HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Anaeroglobus geminatus (GCA_905372395.1)

Select a Genome:
BAKTA Annotations for GCA_905372395.1
Genome Selected: Anaeroglobus geminatus
ContigsBases CDSrRNA tmRNAtRNA
30 1760181 1646 0 1 45
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3418 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:5]    |    Number of Records Found: 3418 [7 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
2001 CAJPOR010000008.1 GCA905372395_00995 CDS open 9953-10270 _na     105_aa YbaB/EbfC family nucleoid-associated protein
2002 CAJPOR010000008.1 GCA905372395_00996 CDS open 10289-12190 _na     633_aa dnaX DNA polymerase III subunit gamma/tau
2003 CAJPOR010000008.1 GCA905372395_00999 CDS open 12539-13462 _na     307_aa ompA OmpA family protein
2004 CAJPOR010000008.1 GCA905372395_01000 CDS open 13724-14170 _na     148_aa GtrA-like protein
2005 CAJPOR010000008.1 GCA905372395_01001 CDS open 14170-15501 _na     443_aa rarA Recombination factor protein RarA
2006 CAJPOR010000008.1 GCA905372395_01002 CDS open 15527-16114 _na     195_aa HDIG domain protein
2007 CAJPOR010000008.1 GCA905372395_01003 CDS open 16154-17290 _na     378_aa Sugar fermentation stimulation -like protein
2008 CAJPOR010000008.1 GCA905372395_01004 CDS open 17393-18235 _na     280_aa dapF diaminopimelate epimerase
2009 CAJPOR010000008.1 GCA905372395_01005 CDS open 18274-20550 _na     758_aa hydratase
2010 CAJPOR010000008.1 GCA905372395_01006 CDS open 20849-22189 _na     446_aa Citrate synthase
2011 CAJPOR010000008.1 GCA905372395_01007 CDS open 22193-23188 _na     331_aa Putative isocitrate dehydrogenase%2C NAD-dependent
2012 CAJPOR010000008.1 GCA905372395_01008 CDS open 23295-24254 _na     319_aa Glycerol-3-phosphate dehydrogenase [NAD(P)+]
2013 CAJPOR010000008.1 GCA905372395_01009 CDS open 24314-25675 _na     453_aa CBS domain protein
2014 CAJPOR010000008.1 GCA905372395_01010 CDS open 25695-26429 _na     244_aa TPM domain-containing protein
2015 CAJPOR010000008.1 GCA905372395_01011 CDS open 26478-27608 _na     376_aa Aminotransferase
2016 CAJPOR010000008.1 GCA905372395_01012 CDS open 27624-29537 _na     637_aa gyrB DNA topoisomerase (ATP-hydrolyzing) subunit B
2017 CAJPOR010000008.1 GCA905372395_01013 CDS open 29622-29882 _na     86_aa remB extracellular matrix regulator RemB
2018 CAJPOR010000008.1 GCA905372395_01014 CDS open 29882-30745 _na     287_aa DUF721 domain-containing protein
2019 CAJPOR010000008.1 GCA905372395_01015 CDS open 30738-31841 _na     367_aa recF DNA replication/repair protein RecF
2020 CAJPOR010000008.1 GCA905372395_01016 CDS open 31842-32060 _na     72_aa S4 domain protein
2021 CAJPOR010000008.1 GCA905372395_01017 CDS open 32070-33185 _na     371_aa dnaN DNA polymerase III subunit beta
2022 CAJPOR010000008.1 GCA905372395_01018 CDS open 33407-34930 _na     507_aa dnaA chromosomal replication initiator protein DnaA
2023 CAJPOR010000008.1 GCA905372395_01019 CDS open 35474-35827 _na     117_aa rnpA ribonuclease P protein component
2024 CAJPOR010000008.1 GCA905372395_01020 CDS open 36106-36780 _na     224_aa Stage III sporulation protein J family protein
2025 CAJPOR010000008.1 GCA905372395_01021 CDS open 36782-37498 _na     238_aa jag RNA-binding cell elongation regulator Jag/EloR
2026 CAJPOR010000008.1 GCA905372395_01022 CDS open 37557-38933 _na     458_aa mnmE tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE
2027 CAJPOR010000008.1 GCA905372395_01023 CDS open 38945-40837 _na     630_aa mnmG tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG
2028 CAJPOR010000008.1 GCA905372395_01024 CDS open 40824-41537 _na     237_aa rsmG 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG
2029 CAJPOR010000008.1 GCA905372395_01025 CDS open 41560-42525 _na     321_aa Serine-type D-Ala-D-Ala carboxypeptidase
2030 CAJPOR010000008.1 GCA905372395_01026 CDS open 42829-43086 _na     85_aa Putative phosphocarrier protein HPr
2031 CAJPOR010000008.1 GCA905372395_01027 CDS open 43099-44730 _na     543_aa Phosphoenolpyruvate-protein phosphotransferase
2032 CAJPOR010000008.1 GCA905372395_01028 CDS open 45304-48090 _na     928_aa copZ copper chaperone CopZ
2033 CAJPOR010000008.1 GCA905372395_01029 CDS open 48100-48420 _na     106_aa csoR Copper-sensing transcriptional repressor CsoR family protein
2034 CAJPOR010000008.1 GCA905372395_01030 CDS open 48916-49344 _na     142_aa Outer membrane protein
2035 CAJPOR010000008.1 GCA905372395_01031 CDS open 49458-49883 _na     141_aa ytfJ Sporulation protein YtfJ
2036 CAJPOR010000008.1 GCA905372395_01032 CDS open 49858-50610 _na     250_aa DUF2953 domain-containing protein
2037 CAJPOR010000008.1 GCA905372395_01033 CDS open 50684-51784 _na     366_aa Oxidoreductase%2C FAD/FMN-binding protein
2038 CAJPOR010000008.1 GCA905372395_01034 CDS open 52011-53294 _na     427_aa Adenylosuccinate synthetase
2039 CAJPOR010000008.1 GCA905372395_01035 CDS open 53489-54154 _na     221_aa Vitamin B12 dependent methionine synthase%2C activation domain protein
2040 CAJPOR010000008.1 GCA905372395_01036 CDS open 54336-55112 _na     258_aa Sporulation initiation inhibitor protein Soj
2041 CAJPOR010000008.1 GCA905372395_01037 CDS open 55102-56001 _na     299_aa Stage 0 sporulation protein J
2042 CAJPOR010000008.1 GCA905372395_01038 CDS open 56060-56584 _na     174_aa DUF4446 domain-containing protein
2043 CAJPOR010000008.1 GCA905372395_01039 CDS open 56597-57559 _na     320_aa Peptidase%2C M23 family
2044 CAJPOR010000008.1 GCA905372395_01040 CDS open 57594-58070 _na     158_aa Peptidyl-prolyl cis-trans isomerase
2045 CAJPOR010000008.1 GCA905372395_01041 CDS open 58030-58446 _na     138_aa hypothetical protein
2046 CAJPOR010000008.1 GCA905372395_01042 CDS open 58802-59737 _na     311_aa cysK cysteine synthase A
