HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Centipeda periodontii (GCA_905372315.1)

Select a Genome:
BAKTA Annotations for GCA_905372315.1
Genome Selected: Centipeda periodontii
ContigsBases CDSrRNA tmRNAtRNA
173 2403355 2315 0 1 28
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4720 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:8]    |    Number of Records Found: 4720 [10 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
3501 CAJPOY010000061.1 GCA905372315_01750 CDS open 7722-9254 _na     510_aa NADH:quinone oxidoreductase/Mrp antiporter transmembrane domain-containing protein
3502 CAJPOY010000061.1 GCA905372315_01751 CDS open 9254-10708 _na     484_aa NADH-quinone oxidoreductase subunit N
3503 CAJPOY010000061.1 GCA905372315_01740 gene open 65-430
3504 CAJPOY010000061.1 GCA905372315_01741 gene open 802-1155
3505 CAJPOY010000061.1 GCA905372315_01742 gene open 1146-1685
3506 CAJPOY010000061.1 GCA905372315_01743 gene open 1682-2173
3507 CAJPOY010000061.1 GCA905372315_01744 gene open 2173-3273
3508 CAJPOY010000061.1 GCA905372315_01745 gene open 3289-4332 nuoH
3509 CAJPOY010000061.1 GCA905372315_01746 gene open 4345-5016
3510 CAJPOY010000061.1 GCA905372315_01747 gene open 5013-5507
3511 CAJPOY010000061.1 GCA905372315_01748 gene open 5504-5809 nuoK
3512 CAJPOY010000061.1 GCA905372315_01749 gene open 5824-7725 nuoL
3513 CAJPOY010000061.1 GCA905372315_01750 gene open 7722-9254
3514 CAJPOY010000061.1 GCA905372315_01751 gene open 9254-10708
3515 CAJPOY010000062.1 repeat_region open 8502-10539 CRISPR array with 31 repeats of length 33%2C consensus sequence GTCGCGCCCCGCACGGGGCGCGTGGATTGAAAC and spacer length 33
3516 CAJPOY010000062.1 GCA905372315_01752 CDS open 207-2621 _na     804_aa CRISPR-associated helicase cas3
3517 CAJPOY010000062.1 GCA905372315_01753 CDS open 2634-3353 _na     239_aa cas5c type I-C CRISPR-associated protein Cas5c
3518 CAJPOY010000062.1 GCA905372315_01754 CDS open 3350-5275 _na     641_aa Type I-C CRISPR-associated protein Cas8c/Csd1
3519 CAJPOY010000062.1 GCA905372315_01755 CDS open 5272-6162 _na     296_aa cas7c type I-C CRISPR-associated protein Cas7/Csd2
3520 CAJPOY010000062.1 GCA905372315_01756 CDS open 6182-6841 _na     219_aa cas4 CRISPR-associated protein Cas4
3521 CAJPOY010000062.1 GCA905372315_01757 CDS open 6838-7866 _na     342_aa cas1c type I-C CRISPR-associated endonuclease Cas1c
3522 CAJPOY010000062.1 GCA905372315_01758 CDS open 7876-8166 _na     96_aa cas2 CRISPR-associated endonuclease Cas2
3523 CAJPOY010000062.1 GCA905372315_01752 gene open 207-2621
3524 CAJPOY010000062.1 GCA905372315_01753 gene open 2634-3353 cas5c
3525 CAJPOY010000062.1 GCA905372315_01754 gene open 3350-5275
3526 CAJPOY010000062.1 GCA905372315_01755 gene open 5272-6162 cas7c
3527 CAJPOY010000062.1 GCA905372315_01756 gene open 6182-6841 cas4
3528 CAJPOY010000062.1 GCA905372315_01757 gene open 6838-7866 cas1c
3529 CAJPOY010000062.1 GCA905372315_01758 gene open 7876-8166 cas2
3530 CAJPOY010000063.1 GCA905372315_01759 CDS open 142-1104 _na     320_aa pfkA 6-phosphofructokinase
3531 CAJPOY010000063.1 GCA905372315_01760 CDS open 1268-2590 _na     440_aa dnaB replicative DNA helicase
3532 CAJPOY010000063.1 GCA905372315_01761 CDS open 2556-4568 _na     670_aa endopeptidase La
3533 CAJPOY010000063.1 GCA905372315_01762 CDS open 4765-5208 _na     147_aa rplI 50S ribosomal protein L9
3534 CAJPOY010000063.1 GCA905372315_01763 CDS open 5180-7192 _na     670_aa Cyclic-di-AMP phosphodiesterase
3535 CAJPOY010000063.1 GCA905372315_01764 CDS open 7226-8212 _na     328_aa Brp/Blh family beta-carotene 15%2C15'-monooxygenase
3536 CAJPOY010000063.1 GCA905372315_01765 CDS open 8447-10228 _na     593_aa DNA mismatch repair protein
3537 CAJPOY010000063.1 GCA905372315_01759 gene open 142-1104 pfkA
3538 CAJPOY010000063.1 GCA905372315_01760 gene open 1268-2590 dnaB
3539 CAJPOY010000063.1 GCA905372315_01761 gene open 2556-4568
3540 CAJPOY010000063.1 GCA905372315_01762 gene open 4765-5208 rplI
3541 CAJPOY010000063.1 GCA905372315_01763 gene open 5180-7192
3542 CAJPOY010000063.1 GCA905372315_01764 gene open 7226-8212
3543 CAJPOY010000063.1 GCA905372315_01765 gene open 8447-10228
3544 CAJPOY010000064.1 GCA905372315_01766 CDS open 172-447 _na     91_aa hypothetical protein
3545 CAJPOY010000064.1 GCA905372315_01767 CDS open 510-1196 _na     228_aa Thiamine-phosphate synthase
3546 CAJPOY010000064.1 GCA905372315_01768 CDS open 1391-2251 _na     286_aa 2-hydroxy-3-oxopropionate reductase
3547 CAJPOY010000064.1 GCA905372315_01769 CDS open 2323-3990 _na     555_aa Metallo-beta-lactamase
3548 CAJPOY010000064.1 GCA905372315_01770 CDS open 4183-8442 _na     1419_aa CoA-substrate-specific enzyme activase
3549 CAJPOY010000064.1 GCA905372315_01771 CDS open 8790-9140 _na     116_aa lysM LysM domain-containing protein
3550 CAJPOY010000064.1 GCA905372315_01766 gene open 172-447
3551 CAJPOY010000064.1 GCA905372315_01767 gene open 510-1196
3552 CAJPOY010000064.1 GCA905372315_01768 gene open 1391-2251
3553 CAJPOY010000064.1 GCA905372315_01769 gene open 2323-3990
3554 CAJPOY010000064.1 GCA905372315_01770 gene open 4183-8442
3555 CAJPOY010000064.1 GCA905372315_01771 gene open 8790-9140 lysM
3556 CAJPOY010000065.1 GCA905372315_01772 CDS open 158-1474 _na     438_aa protein O-GlcNAc transferase
3557 CAJPOY010000065.1 GCA905372315_01773 CDS open 1545-1928 _na     127_aa hypothetical protein
3558 CAJPOY010000065.1 GCA905372315_01774 CDS open 2292-3536 _na     414_aa NAD-dependent malic enzyme
