HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Capnocytophaga leadbetteri (GCA_905372535.1)

Select a Genome:
BAKTA Annotations for GCA_905372535.1
Genome Selected: Capnocytophaga leadbetteri
ContigsBases CDSrRNA tmRNAtRNA
157 2591175 2367 0 1 35
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4820 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:9]    |    Number of Records Found: 4820 [10 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
4001 CAJPPO010000083.1 GCA905372535_02001 CDS open 6791-7069 _na     92_aa Co-chaperonin GroES
4002 CAJPPO010000083.1 GCA905372535_02002 CDS open 7316-7678 _na     120_aa secG preprotein translocase subunit SecG
4003 CAJPPO010000083.1 GCA905372535_02003 CDS open 7682-8599 _na     305_aa Tetratricopeptide repeat protein
4004 CAJPPO010000083.1 GCA905372535_02004 CDS open 8613-9104 _na     163_aa Lipopolysaccharide-assembly
4005 CAJPPO010000083.1 GCA905372535_02005 CDS open 9191-10336 _na     381_aa Carboxypeptidase-like regulatory domain-containing protein
4006 CAJPPO010000083.1 GCA905372535_01996 gene open 114-872 yaaA
4007 CAJPPO010000083.1 GCA905372535_01997 gene open 1108-1899
4008 CAJPPO010000083.1 GCA905372535_01998 gene open 1964-4363 pbpC
4009 CAJPPO010000083.1 GCA905372535_01999 gene open 4446-5027 ruvA
4010 CAJPPO010000083.1 GCA905372535_02000 gene open 5116-6750 groL
4011 CAJPPO010000083.1 GCA905372535_02001 gene open 6791-7069
4012 CAJPPO010000083.1 GCA905372535_02002 gene open 7316-7678 secG
4013 CAJPPO010000083.1 GCA905372535_02003 gene open 7682-8599
4014 CAJPPO010000083.1 GCA905372535_02004 gene open 8613-9104
4015 CAJPPO010000083.1 GCA905372535_02005 gene open 9191-10336
4016 CAJPPO010000084.1 GCA905372535_02006 CDS open 21-239 _na     72_aa Type IX secretion system membrane protein PorP/SprF
4017 CAJPPO010000084.1 GCA905372535_02007 CDS open 307-2253 _na     648_aa ompA OmpA family protein
4018 CAJPPO010000084.1 GCA905372535_02008 CDS open 2367-4349 _na     660_aa ompA OmpA family protein
4019 CAJPPO010000084.1 GCA905372535_02009 CDS open 4430-5779 _na     449_aa murC UDP-N-acetylmuramate--L-alanine ligase
4020 CAJPPO010000084.1 GCA905372535_02010 CDS open 5776-6621 _na     281_aa ywqK Toxin-antitoxin system YwqK family antitoxin
4021 CAJPPO010000084.1 GCA905372535_02011 CDS open 6634-7710 _na     358_aa murG undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase
4022 CAJPPO010000084.1 GCA905372535_02012 CDS open 7717-8964 _na     415_aa Calcineurin-like phosphoesterase domain-containing protein
4023 CAJPPO010000084.1 GCA905372535_02013 CDS open 9005-9718 _na     237_aa cutC PF03932 family protein CutC
4024 CAJPPO010000084.1 GCA905372535_02006 gene open 21-239
4025 CAJPPO010000084.1 GCA905372535_02007 gene open 307-2253 ompA
4026 CAJPPO010000084.1 GCA905372535_02008 gene open 2367-4349 ompA
4027 CAJPPO010000084.1 GCA905372535_02009 gene open 4430-5779 murC
4028 CAJPPO010000084.1 GCA905372535_02010 gene open 5776-6621 ywqK
4029 CAJPPO010000084.1 GCA905372535_02011 gene open 6634-7710 murG
4030 CAJPPO010000084.1 GCA905372535_02012 gene open 7717-8964
4031 CAJPPO010000084.1 GCA905372535_02013 gene open 9005-9718 cutC
4032 CAJPPO010000085.1 GCA905372535_02014 CDS open 16-486 _na     156_aa hypothetical protein
4033 CAJPPO010000085.1 GCA905372535_02015 CDS open 514-942 _na     142_aa IraD/Gp25-like domain-containing protein
4034 CAJPPO010000085.1 GCA905372535_02016 CDS open 957-2789 _na     610_aa tssF Type VI secretion system baseplate subunit TssF
4035 CAJPPO010000085.1 GCA905372535_02017 CDS open 3072-3524 _na     150_aa Type VI secretion protein%2C VC_A0107 family
4036 CAJPPO010000085.1 GCA905372535_02018 CDS open 3553-4914 _na     453_aa tssC Type VI secretion system contractile sheath protein TssC
4037 CAJPPO010000085.1 GCA905372535_02019 CDS open 5074-5460 _na     128_aa Phage tail protein
4038 CAJPPO010000085.1 GCA905372535_02020 CDS open 5511-5897 _na     128_aa Phage tail protein
4039 CAJPPO010000085.1 GCA905372535_02021 CDS open 5997-6386 _na     129_aa Phage tail protein
4040 CAJPPO010000085.1 GCA905372535_02022 CDS open 6432-8279 _na     615_aa type VI secretion system Vgr family protein
4041 CAJPPO010000085.1 GCA905372535_02023 CDS open 8282-9943 _na     553_aa DUF2235 domain-containing protein
4042 CAJPPO010000085.1 GCA905372535_02014 gene open 16-486
4043 CAJPPO010000085.1 GCA905372535_02015 gene open 514-942
4044 CAJPPO010000085.1 GCA905372535_02016 gene open 957-2789 tssF
4045 CAJPPO010000085.1 GCA905372535_02017 gene open 3072-3524
4046 CAJPPO010000085.1 GCA905372535_02018 gene open 3553-4914 tssC
4047 CAJPPO010000085.1 GCA905372535_02019 gene open 5074-5460
4048 CAJPPO010000085.1 GCA905372535_02020 gene open 5511-5897
4049 CAJPPO010000085.1 GCA905372535_02021 gene open 5997-6386
4050 CAJPPO010000085.1 GCA905372535_02022 gene open 6432-8279
4051 CAJPPO010000085.1 GCA905372535_02023 gene open 8282-9943
4052 CAJPPO010000086.1 GCA905372535_02024 CDS open 385-1317 _na     310_aa Beta-ketoacyl synthase
4053 CAJPPO010000086.1 GCA905372535_02025 CDS open 1314-1502 _na     62_aa hypothetical protein
4054 CAJPPO010000086.1 GCA905372535_02026 CDS open 1525-3387 _na     620_aa abc-f ribosomal protection-like ABC-F family protein
4055 CAJPPO010000086.1 GCA905372535_02027 CDS open 3472-4590 _na     372_aa Arginase
4056 CAJPPO010000086.1 GCA905372535_02028 CDS open 4699-4956 _na     85_aa glutaredoxin-2 domain protein
4057 CAJPPO010000086.1 GCA905372535_02029 CDS open 4959-5426 _na     155_aa PIN domain-containing protein