2047 CAJPOR010000008.1 GCA905372395_01043 CDS open 59881-60576 _na     231_aa cysE serine O-acetyltransferase
2048 CAJPOR010000008.1 GCA905372395_01044 CDS open 61687-62379 _na     230_aa Metallo-beta-lactamase domain-containing protein
2049 CAJPOR010000008.1 GCA905372395_01045 CDS open 62419-63687 _na     422_aa DUF445 domain-containing protein
2050 CAJPOR010000008.1 GCA905372395_01046 CDS open 63689-64975 _na     428_aa DUF445 domain-containing protein
2051 CAJPOR010000008.1 GCA905372395_01047 CDS open 65223-66224 _na     333_aa Radical SAM domain protein
2052 CAJPOR010000008.1 GCA905372395_01048 CDS open 66319-68196 _na     625_aa Carbon starvation protein A-like protein
2053 CAJPOR010000008.1 GCA905372395_01049 CDS open 68535-68858 _na     107_aa Thioredoxin
2054 CAJPOR010000008.1 GCA905372395_01050 CDS open 69115-69783 _na     222_aa artM Arginine ABC transporter%2C ATP-binding protein ArtM
2055 CAJPOR010000008.1 GCA905372395_00985 gene open 131-913
2056 CAJPOR010000008.1 GCA905372395_00986 gene open 1193-2665
2057 CAJPOR010000008.1 GCA905372395_00987 gene open 2702-4279
2058 CAJPOR010000008.1 GCA905372395_00988 gene open 4473-5642
2059 CAJPOR010000008.1 GCA905372395_00989 gene open 5658-6479
2060 CAJPOR010000008.1 GCA905372395_00990 gene open 6597-7202
2061 CAJPOR010000008.1 GCA905372395_00991 gene open 7199-7963
2062 CAJPOR010000008.1 GCA905372395_00992 gene open 7985-9091
2063 CAJPOR010000008.1 GCA905372395_00993 gene open 9110-9355 bofA
2064 CAJPOR010000008.1 GCA905372395_00994 gene open 9363-9953 recR
2065 CAJPOR010000008.1 GCA905372395_00995 gene open 9953-10270
2066 CAJPOR010000008.1 GCA905372395_00996 gene open 10289-12190 dnaX
2067 CAJPOR010000008.1 GCA905372395_00999 gene open 12539-13462 ompA
2068 CAJPOR010000008.1 GCA905372395_01000 gene open 13724-14170
2069 CAJPOR010000008.1 GCA905372395_01001 gene open 14170-15501 rarA
2070 CAJPOR010000008.1 GCA905372395_01002 gene open 15527-16114
2071 CAJPOR010000008.1 GCA905372395_01003 gene open 16154-17290
2072 CAJPOR010000008.1 GCA905372395_01004 gene open 17393-18235 dapF
2073 CAJPOR010000008.1 GCA905372395_01005 gene open 18274-20550
2074 CAJPOR010000008.1 GCA905372395_01006 gene open 20849-22189
2075 CAJPOR010000008.1 GCA905372395_01007 gene open 22193-23188
2076 CAJPOR010000008.1 GCA905372395_01008 gene open 23295-24254
2077 CAJPOR010000008.1 GCA905372395_01009 gene open 24314-25675
2078 CAJPOR010000008.1 GCA905372395_01010 gene open 25695-26429
2079 CAJPOR010000008.1 GCA905372395_01011 gene open 26478-27608
2080 CAJPOR010000008.1 GCA905372395_01012 gene open 27624-29537 gyrB
2081 CAJPOR010000008.1 GCA905372395_01013 gene open 29622-29882 remB
2082 CAJPOR010000008.1 GCA905372395_01014 gene open 29882-30745
2083 CAJPOR010000008.1 GCA905372395_01015 gene open 30738-31841 recF
2084 CAJPOR010000008.1 GCA905372395_01016 gene open 31842-32060
2085 CAJPOR010000008.1 GCA905372395_01017 gene open 32070-33185 dnaN
2086 CAJPOR010000008.1 GCA905372395_01018 gene open 33407-34930 dnaA
2087 CAJPOR010000008.1 GCA905372395_01019 gene open 35474-35827 rnpA
2088 CAJPOR010000008.1 GCA905372395_01020 gene open 36106-36780
2089 CAJPOR010000008.1 GCA905372395_01021 gene open 36782-37498 jag
2090 CAJPOR010000008.1 GCA905372395_01022 gene open 37557-38933 mnmE
2091 CAJPOR010000008.1 GCA905372395_01023 gene open 38945-40837 mnmG
2092 CAJPOR010000008.1 GCA905372395_01024 gene open 40824-41537 rsmG
2093 CAJPOR010000008.1 GCA905372395_01025 gene open 41560-42525
2094 CAJPOR010000008.1 GCA905372395_01026 gene open 42829-43086
2095 CAJPOR010000008.1 GCA905372395_01027 gene open 43099-44730
2096 CAJPOR010000008.1 GCA905372395_01028 gene open 45304-48090 copZ
2097 CAJPOR010000008.1 GCA905372395_01029 gene open 48100-48420 csoR
2098 CAJPOR010000008.1 GCA905372395_01030 gene open 48916-49344
2099 CAJPOR010000008.1 GCA905372395_01031 gene open 49458-49883 ytfJ
2100 CAJPOR010000008.1 GCA905372395_01032 gene open 49858-50610
2101 CAJPOR010000008.1 GCA905372395_01033 gene open 50684-51784
2102 CAJPOR010000008.1 GCA905372395_01034 gene open 52011-53294
2103 CAJPOR010000008.1 GCA905372395_01035 gene open 53489-54154
2104 CAJPOR010000008.1 GCA905372395_01036 gene open 54336-55112
2105 CAJPOR010000008.1 GCA905372395_01037 gene open 55102-56001
2106 CAJPOR010000008.1 GCA905372395_01038 gene open 56060-56584
2107 CAJPOR010000008.1 GCA905372395_01039 gene open 56597-57559
2108 CAJPOR010000008.1 GCA905372395_01040 gene open 57594-58070
2109 CAJPOR010000008.1 GCA905372395_01041 gene open 58030-58446
2110 CAJPOR010000008.1 GCA905372395_01042 gene open 58802-59737 cysK
2111 CAJPOR010000008.1 GCA905372395_01043 gene open 59881-60576 cysE
2112 CAJPOR010000008.1 GCA905372395_01044 gene open 61687-62379
2113 CAJPOR010000008.1 GCA905372395_01045 gene open 62419-63687
2114 CAJPOR010000008.1 GCA905372395_01046 gene open 63689-64975
2115 CAJPOR010000008.1 GCA905372395_01047 gene open 65223-66224
2116 CAJPOR010000008.1 GCA905372395_01048 gene open 66319-68196
2117 CAJPOR010000008.1 GCA905372395_01049 gene open 68535-68858
2118 CAJPOR010000008.1 GCA905372395_01050 gene open 69115-69783 artM
2119 CAJPOR010000009.1 GCA905372395_01051 CDS open 96-1364 _na     422_aa Amidohydrolase
2120 CAJPOR010000009.1 GCA905372395_01052 CDS open 1460-2047 _na     195_aa Uracil-DNA glycosylase family protein
2121 CAJPOR010000009.1 GCA905372395_01053 CDS open 2116-2622 _na     168_aa Flavodoxin-like domain-containing protein
2122 CAJPOR010000009.1 GCA905372395_01054 CDS open 2635-3369 _na     244_aa Carboxymuconolactone decarboxylase family protein
2123 CAJPOR010000009.1 GCA905372395_01055 CDS open 3433-3588 _na     51_aa hypothetical protein
2124 CAJPOR010000009.1 GCA905372395_01056 CDS open 3729-4631 _na     300_aa lysR LysR substrate binding domain protein