3559 CAJPOY010000065.1 GCA905372315_01775 CDS open 3683-5029 _na     448_aa Cell envelope-related transcriptional attenuator
3560 CAJPOY010000065.1 GCA905372315_01776 CDS open 5226-5699 _na     157_aa Adenylate cyclase
3561 CAJPOY010000065.1 GCA905372315_01777 CDS open 6053-6730 _na     225_aa ACT domain-containing protein
3562 CAJPOY010000065.1 GCA905372315_01778 CDS open 6877-8502 _na     541_aa L-aspartate oxidase
3563 CAJPOY010000065.1 GCA905372315_01779 CDS open 8989-10119 _na     376_aa Cyclically-permuted mutarotase
3564 CAJPOY010000065.1 GCA905372315_01772 gene open 158-1474
3565 CAJPOY010000065.1 GCA905372315_01773 gene open 1545-1928
3566 CAJPOY010000065.1 GCA905372315_01774 gene open 2292-3536
3567 CAJPOY010000065.1 GCA905372315_01775 gene open 3683-5029
3568 CAJPOY010000065.1 GCA905372315_01776 gene open 5226-5699
3569 CAJPOY010000065.1 GCA905372315_01777 gene open 6053-6730
3570 CAJPOY010000065.1 GCA905372315_01778 gene open 6877-8502
3571 CAJPOY010000065.1 GCA905372315_01779 gene open 8989-10119
3572 CAJPOY010000066.1 GCA905372315_01780 CDS open 161-1039 _na     292_aa prmC peptide chain release factor N(5)-glutamine methyltransferase
3573 CAJPOY010000066.1 GCA905372315_01781 CDS open 1039-2103 _na     354_aa prfA peptide chain release factor 1
3574 CAJPOY010000066.1 GCA905372315_01782 CDS open 2088-3011 _na     307_aa DUF1385 domain-containing protein
3575 CAJPOY010000066.1 GCA905372315_01783 CDS open 3128-3328 _na     66_aa rpmE 50S ribosomal protein L31
3576 CAJPOY010000066.1 GCA905372315_01784 CDS open 3505-3987 _na     160_aa 5-nitroimidazole antibiotic resistance protein
3577 CAJPOY010000066.1 GCA905372315_01785 CDS open 3989-5275 _na     428_aa NADH:ubiquinone reductase (non-electrogenic)
3578 CAJPOY010000066.1 GCA905372315_01786 CDS open 5457-6824 _na     455_aa norM putative multidrug resistance protein NorM
3579 CAJPOY010000066.1 GCA905372315_01787 CDS open 6850-7995 _na     381_aa N-acetylmuramoyl-L-alanine amidase
3580 CAJPOY010000066.1 GCA905372315_01788 CDS open 8256-8864 _na     202_aa mgtE Magnesium transporter MgtE intracellular domain-containing protein
3581 CAJPOY010000066.1 GCA905372315_01789 CDS open 8914-9513 _na     199_aa Lytic transglycosylase
3582 CAJPOY010000066.1 GCA905372315_01790 CDS open 9510-9977 _na     155_aa fliJ flagellar export protein FliJ
3583 CAJPOY010000066.1 GCA905372315_01791 CDS open 9974-10246 _na     90_aa hypothetical protein
3584 CAJPOY010000066.1 GCA905372315_01780 gene open 161-1039 prmC
3585 CAJPOY010000066.1 GCA905372315_01781 gene open 1039-2103 prfA
3586 CAJPOY010000066.1 GCA905372315_01782 gene open 2088-3011
3587 CAJPOY010000066.1 GCA905372315_01783 gene open 3128-3328 rpmE
3588 CAJPOY010000066.1 GCA905372315_01784 gene open 3505-3987
3589 CAJPOY010000066.1 GCA905372315_01785 gene open 3989-5275
3590 CAJPOY010000066.1 GCA905372315_01786 gene open 5457-6824 norM
3591 CAJPOY010000066.1 GCA905372315_01787 gene open 6850-7995
3592 CAJPOY010000066.1 GCA905372315_01788 gene open 8256-8864 mgtE
3593 CAJPOY010000066.1 GCA905372315_01789 gene open 8914-9513
3594 CAJPOY010000066.1 GCA905372315_01790 gene open 9510-9977 fliJ
3595 CAJPOY010000066.1 GCA905372315_01791 gene open 9974-10246
3596 CAJPOY010000067.1 GCA905372315_01792 CDS open 67-471 _na     134_aa hypothetical protein
3597 CAJPOY010000067.1 GCA905372315_01793 CDS open 480-1352 _na     290_aa Pseudouridine synthase
3598 CAJPOY010000067.1 GCA905372315_01794 CDS open 1303-2460 _na     385_aa Pyridine nucleotide-disulfide oxidoreductase
3599 CAJPOY010000067.1 GCA905372315_01795 CDS open 2466-3773 _na     435_aa aroA 3-phosphoshikimate 1-carboxyvinyltransferase
3600 CAJPOY010000067.1 GCA905372315_01796 CDS open 3786-4439 _na     217_aa cmk (d)CMP kinase
3601 CAJPOY010000067.1 GCA905372315_01797 CDS open 4452-5054 _na     200_aa 1-acyl-sn-glycerol-3-phosphate acyltransferase
3602 CAJPOY010000067.1 GCA905372315_01798 CDS open 5072-6490 _na     472_aa jetA Wadjet protein JetA
3603 CAJPOY010000067.1 GCA905372315_01799 CDS open 6487-7086 _na     199_aa DUF4194 domain-containing protein
3604 CAJPOY010000067.1 GCA905372315_01800 CDS open 7451-8104 _na     217_aa hypothetical protein
3605 CAJPOY010000067.1 GCA905372315_01801 CDS open 8468-9052 _na     194_aa hypothetical protein
3606 CAJPOY010000067.1 GCA905372315_01802 CDS open 9377-9889 _na     170_aa hypothetical protein
3607 CAJPOY010000067.1 GCA905372315_01792 gene open 67-471
3608 CAJPOY010000067.1 GCA905372315_01793 gene open 480-1352
3609 CAJPOY010000067.1 GCA905372315_01794 gene open 1303-2460
3610 CAJPOY010000067.1 GCA905372315_01795 gene open 2466-3773 aroA
3611 CAJPOY010000067.1 GCA905372315_01796 gene open 3786-4439 cmk
3612 CAJPOY010000067.1 GCA905372315_01797 gene open 4452-5054
3613 CAJPOY010000067.1 GCA905372315_01798 gene open 5072-6490 jetA
3614 CAJPOY010000067.1 GCA905372315_01799 gene open 6487-7086
3615 CAJPOY010000067.1 GCA905372315_01800 gene open 7451-8104
3616 CAJPOY010000067.1 GCA905372315_01801 gene open 8468-9052
3617 CAJPOY010000067.1 GCA905372315_01802 gene open 9377-9889
3618 CAJPOY010000068.1 GCA905372315_01803 CDS open 176-625 _na     149_aa hypothetical protein
3619 CAJPOY010000068.1 GCA905372315_01804 CDS open 568-2034 _na     488_aa gatA Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA
3620 CAJPOY010000068.1 GCA905372315_01805 CDS open 2047-2337 _na     96_aa gatC Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC
3621 CAJPOY010000068.1 GCA905372315_01806 CDS open 2411-3292 _na     293_aa speB agmatinase
3622 CAJPOY010000068.1 GCA905372315_01807 CDS open 3273-4133 _na     286_aa speE polyamine aminopropyltransferase
3623 CAJPOY010000068.1 GCA905372315_01808 CDS open 4136-5590 _na     484_aa Orn/Lys/Arg decarboxylases family 1 pyridoxal-P attachment site domain-containing protein
3624 CAJPOY010000068.1 GCA905372315_01809 CDS open 5590-6537 _na     315_aa NLPA lipoprotein
3625 CAJPOY010000068.1 GCA905372315_01810 CDS open 6534-6947 _na     137_aa DUF3783 domain-containing protein
3626 CAJPOY010000068.1 GCA905372315_01811 CDS open 6955-7803 _na     282_aa NYN domain-containing protein
3627 CAJPOY010000068.1 GCA905372315_01812 CDS open 7815-8864 _na     349_aa DUF2939 domain-containing protein
3628 CAJPOY010000068.1 GCA905372315_01813 CDS open 8896-9963 _na     355_aa mnmA tRNA 2-thiouridine(34) synthase MnmA
3629 CAJPOY010000068.1 GCA905372315_01803 gene open 176-625
3630 CAJPOY010000068.1 GCA905372315_01804 gene open 568-2034 gatA
3631 CAJPOY010000068.1 GCA905372315_01805 gene open 2047-2337 gatC
3632 CAJPOY010000068.1 GCA905372315_01806 gene open 2411-3292 speB
3633 CAJPOY010000068.1 GCA905372315_01807 gene open 3273-4133 speE
3634 CAJPOY010000068.1 GCA905372315_01808 gene open 4136-5590
3635 CAJPOY010000068.1 GCA905372315_01809 gene open 5590-6537
3636 CAJPOY010000068.1 GCA905372315_01810 gene open 6534-6947
3637 CAJPOY010000068.1 GCA905372315_01811 gene open 6955-7803
3638 CAJPOY010000068.1 GCA905372315_01812 gene open 7815-8864
3639 CAJPOY010000068.1 GCA905372315_01813 gene open 8896-9963 mnmA
3640 CAJPOY010000069.1 GCA905372315_01814 CDS open 370-2037 _na     555_aa 2-isopropylmalate synthase
3641 CAJPOY010000069.1 GCA905372315_01815 CDS open 2350-3306 _na     318_aa Phosphatidylglycerol lysyltransferase C-terminal domain-containing protein
3642 CAJPOY010000069.1 GCA905372315_01816 CDS open 3332-4297 _na     321_aa manA mannose-6-phosphate isomerase%2C class I
3643 CAJPOY010000069.1 GCA905372315_01817 CDS open 4459-5712 _na     417_aa uraA uracil permease
3644 CAJPOY010000069.1 GCA905372315_01818 CDS open 5709-6587 _na     292_aa Pseudouridine synthase
3645 CAJPOY010000069.1 GCA905372315_01819 CDS open 6803-7966 _na     387_aa DUF819 domain-containing protein
3646 CAJPOY010000069.1 GCA905372315_01820 CDS open 8137-9225 _na     362_aa Dipeptide epimerase
3647 CAJPOY010000069.1 GCA905372315_01821 CDS open 9236-9796 _na     186_aa SPFH domain-containing protein
3648 CAJPOY010000069.1 GCA905372315_01814 gene open 370-2037
3649 CAJPOY010000069.1 GCA905372315_01815 gene open 2350-3306
3650 CAJPOY010000069.1 GCA905372315_01816 gene open 3332-4297 manA
3651 CAJPOY010000069.1 GCA905372315_01817 gene open 4459-5712 uraA
3652 CAJPOY010000069.1 GCA905372315_01818 gene open 5709-6587
3653 CAJPOY010000069.1 GCA905372315_01819 gene open 6803-7966
3654 CAJPOY010000069.1 GCA905372315_01820 gene open 8137-9225
3655 CAJPOY010000069.1 GCA905372315_01821 gene open 9236-9796
3656 CAJPOY010000070.1 GCA905372315_01822 CDS open 25-960 _na     311_aa argF ornithine carbamoyltransferase
3657 CAJPOY010000070.1 GCA905372315_01823 CDS open 960-2177 _na     405_aa acetylornithine transaminase
3658 CAJPOY010000070.1 GCA905372315_01824 CDS open 2190-3074 _na     294_aa Acetylglutamate kinase
3659 CAJPOY010000070.1 GCA905372315_01825 CDS open 3088-4299 _na     403_aa argJ bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ
3660 CAJPOY010000070.1 GCA905372315_01826 CDS open 4331-5365 _na     344_aa argC N-acetyl-gamma-glutamyl-phosphate reductase
3661 CAJPOY010000070.1 GCA905372315_01827 CDS open 5501-6454 _na     317_aa thrB homoserine kinase
3662 CAJPOY010000070.1 GCA905372315_01828 CDS open 6451-7752 _na     433_aa Homoserine dehydrogenase
3663 CAJPOY010000070.1 GCA905372315_01829 CDS open 7771-8217 _na     148_aa ACT domain-containing protein
3664 CAJPOY010000070.1 GCA905372315_01830 CDS open 8307-8888 _na     193_aa plsY glycerol-3-phosphate 1-O-acyltransferase PlsY
3665 CAJPOY010000070.1 GCA905372315_01831 CDS open 8888-9763 _na     291_aa Ribosome biogenesis GTPase Der
3666 CAJPOY010000070.1 GCA905372315_01822 gene open 25-960 argF
3667 CAJPOY010000070.1 GCA905372315_01823 gene open 960-2177
3668 CAJPOY010000070.1 GCA905372315_01824 gene open 2190-3074
3669 CAJPOY010000070.1 GCA905372315_01825 gene open 3088-4299 argJ
3670 CAJPOY010000070.1 GCA905372315_01826 gene open 4331-5365 argC
3671 CAJPOY010000070.1 GCA905372315_01827 gene open 5501-6454 thrB
3672 CAJPOY010000070.1 GCA905372315_01828 gene open 6451-7752
3673 CAJPOY010000070.1 GCA905372315_01829 gene open 7771-8217
3674 CAJPOY010000070.1 GCA905372315_01830 gene open 8307-8888 plsY
3675 CAJPOY010000070.1 GCA905372315_01831 gene open 8888-9763
3676 CAJPOY010000071.1 GCA905372315_01832 CDS open 18-845 _na     275_aa kdsA 3-deoxy-8-phosphooctulonate synthase
3677 CAJPOY010000071.1 GCA905372315_01833 CDS open 855-1835 _na     326_aa KpsF/GutQ family sugar-phosphate isomerase
3678 CAJPOY010000071.1 GCA905372315_01834 CDS open 1835-2392 _na     185_aa 3-deoxy-manno-octulosonate-8-phosphatase
3679 CAJPOY010000071.1 GCA905372315_01835 CDS open 2419-3330 _na     303_aa Lipid A biosynthesis acyltransferase
3680 CAJPOY010000071.1 GCA905372315_01836 CDS open 3330-3875 _na     181_aa lptC LPS export ABC transporter periplasmic protein LptC
3681 CAJPOY010000071.1 GCA905372315_01837 CDS open 3872-4567 _na     231_aa ostA OstA family protein