4058 CAJPPO010000086.1 GCA905372535_02030 CDS open 5423-6361 _na     312_aa Glycerate dehydrogenase
4059 CAJPPO010000086.1 GCA905372535_02031 CDS open 6424-7242 _na     272_aa 5'-nucleotidase%2C lipoprotein e(P4) family
4060 CAJPPO010000086.1 GCA905372535_02032 CDS open 7386-8198 _na     270_aa Ser/Thr phosphatase family protein
4061 CAJPPO010000086.1 GCA905372535_02033 CDS open 8366-9721 _na     451_aa DUF262 domain-containing protein
4062 CAJPPO010000086.1 GCA905372535_02024 gene open 385-1317
4063 CAJPPO010000086.1 GCA905372535_02025 gene open 1314-1502
4064 CAJPPO010000086.1 GCA905372535_02026 gene open 1525-3387 abc-f
4065 CAJPPO010000086.1 GCA905372535_02027 gene open 3472-4590
4066 CAJPPO010000086.1 GCA905372535_02028 gene open 4699-4956
4067 CAJPPO010000086.1 GCA905372535_02029 gene open 4959-5426
4068 CAJPPO010000086.1 GCA905372535_02030 gene open 5423-6361
4069 CAJPPO010000086.1 GCA905372535_02031 gene open 6424-7242
4070 CAJPPO010000086.1 GCA905372535_02032 gene open 7386-8198
4071 CAJPPO010000086.1 GCA905372535_02033 gene open 8366-9721
4072 CAJPPO010000087.1 GCA905372535_02034 CDS open 55-411 _na     118_aa hypothetical protein
4073 CAJPPO010000087.1 GCA905372535_02035 CDS open 425-1378 _na     317_aa Glycosyltransferase 2-like domain-containing protein
4074 CAJPPO010000087.1 GCA905372535_02036 CDS open 1375-1830 _na     151_aa Restriction endonuclease subunit R
4075 CAJPPO010000087.1 GCA905372535_02037 CDS open 1868-2881 _na     337_aa holA DNA polymerase III subunit delta
4076 CAJPPO010000087.1 GCA905372535_02038 CDS open 3064-3879 _na     271_aa 2%2C3%2C4%2C5-tetrahydropyridine-2%2C6-dicarboxylate N-succinyltransferase
4077 CAJPPO010000087.1 GCA905372535_02039 CDS open 3886-6510 _na     874_aa valine--tRNA ligase
4078 CAJPPO010000087.1 GCA905372535_02040 CDS open 6549-7106 _na     185_aa Acetyltransferase%2C GNAT family
4079 CAJPPO010000087.1 GCA905372535_02041 CDS open 7090-7272 _na     60_aa Toxin-antitoxin system%2C antitoxin component%2C ribbon-helix-helix domain protein
4080 CAJPPO010000087.1 GCA905372535_02042 CDS open 7378-7851 _na     157_aa CYTH domain-containing protein
4081 CAJPPO010000087.1 GCA905372535_02043 CDS open 8079-8801 _na     240_aa Lipoprotein
4082 CAJPPO010000087.1 GCA905372535_02034 gene open 55-411
4083 CAJPPO010000087.1 GCA905372535_02035 gene open 425-1378
4084 CAJPPO010000087.1 GCA905372535_02036 gene open 1375-1830
4085 CAJPPO010000087.1 GCA905372535_02037 gene open 1868-2881 holA
4086 CAJPPO010000087.1 GCA905372535_02038 gene open 3064-3879
4087 CAJPPO010000087.1 GCA905372535_02039 gene open 3886-6510
4088 CAJPPO010000087.1 GCA905372535_02040 gene open 6549-7106
4089 CAJPPO010000087.1 GCA905372535_02041 gene open 7090-7272
4090 CAJPPO010000087.1 GCA905372535_02042 gene open 7378-7851
4091 CAJPPO010000087.1 GCA905372535_02043 gene open 8079-8801
4092 CAJPPO010000088.1 GCA905372535_02044 CDS open 112-1050 _na     312_aa YD repeat-containing protein
4093 CAJPPO010000088.1 GCA905372535_02045 CDS open 1169-1390 _na     73_aa DNA-damage-inducible protein J
4094 CAJPPO010000088.1 GCA905372535_02046 CDS open 1695-2927 _na     410_aa ATPase
4095 CAJPPO010000088.1 GCA905372535_02047 CDS open 2924-3556 _na     210_aa HNH domain-containing protein
4096 CAJPPO010000088.1 GCA905372535_02048 CDS open 3544-4695 _na     383_aa UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase
4097 CAJPPO010000088.1 GCA905372535_02049 CDS open 4712-6976 _na     754_aa Malate dehydrogenase (Oxaloacetate-decarboxylating) (NADP(+))
4098 CAJPPO010000088.1 GCA905372535_02050 CDS open 7010-7978 _na     322_aa Glycosidase
4099 CAJPPO010000088.1 GCA905372535_02051 CDS open 8070-9362 _na     430_aa Fic family protein
4100 CAJPPO010000088.1 GCA905372535_02044 gene open 112-1050
4101 CAJPPO010000088.1 GCA905372535_02045 gene open 1169-1390
4102 CAJPPO010000088.1 GCA905372535_02046 gene open 1695-2927
4103 CAJPPO010000088.1 GCA905372535_02047 gene open 2924-3556
4104 CAJPPO010000088.1 GCA905372535_02048 gene open 3544-4695
4105 CAJPPO010000088.1 GCA905372535_02049 gene open 4712-6976
4106 CAJPPO010000088.1 GCA905372535_02050 gene open 7010-7978
4107 CAJPPO010000088.1 GCA905372535_02051 gene open 8070-9362
4108 CAJPPO010000089.1 repeat_region open 2931-4049 CRISPR array with 15 repeats of length 44%2C consensus sequence GTTGTGAATTGCTTTCAAATTTTGTAGTTTTGTGATTGATAACA and spacer length 32
4109 CAJPPO010000089.1 GCA905372535_02052 CDS open 141-467 _na     108_aa Gas vesicle protein
4110 CAJPPO010000089.1 GCA905372535_02053 CDS open 472-846 _na     124_aa Holin-X%2C holin superfamily III
4111 CAJPPO010000089.1 GCA905372535_02054 CDS open 830-1084 _na     84_aa DUF6327 domain-containing protein
4112 CAJPPO010000089.1 GCA905372535_02055 CDS open 1225-1611 _na     128_aa Lipocalin-like domain-containing protein
4113 CAJPPO010000089.1 GCA905372535_02056 CDS open 1690-1941 _na     83_aa Transglycosylase-associated protein
4114 CAJPPO010000089.1 GCA905372535_02057 CDS open 2362-2799 _na     145_aa Polymerase
4115 CAJPPO010000089.1 GCA905372535_02058 CDS open 4513-8820 _na     1435_aa cas9 type II CRISPR RNA-guided endonuclease Cas9
4116 CAJPPO010000089.1 GCA905372535_02059 CDS open 9002-9454 _na     150_aa dtd D-aminoacyl-tRNA deacylase
4117 CAJPPO010000089.1 GCA905372535_02052 gene open 141-467
4118 CAJPPO010000089.1 GCA905372535_02053 gene open 472-846
4119 CAJPPO010000089.1 GCA905372535_02054 gene open 830-1084
4120 CAJPPO010000089.1 GCA905372535_02055 gene open 1225-1611
4121 CAJPPO010000089.1 GCA905372535_02056 gene open 1690-1941