2125 CAJPOR010000009.1 GCA905372395_01057 CDS open 4682-4930 _na     82_aa 4Fe-4S binding domain protein
2126 CAJPOR010000009.1 GCA905372395_01059 CDS open 5526-6233 _na     235_aa HTH cro/C1-type domain-containing protein
2127 CAJPOR010000009.1 GCA905372395_01060 CDS open 6667-7959 _na     430_aa amino acid permease
2128 CAJPOR010000009.1 GCA905372395_01061 CDS open 8067-9302 _na     411_aa Ser/Thr protein phosphatase family protein
2129 CAJPOR010000009.1 GCA905372395_01062 CDS open 9318-10643 _na     441_aa 4Fe-4S binding domain protein
2130 CAJPOR010000009.1 GCA905372395_01063 CDS open 10874-11224 _na     116_aa Molecular chaperone Hsp90
2131 CAJPOR010000009.1 GCA905372395_01064 CDS open 11341-12021 _na     226_aa Zinc-ribbon domain-containing protein
2132 CAJPOR010000009.1 GCA905372395_01065 CDS open 12132-12395 _na     87_aa N-acetyltransferase domain-containing protein
2133 CAJPOR010000009.1 GCA905372395_01066 CDS open 12453-12689 _na     78_aa Toxin-antitoxin system%2C toxin component%2C GNAT domain protein
2134 CAJPOR010000009.1 GCA905372395_01067 CDS open 12686-13612 _na     308_aa rarD EamA family transporter RarD
2135 CAJPOR010000009.1 GCA905372395_01068 CDS open 13643-15010 _na     455_aa Putative permease
2136 CAJPOR010000009.1 GCA905372395_01069 CDS open 15019-16377 _na     452_aa Putative guanine deaminase
2137 CAJPOR010000009.1 GCA905372395_01070 CDS open 16655-17875 _na     406_aa Transporter%2C dicarboxylate/amino acid:cation Na+/H+ symporter family protein
2138 CAJPOR010000009.1 GCA905372395_01071 CDS open 18476-18712 _na     78_aa secE preprotein translocase subunit SecE
2139 CAJPOR010000009.1 GCA905372395_01072 CDS open 18725-19264 _na     179_aa nusG transcription termination/antitermination protein NusG
2140 CAJPOR010000009.1 GCA905372395_01073 CDS open 19352-19777 _na     141_aa rplK 50S ribosomal protein L11
2141 CAJPOR010000009.1 GCA905372395_01074 CDS open 19839-20555 _na     238_aa rplA 50S ribosomal protein L1
2142 CAJPOR010000009.1 GCA905372395_01075 CDS open 20730-21284 _na     184_aa rplJ 50S ribosomal protein L10
2143 CAJPOR010000009.1 GCA905372395_01076 CDS open 21335-21706 _na     123_aa rplL 50S ribosomal protein L7/L12
2144 CAJPOR010000009.1 GCA905372395_01077 CDS open 22010-23449 _na     479_aa Glucose-6-phosphate isomerase
2145 CAJPOR010000009.1 GCA905372395_01078 CDS open 23462-24040 _na     192_aa Tat pathway signal sequence domain protein
2146 CAJPOR010000009.1 GCA905372395_01079 CDS open 24053-25183 _na     376_aa Bacterial type II/III secretion system short domain protein
2147 CAJPOR010000009.1 GCA905372395_01080 CDS open 25248-25745 _na     165_aa queT QueT transporter
2148 CAJPOR010000009.1 GCA905372395_01081 CDS open 25843-26793 _na     316_aa CobW/P47K family protein
2149 CAJPOR010000009.1 GCA905372395_01082 CDS open 26797-28347 _na     516_aa Putative permease
2150 CAJPOR010000009.1 GCA905372395_01083 CDS open 28344-29096 _na     250_aa TIGR03943 family putative permease subunit
2151 CAJPOR010000009.1 GCA905372395_01084 CDS open 29404-30024 _na     206_aa Transporter%2C MotA/TolQ/ExbB proton channel family protein
2152 CAJPOR010000009.1 GCA905372395_01085 CDS open 30024-30428 _na     134_aa Transport energizing protein%2C ExbD/TolR family
2153 CAJPOR010000009.1 GCA905372395_01086 CDS open 30435-31223 _na     262_aa TonB-dependent receptor
2154 CAJPOR010000009.1 GCA905372395_01087 CDS open 31284-32138 _na     284_aa Pyridoxamine 5'-phosphate oxidase family protein
2155 CAJPOR010000009.1 GCA905372395_01088 CDS open 32566-37497 _na     1643_aa TonB-dependent receptor plug domain protein
2156 CAJPOR010000009.1 GCA905372395_01089 CDS open 37802-42805 _na     1667_aa TonB-dependent receptor domain-containing protein
2157 CAJPOR010000009.1 GCA905372395_01090 CDS open 43000-43989 _na     329_aa 1%2C4-beta-N-acetylmuramidase
2158 CAJPOR010000009.1 GCA905372395_01092 CDS open 44307-44963 _na     218_aa Type-4 uracil-DNA glycosylase
2159 CAJPOR010000009.1 GCA905372395_01093 CDS open 44963-45475 _na     170_aa ybaK Cys-tRNA(Pro) deacylase
2160 CAJPOR010000009.1 GCA905372395_01094 CDS open 45594-46382 _na     262_aa Hydrolase%2C carbon-nitrogen family
2161 CAJPOR010000009.1 GCA905372395_01095 CDS open 46407-47588 _na     393_aa Peptidase M20 domain-containing protein 2
2162 CAJPOR010000009.1 GCA905372395_01096 CDS open 47702-49270 _na     522_aa PAS domain S-box protein
2163 CAJPOR010000009.1 GCA905372395_01097 CDS open 49457-50413 _na     318_aa Fe/B12 periplasmic-binding domain-containing protein
2164 CAJPOR010000009.1 GCA905372395_01098 CDS open 50413-51420 _na     335_aa fhuG Putative ferrichrome transport system permease protein FhuG
2165 CAJPOR010000009.1 GCA905372395_01099 CDS open 51417-52232 _na     271_aa fhuC Putative ferrichrome ABC transporter%2C ATP-binding protein FhuC
2166 CAJPOR010000009.1 GCA905372395_01100 CDS open 52229-54310 _na     693_aa TonB-dependent receptor
2167 CAJPOR010000009.1 GCA905372395_01101 CDS open 54312-55214 _na     300_aa chaN Haem-binding uptake Tiki superfamily ChaN domain-containing protein
2168 CAJPOR010000009.1 GCA905372395_01102 CDS open 55285-56997 _na     570_aa ABC transporter%2C ATP-binding protein
2169 CAJPOR010000009.1 GCA905372395_01103 CDS open 57098-58036 _na     312_aa araC Transcriptional regulator%2C AraC family
2170 CAJPOR010000009.1 GCA905372395_01104 CDS open 58480-59001 _na     173_aa Flavodoxin
2171 CAJPOR010000009.1 GCA905372395_01105 CDS open 59003-60571 _na     522_aa hutW heme anaerobic degradation radical SAM methyltransferase ChuW/HutW
2172 CAJPOR010000009.1 GCA905372395_01106 CDS open 60807-62735 _na     642_aa Fructose-1%2C6-bisphosphatase class 3