3682 CAJPOY010000071.1 GCA905372315_01838 CDS open 4580-5299 _na     239_aa lptB LPS export ABC transporter ATP-binding protein
3683 CAJPOY010000071.1 GCA905372315_01839 CDS open 5485-5814 _na     109_aa DUF4181 domain-containing protein
3684 CAJPOY010000071.1 GCA905372315_01840 CDS open 5988-7706 _na     572_aa Methyl-accepting chemotaxis protein
3685 CAJPOY010000071.1 GCA905372315_01841 CDS open 8005-9411 _na     468_aa Flagellin
3686 CAJPOY010000071.1 GCA905372315_01842 CDS open 9579-9776 _na     65_aa Transposase
3687 CAJPOY010000071.1 GCA905372315_01832 gene open 18-845 kdsA
3688 CAJPOY010000071.1 GCA905372315_01833 gene open 855-1835
3689 CAJPOY010000071.1 GCA905372315_01834 gene open 1835-2392
3690 CAJPOY010000071.1 GCA905372315_01835 gene open 2419-3330
3691 CAJPOY010000071.1 GCA905372315_01836 gene open 3330-3875 lptC
3692 CAJPOY010000071.1 GCA905372315_01837 gene open 3872-4567 ostA
3693 CAJPOY010000071.1 GCA905372315_01838 gene open 4580-5299 lptB
3694 CAJPOY010000071.1 GCA905372315_01839 gene open 5485-5814
3695 CAJPOY010000071.1 GCA905372315_01840 gene open 5988-7706
3696 CAJPOY010000071.1 GCA905372315_01841 gene open 8005-9411
3697 CAJPOY010000071.1 GCA905372315_01842 gene open 9579-9776
3698 CAJPOY010000072.1 GCA905372315_01843 CDS open 21-206 _na     61_aa hypothetical protein
3699 CAJPOY010000072.1 GCA905372315_01844 CDS open 206-1387 _na     393_aa ftsW putative peptidoglycan glycosyltransferase FtsW
3700 CAJPOY010000072.1 GCA905372315_01845 CDS open 1513-3534 _na     673_aa Sulfatase
3701 CAJPOY010000072.1 GCA905372315_01846 CDS open 3717-3962 _na     81_aa 50S ribosomal protein L7/L12
3702 CAJPOY010000072.1 GCA905372315_01847 CDS open 4026-4403 _na     125_aa rpsL 30S ribosomal protein S12
3703 CAJPOY010000072.1 GCA905372315_01848 CDS open 4431-4901 _na     156_aa rpsG 30S ribosomal protein S7
3704 CAJPOY010000072.1 GCA905372315_01849 CDS open 5092-7170 _na     692_aa fusA elongation factor G
3705 CAJPOY010000072.1 GCA905372315_01850 CDS open 7185-8372 _na     395_aa tuf elongation factor Tu
3706 CAJPOY010000072.1 GCA905372315_01851 CDS open 8588-8899 _na     103_aa rpsJ 30S ribosomal protein S10
3707 CAJPOY010000072.1 GCA905372315_01852 CDS open 8930-9334 _na     134_aa hypothetical protein
3708 CAJPOY010000072.1 GCA905372315_01843 gene open 21-206
3709 CAJPOY010000072.1 GCA905372315_01844 gene open 206-1387 ftsW
3710 CAJPOY010000072.1 GCA905372315_01845 gene open 1513-3534
3711 CAJPOY010000072.1 GCA905372315_01846 gene open 3717-3962
3712 CAJPOY010000072.1 GCA905372315_01847 gene open 4026-4403 rpsL
3713 CAJPOY010000072.1 GCA905372315_01848 gene open 4431-4901 rpsG
3714 CAJPOY010000072.1 GCA905372315_01849 gene open 5092-7170 fusA
3715 CAJPOY010000072.1 GCA905372315_01850 gene open 7185-8372 tuf
3716 CAJPOY010000072.1 GCA905372315_01851 gene open 8588-8899 rpsJ
3717 CAJPOY010000072.1 GCA905372315_01852 gene open 8930-9334
3718 CAJPOY010000073.1 GCA905372315_01853 CDS open 269-1933 _na     554_aa ilvB biosynthetic-type acetolactate synthase large subunit
3719 CAJPOY010000073.1 GCA905372315_01854 CDS open 1911-2354 _na     147_aa General secretion pathway protein G
3720 CAJPOY010000073.1 GCA905372315_01855 CDS open 2356-2922 _na     188_aa Type IV prepilin leader peptidase
3721 CAJPOY010000073.1 GCA905372315_01856 CDS open 2937-3437 _na     166_aa gspH General secretion pathway GspH domain-containing protein
3722 CAJPOY010000073.1 GCA905372315_01857 CDS open 3427-3813 _na     128_aa Type II secretion system protein
3723 CAJPOY010000073.1 GCA905372315_01858 CDS open 3788-4303 _na     171_aa Prepilin-type N-terminal cleavage/methylation domain-containing protein
3724 CAJPOY010000073.1 GCA905372315_01859 CDS open 4293-4769 _na     158_aa pilX Type 4 fimbrial biogenesis protein PilX N-terminal domain-containing protein
3725 CAJPOY010000073.1 GCA905372315_01860 CDS open 4747-5925 _na     392_aa Fimbrial assembly protein
3726 CAJPOY010000073.1 GCA905372315_01861 CDS open 5934-6473 _na     179_aa pilO Type IV pilus assembly protein PilO
3727 CAJPOY010000073.1 GCA905372315_01862 CDS open 6473-6583 _na     36_aa hypothetical protein
3728 CAJPOY010000073.1 GCA905372315_01863 CDS open 6580-7749 _na     389_aa aroC chorismate synthase
3729 CAJPOY010000073.1 GCA905372315_01864 CDS open 7746-8267 _na     173_aa Shikimate kinase
3730 CAJPOY010000073.1 GCA905372315_01865 CDS open 8269-9357 _na     362_aa aroB 3-dehydroquinate synthase
3731 CAJPOY010000073.1 GCA905372315_01853 gene open 269-1933 ilvB
3732 CAJPOY010000073.1 GCA905372315_01854 gene open 1911-2354
3733 CAJPOY010000073.1 GCA905372315_01855 gene open 2356-2922
3734 CAJPOY010000073.1 GCA905372315_01856 gene open 2937-3437 gspH
3735 CAJPOY010000073.1 GCA905372315_01857 gene open 3427-3813
3736 CAJPOY010000073.1 GCA905372315_01858 gene open 3788-4303
3737 CAJPOY010000073.1 GCA905372315_01859 gene open 4293-4769 pilX
3738 CAJPOY010000073.1 GCA905372315_01860 gene open 4747-5925
3739 CAJPOY010000073.1 GCA905372315_01861 gene open 5934-6473 pilO
3740 CAJPOY010000073.1 GCA905372315_01862 gene open 6473-6583
3741 CAJPOY010000073.1 GCA905372315_01863 gene open 6580-7749 aroC
3742 CAJPOY010000073.1 GCA905372315_01864 gene open 7746-8267
3743 CAJPOY010000073.1 GCA905372315_01865 gene open 8269-9357 aroB
3744 CAJPOY010000074.1 GCA905372315_01866 CDS open 157-543 _na     128_aa Phage capsid family protein
3745 CAJPOY010000074.1 GCA905372315_01867 CDS open 578-853 _na     91_aa head-tail connector protein