4122 CAJPPO010000089.1 GCA905372535_02057 gene open 2362-2799
4123 CAJPPO010000089.1 GCA905372535_02058 gene open 4513-8820 cas9
4124 CAJPPO010000089.1 GCA905372535_02059 gene open 9002-9454 dtd
4125 CAJPPO010000090.1 GCA905372535_02060 CDS open 306-2393 _na     695_aa Sulfatase-like hydrolase/transferase
4126 CAJPPO010000090.1 GCA905372535_02061 CDS open 2377-3594 _na     405_aa HD/PDEase domain-containing protein
4127 CAJPPO010000090.1 GCA905372535_02062 CDS open 3750-4769 _na     339_aa lpxD UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase
4128 CAJPPO010000090.1 GCA905372535_02063 CDS open 4779-6167 _na     462_aa bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase
4129 CAJPPO010000090.1 GCA905372535_02064 CDS open 6174-6962 _na     262_aa lpxA acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase
4130 CAJPPO010000090.1 GCA905372535_02065 CDS open 6996-7562 _na     188_aa efp elongation factor P
4131 CAJPPO010000090.1 GCA905372535_02066 CDS open 7665-8582 _na     305_aa lpxD UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase
4132 CAJPPO010000090.1 GCA905372535_02067 CDS open 8646-9329 _na     227_aa Cell division transport system ATP-binding protein
4133 CAJPPO010000090.1 GCA905372535_02060 gene open 306-2393
4134 CAJPPO010000090.1 GCA905372535_02061 gene open 2377-3594
4135 CAJPPO010000090.1 GCA905372535_02062 gene open 3750-4769 lpxD
4136 CAJPPO010000090.1 GCA905372535_02063 gene open 4779-6167
4137 CAJPPO010000090.1 GCA905372535_02064 gene open 6174-6962 lpxA
4138 CAJPPO010000090.1 GCA905372535_02065 gene open 6996-7562 efp
4139 CAJPPO010000090.1 GCA905372535_02066 gene open 7665-8582 lpxD
4140 CAJPPO010000090.1 GCA905372535_02067 gene open 8646-9329
4141 CAJPPO010000091.1 GCA905372535_02068 CDS open 57-968 _na     303_aa hypothetical protein
4142 CAJPPO010000091.1 GCA905372535_02069 CDS open 1102-2664 _na     520_aa Lipoprotein
4143 CAJPPO010000091.1 GCA905372535_02070 CDS open 2661-3257 _na     198_aa Outer membrane beta-barrel protein
4144 CAJPPO010000091.1 GCA905372535_02071 CDS open 3452-4048 _na     198_aa hypothetical protein
4145 CAJPPO010000091.1 GCA905372535_02072 CDS open 4055-4534 _na     159_aa recX Regulatory protein RecX
4146 CAJPPO010000091.1 GCA905372535_02073 CDS open 4524-6188 _na     554_aa DUF6909 domain-containing protein
4147 CAJPPO010000091.1 GCA905372535_02074 CDS open 6269-6508 _na     79_aa Toxin-antitoxin system%2C antitoxin component
4148 CAJPPO010000091.1 GCA905372535_02075 CDS open 6498-6788 _na     96_aa Type II toxin-antitoxin system RelE/ParE family toxin
4149 CAJPPO010000091.1 GCA905372535_02076 CDS open 6845-7363 _na     172_aa Methyltransferase
4150 CAJPPO010000091.1 GCA905372535_02077 CDS open 7395-8561 _na     388_aa Carboxypeptidase-like regulatory domain-containing protein
4151 CAJPPO010000091.1 GCA905372535_02068 gene open 57-968
4152 CAJPPO010000091.1 GCA905372535_02069 gene open 1102-2664
4153 CAJPPO010000091.1 GCA905372535_02070 gene open 2661-3257
4154 CAJPPO010000091.1 GCA905372535_02071 gene open 3452-4048
4155 CAJPPO010000091.1 GCA905372535_02072 gene open 4055-4534 recX
4156 CAJPPO010000091.1 GCA905372535_02073 gene open 4524-6188
4157 CAJPPO010000091.1 GCA905372535_02074 gene open 6269-6508
4158 CAJPPO010000091.1 GCA905372535_02075 gene open 6498-6788
4159 CAJPPO010000091.1 GCA905372535_02076 gene open 6845-7363
4160 CAJPPO010000091.1 GCA905372535_02077 gene open 7395-8561
4161 CAJPPO010000092.1 GCA905372535_02078 CDS open 42-968 _na     308_aa helix-turn-helix transcriptional regulator
4162 CAJPPO010000092.1 GCA905372535_02079 CDS open 1349-2458 _na     369_aa IPT/TIG domain-containing protein
4163 CAJPPO010000092.1 GCA905372535_02080 CDS open 2479-3462 _na     327_aa hypothetical protein
4164 CAJPPO010000092.1 GCA905372535_02081 CDS open 3477-4232 _na     251_aa hypothetical protein
4165 CAJPPO010000092.1 GCA905372535_02082 CDS open 4234-5298 _na     354_aa DUF4236 domain-containing protein
4166 CAJPPO010000092.1 GCA905372535_02083 CDS open 5440-7155 _na     571_aa ATP-dependent endonuclease
4167 CAJPPO010000092.1 GCA905372535_02078 gene open 42-968
4168 CAJPPO010000092.1 GCA905372535_02079 gene open 1349-2458
4169 CAJPPO010000092.1 GCA905372535_02080 gene open 2479-3462
4170 CAJPPO010000092.1 GCA905372535_02081 gene open 3477-4232
4171 CAJPPO010000092.1 GCA905372535_02082 gene open 4234-5298
4172 CAJPPO010000092.1 GCA905372535_02083 gene open 5440-7155
4173 CAJPPO010000093.1 GCA905372535_02084 CDS open 179-694 _na     171_aa rplJ 50S ribosomal protein L10
4174 CAJPPO010000093.1 GCA905372535_02085 CDS open 718-1407 _na     229_aa rplA 50S ribosomal protein L1
4175 CAJPPO010000093.1 GCA905372535_02086 CDS open 1420-1857 _na     145_aa rplK 50S ribosomal protein L11
4176 CAJPPO010000093.1 GCA905372535_02087 CDS open 1925-2476 _na     183_aa nusG transcription termination/antitermination protein NusG
4177 CAJPPO010000093.1 GCA905372535_02088 CDS open 2489-2674 _na     61_aa secE preprotein translocase subunit SecE
4178 CAJPPO010000093.1 GCA905372535_02089 CDS open 2781-4166 _na     461_aa Leucine rich repeat (LRR) protein
4179 CAJPPO010000093.1 GCA905372535_02090 CDS open 4593-6710 _na     705_aa ppiD Periplasmic chaperone PpiD
4180 CAJPPO010000093.1 GCA905372535_02091 CDS open 6830-7096 _na     88_aa Glutaredoxin-2 domain protein
4181 CAJPPO010000093.1 GCA905372535_02092 CDS open 7093-7548 _na     151_aa PIN domain-containing protein
4182 CAJPPO010000093.1 GCA905372535_02093 CDS open 7535-8176 _na     213_aa pdxH pyridoxamine 5'-phosphate oxidase