2173 CAJPOR010000009.1 GCA905372395_01107 CDS open 62919-64118 _na     399_aa Anaerobic nitric oxide reductase flavorubredoxin
2174 CAJPOR010000009.1 GCA905372395_01108 CDS open 64226-64789 _na     187_aa Flavin reductase
2175 CAJPOR010000009.1 GCA905372395_01109 CDS open 64801-65235 _na     144_aa PPC domain-containing protein
2176 CAJPOR010000009.1 GCA905372395_01110 CDS open 65294-65995 _na     233_aa DUF1275 domain-containing protein
2177 CAJPOR010000009.1 GCA905372395_01112 CDS open 66166-68052 _na     628_aa abc-f ribosomal protection-like ABC-F family protein
2178 CAJPOR010000009.1 GCA905372395_01113 CDS open 68267-68701 _na     144_aa Hsp20/alpha crystallin family protein
2179 CAJPOR010000009.1 GCA905372395_01114 CDS open 68824-69300 _na     158_aa Pyridoxamine 5'-phosphate oxidase family protein
2180 CAJPOR010000009.1 GCA905372395_01051 gene open 96-1364
2181 CAJPOR010000009.1 GCA905372395_01052 gene open 1460-2047
2182 CAJPOR010000009.1 GCA905372395_01053 gene open 2116-2622
2183 CAJPOR010000009.1 GCA905372395_01054 gene open 2635-3369
2184 CAJPOR010000009.1 GCA905372395_01055 gene open 3433-3588
2185 CAJPOR010000009.1 GCA905372395_01056 gene open 3729-4631 lysR
2186 CAJPOR010000009.1 GCA905372395_01057 gene open 4682-4930
2187 CAJPOR010000009.1 GCA905372395_01059 gene open 5526-6233
2188 CAJPOR010000009.1 GCA905372395_01060 gene open 6667-7959
2189 CAJPOR010000009.1 GCA905372395_01061 gene open 8067-9302
2190 CAJPOR010000009.1 GCA905372395_01062 gene open 9318-10643
2191 CAJPOR010000009.1 GCA905372395_01063 gene open 10874-11224
2192 CAJPOR010000009.1 GCA905372395_01064 gene open 11341-12021
2193 CAJPOR010000009.1 GCA905372395_01065 gene open 12132-12395
2194 CAJPOR010000009.1 GCA905372395_01066 gene open 12453-12689
2195 CAJPOR010000009.1 GCA905372395_01067 gene open 12686-13612 rarD
2196 CAJPOR010000009.1 GCA905372395_01068 gene open 13643-15010
2197 CAJPOR010000009.1 GCA905372395_01069 gene open 15019-16377
2198 CAJPOR010000009.1 GCA905372395_01070 gene open 16655-17875
2199 CAJPOR010000009.1 GCA905372395_01071 gene open 18476-18712 secE
2200 CAJPOR010000009.1 GCA905372395_01072 gene open 18725-19264 nusG
2201 CAJPOR010000009.1 GCA905372395_01073 gene open 19352-19777 rplK
2202 CAJPOR010000009.1 GCA905372395_01074 gene open 19839-20555 rplA
2203 CAJPOR010000009.1 GCA905372395_01075 gene open 20730-21284 rplJ
2204 CAJPOR010000009.1 GCA905372395_01076 gene open 21335-21706 rplL
2205 CAJPOR010000009.1 GCA905372395_01077 gene open 22010-23449
2206 CAJPOR010000009.1 GCA905372395_01078 gene open 23462-24040
2207 CAJPOR010000009.1 GCA905372395_01079 gene open 24053-25183
2208 CAJPOR010000009.1 GCA905372395_01080 gene open 25248-25745 queT
2209 CAJPOR010000009.1 GCA905372395_01081 gene open 25843-26793
2210 CAJPOR010000009.1 GCA905372395_01082 gene open 26797-28347
2211 CAJPOR010000009.1 GCA905372395_01083 gene open 28344-29096
2212 CAJPOR010000009.1 GCA905372395_01084 gene open 29404-30024
2213 CAJPOR010000009.1 GCA905372395_01085 gene open 30024-30428
2214 CAJPOR010000009.1 GCA905372395_01086 gene open 30435-31223
2215 CAJPOR010000009.1 GCA905372395_01087 gene open 31284-32138
2216 CAJPOR010000009.1 GCA905372395_01088 gene open 32566-37497
2217 CAJPOR010000009.1 GCA905372395_01089 gene open 37802-42805
2218 CAJPOR010000009.1 GCA905372395_01090 gene open 43000-43989
2219 CAJPOR010000009.1 GCA905372395_01092 gene open 44307-44963
2220 CAJPOR010000009.1 GCA905372395_01093 gene open 44963-45475 ybaK
2221 CAJPOR010000009.1 GCA905372395_01094 gene open 45594-46382
2222 CAJPOR010000009.1 GCA905372395_01095 gene open 46407-47588
2223 CAJPOR010000009.1 GCA905372395_01096 gene open 47702-49270
2224 CAJPOR010000009.1 GCA905372395_01097 gene open 49457-50413
2225 CAJPOR010000009.1 GCA905372395_01098 gene open 50413-51420 fhuG
2226 CAJPOR010000009.1 GCA905372395_01099 gene open 51417-52232 fhuC
2227 CAJPOR010000009.1 GCA905372395_01100 gene open 52229-54310
2228 CAJPOR010000009.1 GCA905372395_01101 gene open 54312-55214 chaN
2229 CAJPOR010000009.1 GCA905372395_01102 gene open 55285-56997
2230 CAJPOR010000009.1 GCA905372395_01103 gene open 57098-58036 araC
2231 CAJPOR010000009.1 GCA905372395_01104 gene open 58480-59001
2232 CAJPOR010000009.1 GCA905372395_01105 gene open 59003-60571 hutW
2233 CAJPOR010000009.1 GCA905372395_01106 gene open 60807-62735
2234 CAJPOR010000009.1 GCA905372395_01107 gene open 62919-64118
2235 CAJPOR010000009.1 GCA905372395_01108 gene open 64226-64789
2236 CAJPOR010000009.1 GCA905372395_01109 gene open 64801-65235
2237 CAJPOR010000009.1 GCA905372395_01110 gene open 65294-65995
2238 CAJPOR010000009.1 GCA905372395_01112 gene open 66166-68052 abc-f
2239 CAJPOR010000009.1 GCA905372395_01113 gene open 68267-68701
2240 CAJPOR010000009.1 GCA905372395_01114 gene open 68824-69300
2241 CAJPOR010000009.1 GCA905372395_01058 gene open 5216-5291 trnT
2242 CAJPOR010000009.1 GCA905372395_01091 gene open 44177-44250 trnG
2243 CAJPOR010000009.1 GCA905372395_01111 gene open 66036-66111 trnA
2244 CAJPOR010000009.1 GCA905372395_01058 tRNA open 5216-5291 trnT tRNA-Thr(cgt)
2245 CAJPOR010000009.1 GCA905372395_01091 tRNA open 44177-44250 trnG tRNA-Gly(ccc)
2246 CAJPOR010000009.1 GCA905372395_01111 tRNA open 66036-66111 trnA tRNA-Ala(tgc)
2247 CAJPOR010000010.1 regulatory_region open 52771-52996 T-box leader
2248 CAJPOR010000010.1 repeat_region open 34946-35499 CRISPR array with 8 repeats of length 35%2C consensus sequence AATTAATTACCTAAACCCCGAGAGGGGACGGAAAC and spacer length 37
2249 CAJPOR010000010.1 repeat_region open 35524-38029 CRISPR array with 34 repeats of length 35%2C consensus sequence AATTAATTACCTAAACCCCGAGAGGGGACGGAAAC and spacer length 38
2250 CAJPOR010000010.1 GCA905372395_01115 CDS open 15-1202 _na     395_aa tuf elongation factor Tu