3746 CAJPOY010000074.1 GCA905372315_01868 CDS open 854-1192 _na     112_aa phage head closure protein
3747 CAJPOY010000074.1 GCA905372315_01869 CDS open 1476-2339 _na     287_aa DUF3298 domain-containing protein
3748 CAJPOY010000074.1 GCA905372315_01870 CDS open 2427-2978 _na     183_aa hypothetical protein
3749 CAJPOY010000074.1 GCA905372315_01871 CDS open 3000-3188 _na     62_aa hypothetical protein
3750 CAJPOY010000074.1 GCA905372315_01872 CDS open 3281-4321 _na     346_aa Lipoprotein
3751 CAJPOY010000074.1 GCA905372315_01873 CDS open 4578-5198 _na     206_aa DNA-binding response regulator
3752 CAJPOY010000074.1 GCA905372315_01874 CDS open 5195-6586 _na     463_aa histidine kinase
3753 CAJPOY010000074.1 GCA905372315_01875 CDS open 6574-9003 _na     809_aa Histidine kinase N-terminal 7TM region domain-containing protein
3754 CAJPOY010000074.1 GCA905372315_01866 gene open 157-543
3755 CAJPOY010000074.1 GCA905372315_01867 gene open 578-853
3756 CAJPOY010000074.1 GCA905372315_01868 gene open 854-1192
3757 CAJPOY010000074.1 GCA905372315_01869 gene open 1476-2339
3758 CAJPOY010000074.1 GCA905372315_01870 gene open 2427-2978
3759 CAJPOY010000074.1 GCA905372315_01871 gene open 3000-3188
3760 CAJPOY010000074.1 GCA905372315_01872 gene open 3281-4321
3761 CAJPOY010000074.1 GCA905372315_01873 gene open 4578-5198
3762 CAJPOY010000074.1 GCA905372315_01874 gene open 5195-6586
3763 CAJPOY010000074.1 GCA905372315_01875 gene open 6574-9003
3764 CAJPOY010000075.1 GCA905372315_01876 CDS open 27-440 _na     137_aa hypothetical protein
3765 CAJPOY010000075.1 GCA905372315_01877 CDS open 814-2178 _na     454_aa Pyridine nucleotide-disulfide dehydrogenase
3766 CAJPOY010000075.1 GCA905372315_01878 CDS open 2192-2806 _na     204_aa Lipoprotein
3767 CAJPOY010000075.1 GCA905372315_01879 CDS open 2796-3821 _na     341_aa Acetyl-hydrolase
3768 CAJPOY010000075.1 GCA905372315_01880 CDS open 3881-5506 _na     541_aa peptide chain release factor 3
3769 CAJPOY010000075.1 GCA905372315_01881 CDS open 5631-6383 _na     250_aa exodeoxyribonuclease III
3770 CAJPOY010000075.1 GCA905372315_01882 CDS open 6398-6925 _na     175_aa lepB signal peptidase I
3771 CAJPOY010000075.1 GCA905372315_01883 CDS open 6987-7328 _na     113_aa rplS 50S ribosomal protein L19
3772 CAJPOY010000075.1 GCA905372315_01884 CDS open 7445-9250 _na     601_aa Diguanylate cyclase
3773 CAJPOY010000075.1 GCA905372315_01876 gene open 27-440
3774 CAJPOY010000075.1 GCA905372315_01877 gene open 814-2178
3775 CAJPOY010000075.1 GCA905372315_01878 gene open 2192-2806
3776 CAJPOY010000075.1 GCA905372315_01879 gene open 2796-3821
3777 CAJPOY010000075.1 GCA905372315_01880 gene open 3881-5506
3778 CAJPOY010000075.1 GCA905372315_01881 gene open 5631-6383
3779 CAJPOY010000075.1 GCA905372315_01882 gene open 6398-6925 lepB
3780 CAJPOY010000075.1 GCA905372315_01883 gene open 6987-7328 rplS
3781 CAJPOY010000075.1 GCA905372315_01884 gene open 7445-9250
3782 CAJPOY010000076.1 GCA905372315_01885 CDS open 460-1020 _na     186_aa P27 family phage terminase small subunit
3783 CAJPOY010000076.1 GCA905372315_01886 CDS open 1143-1589 _na     148_aa hypothetical protein
3784 CAJPOY010000076.1 GCA905372315_01887 CDS open 1624-2199 _na     191_aa hypothetical protein
3785 CAJPOY010000076.1 GCA905372315_01888 CDS open 2312-3553 _na     413_aa Methyltransferase
3786 CAJPOY010000076.1 GCA905372315_01889 CDS open 3553-4095 _na     180_aa N-acetylmuramoyl-L-alanine amidase
3787 CAJPOY010000076.1 GCA905372315_01890 CDS open 4096-4389 _na     97_aa prevent-host-death protein
3788 CAJPOY010000076.1 GCA905372315_01891 CDS open 4457-5176 _na     239_aa virulence protein
3789 CAJPOY010000076.1 GCA905372315_01892 CDS open 5160-5396 _na     78_aa DUF4314 domain-containing protein
3790 CAJPOY010000076.1 GCA905372315_01893 CDS open 5393-5575 _na     60_aa DUF5049 domain-containing protein
3791 CAJPOY010000076.1 GCA905372315_01894 CDS open 5694-5972 _na     92_aa Nucleotide modification associated domain-containing protein
3792 CAJPOY010000076.1 GCA905372315_01895 CDS open 6054-6770 _na     238_aa DUF554 domain-containing protein
3793 CAJPOY010000076.1 GCA905372315_01896 CDS open 7040-7999 _na     319_aa Putative amidoligase enzyme
3794 CAJPOY010000076.1 GCA905372315_01897 CDS open 8084-8560 _na     158_aa AIG2-like family protein
3795 CAJPOY010000076.1 GCA905372315_01885 gene open 460-1020
3796 CAJPOY010000076.1 GCA905372315_01886 gene open 1143-1589
3797 CAJPOY010000076.1 GCA905372315_01887 gene open 1624-2199
3798 CAJPOY010000076.1 GCA905372315_01888 gene open 2312-3553
3799 CAJPOY010000076.1 GCA905372315_01889 gene open 3553-4095
3800 CAJPOY010000076.1 GCA905372315_01890 gene open 4096-4389
3801 CAJPOY010000076.1 GCA905372315_01891 gene open 4457-5176
3802 CAJPOY010000076.1 GCA905372315_01892 gene open 5160-5396
3803 CAJPOY010000076.1 GCA905372315_01893 gene open 5393-5575
3804 CAJPOY010000076.1 GCA905372315_01894 gene open 5694-5972
3805 CAJPOY010000076.1 GCA905372315_01895 gene open 6054-6770
3806 CAJPOY010000076.1 GCA905372315_01896 gene open 7040-7999
3807 CAJPOY010000076.1 GCA905372315_01897 gene open 8084-8560
3808 CAJPOY010000077.1 GCA905372315_01898 CDS open 171-1433 _na     420_aa pfp diphosphate--fructose-6-phosphate 1-phosphotransferase
3809 CAJPOY010000077.1 GCA905372315_01899 CDS open 1581-2852 _na     423_aa RNA helicase
3810 CAJPOY010000077.1 GCA905372315_01900 CDS open 2849-3721 _na     290_aa map type I methionyl aminopeptidase
3811 CAJPOY010000077.1 GCA905372315_01901 CDS open 3901-4731 _na     276_aa Polysaccharide deacetylase