4183 CAJPPO010000093.1 GCA905372535_02084 gene open 179-694 rplJ
4184 CAJPPO010000093.1 GCA905372535_02085 gene open 718-1407 rplA
4185 CAJPPO010000093.1 GCA905372535_02086 gene open 1420-1857 rplK
4186 CAJPPO010000093.1 GCA905372535_02087 gene open 1925-2476 nusG
4187 CAJPPO010000093.1 GCA905372535_02088 gene open 2489-2674 secE
4188 CAJPPO010000093.1 GCA905372535_02089 gene open 2781-4166
4189 CAJPPO010000093.1 GCA905372535_02090 gene open 4593-6710 ppiD
4190 CAJPPO010000093.1 GCA905372535_02091 gene open 6830-7096
4191 CAJPPO010000093.1 GCA905372535_02092 gene open 7093-7548
4192 CAJPPO010000093.1 GCA905372535_02093 gene open 7535-8176 pdxH
4193 CAJPPO010000094.1 GCA905372535_02094 CDS open 357-476 _na     39_aa hypothetical protein
4194 CAJPPO010000094.1 GCA905372535_02095 CDS open 703-2946 _na     747_aa Arginyl-tRNA synthetase (Arginine--tRNA ligase ArgRS)
4195 CAJPPO010000094.1 GCA905372535_02096 CDS open 3034-4320 _na     428_aa brnQ branched-chain amino acid transport system II carrier protein
4196 CAJPPO010000094.1 GCA905372535_02097 CDS open 4461-5645 _na     394_aa GST C-terminal domain-containing protein
4197 CAJPPO010000094.1 GCA905372535_02098 CDS open 5642-6553 _na     303_aa Polynucleotide kinase
4198 CAJPPO010000094.1 GCA905372535_02099 CDS open 6612-7313 _na     233_aa lipB lipoyl(octanoyl) transferase LipB
4199 CAJPPO010000094.1 GCA905372535_02100 CDS open 7291-8163 _na     290_aa Putative neutral zinc metallopeptidase
4200 CAJPPO010000094.1 GCA905372535_02094 gene open 357-476
4201 CAJPPO010000094.1 GCA905372535_02095 gene open 703-2946
4202 CAJPPO010000094.1 GCA905372535_02096 gene open 3034-4320 brnQ
4203 CAJPPO010000094.1 GCA905372535_02097 gene open 4461-5645
4204 CAJPPO010000094.1 GCA905372535_02098 gene open 5642-6553
4205 CAJPPO010000094.1 GCA905372535_02099 gene open 6612-7313 lipB
4206 CAJPPO010000094.1 GCA905372535_02100 gene open 7291-8163
4207 CAJPPO010000095.1 GCA905372535_02102 CDS open 249-1250 _na     333_aa moxR MoxR family ATPase
4208 CAJPPO010000095.1 GCA905372535_02103 CDS open 1310-1618 _na     102_aa hypothetical protein
4209 CAJPPO010000095.1 GCA905372535_02104 CDS open 1630-2493 _na     287_aa DUF58 domain-containing protein
4210 CAJPPO010000095.1 GCA905372535_02105 CDS open 2519-4153 _na     544_aa batD Protein BatD
4211 CAJPPO010000095.1 GCA905372535_02106 CDS open 4175-5176 _na     333_aa batA Aerotolerance regulator BatA
4212 CAJPPO010000095.1 GCA905372535_02107 CDS open 5241-6131 _na     296_aa lipA lipoyl synthase
4213 CAJPPO010000095.1 GCA905372535_02108 CDS open 6437-7435 _na     332_aa Cell filamentation protein Fic
4214 CAJPPO010000095.1 GCA905372535_02109 CDS open 7666-8037 _na     123_aa transporter
4215 CAJPPO010000095.1 GCA905372535_02110 CDS open 8068-8232 _na     54_aa hypothetical protein
4216 CAJPPO010000095.1 GCA905372535_02102 gene open 249-1250 moxR
4217 CAJPPO010000095.1 GCA905372535_02103 gene open 1310-1618
4218 CAJPPO010000095.1 GCA905372535_02104 gene open 1630-2493
4219 CAJPPO010000095.1 GCA905372535_02105 gene open 2519-4153 batD
4220 CAJPPO010000095.1 GCA905372535_02106 gene open 4175-5176 batA
4221 CAJPPO010000095.1 GCA905372535_02107 gene open 5241-6131 lipA
4222 CAJPPO010000095.1 GCA905372535_02108 gene open 6437-7435
4223 CAJPPO010000095.1 GCA905372535_02109 gene open 7666-8037
4224 CAJPPO010000095.1 GCA905372535_02110 gene open 8068-8232
4225 CAJPPO010000095.1 GCA905372535_02101 gene open 2-51 trnR
4226 CAJPPO010000095.1 GCA905372535_02101 tRNA open 2-51 trnR tRNA-Arg(tct)
4227 CAJPPO010000096.1 GCA905372535_02111 CDS open 92-3124 _na     1010_aa SusC/RagA family TonB-linked outer membrane protein
4228 CAJPPO010000096.1 GCA905372535_02112 CDS open 3137-4789 _na     550_aa susD SusD family protein
4229 CAJPPO010000096.1 GCA905372535_02113 CDS open 4806-6485 _na     559_aa Glycosyl hydrolase family 32
4230 CAJPPO010000096.1 GCA905372535_02114 CDS open 6523-8190 _na     555_aa Glycosyl hydrolase family 32
4231 CAJPPO010000096.1 GCA905372535_02111 gene open 92-3124
4232 CAJPPO010000096.1 GCA905372535_02112 gene open 3137-4789 susD
4233 CAJPPO010000096.1 GCA905372535_02113 gene open 4806-6485
4234 CAJPPO010000096.1 GCA905372535_02114 gene open 6523-8190
4235 CAJPPO010000097.1 GCA905372535_02115 CDS open 1044-1781 _na     245_aa DUF4130 domain-containing protein
4236 CAJPPO010000097.1 GCA905372535_02116 CDS open 1794-3053 _na     419_aa Putative DNA modification/repair radical SAM protein
4237 CAJPPO010000097.1 GCA905372535_02117 CDS open 3053-3601 _na     182_aa rfbC dTDP-4-dehydrorhamnose 3%2C5-epimerase
4238 CAJPPO010000097.1 GCA905372535_02118 CDS open 3620-4765 _na     381_aa Esterase
4239 CAJPPO010000097.1 GCA905372535_02119 CDS open 4857-5681 _na     274_aa thymidylate synthase
4240 CAJPPO010000097.1 GCA905372535_02120 CDS open 5735-6316 _na     193_aa DUF3575 domain-containing protein
4241 CAJPPO010000097.1 GCA905372535_02121 CDS open 6320-7408 _na     362_aa hypothetical protein
4242 CAJPPO010000097.1 GCA905372535_02115 gene open 1044-1781
4243 CAJPPO010000097.1 GCA905372535_02116 gene open 1794-3053
4244 CAJPPO010000097.1 GCA905372535_02117 gene open 3053-3601 rfbC
4245 CAJPPO010000097.1 GCA905372535_02118 gene open 3620-4765
4246 CAJPPO010000097.1 GCA905372535_02119 gene open 4857-5681
4247 CAJPPO010000097.1 GCA905372535_02120 gene open 5735-6316
4248 CAJPPO010000097.1 GCA905372535_02121 gene open 6320-7408
4249 CAJPPO010000098.1 GCA905372535_02122 CDS open 91-2478 _na     795_aa hsdR EcoAI/FtnUII family type I restriction enzme subunit R