2251 CAJPOR010000010.1 GCA905372395_01116 CDS open 1572-1883 _na     103_aa rpsJ 30S ribosomal protein S10
2252 CAJPOR010000010.1 GCA905372395_01117 CDS open 1898-2536 _na     212_aa rplC 50S ribosomal protein L3
2253 CAJPOR010000010.1 GCA905372395_01118 CDS open 2567-3190 _na     207_aa rplD 50S ribosomal protein L4
2254 CAJPOR010000010.1 GCA905372395_01119 CDS open 3190-3474 _na     94_aa rplW 50S ribosomal protein L23
2255 CAJPOR010000010.1 GCA905372395_01120 CDS open 3507-4334 _na     275_aa rplB 50S ribosomal protein L2
2256 CAJPOR010000010.1 GCA905372395_01121 CDS open 4356-4631 _na     91_aa rpsS 30S ribosomal protein S19
2257 CAJPOR010000010.1 GCA905372395_01122 CDS open 4647-4982 _na     111_aa rplV 50S ribosomal protein L22
2258 CAJPOR010000010.1 GCA905372395_01123 CDS open 4996-5667 _na     223_aa rpsC 30S ribosomal protein S3
2259 CAJPOR010000010.1 GCA905372395_01124 CDS open 5667-6104 _na     145_aa rplP 50S ribosomal protein L16
2260 CAJPOR010000010.1 GCA905372395_01125 CDS open 6094-6288 _na     64_aa rpmC 50S ribosomal protein L29
2261 CAJPOR010000010.1 GCA905372395_01126 CDS open 6329-6583 _na     84_aa rpsQ 30S ribosomal protein S17
2262 CAJPOR010000010.1 GCA905372395_01127 CDS open 6610-6978 _na     122_aa rplN 50S ribosomal protein L14
2263 CAJPOR010000010.1 GCA905372395_01128 CDS open 6998-7315 _na     105_aa rplX 50S ribosomal protein L24
2264 CAJPOR010000010.1 GCA905372395_01129 CDS open 7337-7882 _na     181_aa rplE 50S ribosomal protein L5
2265 CAJPOR010000010.1 GCA905372395_01130 CDS open 7897-8166 _na     89_aa rpsN 30S ribosomal protein S14
2266 CAJPOR010000010.1 GCA905372395_01131 CDS open 8194-8586 _na     130_aa rpsH 30S ribosomal protein S8
2267 CAJPOR010000010.1 GCA905372395_01132 CDS open 8603-9145 _na     180_aa rplF 50S ribosomal protein L6
2268 CAJPOR010000010.1 GCA905372395_01133 CDS open 9178-9537 _na     119_aa rplR 50S ribosomal protein L18
2269 CAJPOR010000010.1 GCA905372395_01134 CDS open 9556-10056 _na     166_aa rpsE 30S ribosomal protein S5
2270 CAJPOR010000010.1 GCA905372395_01135 CDS open 10074-10253 _na     59_aa rpmD 50S ribosomal protein L30
2271 CAJPOR010000010.1 GCA905372395_01136 CDS open 10274-10714 _na     146_aa rplO 50S ribosomal protein L15
2272 CAJPOR010000010.1 GCA905372395_01137 CDS open 10716-11978 _na     420_aa secY preprotein translocase subunit SecY
2273 CAJPOR010000010.1 GCA905372395_01138 CDS open 11994-12644 _na     216_aa adenylate kinase
2274 CAJPOR010000010.1 GCA905372395_01139 CDS open 12647-13396 _na     249_aa map type I methionyl aminopeptidase
2275 CAJPOR010000010.1 GCA905372395_01140 CDS open 13396-13665 _na     89_aa KOW domain-containing protein
2276 CAJPOR010000010.1 GCA905372395_01141 CDS open 13669-13887 _na     72_aa infA translation initiation factor IF-1
2277 CAJPOR010000010.1 GCA905372395_01142 CDS open 13907-14020 _na     37_aa rpmJ 50S ribosomal protein L36
2278 CAJPOR010000010.1 GCA905372395_01143 CDS open 14043-14411 _na     122_aa rpsM 30S ribosomal protein S13
2279 CAJPOR010000010.1 GCA905372395_01144 CDS open 14439-14831 _na     130_aa rpsK 30S ribosomal protein S11
2280 CAJPOR010000010.1 GCA905372395_01145 CDS open 14885-15871 _na     328_aa DNA-directed RNA polymerase subunit alpha
2281 CAJPOR010000010.1 GCA905372395_01146 CDS open 15888-16226 _na     112_aa rplQ 50S ribosomal protein L17
2282 CAJPOR010000010.1 GCA905372395_01147 CDS open 16316-16744 _na     142_aa WH2 domain-containing protein
2283 CAJPOR010000010.1 GCA905372395_01148 CDS open 16757-17230 _na     157_aa Oxidized purine nucleoside triphosphate hydrolase
2284 CAJPOR010000010.1 GCA905372395_01149 CDS open 17281-18762 _na     493_aa Putative aldehyde dehydrogenase B
2285 CAJPOR010000010.1 GCA905372395_01150 CDS open 18798-19343 _na     181_aa Glutathione peroxidase
2286 CAJPOR010000010.1 GCA905372395_01151 CDS open 19586-20104 _na     172_aa Bacterial transferase hexapeptide repeat protein
2287 CAJPOR010000010.1 GCA905372395_01152 CDS open 20222-22585 _na     787_aa mutS2 endonuclease MutS2
2288 CAJPOR010000010.1 GCA905372395_01153 CDS open 22607-23182 _na     191_aa xanthine phosphoribosyltransferase
2289 CAJPOR010000010.1 GCA905372395_01154 CDS open 23347-24069 _na     240_aa NAD-dependent protein deacylase
2290 CAJPOR010000010.1 GCA905372395_01155 CDS open 24473-25888 _na     471_aa Amino acid carrier protein
2291 CAJPOR010000010.1 GCA905372395_01156 CDS open 26042-27784 _na     580_aa 1-deoxy-D-xylulose-5-phosphate synthase
2292 CAJPOR010000010.1 GCA905372395_01157 CDS open 28112-30907 _na     931_aa ileS isoleucine--tRNA ligase
2293 CAJPOR010000010.1 GCA905372395_01158 CDS open 31003-32508 _na     501_aa ABC transporter%2C substrate-binding protein%2C QAT family
2294 CAJPOR010000010.1 GCA905372395_01159 CDS open 32501-33235 _na     244_aa ABC transporter%2C ATP-binding protein
2295 CAJPOR010000010.1 GCA905372395_01160 CDS open 33470-33937 _na     155_aa marR Transcriptional regulator%2C MarR family
2296 CAJPOR010000010.1 GCA905372395_01161 CDS open 34086-34286 _na     66_aa Hydrid cluster protein-associated redox disulfide domain protein
2297 CAJPOR010000010.1 GCA905372395_01162 CDS open 38169-39914 _na     581_aa ABC transporter%2C ATP-binding protein
2298 CAJPOR010000010.1 GCA905372395_01163 CDS open 39911-41653 _na     580_aa ABC transporter domain-containing protein
2299 CAJPOR010000010.1 GCA905372395_01164 CDS open 41945-42934 _na     329_aa cas1 CRISPR-associated endonuclease Cas1
2300 CAJPOR010000010.1 GCA905372395_01165 CDS open 42942-43244 _na     100_aa cas2 CRISPR-associated endonuclease Cas2
2301 CAJPOR010000010.1 GCA905372395_01166 CDS open 43278-45728 _na     816_aa cas10 type III-A CRISPR-associated protein Cas10/Csm1