3812 CAJPOY010000077.1 GCA905372315_01902 CDS open 4825-5025 _na     66_aa hypothetical protein
3813 CAJPOY010000077.1 GCA905372315_01903 CDS open 5356-6744 _na     462_aa methyl-accepting chemotaxis protein
3814 CAJPOY010000077.1 GCA905372315_01904 CDS open 6818-8272 _na     484_aa Sucrose-6-phosphate hydrolase
3815 CAJPOY010000077.1 GCA905372315_01905 CDS open 8278-9090 _na     270_aa hypothetical protein
3816 CAJPOY010000077.1 GCA905372315_01898 gene open 171-1433 pfp
3817 CAJPOY010000077.1 GCA905372315_01899 gene open 1581-2852
3818 CAJPOY010000077.1 GCA905372315_01900 gene open 2849-3721 map
3819 CAJPOY010000077.1 GCA905372315_01901 gene open 3901-4731
3820 CAJPOY010000077.1 GCA905372315_01902 gene open 4825-5025
3821 CAJPOY010000077.1 GCA905372315_01903 gene open 5356-6744
3822 CAJPOY010000077.1 GCA905372315_01904 gene open 6818-8272
3823 CAJPOY010000077.1 GCA905372315_01905 gene open 8278-9090
3824 CAJPOY010000078.1 GCA905372315_01906 CDS open 69-851 _na     260_aa ADP-ribosylglycohydrolase
3825 CAJPOY010000078.1 GCA905372315_01907 CDS open 1010-1216 _na     68_aa Esterase
3826 CAJPOY010000078.1 GCA905372315_01908 CDS open 1206-2129 _na     307_aa yafY YafY family protein
3827 CAJPOY010000078.1 GCA905372315_01909 CDS open 2201-2911 _na     236_aa yaaW YaaW family protein
3828 CAJPOY010000078.1 GCA905372315_01910 CDS open 2925-3332 _na     135_aa DUF1232 domain-containing protein
3829 CAJPOY010000078.1 GCA905372315_01911 CDS open 3460-4047 _na     195_aa VWA domain-containing protein
3830 CAJPOY010000078.1 GCA905372315_01912 CDS open 4066-4272 _na     68_aa DUF4366 domain-containing protein
3831 CAJPOY010000078.1 GCA905372315_01913 CDS open 4545-4931 _na     128_aa hypothetical protein
3832 CAJPOY010000078.1 GCA905372315_01914 CDS open 5083-5868 _na     261_aa Helix-turn-helix domain-containing protein
3833 CAJPOY010000078.1 GCA905372315_01915 CDS open 5971-6543 _na     190_aa DUF3862 domain-containing protein
3834 CAJPOY010000078.1 GCA905372315_01916 CDS open 6722-7543 _na     273_aa TPM domain-containing protein
3835 CAJPOY010000078.1 GCA905372315_01917 CDS open 7556-8668 _na     370_aa Zinc finger domain protein%2C LSD1 subclass
3836 CAJPOY010000078.1 GCA905372315_01906 gene open 69-851
3837 CAJPOY010000078.1 GCA905372315_01907 gene open 1010-1216
3838 CAJPOY010000078.1 GCA905372315_01908 gene open 1206-2129 yafY
3839 CAJPOY010000078.1 GCA905372315_01909 gene open 2201-2911 yaaW
3840 CAJPOY010000078.1 GCA905372315_01910 gene open 2925-3332
3841 CAJPOY010000078.1 GCA905372315_01911 gene open 3460-4047
3842 CAJPOY010000078.1 GCA905372315_01912 gene open 4066-4272
3843 CAJPOY010000078.1 GCA905372315_01913 gene open 4545-4931
3844 CAJPOY010000078.1 GCA905372315_01914 gene open 5083-5868
3845 CAJPOY010000078.1 GCA905372315_01915 gene open 5971-6543
3846 CAJPOY010000078.1 GCA905372315_01916 gene open 6722-7543
3847 CAJPOY010000078.1 GCA905372315_01917 gene open 7556-8668
3848 CAJPOY010000079.1 repeat_region open 5744-7536 CRISPR array with 25 repeats of length 35%2C consensus sequence GTTTCCGTCCCCTTGCGGGGATGTGGTTTTAAAAT and spacer length 37
3849 CAJPOY010000079.1 GCA905372315_01918 CDS open 221-2248 _na     675_aa OPT family oligopeptide transporter
3850 CAJPOY010000079.1 GCA905372315_01919 CDS open 2352-2540 _na     62_aa hicA HicA family toxin-antitoxin system
3851 CAJPOY010000079.1 GCA905372315_01920 CDS open 2574-3008 _na     144_aa hicB HicB family toxin-antitoxin system
3852 CAJPOY010000079.1 GCA905372315_01921 CDS open 3112-3582 _na     156_aa Glycosyl hydrolase family 98 putative carbohydrate-binding module domain-containing protein
3853 CAJPOY010000079.1 GCA905372315_01922 CDS open 3607-4026 _na     139_aa Pyridoxamine 5'-phosphate oxidase-like domain-containing protein
3854 CAJPOY010000079.1 GCA905372315_01923 CDS open 4088-5341 _na     417_aa Peptidase M48 domain-containing protein
3855 CAJPOY010000079.1 GCA905372315_01924 CDS open 7752-8582 _na     276_aa hypothetical protein
3856 CAJPOY010000079.1 GCA905372315_01918 gene open 221-2248
3857 CAJPOY010000079.1 GCA905372315_01919 gene open 2352-2540 hicA
3858 CAJPOY010000079.1 GCA905372315_01920 gene open 2574-3008 hicB
3859 CAJPOY010000079.1 GCA905372315_01921 gene open 3112-3582
3860 CAJPOY010000079.1 GCA905372315_01922 gene open 3607-4026
3861 CAJPOY010000079.1 GCA905372315_01923 gene open 4088-5341
3862 CAJPOY010000079.1 GCA905372315_01924 gene open 7752-8582
3863 CAJPOY010000080.1 GCA905372315_01925 CDS open 273-1043 _na     256_aa UPF0251 protein HMPREF9081_0012
3864 CAJPOY010000080.1 GCA905372315_01926 CDS open 1403-1903 _na     166_aa flavodoxin family protein
3865 CAJPOY010000080.1 GCA905372315_01927 CDS open 1900-3558 _na     552_aa hutW heme anaerobic degradation radical SAM methyltransferase ChuW/HutW
3866 CAJPOY010000080.1 GCA905372315_01928 CDS open 3623-4729 _na     368_aa Adenine DNA glycosylase
3867 CAJPOY010000080.1 GCA905372315_01929 CDS open 4863-6134 _na     423_aa serS serine--tRNA ligase
3868 CAJPOY010000080.1 GCA905372315_01930 CDS open 6131-6685 _na     184_aa ubiX Flavin prenyltransferase UbiX
3869 CAJPOY010000080.1 GCA905372315_01931 CDS open 6691-7314 _na     207_aa Lipid A 3-O-deacylase
3870 CAJPOY010000080.1 GCA905372315_01932 CDS open 7325-7999 _na     224_aa rnhA ribonuclease HI
3871 CAJPOY010000080.1 GCA905372315_01933 CDS open 8106-8873 _na     255_aa ABC transporter permease
3872 CAJPOY010000080.1 GCA905372315_01925 gene open 273-1043