4250 CAJPPO010000098.1 GCA905372535_02123 CDS open 2482-3981 _na     499_aa site-specific DNA-methyltransferase (adenine-specific)
4251 CAJPPO010000098.1 GCA905372535_02124 CDS open 3978-5477 _na     499_aa restriction endonuclease subunit S
4252 CAJPPO010000098.1 GCA905372535_02125 CDS open 5474-6715 _na     413_aa restriction endonuclease subunit S
4253 CAJPPO010000098.1 GCA905372535_02126 CDS open 6940-7743 _na     267_aa Site-specific recombinase%2C phage integrase family
4254 CAJPPO010000098.1 GCA905372535_02122 gene open 91-2478 hsdR
4255 CAJPPO010000098.1 GCA905372535_02123 gene open 2482-3981
4256 CAJPPO010000098.1 GCA905372535_02124 gene open 3978-5477
4257 CAJPPO010000098.1 GCA905372535_02125 gene open 5474-6715
4258 CAJPPO010000098.1 GCA905372535_02126 gene open 6940-7743
4259 CAJPPO010000099.1 GCA905372535_02127 CDS open 161-538 _na     125_aa ribonuclease P protein component
4260 CAJPPO010000099.1 GCA905372535_02128 CDS open 546-1610 _na     354_aa Fic family protein
4261 CAJPPO010000099.1 GCA905372535_02129 CDS open 1720-2319 _na     199_aa purN phosphoribosylglycinamide formyltransferase
4262 CAJPPO010000099.1 GCA905372535_02130 CDS open 2385-2579 _na     64_aa hypothetical protein
4263 CAJPPO010000099.1 GCA905372535_02131 CDS open 2714-3193 _na     159_aa DUF2004 domain-containing protein
4264 CAJPPO010000099.1 GCA905372535_02132 CDS open 3525-4118 _na     197_aa hmuY HmuY family protein
4265 CAJPPO010000099.1 GCA905372535_02133 CDS open 4105-4842 _na     245_aa nikM Nickel transport complex%2C NikM subunit%2C transmembrane
4266 CAJPPO010000099.1 GCA905372535_02134 CDS open 5027-5482 _na     151_aa rplM 50S ribosomal protein L13
4267 CAJPPO010000099.1 GCA905372535_02135 CDS open 5482-5868 _na     128_aa rpsI 30S ribosomal protein S9
4268 CAJPPO010000099.1 GCA905372535_02136 CDS open 6033-6752 _na     239_aa rpsB 30S ribosomal protein S2
4269 CAJPPO010000099.1 GCA905372535_02137 CDS open 6818-7780 _na     320_aa tsf translation elongation factor Ts
4270 CAJPPO010000099.1 GCA905372535_02127 gene open 161-538
4271 CAJPPO010000099.1 GCA905372535_02128 gene open 546-1610
4272 CAJPPO010000099.1 GCA905372535_02129 gene open 1720-2319 purN
4273 CAJPPO010000099.1 GCA905372535_02130 gene open 2385-2579
4274 CAJPPO010000099.1 GCA905372535_02131 gene open 2714-3193
4275 CAJPPO010000099.1 GCA905372535_02132 gene open 3525-4118 hmuY
4276 CAJPPO010000099.1 GCA905372535_02133 gene open 4105-4842 nikM
4277 CAJPPO010000099.1 GCA905372535_02134 gene open 5027-5482 rplM
4278 CAJPPO010000099.1 GCA905372535_02135 gene open 5482-5868 rpsI
4279 CAJPPO010000099.1 GCA905372535_02136 gene open 6033-6752 rpsB
4280 CAJPPO010000099.1 GCA905372535_02137 gene open 6818-7780 tsf
4281 CAJPPO010000100.1 GCA905372535_02138 CDS open 234-515 _na     93_aa hypothetical protein
4282 CAJPPO010000100.1 GCA905372535_02139 CDS open 571-1008 _na     145_aa hypothetical protein
4283 CAJPPO010000100.1 GCA905372535_02140 CDS open 1012-2112 _na     366_aa WG repeat protein
4284 CAJPPO010000100.1 GCA905372535_02141 CDS open 2153-3199 _na     348_aa WG repeat-containing protein
4285 CAJPPO010000100.1 GCA905372535_02142 CDS open 3332-3421 _na     29_aa hypothetical protein
4286 CAJPPO010000100.1 GCA905372535_02143 CDS open 3630-3920 _na     96_aa RNA-binding protein
4287 CAJPPO010000100.1 GCA905372535_02144 CDS open 3925-4467 _na     180_aa Ribosomal protein S18 acetylase RimI-like enzyme
4288 CAJPPO010000100.1 GCA905372535_02145 CDS open 4474-5811 _na     445_aa dihydroorotase
4289 CAJPPO010000100.1 GCA905372535_02146 CDS open 5813-6223 _na     136_aa DUF4296 domain-containing protein
4290 CAJPPO010000100.1 GCA905372535_02147 CDS open 6238-6909 _na     223_aa DUF4271 domain-containing protein
4291 CAJPPO010000100.1 GCA905372535_02148 CDS open 6968-7717 _na     249_aa Uroporphyrinogen-III synthase
4292 CAJPPO010000100.1 GCA905372535_02138 gene open 234-515
4293 CAJPPO010000100.1 GCA905372535_02139 gene open 571-1008
4294 CAJPPO010000100.1 GCA905372535_02140 gene open 1012-2112
4295 CAJPPO010000100.1 GCA905372535_02141 gene open 2153-3199
4296 CAJPPO010000100.1 GCA905372535_02142 gene open 3332-3421
4297 CAJPPO010000100.1 GCA905372535_02143 gene open 3630-3920
4298 CAJPPO010000100.1 GCA905372535_02144 gene open 3925-4467
4299 CAJPPO010000100.1 GCA905372535_02145 gene open 4474-5811
4300 CAJPPO010000100.1 GCA905372535_02146 gene open 5813-6223
4301 CAJPPO010000100.1 GCA905372535_02147 gene open 6238-6909
4302 CAJPPO010000100.1 GCA905372535_02148 gene open 6968-7717
4303 CAJPPO010000101.1 GCA905372535_02149 CDS open 404-1777 _na     457_aa Tetratricopeptide repeat protein
4304 CAJPPO010000101.1 GCA905372535_02150 CDS open 1919-6574 _na     1551_aa DUF6531 domain-containing protein
4305 CAJPPO010000101.1 GCA905372535_02151 CDS open 6577-7047 _na     156_aa hypothetical protein
4306 CAJPPO010000101.1 GCA905372535_02149 gene open 404-1777
4307 CAJPPO010000101.1 GCA905372535_02150 gene open 1919-6574
4308 CAJPPO010000101.1 GCA905372535_02151 gene open 6577-7047
4309 CAJPPO010000102.1 GCA905372535_02152 CDS open 152-1066 _na     304_aa rsmH 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH
4310 CAJPPO010000102.1 GCA905372535_02153 CDS open 1077-1406 _na     109_aa S-adenosyl-methyltransferase
4311 CAJPPO010000102.1 GCA905372535_02154 CDS open 1424-3439 _na     671_aa ftsI Cell division protein FtsI (Penicillin-binding protein 3)