2302 CAJPOR010000010.1 GCA905372395_01167 CDS open 45746-46174 _na     142_aa CRISPR system Cms protein Csm2
2303 CAJPOR010000010.1 GCA905372395_01168 CDS open 46174-46869 _na     231_aa csm3 type III-A CRISPR-associated RAMP protein Csm3
2304 CAJPOR010000010.1 GCA905372395_01169 CDS open 46869-47873 _na     334_aa csm4 type III-A CRISPR-associated RAMP protein Csm4
2305 CAJPOR010000010.1 GCA905372395_01170 CDS open 47870-49084 _na     404_aa csm5 type III-A CRISPR-associated RAMP protein Csm5
2306 CAJPOR010000010.1 GCA905372395_01171 CDS open 49087-49842 _na     251_aa Putative CRISPR-associated endoribonuclease Cas6
2307 CAJPOR010000010.1 GCA905372395_01172 CDS open 49849-51189 _na     446_aa csm6 type III-A CRISPR-associated CARF protein Csm6
2308 CAJPOR010000010.1 GCA905372395_01173 CDS open 51323-52660 _na     445_aa Alkaline phosphatase
2309 CAJPOR010000010.1 GCA905372395_01174 CDS open 53043-54029 _na     328_aa Tryptophan--tRNA ligase
2310 CAJPOR010000010.1 GCA905372395_01175 CDS open 54041-54619 _na     192_aa yfbR 5'-deoxynucleotidase
2311 CAJPOR010000010.1 GCA905372395_01176 CDS open 54747-56048 _na     433_aa Nodulation efficiency protein D
2312 CAJPOR010000010.1 GCA905372395_01177 CDS open 56069-57094 _na     341_aa floA flotillin-like protein FloA
2313 CAJPOR010000010.1 GCA905372395_01178 CDS open 57103-57501 _na     132_aa Secreted protein
2314 CAJPOR010000010.1 GCA905372395_01179 CDS open 57502-58227 _na     241_aa Phospholipase/carboxylesterase
2315 CAJPOR010000010.1 GCA905372395_01115 gene open 15-1202 tuf
2316 CAJPOR010000010.1 GCA905372395_01116 gene open 1572-1883 rpsJ
2317 CAJPOR010000010.1 GCA905372395_01117 gene open 1898-2536 rplC
2318 CAJPOR010000010.1 GCA905372395_01118 gene open 2567-3190 rplD
2319 CAJPOR010000010.1 GCA905372395_01119 gene open 3190-3474 rplW
2320 CAJPOR010000010.1 GCA905372395_01120 gene open 3507-4334 rplB
2321 CAJPOR010000010.1 GCA905372395_01121 gene open 4356-4631 rpsS
2322 CAJPOR010000010.1 GCA905372395_01122 gene open 4647-4982 rplV
2323 CAJPOR010000010.1 GCA905372395_01123 gene open 4996-5667 rpsC
2324 CAJPOR010000010.1 GCA905372395_01124 gene open 5667-6104 rplP
2325 CAJPOR010000010.1 GCA905372395_01125 gene open 6094-6288 rpmC
2326 CAJPOR010000010.1 GCA905372395_01126 gene open 6329-6583 rpsQ
2327 CAJPOR010000010.1 GCA905372395_01127 gene open 6610-6978 rplN
2328 CAJPOR010000010.1 GCA905372395_01128 gene open 6998-7315 rplX
2329 CAJPOR010000010.1 GCA905372395_01129 gene open 7337-7882 rplE
2330 CAJPOR010000010.1 GCA905372395_01130 gene open 7897-8166 rpsN
2331 CAJPOR010000010.1 GCA905372395_01131 gene open 8194-8586 rpsH
2332 CAJPOR010000010.1 GCA905372395_01132 gene open 8603-9145 rplF
2333 CAJPOR010000010.1 GCA905372395_01133 gene open 9178-9537 rplR
2334 CAJPOR010000010.1 GCA905372395_01134 gene open 9556-10056 rpsE
2335 CAJPOR010000010.1 GCA905372395_01135 gene open 10074-10253 rpmD
2336 CAJPOR010000010.1 GCA905372395_01136 gene open 10274-10714 rplO
2337 CAJPOR010000010.1 GCA905372395_01137 gene open 10716-11978 secY
2338 CAJPOR010000010.1 GCA905372395_01138 gene open 11994-12644
2339 CAJPOR010000010.1 GCA905372395_01139 gene open 12647-13396 map
2340 CAJPOR010000010.1 GCA905372395_01140 gene open 13396-13665
2341 CAJPOR010000010.1 GCA905372395_01141 gene open 13669-13887 infA
2342 CAJPOR010000010.1 GCA905372395_01142 gene open 13907-14020 rpmJ
2343 CAJPOR010000010.1 GCA905372395_01143 gene open 14043-14411 rpsM
2344 CAJPOR010000010.1 GCA905372395_01144 gene open 14439-14831 rpsK
2345 CAJPOR010000010.1 GCA905372395_01145 gene open 14885-15871
2346 CAJPOR010000010.1 GCA905372395_01146 gene open 15888-16226 rplQ
2347 CAJPOR010000010.1 GCA905372395_01147 gene open 16316-16744
2348 CAJPOR010000010.1 GCA905372395_01148 gene open 16757-17230
2349 CAJPOR010000010.1 GCA905372395_01149 gene open 17281-18762
2350 CAJPOR010000010.1 GCA905372395_01150 gene open 18798-19343
2351 CAJPOR010000010.1 GCA905372395_01151 gene open 19586-20104
2352 CAJPOR010000010.1 GCA905372395_01152 gene open 20222-22585 mutS2
2353 CAJPOR010000010.1 GCA905372395_01153 gene open 22607-23182
2354 CAJPOR010000010.1 GCA905372395_01154 gene open 23347-24069
2355 CAJPOR010000010.1 GCA905372395_01155 gene open 24473-25888
2356 CAJPOR010000010.1 GCA905372395_01156 gene open 26042-27784
2357 CAJPOR010000010.1 GCA905372395_01157 gene open 28112-30907 ileS
2358 CAJPOR010000010.1 GCA905372395_01158 gene open 31003-32508
2359 CAJPOR010000010.1 GCA905372395_01159 gene open 32501-33235
2360 CAJPOR010000010.1 GCA905372395_01160 gene open 33470-33937 marR
2361 CAJPOR010000010.1 GCA905372395_01161 gene open 34086-34286
2362 CAJPOR010000010.1 GCA905372395_01162 gene open 38169-39914
2363 CAJPOR010000010.1 GCA905372395_01163 gene open 39911-41653
2364 CAJPOR010000010.1 GCA905372395_01164 gene open 41945-42934 cas1
2365 CAJPOR010000010.1 GCA905372395_01165 gene open 42942-43244 cas2
2366 CAJPOR010000010.1 GCA905372395_01166 gene open 43278-45728 cas10
2367 CAJPOR010000010.1 GCA905372395_01167 gene open 45746-46174
2368 CAJPOR010000010.1 GCA905372395_01168 gene open 46174-46869 csm3
2369 CAJPOR010000010.1 GCA905372395_01169 gene open 46869-47873 csm4
2370 CAJPOR010000010.1 GCA905372395_01170 gene open 47870-49084 csm5
2371 CAJPOR010000010.1 GCA905372395_01171 gene open 49087-49842
2372 CAJPOR010000010.1 GCA905372395_01172 gene open 49849-51189 csm6
2373 CAJPOR010000010.1 GCA905372395_01173 gene open 51323-52660
2374 CAJPOR010000010.1 GCA905372395_01174 gene open 53043-54029
2375 CAJPOR010000010.1 GCA905372395_01175 gene open 54041-54619 yfbR
2376 CAJPOR010000010.1 GCA905372395_01176 gene open 54747-56048
2377 CAJPOR010000010.1 GCA905372395_01177 gene open 56069-57094 floA
2378 CAJPOR010000010.1 GCA905372395_01178 gene open 57103-57501
