449 CDS open 3788-4903 _na     371_aa L-seryl-tRNA(Sec) selenium transferase
2904 CAJPOY010000040.1 GCA905372315_01450 CDS open 4919-5587 _na     222_aa Membrane protein
2905 CAJPOY010000040.1 GCA905372315_01451 CDS open 5593-6375 _na     260_aa Permease
2906 CAJPOY010000040.1 GCA905372315_01452 CDS open 6391-6729 _na     112_aa Putative cytosolic protein
2907 CAJPOY010000040.1 GCA905372315_01453 CDS open 6743-7105 _na     120_aa Transcriptional regulator
2908 CAJPOY010000040.1 GCA905372315_01454 CDS open 7128-7481 _na     117_aa PRD domain-containing protein
2909 CAJPOY010000040.1 GCA905372315_01455 CDS open 7478-8602 _na     374_aa amidohydrolase/deacetylase family metallohydrolase
2910 CAJPOY010000040.1 GCA905372315_01456 CDS open 8603-10498 _na     631_aa bglG BglG family transcriptional antiterminator
2911 CAJPOY010000040.1 GCA905372315_01457 CDS open 10630-10869 _na     79_aa F0F1-ATPase subunit
2912 CAJPOY010000040.1 GCA905372315_01458 CDS open 10899-12056 _na     385_aa wecB non-hydrolyzing UDP-N-acetylglucosamine 2-epimerase
2913 CAJPOY010000040.1 GCA905372315_01459 CDS open 12154-13203 _na     349_aa UDP-N-acetylglucosamine:undecaprenyl-P N-acetylglucosaminyl 1-P transferase
2914 CAJPOY010000040.1 GCA905372315_01460 CDS open 13281-13673 _na     130_aa Resolvase%2C RNase H domain protein
2915 CAJPOY010000040.1 GCA905372315_01461 CDS open 13670-14845 _na     391_aa DUF3084 domain-containing protein
2916 CAJPOY010000040.1 GCA905372315_01462 CDS open 14892-15992 _na     366_aa LptF/LptG family permease
2917 CAJPOY010000040.1 GCA905372315_01444 gene open 90-551
2918 CAJPOY010000040.1 GCA905372315_01445 gene open 763-1698 cysK
2919 CAJPOY010000040.1 GCA905372315_01446 gene open 1906-2181
2920 CAJPOY010000040.1 GCA905372315_01447 gene open 2268-2780
2921 CAJPOY010000040.1 GCA905372315_01448 gene open 3067-3786
2922 CAJPOY010000040.1 GCA905372315_01449 gene open 3788-4903
2923 CAJPOY010000040.1 GCA905372315_01450 gene open 4919-5587
2924 CAJPOY010000040.1 GCA905372315_01451 gene open 5593-6375
2925 CAJPOY010000040.1 GCA905372315_01452 gene open 6391-6729
2926 CAJPOY010000040.1 GCA905372315_01453 gene open 6743-7105
2927 CAJPOY010000040.1 GCA905372315_01454 gene open 7128-7481
2928 CAJPOY010000040.1 GCA905372315_01455 gene open 7478-8602
2929 CAJPOY010000040.1 GCA905372315_01456 gene open 8603-10498 bglG
2930 CAJPOY010000040.1 GCA905372315_01457 gene open 10630-10869
2931 CAJPOY010000040.1 GCA905372315_01458 gene open 10899-12056 wecB
2932 CAJPOY010000040.1 GCA905372315_01459 gene open 12154-13203
2933 CAJPOY010000040.1 GCA905372315_01460 gene open 13281-13673
2934 CAJPOY010000040.1 GCA905372315_01461 gene open 13670-14845
2935 CAJPOY010000040.1 GCA905372315_01462 gene open 14892-15992
2936 CAJPOY010000041.1 GCA905372315_01463 CDS open 84-356 _na     90_aa Molybdenum-pterin-binding protein 2
2937 CAJPOY010000041.1 GCA905372315_01464 CDS open 461-1294 _na     277_aa Ketose-bisphosphate aldolase
2938 CAJPOY010000041.1 GCA905372315_01465 CDS open 1335-2420 _na     361_aa AB hydrolase-1 domain-containing protein
2939 CAJPOY010000041.1 GCA905372315_01466 CDS open 2454-3839 _na     461_aa Gluconate permease
2940 CAJPOY010000041.1 GCA905372315_01467 CDS open 3876-5288 _na     470_aa Ketose-bisphosphate aldolase class-II family protein
2941 CAJPOY010000041.1 GCA905372315_01468 CDS open 5300-6196 _na     298_aa garR 2-hydroxy-3-oxopropionate reductase
2942 CAJPOY010000041.1 GCA905372315_01469 CDS open 6345-7166 _na     273_aa HTH gntR-type domain-containing protein
2943 CAJPOY010000041.1 GCA905372315_01470 CDS open 7199-9463 _na     754_aa anaerobic ribonucleoside triphosphate reductase
2944 CAJPOY010000041.1 GCA905372315_01471 CDS open 10244-10810 _na     188_aa hypothetical protein
2945 CAJPOY010000041.1 GCA905372315_01472 CDS open 10954-11091 _na     45_aa hypothetical protein
2946 CAJPOY010000041.1 GCA905372315_01473 CDS open 11114-12298 _na     394_aa hypothetical protein
2947 CAJPOY010000041.1 GCA905372315_01474 CDS open 12335-14002 _na     555_aa hypothetical protein
2948 CAJPOY010000041.1 GCA905372315_01475 CDS open 14234-15568 _na     444_aa hypothetical protein
2949 CAJPOY010000041.1 GCA905372315_01463 gene open 84-356