4312 CAJPPO010000102.1 GCA905372535_02155 CDS open 3465-4928 _na     487_aa UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2%2C6-diaminopimelate ligase
4313 CAJPPO010000102.1 GCA905372535_02156 CDS open 5197-6891 _na     564_aa ftsK FtsK domain-containing protein
4314 CAJPPO010000102.1 GCA905372535_02152 gene open 152-1066 rsmH
4315 CAJPPO010000102.1 GCA905372535_02153 gene open 1077-1406
4316 CAJPPO010000102.1 GCA905372535_02154 gene open 1424-3439 ftsI
4317 CAJPPO010000102.1 GCA905372535_02155 gene open 3465-4928
4318 CAJPPO010000102.1 GCA905372535_02156 gene open 5197-6891 ftsK
4319 CAJPPO010000103.1 GCA905372535_02157 CDS open 288-545 _na     85_aa Toxin-antitoxin system%2C antitoxin component%2C ribbon-helix-helix domain protein
4320 CAJPPO010000103.1 GCA905372535_02158 CDS open 639-1154 _na     171_aa Periplasmic chaperone for outer membrane proteins Skp
4321 CAJPPO010000103.1 GCA905372535_02159 CDS open 1204-1869 _na     221_aa lysE LysE family translocator
4322 CAJPPO010000103.1 GCA905372535_02160 CDS open 1991-4069 _na     692_aa rnr ribonuclease R
4323 CAJPPO010000103.1 GCA905372535_02161 CDS open 4566-6110 _na     514_aa leucine-rich repeat protein
4324 CAJPPO010000103.1 GCA905372535_02162 CDS open 6310-6504 _na     64_aa rpsU 30S ribosomal protein S21
4325 CAJPPO010000103.1 GCA905372535_02163 CDS open 6577-6849 _na     90_aa type II toxin-antitoxin system RelE/ParE family toxin
4326 CAJPPO010000103.1 GCA905372535_02164 CDS open 6836-7069 _na     77_aa XRE family transcriptional regulator
4327 CAJPPO010000103.1 GCA905372535_02157 gene open 288-545
4328 CAJPPO010000103.1 GCA905372535_02158 gene open 639-1154
4329 CAJPPO010000103.1 GCA905372535_02159 gene open 1204-1869 lysE
4330 CAJPPO010000103.1 GCA905372535_02160 gene open 1991-4069 rnr
4331 CAJPPO010000103.1 GCA905372535_02161 gene open 4566-6110
4332 CAJPPO010000103.1 GCA905372535_02162 gene open 6310-6504 rpsU
4333 CAJPPO010000103.1 GCA905372535_02163 gene open 6577-6849
4334 CAJPPO010000103.1 GCA905372535_02164 gene open 6836-7069
4335 CAJPPO010000104.1 GCA905372535_02165 CDS open 307-591 _na     94_aa Helix-turn-helix domain-containing protein
4336 CAJPPO010000104.1 GCA905372535_02166 CDS open 588-869 _na     93_aa Helix-turn-helix domain-containing protein
4337 CAJPPO010000104.1 GCA905372535_02167 CDS open 1054-1899 _na     281_aa THIF-type NAD/FAD binding fold domain-containing protein
4338 CAJPPO010000104.1 GCA905372535_02168 CDS open 1902-2624 _na     240_aa PRTRC system protein B
4339 CAJPPO010000104.1 GCA905372535_02169 CDS open 2626-3789 _na     387_aa PRTRC system protein F
4340 CAJPPO010000104.1 GCA905372535_02170 CDS open 3890-4108 _na     72_aa PRTRC system protein C
4341 CAJPPO010000104.1 GCA905372535_02171 CDS open 4136-4633 _na     165_aa ParB-related ThiF-related cassette protein E domain-containing protein
4342 CAJPPO010000104.1 GCA905372535_02172 CDS open 4683-4898 _na     71_aa hypothetical protein
4343 CAJPPO010000104.1 GCA905372535_02173 CDS open 4918-5151 _na     77_aa Phage protein
4344 CAJPPO010000104.1 GCA905372535_02174 CDS open 5158-5364 _na     68_aa 3-isopropylmalate dehydratase
4345 CAJPPO010000104.1 GCA905372535_02175 CDS open 5361-5807 _na     148_aa DUF4240 domain-containing protein
4346 CAJPPO010000104.1 GCA905372535_02176 CDS open 5837-6271 _na     144_aa Single-stranded DNA-binding protein
4347 CAJPPO010000104.1 GCA905372535_02177 CDS open 6297-6632 _na     111_aa Molybdenum ABC transporter ATP-binding protein
4348 CAJPPO010000104.1 GCA905372535_02165 gene open 307-591
4349 CAJPPO010000104.1 GCA905372535_02166 gene open 588-869
4350 CAJPPO010000104.1 GCA905372535_02167 gene open 1054-1899
4351 CAJPPO010000104.1 GCA905372535_02168 gene open 1902-2624
4352 CAJPPO010000104.1 GCA905372535_02169 gene open 2626-3789
4353 CAJPPO010000104.1 GCA905372535_02170 gene open 3890-4108
4354 CAJPPO010000104.1 GCA905372535_02171 gene open 4136-4633
4355 CAJPPO010000104.1 GCA905372535_02172 gene open 4683-4898
4356 CAJPPO010000104.1 GCA905372535_02173 gene open 4918-5151
4357 CAJPPO010000104.1 GCA905372535_02174 gene open 5158-5364
4358 CAJPPO010000104.1 GCA905372535_02175 gene open 5361-5807
4359 CAJPPO010000104.1 GCA905372535_02176 gene open 5837-6271
4360 CAJPPO010000104.1 GCA905372535_02177 gene open 6297-6632
4361 CAJPPO010000105.1 GCA905372535_02178 CDS open 17-2596 _na     859_aa mutS DNA mismatch repair protein MutS
4362 CAJPPO010000105.1 GCA905372535_02179 CDS open 2615-3319 _na     234_aa tRNA1(Val) (adenine(37)-N6)-methyltransferase
4363 CAJPPO010000105.1 GCA905372535_02180 CDS open 3365-3679 _na     104_aa type II toxin-antitoxin system RelE/ParE family toxin
4364 CAJPPO010000105.1 GCA905372535_02181 CDS open 3670-3936 _na     88_aa hypothetical protein
4365 CAJPPO010000105.1 GCA905372535_02182 CDS open 4002-4847 _na     281_aa YD repeat-containing protein
4366 CAJPPO010000105.1 GCA905372535_02183 CDS open 4965-6515 _na     516_aa NAD metabolism ATPase/kinase
4367 CAJPPO010000105.1 GCA905372535_02178 gene open 17-2596 mutS
4368 CAJPPO010000105.1 GCA905372535_02179 gene open 2615-3319
4369 CAJPPO010000105.1 GCA905372535_02180 gene open 3365-3679
4370 CAJPPO010000105.1 GCA905372535_02181 gene open 3670-3936
4371 CAJPPO010000105.1 GCA905372535_02182 gene open 4002-4847
4372 CAJPPO010000105.1 GCA905372535_02183 gene open 4965-6515
4373 CAJPPO010000106.1 GCA905372535_02184 CDS open 77-1411 _na     444_aa Transporter
4374 CAJPPO010000106.1 GCA905372535_02185 CDS open 1456-2070 _na     204_aa tetR TetR family transcriptional regulator