2379 CAJPOR010000010.1 GCA905372395_01179 gene open 57502-58227
2380 CAJPOR010000011.1 regulatory_region open 32303-32394 Glycine riboswitch aptamer
2381 CAJPOR010000011.1 GCA905372395_01184 CDS open 501-944 _na     147_aa hypothetical protein
2382 CAJPOR010000011.1 GCA905372395_01185 CDS open 1024-2418 _na     464_aa 4Fe-4S ferredoxin-type domain-containing protein
2383 CAJPOR010000011.1 GCA905372395_01186 CDS open 2724-3593 _na     289_aa Tat pathway signal sequence domain protein
2384 CAJPOR010000011.1 GCA905372395_01187 CDS open 3583-4359 _na     258_aa 4Fe-4S binding domain protein
2385 CAJPOR010000011.1 GCA905372395_01188 CDS open 4343-5176 _na     277_aa nifB Putative nitrogenase cofactor biosynthesis protein NifB
2386 CAJPOR010000011.1 GCA905372395_01189 CDS open 5218-6366 _na     382_aa cysteine desulfurase
2387 CAJPOR010000011.1 GCA905372395_01190 CDS open 6533-7594 _na     353_aa yedE YedE family putative selenium transporter
2388 CAJPOR010000011.1 GCA905372395_01191 CDS open 7610-7813 _na     67_aa UPF0033 domain-containing protein
2389 CAJPOR010000011.1 GCA905372395_01192 CDS open 7835-8077 _na     80_aa Putative Se/S carrier protein-like domain-containing protein
2390 CAJPOR010000011.1 GCA905372395_01193 CDS open 8171-9127 _na     318_aa selD selenide%2C water dikinase SelD
2391 CAJPOR010000011.1 GCA905372395_01194 CDS open 9447-10739 _na     430_aa purB adenylosuccinate lyase
2392 CAJPOR010000011.1 GCA905372395_01195 CDS open 10805-11944 _na     379_aa Cysteine desulfurase family protein
2393 CAJPOR010000011.1 GCA905372395_01196 CDS open 11966-12928 _na     320_aa C4-dicarboxylate transporter/malic acid transport protein
2394 CAJPOR010000011.1 GCA905372395_01197 CDS open 12980-14197 _na     405_aa Efflux ABC transporter%2C permease protein
2395 CAJPOR010000011.1 GCA905372395_01198 CDS open 14187-14894 _na     235_aa ABC transporter%2C ATP-binding protein
2396 CAJPOR010000011.1 GCA905372395_01199 CDS open 14909-16039 _na     376_aa Efflux transporter periplasmic adaptor subunit
2397 CAJPOR010000011.1 GCA905372395_01200 CDS open 16386-17543 _na     385_aa cytX Putative hydroxymethylpyrimidine transporter CytX
2398 CAJPOR010000011.1 GCA905372395_01201 CDS open 17589-19631 _na     680_aa peptidoglycan glycosyltransferase
2399 CAJPOR010000011.1 GCA905372395_01202 CDS open 19957-22350 _na     797_aa ppsA phosphoenolpyruvate synthase
2400 CAJPOR010000011.1 GCA905372395_01203 CDS open 22502-23143 _na     213_aa ccpN Putative transcriptional repressor CcpN
2401 CAJPOR010000011.1 GCA905372395_01204 CDS open 23144-23965 _na     273_aa Putative pyruvate%2C phosphate dikinase regulatory protein
2402 CAJPOR010000011.1 GCA905372395_01205 CDS open 24066-24257 _na     63_aa rpmB 50S ribosomal protein L28
2403 CAJPOR010000011.1 GCA905372395_01206 CDS open 24435-26468 _na     677_aa recG ATP-dependent DNA helicase RecG
2404 CAJPOR010000011.1 GCA905372395_01207 CDS open 26578-28035 _na     485_aa guaB IMP dehydrogenase
2405 CAJPOR010000011.1 GCA905372395_01208 CDS open 28052-28780 _na     242_aa N-acetylglucosaminyldiphosphoundecaprenol N-acetyl-beta-D-mannosaminyltransferase
2406 CAJPOR010000011.1 GCA905372395_01209 CDS open 28796-29434 _na     212_aa phosphatidylserine decarboxylase
2407 CAJPOR010000011.1 GCA905372395_01210 CDS open 29431-30099 _na     222_aa CDP-diacylglycerol-serine O-phosphatidyltransferase
2408 CAJPOR010000011.1 GCA905372395_01211 CDS open 30114-31367 _na     417_aa Glycosyltransferase%2C group 2 family protein
2409 CAJPOR010000011.1 GCA905372395_01212 CDS open 31377-32147 _na     256_aa surE 5'/3'-nucleotidase SurE
2410 CAJPOR010000011.1 GCA905372395_01213 CDS open 32501-33883 _na     460_aa Amino acid carrier protein
2411 CAJPOR010000011.1 GCA905372395_01215 CDS open 34305-34736 _na     143_aa twin-arginine translocase TatA/TatE family subunit
2412 CAJPOR010000011.1 GCA905372395_01216 CDS open 34726-35433 _na     235_aa tatC Sec-independent protein translocase protein TatC
2413 CAJPOR010000011.1 GCA905372395_01217 CDS open 35568-39002 _na     1144_aa pyruvate carboxylase
2414 CAJPOR010000011.1 GCA905372395_01218 CDS open 39073-40575 _na     500_aa Transporter%2C major facilitator family protein
2415 CAJPOR010000011.1 GCA905372395_01219 CDS open 40613-41563 _na     316_aa LD-carboxypeptidase
2416 CAJPOR010000011.1 GCA905372395_01220 CDS open 41630-42295 _na     221_aa UPF0173 metal-dependent hydrolase PAGU1578_16780
2417 CAJPOR010000011.1 GCA905372395_01221 CDS open 42427-46731 _na     1434_aa CoA-substrate-specific enzyme activase
2418 CAJPOR010000011.1 GCA905372395_01222 CDS open 46955-47803 _na     282_aa speE polyamine aminopropyltransferase
2419 CAJPOR010000011.1 GCA905372395_01226 CDS open 48221-49663 _na     480_aa Tat pathway signal sequence domain protein
2420 CAJPOR010000011.1 GCA905372395_01227 CDS open 49862-50308 _na     148_aa Universal stress protein
2421 CAJPOR010000011.1 GCA905372395_01184 gene open 501-944
2422 CAJPOR010000011.1 GCA905372395_01185 gene open 1024-2418
2423 CAJPOR010000011.1 GCA905372395_01186 gene open 2724-3593
2424 CAJPOR010000011.1 GCA905372395_01187 gene open 3583-4359
2425 CAJPOR010000011.1 GCA905372395_01188 gene open 4343-5176 nifB
2426 CAJPOR010000011.1 GCA905372395_01189 gene open 5218-6366
2427 CAJPOR010000011.1 GCA905372395_01190 gene open 6533-7594 yedE
2428 CAJPOR010000011.1 GCA905372395_01191 gene open 7610-7813
2429 CAJPOR010000011.1 GCA905372395_01192 gene open 7835-8077
2430 CAJPOR010000011.1 GCA905372395_01193 gene open 8171-9127 selD
2431 CAJPOR010000011.1 GCA905372395_01194 gene open 9447-10739 purB
2432 CAJPOR010000011.1 GCA905372395_01195 gene open 10805-11944
2433 CAJPOR010000011.1 GCA905372395_01196 gene open 11966-12928
2434 CAJPOR010000011.1 GCA905372395_01197 gene open 12980-14197