3873 CAJPOY010000080.1 GCA905372315_01926 gene open 1403-1903
3874 CAJPOY010000080.1 GCA905372315_01927 gene open 1900-3558 hutW
3875 CAJPOY010000080.1 GCA905372315_01928 gene open 3623-4729
3876 CAJPOY010000080.1 GCA905372315_01929 gene open 4863-6134 serS
3877 CAJPOY010000080.1 GCA905372315_01930 gene open 6131-6685 ubiX
3878 CAJPOY010000080.1 GCA905372315_01931 gene open 6691-7314
3879 CAJPOY010000080.1 GCA905372315_01932 gene open 7325-7999 rnhA
3880 CAJPOY010000080.1 GCA905372315_01933 gene open 8106-8873
3881 CAJPOY010000081.1 GCA905372315_01934 CDS open 275-1096 _na     273_aa VWFA domain-containing protein
3882 CAJPOY010000081.1 GCA905372315_01935 CDS open 1241-1978 _na     245_aa VWFA domain-containing protein
3883 CAJPOY010000081.1 GCA905372315_01936 CDS open 2123-2791 _na     222_aa VWFA domain-containing protein
3884 CAJPOY010000081.1 GCA905372315_01937 CDS open 2941-3426 _na     161_aa Methylated-DNA--protein-cysteine methyltransferase
3885 CAJPOY010000081.1 GCA905372315_01938 CDS open 3827-4231 _na     134_aa SpoVT-AbrB domain-containing protein
3886 CAJPOY010000081.1 GCA905372315_01939 CDS open 4396-5868 _na     490_aa DUF2828 domain-containing protein
3887 CAJPOY010000081.1 GCA905372315_01940 CDS open 6187-6735 _na     182_aa HotDog ACOT-type domain-containing protein
3888 CAJPOY010000081.1 GCA905372315_01941 CDS open 6911-8668 _na     585_aa 1-deoxy-D-xylulose-5-phosphate synthase
3889 CAJPOY010000081.1 GCA905372315_01934 gene open 275-1096
3890 CAJPOY010000081.1 GCA905372315_01935 gene open 1241-1978
3891 CAJPOY010000081.1 GCA905372315_01936 gene open 2123-2791
3892 CAJPOY010000081.1 GCA905372315_01937 gene open 2941-3426
3893 CAJPOY010000081.1 GCA905372315_01938 gene open 3827-4231
3894 CAJPOY010000081.1 GCA905372315_01939 gene open 4396-5868
3895 CAJPOY010000081.1 GCA905372315_01940 gene open 6187-6735
3896 CAJPOY010000081.1 GCA905372315_01941 gene open 6911-8668
3897 CAJPOY010000082.1 GCA905372315_01942 CDS open 154-915 _na     253_aa Cobalt transport protein
3898 CAJPOY010000082.1 GCA905372315_01943 CDS open 927-2399 _na     490_aa ccmA heme ABC exporter ATP-binding protein CcmA
3899 CAJPOY010000082.1 GCA905372315_01944 CDS open 2423-3010 _na     195_aa TIGR02185 family protein
3900 CAJPOY010000082.1 GCA905372315_01945 CDS open 3191-3463 _na     90_aa ACT domain-containing protein
3901 CAJPOY010000082.1 GCA905372315_01946 CDS open 3479-4840 _na     453_aa UPF0210 protein HMPREF9081_1472
3902 CAJPOY010000082.1 GCA905372315_01947 CDS open 4842-5474 _na     210_aa nth endonuclease III
3903 CAJPOY010000082.1 GCA905372315_01948 CDS open 5494-5943 _na     149_aa N-acetyltransferase
3904 CAJPOY010000082.1 GCA905372315_01949 CDS open 5956-6969 _na     337_aa bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase
3905 CAJPOY010000082.1 GCA905372315_01950 CDS open 6966-7856 _na     296_aa Prephenate dehydrogenase
3906 CAJPOY010000082.1 GCA905372315_01951 CDS open 7918-8562 _na     214_aa lexA transcriptional repressor LexA
3907 CAJPOY010000082.1 GCA905372315_01942 gene open 154-915
3908 CAJPOY010000082.1 GCA905372315_01943 gene open 927-2399 ccmA
3909 CAJPOY010000082.1 GCA905372315_01944 gene open 2423-3010
3910 CAJPOY010000082.1 GCA905372315_01945 gene open 3191-3463
3911 CAJPOY010000082.1 GCA905372315_01946 gene open 3479-4840
3912 CAJPOY010000082.1 GCA905372315_01947 gene open 4842-5474 nth
3913 CAJPOY010000082.1 GCA905372315_01948 gene open 5494-5943
3914 CAJPOY010000082.1 GCA905372315_01949 gene open 5956-6969
3915 CAJPOY010000082.1 GCA905372315_01950 gene open 6966-7856
3916 CAJPOY010000082.1 GCA905372315_01951 gene open 7918-8562 lexA
3917 CAJPOY010000083.1 GCA905372315_01952 CDS open 248-1828 _na     526_aa fliF flagellar basal-body MS-ring/collar protein FliF
3918 CAJPOY010000083.1 GCA905372315_01953 CDS open 1901-2203 _na     100_aa fliE flagellar hook-basal body complex protein FliE
3919 CAJPOY010000083.1 GCA905372315_01954 CDS open 2237-2692 _na     151_aa flgC flagellar basal body rod protein FlgC
3920 CAJPOY010000083.1 GCA905372315_01955 CDS open 2711-3133 _na     140_aa flgB flagellar basal body rod protein FlgB
3921 CAJPOY010000083.1 GCA905372315_01956 CDS open 3304-4155 _na     283_aa Asp23/Gls24 family envelope stress response protein
3922 CAJPOY010000083.1 GCA905372315_01957 CDS open 4177-5007 _na     276_aa PHP domain protein
3923 CAJPOY010000083.1 GCA905372315_01958 CDS open 5022-5804 _na     260_aa Ser/Thr protein phosphatase
3924 CAJPOY010000083.1 GCA905372315_01959 CDS open 5825-6382 _na     185_aa hypothetical protein
3925 CAJPOY010000083.1 GCA905372315_01960 CDS open 6402-8177 _na     591_aa Sensory box/GGDEF domain protein
3926 CAJPOY010000083.1 GCA905372315_01952 gene open 248-1828 fliF
3927 CAJPOY010000083.1 GCA905372315_01953 gene open 1901-2203 fliE
3928 CAJPOY010000083.1 GCA905372315_01954 gene open 2237-2692 flgC
3929 CAJPOY010000083.1 GCA905372315_01955 gene open 2711-3133 flgB
3930 CAJPOY010000083.1 GCA905372315_01956 gene open 3304-4155
3931 CAJPOY010000083.1 GCA905372315_01957 gene open 4177-5007
3932 CAJPOY010000083.1 GCA905372315_01958 gene open 5022-5804
3933 CAJPOY010000083.1 GCA905372315_01959 gene open 5825-6382
3934 CAJPOY010000083.1 GCA905372315_01960 gene open 6402-8177
3935 CAJPOY010000084.1 GCA905372315_01961 CDS open 24-1238 _na     404_aa argininosuccinate synthase
3936 CAJPOY010000084.1 GCA905372315_01962 CDS open 1235-2659 _na     474_aa argH argininosuccinate lyase