4375 CAJPPO010000106.1 GCA905372535_02186 CDS open 2212-2730 _na     172_aa Phosphatidylcholine 1-acylhydrolase
4376 CAJPPO010000106.1 GCA905372535_02187 CDS open 2690-3145 _na     151_aa Phosphatidylcholine 1-acylhydrolase
4377 CAJPPO010000106.1 GCA905372535_02188 CDS open 3183-4382 _na     399_aa DKNYY family protein
4378 CAJPPO010000106.1 GCA905372535_02189 CDS open 4407-5816 _na     469_aa mnmE tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE
4379 CAJPPO010000106.1 GCA905372535_02190 CDS open 5914-6609 _na     231_aa SAM-dependent methyltransferase
4380 CAJPPO010000106.1 GCA905372535_02184 gene open 77-1411
4381 CAJPPO010000106.1 GCA905372535_02185 gene open 1456-2070 tetR
4382 CAJPPO010000106.1 GCA905372535_02186 gene open 2212-2730
4383 CAJPPO010000106.1 GCA905372535_02187 gene open 2690-3145
4384 CAJPPO010000106.1 GCA905372535_02188 gene open 3183-4382
4385 CAJPPO010000106.1 GCA905372535_02189 gene open 4407-5816 mnmE
4386 CAJPPO010000106.1 GCA905372535_02190 gene open 5914-6609
4387 CAJPPO010000107.1 GCA905372535_02191 CDS open 76-567 _na     163_aa transposase
4388 CAJPPO010000107.1 GCA905372535_02192 CDS open 614-952 _na     112_aa hypothetical protein
4389 CAJPPO010000107.1 GCA905372535_02193 CDS open 1203-5012 _na     1269_aa rpoB DNA-directed RNA polymerase subunit beta
4390 CAJPPO010000107.1 GCA905372535_02194 CDS open 5109-5660 _na     183_aa GNAT family N-acetyltransferase
4391 CAJPPO010000107.1 GCA905372535_02195 CDS open 5663-5848 _na     61_aa Toxin-antitoxin system%2C antitoxin component%2C ribbon-helix-helix domain protein
4392 CAJPPO010000107.1 GCA905372535_02196 CDS open 5871-6164 _na     97_aa Type II toxin-antitoxin system RelE/ParE family toxin
4393 CAJPPO010000107.1 GCA905372535_02197 CDS open 6136-6342 _na     68_aa Toxin-antitoxin system%2C antitoxin component%2C ribbon-helix-helix domain protein
4394 CAJPPO010000107.1 GCA905372535_02191 gene open 76-567
4395 CAJPPO010000107.1 GCA905372535_02192 gene open 614-952
4396 CAJPPO010000107.1 GCA905372535_02193 gene open 1203-5012 rpoB
4397 CAJPPO010000107.1 GCA905372535_02194 gene open 5109-5660
4398 CAJPPO010000107.1 GCA905372535_02195 gene open 5663-5848
4399 CAJPPO010000107.1 GCA905372535_02196 gene open 5871-6164
4400 CAJPPO010000107.1 GCA905372535_02197 gene open 6136-6342
4401 CAJPPO010000108.1 GCA905372535_02198 CDS open 1738-2967 _na     409_aa odhB 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase
4402 CAJPPO010000108.1 GCA905372535_02199 CDS open 3007-3528 _na     173_aa TonB-dependent receptor
4403 CAJPPO010000108.1 GCA905372535_02200 CDS open 3546-6323 _na     925_aa 2-oxoglutarate dehydrogenase E1 component
4404 CAJPPO010000108.1 GCA905372535_02198 gene open 1738-2967 odhB
4405 CAJPPO010000108.1 GCA905372535_02199 gene open 3007-3528
4406 CAJPPO010000108.1 GCA905372535_02200 gene open 3546-6323
4407 CAJPPO010000109.1 GCA905372535_02201 CDS open 23-490 _na     155_aa N5-carboxyaminoimidazole ribonucleotide mutase
4408 CAJPPO010000109.1 GCA905372535_02202 CDS open 483-2033 _na     516_aa guaA glutamine-hydrolyzing GMP synthase
4409 CAJPPO010000109.1 GCA905372535_02203 CDS open 2078-4003 _na     641_aa lysM Peptidoglycan-binding protein LysM
4410 CAJPPO010000109.1 GCA905372535_02204 CDS open 4000-4665 _na     221_aa ung uracil-DNA glycosylase
4411 CAJPPO010000109.1 GCA905372535_02205 CDS open 4719-4844 _na     41_aa Serine hydroxymethyltransferase
4412 CAJPPO010000109.1 GCA905372535_02206 CDS open 4872-5771 _na     299_aa Ribonuclease BN
4413 CAJPPO010000109.1 GCA905372535_02201 gene open 23-490
4414 CAJPPO010000109.1 GCA905372535_02202 gene open 483-2033 guaA
4415 CAJPPO010000109.1 GCA905372535_02203 gene open 2078-4003 lysM
4416 CAJPPO010000109.1 GCA905372535_02204 gene open 4000-4665 ung
4417 CAJPPO010000109.1 GCA905372535_02205 gene open 4719-4844
4418 CAJPPO010000109.1 GCA905372535_02206 gene open 4872-5771
4419 CAJPPO010000110.1 GCA905372535_02207 CDS open 554-1057 _na     167_aa hypothetical protein
4420 CAJPPO010000110.1 GCA905372535_02208 CDS open 5101-5313 _na     70_aa hypothetical protein
4421 CAJPPO010000110.1 GCA905372535_02209 CDS open 5455-5727 _na     90_aa hypothetical protein
4422 CAJPPO010000110.1 GCA905372535_02210 CDS open 6046-6315 _na     89_aa hypothetical protein
4423 CAJPPO010000110.1 GCA905372535_02207 gene open 554-1057
4424 CAJPPO010000110.1 GCA905372535_02208 gene open 5101-5313
4425 CAJPPO010000110.1 GCA905372535_02209 gene open 5455-5727
4426 CAJPPO010000110.1 GCA905372535_02210 gene open 6046-6315
4427 CAJPPO010000111.1 GCA905372535_02211 CDS open 91-735 _na     214_aa NlpC/P60 family protein
4428 CAJPPO010000111.1 GCA905372535_02212 CDS open 735-1682 _na     315_aa Type VI secretion%2C VasB%2C ImpH%2C VC_A0111
4429 CAJPPO010000111.1 GCA905372535_02213 CDS open 1697-2635 _na     312_aa tssN TssN family type VI secretion system protein
4430 CAJPPO010000111.1 GCA905372535_02214 CDS open 2663-3802 _na     379_aa vasE Type VI secretion%2C VC_A0110%2C EvfL%2C ImpJ%2C VasE
4431 CAJPPO010000111.1 GCA905372535_02215 CDS open 3832-4347 _na     171_aa tssO Type VI secretion system transmembrane protein TssO
4432 CAJPPO010000111.1 GCA905372535_02216 CDS open 4356-4889 _na     177_aa hypothetical protein
4433 CAJPPO010000111.1 GCA905372535_02217 CDS open 4898-5596 _na     232_aa hypothetical protein
4434 CAJPPO010000111.1 GCA905372535_02211 gene open 91-735
4435 CAJPPO010000111.1 GCA905372535_02212 gene open 735-1682
4436 CAJPPO010000111.1 GCA905372535_02213 gene open 1697-2635 tssN