2435 CAJPOR010000011.1 GCA905372395_01198 gene open 14187-14894
2436 CAJPOR010000011.1 GCA905372395_01199 gene open 14909-16039
2437 CAJPOR010000011.1 GCA905372395_01200 gene open 16386-17543 cytX
2438 CAJPOR010000011.1 GCA905372395_01201 gene open 17589-19631
2439 CAJPOR010000011.1 GCA905372395_01202 gene open 19957-22350 ppsA
2440 CAJPOR010000011.1 GCA905372395_01203 gene open 22502-23143 ccpN
2441 CAJPOR010000011.1 GCA905372395_01204 gene open 23144-23965
2442 CAJPOR010000011.1 GCA905372395_01205 gene open 24066-24257 rpmB
2443 CAJPOR010000011.1 GCA905372395_01206 gene open 24435-26468 recG
2444 CAJPOR010000011.1 GCA905372395_01207 gene open 26578-28035 guaB
2445 CAJPOR010000011.1 GCA905372395_01208 gene open 28052-28780
2446 CAJPOR010000011.1 GCA905372395_01209 gene open 28796-29434
2447 CAJPOR010000011.1 GCA905372395_01210 gene open 29431-30099
2448 CAJPOR010000011.1 GCA905372395_01211 gene open 30114-31367
2449 CAJPOR010000011.1 GCA905372395_01212 gene open 31377-32147 surE
2450 CAJPOR010000011.1 GCA905372395_01213 gene open 32501-33883
2451 CAJPOR010000011.1 GCA905372395_01215 gene open 34305-34736
2452 CAJPOR010000011.1 GCA905372395_01216 gene open 34726-35433 tatC
2453 CAJPOR010000011.1 GCA905372395_01217 gene open 35568-39002
2454 CAJPOR010000011.1 GCA905372395_01218 gene open 39073-40575
2455 CAJPOR010000011.1 GCA905372395_01219 gene open 40613-41563
2456 CAJPOR010000011.1 GCA905372395_01220 gene open 41630-42295
2457 CAJPOR010000011.1 GCA905372395_01221 gene open 42427-46731
2458 CAJPOR010000011.1 GCA905372395_01222 gene open 46955-47803 speE
2459 CAJPOR010000011.1 GCA905372395_01226 gene open 48221-49663
2460 CAJPOR010000011.1 GCA905372395_01227 gene open 49862-50308
2461 CAJPOR010000011.1 GCA905372395_01180 gene open 57-130 trnQ
2462 CAJPOR010000011.1 GCA905372395_01181 gene open 141-216 trnK
2463 CAJPOR010000011.1 GCA905372395_01182 gene open 230-304 trnE
2464 CAJPOR010000011.1 GCA905372395_01183 gene open 310-385 trnV
2465 CAJPOR010000011.1 GCA905372395_01214 gene open 34084-34168 trnL
2466 CAJPOR010000011.1 GCA905372395_01223 gene open 47880-47955 trnH
2467 CAJPOR010000011.1 GCA905372395_01224 gene open 47957-48031 trnQ
2468 CAJPOR010000011.1 GCA905372395_01225 gene open 48037-48112 trnK
2469 CAJPOR010000011.1 GCA905372395_01180 tRNA open 57-130 trnQ tRNA-Gln(ctg)
2470 CAJPOR010000011.1 GCA905372395_01181 tRNA open 141-216 trnK tRNA-Lys(ttt)
2471 CAJPOR010000011.1 GCA905372395_01182 tRNA open 230-304 trnE tRNA-Glu(ttc)
2472 CAJPOR010000011.1 GCA905372395_01183 tRNA open 310-385 trnV tRNA-Val(tac)
2473 CAJPOR010000011.1 GCA905372395_01214 tRNA open 34084-34168 trnL tRNA-Leu(caa)
2474 CAJPOR010000011.1 GCA905372395_01223 tRNA open 47880-47955 trnH tRNA-His(gtg)
2475 CAJPOR010000011.1 GCA905372395_01224 tRNA open 47957-48031 trnQ tRNA-Gln(ttg)
2476 CAJPOR010000011.1 GCA905372395_01225 tRNA open 48037-48112 trnK tRNA-Lys(ttt)
2477 CAJPOR010000012.1 GCA905372395_01231 CDS open 613-1527 _na     304_aa Pyridine nucleotide-disulfide oxidoreductase
2478 CAJPOR010000012.1 GCA905372395_01232 CDS open 1771-3606 _na     611_aa Arylsulfatase
2479 CAJPOR010000012.1 GCA905372395_01233 CDS open 3715-4068 _na     117_aa Cupin domain protein
2480 CAJPOR010000012.1 GCA905372395_01234 CDS open 4691-5935 _na     414_aa prdA D-proline reductase%2C PrdA proprotein
2481 CAJPOR010000012.1 GCA905372395_01235 CDS open 6019-6744 _na     241_aa prdB D-proline reductase (dithiol) protein PrdB
2482 CAJPOR010000012.1 GCA905372395_01236 CDS open 6777-7205 _na     142_aa sipL SipL SPOCS domain-containing protein
2483 CAJPOR010000012.1 GCA905372395_01237 CDS open 7205-8980 _na     591_aa prdA D-proline reductase (dithiol) proprotein PrdA
2484 CAJPOR010000012.1 GCA905372395_01238 CDS open 9040-10332 _na     430_aa prdC proline reductase-associated electron transfer protein PrdC
2485 CAJPOR010000012.1 GCA905372395_01239 CDS open 10625-12079 _na     484_aa HTH cro/C1-type domain-containing protein
2486 CAJPOR010000012.1 GCA905372395_01240 CDS open 12160-12939 _na     259_aa trpA tryptophan synthase subunit alpha
2487 CAJPOR010000012.1 GCA905372395_01241 CDS open 12932-14116 _na     394_aa trpB tryptophan synthase subunit beta
2488 CAJPOR010000012.1 GCA905372395_01242 CDS open 14128-14721 _na     197_aa N-(5'-phosphoribosyl)anthranilate isomerase
2489 CAJPOR010000012.1 GCA905372395_01243 CDS open 14711-15499 _na     262_aa trpC indole-3-glycerol phosphate synthase TrpC
2490 CAJPOR010000012.1 GCA905372395_01244 CDS open 15512-16525 _na     337_aa Anthranilate phosphoribosyltransferase
2491 CAJPOR010000012.1 GCA905372395_01245 CDS open 16550-17116 _na     188_aa Aminodeoxychorismate/anthranilate synthase component 2
2492 CAJPOR010000012.1 GCA905372395_01246 CDS open 17116-18573 _na     485_aa Anthranilate synthase component 1
2493 CAJPOR010000012.1 GCA905372395_01247 CDS open 19112-20200 _na     362_aa Peptidase%2C M48 family
2494 CAJPOR010000012.1 GCA905372395_01248 CDS open 20227-21078 _na     283_aa HTH OST-type domain-containing protein
2495 CAJPOR010000012.1 GCA905372395_01249 CDS open 21206-21643 _na     145_aa Ferritin-like protein
2496 CAJPOR010000012.1 GCA905372395_01250 CDS open 21794-22093 _na     99_aa HTH hxlR-type domain-containing protein
2497 CAJPOR010000012.1 GCA905372395_01251 CDS open 22159-25140 _na     993_aa yhaN putative protein YhaN AAA domain-containing protein
2498 CAJPOR010000012.1 GCA905372395_01252 CDS open 25137-26411 _na     424_aa Ser/Thr phosphatase family protein
2499 CAJPOR010000012.1 GCA905372395_01253 CDS open 26404-27807 _na     467_aa gntR Transcriptional regulator%2C GntR family
2500 CAJPOR010000012.1 GCA905372395_01254 CDS open 27996-28997 _na     333_aa bioB biotin synthase BioB