2950 CAJPOY010000041.1 GCA905372315_01464 gene open 461-1294
2951 CAJPOY010000041.1 GCA905372315_01465 gene open 1335-2420
2952 CAJPOY010000041.1 GCA905372315_01466 gene open 2454-3839
2953 CAJPOY010000041.1 GCA905372315_01467 gene open 3876-5288
2954 CAJPOY010000041.1 GCA905372315_01468 gene open 5300-6196 garR
2955 CAJPOY010000041.1 GCA905372315_01469 gene open 6345-7166
2956 CAJPOY010000041.1 GCA905372315_01470 gene open 7199-9463
2957 CAJPOY010000041.1 GCA905372315_01471 gene open 10244-10810
2958 CAJPOY010000041.1 GCA905372315_01472 gene open 10954-11091
2959 CAJPOY010000041.1 GCA905372315_01473 gene open 11114-12298
2960 CAJPOY010000041.1 GCA905372315_01474 gene open 12335-14002
2961 CAJPOY010000041.1 GCA905372315_01475 gene open 14234-15568
2962 CAJPOY010000042.1 GCA905372315_01476 CDS open 150-623 _na     157_aa hypothetical protein
2963 CAJPOY010000042.1 GCA905372315_01478 CDS open 1165-1860 _na     231_aa SAM-dependent methyltransferase
2964 CAJPOY010000042.1 GCA905372315_01479 CDS open 2036-2845 _na     269_aa Nif3-like dinuclear metal center hexameric protein
2965 CAJPOY010000042.1 GCA905372315_01480 CDS open 2869-4668 _na     599_aa lepA translation elongation factor 4
2966 CAJPOY010000042.1 GCA905372315_01481 CDS open 4661-5827 _na     388_aa hemW radical SAM family heme chaperone HemW
2967 CAJPOY010000042.1 GCA905372315_01482 CDS open 5893-6174 _na     93_aa Glutaredoxin
2968 CAJPOY010000042.1 GCA905372315_01483 CDS open 6361-6717 _na     118_aa Oxaloacetate decarboxylase gamma chain
2969 CAJPOY010000042.1 GCA905372315_01484 CDS open 6735-7862 _na     375_aa Oxaloacetate decarboxylase
2970 CAJPOY010000042.1 GCA905372315_01485 CDS open 8015-8713 _na     232_aa cobI precorrin-2 C(20)-methyltransferase
2971 CAJPOY010000042.1 GCA905372315_01486 CDS open 8715-9644 _na     309_aa Fe/B12 periplasmic-binding domain-containing protein
2972 CAJPOY010000042.1 GCA905372315_01487 CDS open 9641-10612 _na     323_aa Iron compound ABC transporter
2973 CAJPOY010000042.1 GCA905372315_01488 CDS open 10609-11400 _na     263_aa ABC transporter domain-containing protein
2974 CAJPOY010000042.1 GCA905372315_01489 CDS open 11468-11740 _na     90_aa DNA damage-inducible protein
2975 CAJPOY010000042.1 GCA905372315_01490 CDS open 11740-12000 _na     86_aa Txe/YoeB family addiction module toxin
2976 CAJPOY010000042.1 GCA905372315_01491 CDS open 12220-13458 _na     412_aa Outer membrane protein M1
2977 CAJPOY010000042.1 GCA905372315_01492 CDS open 13600-14322 _na     240_aa Fic family protein
2978 CAJPOY010000042.1 GCA905372315_01493 CDS open 14344-15672 _na     442_aa mepA Multidrug export protein MepA
2979 CAJPOY010000042.1 GCA905372315_01476 gene open 150-623
2980 CAJPOY010000042.1 GCA905372315_01478 gene open 1165-1860
2981 CAJPOY010000042.1 GCA905372315_01479 gene open 2036-2845
2982 CAJPOY010000042.1 GCA905372315_01480 gene open 2869-4668 lepA
2983 CAJPOY010000042.1 GCA905372315_01481 gene open 4661-5827 hemW
2984 CAJPOY010000042.1 GCA905372315_01482 gene open 5893-6174
2985 CAJPOY010000042.1 GCA905372315_01483 gene open 6361-6717
2986 CAJPOY010000042.1 GCA905372315_01484 gene open 6735-7862
2987 CAJPOY010000042.1 GCA905372315_01485 gene open 8015-8713 cobI
2988 CAJPOY010000042.1 GCA905372315_01486 gene open 8715-9644
2989 CAJPOY010000042.1 GCA905372315_01487 gene open 9641-10612
2990 CAJPOY010000042.1 GCA905372315_01488 gene open 10609-11400
2991 CAJPOY010000042.1 GCA905372315_01489 gene open 11468-11740
2992 CAJPOY010000042.1 GCA905372315_01490 gene open 11740-12000
2993 CAJPOY010000042.1 GCA905372315_01491 gene open 12220-13458
2994 CAJPOY010000042.1 GCA905372315_01492 gene open 13600-14322
2995 CAJPOY010000042.1 GCA905372315_01493 gene open 14344-15672 mepA
2996 CAJPOY010000042.1 GCA905372315_01477 gene open 966-1041 trnN
2997 CAJPOY010000042.1 GCA905372315_01477 tRNA open 966-1041 trnN tRNA-Asn(gtt)
2998 CAJPOY010000043.1 GCA905372315_01494 CDS open 109-1278 _na     389_aa rpsA 30S ribosomal protein S1
2999 CAJPOY010000043.1 GCA905372315_01495 CDS open 1260-2090 _na     276_aa ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase
3000 CAJPOY010000043.1 GCA905372315_01496 CDS open 2213-2587 _na     124_aa crcB fluoride efflux transporter CrcB