4437 CAJPPO010000111.1 GCA905372535_02214 gene open 2663-3802 vasE
4438 CAJPPO010000111.1 GCA905372535_02215 gene open 3832-4347 tssO
4439 CAJPPO010000111.1 GCA905372535_02216 gene open 4356-4889
4440 CAJPPO010000111.1 GCA905372535_02217 gene open 4898-5596
4441 CAJPPO010000112.1 GCA905372535_02218 CDS open 350-2092 _na     580_aa infB translation initiation factor IF-2
4442 CAJPPO010000112.1 GCA905372535_02219 CDS open 2223-2945 _na     240_aa TPM domain-containing protein
4443 CAJPPO010000112.1 GCA905372535_02220 CDS open 2967-3677 _na     236_aa Response regulator
4444 CAJPPO010000112.1 GCA905372535_02221 CDS open 3715-3891 _na     58_aa CAL67264 family membrane protein
4445 CAJPPO010000112.1 GCA905372535_02222 CDS open 3946-5520 _na     524_aa NADP-dependent glyceraldehyde-3-phosphate dehydrogenase
4446 CAJPPO010000112.1 GCA905372535_02223 CDS open 5578-6150 _na     190_aa cation transporting ATPase C-terminal domain-containing protein
4447 CAJPPO010000112.1 GCA905372535_02218 gene open 350-2092 infB
4448 CAJPPO010000112.1 GCA905372535_02219 gene open 2223-2945
4449 CAJPPO010000112.1 GCA905372535_02220 gene open 2967-3677
4450 CAJPPO010000112.1 GCA905372535_02221 gene open 3715-3891
4451 CAJPPO010000112.1 GCA905372535_02222 gene open 3946-5520
4452 CAJPPO010000112.1 GCA905372535_02223 gene open 5578-6150
4453 CAJPPO010000113.1 regulatory_region open 741-773 DUF805b RNA
4454 CAJPPO010000113.1 GCA905372535_02224 CDS open 420-719 _na     99_aa Adhesin domain-containing protein
4455 CAJPPO010000113.1 GCA905372535_02225 CDS open 1145-2056 _na     303_aa WYL domain-containing protein
4456 CAJPPO010000113.1 GCA905372535_02226 CDS open 2117-2692 _na     191_aa DUF3127 domain-containing protein
4457 CAJPPO010000113.1 GCA905372535_02227 CDS open 2792-3112 _na     106_aa yafQ type II toxin-antitoxin system YafQ family toxin
4458 CAJPPO010000113.1 GCA905372535_02228 CDS open 3105-3365 _na     86_aa fliM flagellar motor switch protein FliM
4459 CAJPPO010000113.1 GCA905372535_02229 CDS open 3412-4716 _na     434_aa tRNA(Ile)-lysidine synthase
4460 CAJPPO010000113.1 GCA905372535_02230 CDS open 4729-5583 _na     284_aa Aminotransferase class IV
4461 CAJPPO010000113.1 GCA905372535_02231 CDS open 5623-6006 _na     127_aa START-like domain-containing protein
4462 CAJPPO010000113.1 GCA905372535_02232 CDS open 6115-6216 _na     33_aa hypothetical protein
4463 CAJPPO010000113.1 GCA905372535_02224 gene open 420-719
4464 CAJPPO010000113.1 GCA905372535_02225 gene open 1145-2056
4465 CAJPPO010000113.1 GCA905372535_02226 gene open 2117-2692
4466 CAJPPO010000113.1 GCA905372535_02227 gene open 2792-3112 yafQ
4467 CAJPPO010000113.1 GCA905372535_02228 gene open 3105-3365 fliM
4468 CAJPPO010000113.1 GCA905372535_02229 gene open 3412-4716
4469 CAJPPO010000113.1 GCA905372535_02230 gene open 4729-5583
4470 CAJPPO010000113.1 GCA905372535_02231 gene open 5623-6006
4471 CAJPPO010000113.1 GCA905372535_02232 gene open 6115-6216
4472 CAJPPO010000114.1 GCA905372535_02233 CDS open 443-829 _na     128_aa hypothetical protein
4473 CAJPPO010000114.1 GCA905372535_02234 CDS open 4091-4282 _na     63_aa hypothetical protein
4474 CAJPPO010000114.1 GCA905372535_02235 CDS open 4448-4714 _na     88_aa hypothetical protein
4475 CAJPPO010000114.1 GCA905372535_02236 CDS open 5381-5539 _na     52_aa hypothetical protein
4476 CAJPPO010000114.1 GCA905372535_02233 gene open 443-829
4477 CAJPPO010000114.1 GCA905372535_02234 gene open 4091-4282
4478 CAJPPO010000114.1 GCA905372535_02235 gene open 4448-4714
4479 CAJPPO010000114.1 GCA905372535_02236 gene open 5381-5539
4480 CAJPPO010000115.1 GCA905372535_02237 CDS open 144-3512 _na     1122_aa gliding motility-associated C-terminal domain-containing protein
4481 CAJPPO010000115.1 GCA905372535_02238 CDS open 3705-4400 _na     231_aa Polysaccharide deacetylase family protein
4482 CAJPPO010000115.1 GCA905372535_02239 CDS open 4400-5014 _na     204_aa lolA Outer membrane lipoprotein carrier protein LolA
4483 CAJPPO010000115.1 GCA905372535_02240 CDS open 4992-5588 _na     198_aa Lipoprotein
4484 CAJPPO010000115.1 GCA905372535_02241 CDS open 5612-5980 _na     122_aa 3-hydroxyacyl-ACP dehydratase
4485 CAJPPO010000115.1 GCA905372535_02237 gene open 144-3512
4486 CAJPPO010000115.1 GCA905372535_02238 gene open 3705-4400
4487 CAJPPO010000115.1 GCA905372535_02239 gene open 4400-5014 lolA
4488 CAJPPO010000115.1 GCA905372535_02240 gene open 4992-5588
4489 CAJPPO010000115.1 GCA905372535_02241 gene open 5612-5980
4490 CAJPPO010000116.1 GCA905372535_02242 CDS open 158-1492 _na     444_aa murD UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase
4491 CAJPPO010000116.1 GCA905372535_02243 CDS open 1505-2749 _na     414_aa ftsW putative peptidoglycan glycosyltransferase FtsW
4492 CAJPPO010000116.1 GCA905372535_02244 CDS open 2859-3875 _na     338_aa hemH ferrochelatase
4493 CAJPPO010000116.1 GCA905372535_02245 CDS open 3878-4414 _na     178_aa Protoporphyrinogen IX oxidase
4494 CAJPPO010000116.1 GCA905372535_02242 gene open 158-1492 murD
4495 CAJPPO010000116.1 GCA905372535_02243 gene open 1505-2749 ftsW
4496 CAJPPO010000116.1 GCA905372535_02244 gene open 2859-3875 hemH
4497 CAJPPO010000116.1 GCA905372535_02245 gene open 3878-4414
4498 CAJPPO010000117.1 GCA905372535_02246 CDS open 153-458 _na     101_aa SMI1/KNR4 family protein
4499 CAJPPO010000117.1 GCA905372535_02247 CDS open 508-936 _na     142_aa Integron-associated effector binding protein domain-containing protein
4500 CAJPPO010000117.1 GCA905372535_02248 CDS open 890-1669 _na     259_aa DNA-binding protein