3937 CAJPOY010000084.1 GCA905372315_01963 CDS open 2767-3276 _na     169_aa Outer membrane protein beta-barrel domain-containing protein
3938 CAJPOY010000084.1 GCA905372315_01964 CDS open 3611-5299 _na     562_aa Ribonuclease J
3939 CAJPOY010000084.1 GCA905372315_01965 CDS open 5458-6309 _na     283_aa Transketolase
3940 CAJPOY010000084.1 GCA905372315_01966 CDS open 6312-7253 _na     313_aa 1-deoxy-D-xylulose-5-phosphate synthase
3941 CAJPOY010000084.1 GCA905372315_01961 gene open 24-1238
3942 CAJPOY010000084.1 GCA905372315_01962 gene open 1235-2659 argH
3943 CAJPOY010000084.1 GCA905372315_01963 gene open 2767-3276
3944 CAJPOY010000084.1 GCA905372315_01964 gene open 3611-5299
3945 CAJPOY010000084.1 GCA905372315_01965 gene open 5458-6309
3946 CAJPOY010000084.1 GCA905372315_01966 gene open 6312-7253
3947 CAJPOY010000085.1 GCA905372315_01967 CDS open 185-3658 _na     1157_aa hypothetical protein
3948 CAJPOY010000085.1 GCA905372315_01968 CDS open 3824-4027 _na     67_aa hypothetical protein
3949 CAJPOY010000085.1 GCA905372315_01969 CDS open 4634-5059 _na     141_aa hypothetical protein
3950 CAJPOY010000085.1 GCA905372315_01970 CDS open 5330-5590 _na     86_aa hypothetical protein
3951 CAJPOY010000085.1 GCA905372315_01971 CDS open 5975-6943 _na     322_aa Rpn family recombination-promoting nuclease/putative transposase
3952 CAJPOY010000085.1 GCA905372315_01972 CDS open 6959-7261 _na     100_aa Transposase
3953 CAJPOY010000085.1 GCA905372315_01967 gene open 185-3658
3954 CAJPOY010000085.1 GCA905372315_01968 gene open 3824-4027
3955 CAJPOY010000085.1 GCA905372315_01969 gene open 4634-5059
3956 CAJPOY010000085.1 GCA905372315_01970 gene open 5330-5590
3957 CAJPOY010000085.1 GCA905372315_01971 gene open 5975-6943
3958 CAJPOY010000085.1 GCA905372315_01972 gene open 6959-7261
3959 CAJPOY010000086.1 GCA905372315_01973 CDS open 52-3777 _na     1241_aa hypothetical protein
3960 CAJPOY010000086.1 GCA905372315_01974 CDS open 3854-4351 _na     165_aa Pyridoxamine 5'-phosphate oxidase
3961 CAJPOY010000086.1 GCA905372315_01975 CDS open 4372-4836 _na     154_aa protein-tyrosine-phosphatase
3962 CAJPOY010000086.1 GCA905372315_01976 CDS open 4940-6667 _na     575_aa ShlB-type superfamily POTRA domain protein
3963 CAJPOY010000086.1 GCA905372315_01977 CDS open 6719-7150 _na     143_aa hypothetical protein
3964 CAJPOY010000086.1 GCA905372315_01973 gene open 52-3777
3965 CAJPOY010000086.1 GCA905372315_01974 gene open 3854-4351
3966 CAJPOY010000086.1 GCA905372315_01975 gene open 4372-4836
3967 CAJPOY010000086.1 GCA905372315_01976 gene open 4940-6667
3968 CAJPOY010000086.1 GCA905372315_01977 gene open 6719-7150
3969 CAJPOY010000087.1 GCA905372315_01978 CDS open 272-1600 _na     442_aa Permease
3970 CAJPOY010000087.1 GCA905372315_01979 CDS open 1610-3337 _na     575_aa Adenine deaminase
3971 CAJPOY010000087.1 GCA905372315_01980 CDS open 3425-4030 _na     201_aa hypothetical protein
3972 CAJPOY010000087.1 GCA905372315_01981 CDS open 4183-4695 _na     170_aa Nicotinamidase
3973 CAJPOY010000087.1 GCA905372315_01982 CDS open 4758-5630 _na     290_aa hypothetical protein
3974 CAJPOY010000087.1 GCA905372315_01983 CDS open 5627-6715 _na     362_aa Schlafen group 3-like DNA/RNA helicase domain-containing protein
3975 CAJPOY010000087.1 GCA905372315_01978 gene open 272-1600
3976 CAJPOY010000087.1 GCA905372315_01979 gene open 1610-3337
3977 CAJPOY010000087.1 GCA905372315_01980 gene open 3425-4030
3978 CAJPOY010000087.1 GCA905372315_01981 gene open 4183-4695
3979 CAJPOY010000087.1 GCA905372315_01982 gene open 4758-5630
3980 CAJPOY010000087.1 GCA905372315_01983 gene open 5627-6715
3981 CAJPOY010000088.1 GCA905372315_01984 CDS open 76-1173 _na     365_aa mqnE aminofutalosine synthase MqnE
3982 CAJPOY010000088.1 GCA905372315_01985 CDS open 1170-2195 _na     341_aa mqnC cyclic dehypoxanthinyl futalosine synthase
3983 CAJPOY010000088.1 GCA905372315_01986 CDS open 2197-3045 _na     282_aa Nucleoside phosphorylase domain-containing protein
3984 CAJPOY010000088.1 GCA905372315_01987 CDS open 3748-4707 _na     319_aa L-lactate dehydrogenase
3985 CAJPOY010000088.1 GCA905372315_01988 CDS open 4844-5011 _na     55_aa hypothetical protein
3986 CAJPOY010000088.1 GCA905372315_01989 CDS open 5173-5379 _na     68_aa General stress protein 14
3987 CAJPOY010000088.1 GCA905372315_01990 CDS open 5531-6061 _na     176_aa 2-oxoacid:acceptor oxidoreductase family protein
3988 CAJPOY010000088.1 GCA905372315_01991 CDS open 6063-6911 _na     282_aa Thiamine pyrophosphate enzyme TPP-binding domain-containing protein
3989 CAJPOY010000088.1 GCA905372315_01984 gene open 76-1173 mqnE
3990 CAJPOY010000088.1 GCA905372315_01985 gene open 1170-2195 mqnC
3991 CAJPOY010000088.1 GCA905372315_01986 gene open 2197-3045
3992 CAJPOY010000088.1 GCA905372315_01987 gene open 3748-4707
3993 CAJPOY010000088.1 GCA905372315_01988 gene open 4844-5011
3994 CAJPOY010000088.1 GCA905372315_01989 gene open 5173-5379
3995 CAJPOY010000088.1 GCA905372315_01990 gene open 5531-6061
3996 CAJPOY010000088.1 GCA905372315_01991 gene open 6063-6911
3997 CAJPOY010000089.1 GCA905372315_01992 CDS open 46-1545 _na     499_aa hypothetical protein
3998 CAJPOY010000089.1 GCA905372315_01993 CDS open 1565-2878 _na     437_aa alanine--glyoxylate transaminase
3999 CAJPOY010000089.1 GCA905372315_01994 CDS open 2889-3440 _na     183_aa Adenine phosphoribosyltransferase
4000 CAJPOY010000089.1 GCA905372315_01995 CDS open 3455-4273 _na     272_aa lgt prolipoprotein diacylglyceryl transferase