HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Hoylesella saccharolytica (GCA_905372675.1)

Select a Genome:
BAKTA Annotations for GCA_905372675.1
Genome Selected: Hoylesella saccharolytica
ContigsBases CDSrRNA tmRNAtRNA
73 2,409,554 1915 0 1 28
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3893 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:1]    |    Number of Records Found: 3893 [8 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1 CAJPQO010000001.1 GCA905372675_00001 CDS open 42-137 _na     31_aa hypothetical protein
2 CAJPQO010000001.1 GCA905372675_00002 CDS open 735-2576 _na     613_aa Arylsulfatase
3 CAJPQO010000001.1 GCA905372675_00003 CDS open 2664-3596 _na     310_aa Sigma factor regulatory protein%2C FecR/PupR family
4 CAJPQO010000001.1 GCA905372675_00004 CDS open 3611-7030 _na     1139_aa TonB-dependent receptor
5 CAJPQO010000001.1 GCA905372675_00005 CDS open 7042-8775 _na     577_aa susD SusD family protein
6 CAJPQO010000001.1 GCA905372675_00006 CDS open 8863-9627 _na     254_aa Endonuclease/exonuclease/phosphatase family protein
7 CAJPQO010000001.1 GCA905372675_00007 CDS open 9730-10734 _na     334_aa Endonuclease/exonuclease/phosphatase family protein
8 CAJPQO010000001.1 GCA905372675_00008 CDS open 10760-12925 _na     721_aa Alpha-N-acetylglucosaminidase
9 CAJPQO010000001.1 GCA905372675_00009 CDS open 13231-15423 _na     730_aa Alpha-N-acetylglucosaminidase
10 CAJPQO010000001.1 GCA905372675_00010 CDS open 15525-16118 _na     197_aa Sigma-70 region 2
11 CAJPQO010000001.1 GCA905372675_00011 CDS open 16377-16976 _na     199_aa Glutathione peroxidase
12 CAJPQO010000001.1 GCA905372675_00012 CDS open 17133-18080 _na     315_aa DUF4595 domain-containing protein
13 CAJPQO010000001.1 GCA905372675_00013 CDS open 18300-19607 _na     435_aa eno phosphopyruvate hydratase
14 CAJPQO010000001.1 GCA905372675_00014 CDS open 19743-21236 _na     497_aa cysS cysteine--tRNA ligase
15 CAJPQO010000001.1 GCA905372675_00015 CDS open 21368-22246 _na     292_aa pfkB Kinase%2C PfkB family
16 CAJPQO010000001.1 GCA905372675_00016 CDS open 22251-24044 _na     597_aa Fructan beta-fructosidase domain protein
17 CAJPQO010000001.1 GCA905372675_00017 CDS open 24463-24615 _na     50_aa hypothetical protein
18 CAJPQO010000001.1 GCA905372675_00018 CDS open 25003-25917 _na     304_aa Lipocalin-like domain-containing protein
19 CAJPQO010000001.1 GCA905372675_00019 CDS open 26087-26911 _na     274_aa Methyltransferase family
20 CAJPQO010000001.1 GCA905372675_00020 CDS open 27046-28179 _na     377_aa acyltransferase
21 CAJPQO010000001.1 GCA905372675_00021 CDS open 28201-28956 _na     251_aa hypothetical protein
22 CAJPQO010000001.1 GCA905372675_00022 CDS open 28989-29813 _na     274_aa lptB LPS export ABC transporter ATP-binding protein
23 CAJPQO010000001.1 GCA905372675_00023 CDS open 29947-30693 _na     248_aa Toluene tolerance protein Ttg2B
24 CAJPQO010000001.1 GCA905372675_00024 CDS open 30704-31480 _na     258_aa ABC transporter%2C ATP-binding protein
25 CAJPQO010000001.1 GCA905372675_00025 CDS open 31633-32532 _na     299_aa DUF2179 domain-containing protein
26 CAJPQO010000001.1 GCA905372675_00026 CDS open 32564-32947 _na     127_aa Putative endoribonuclease L-PSP
27 CAJPQO010000001.1 GCA905372675_00027 CDS open 33205-33387 _na     60_aa hypothetical protein
28 CAJPQO010000001.1 GCA905372675_00028 CDS open 33819-36956 _na     1045_aa Acyltransferase
29 CAJPQO010000001.1 GCA905372675_00029 CDS open 36958-38091 _na     377_aa Acyltransferase family protein
30 CAJPQO010000001.1 GCA905372675_00030 CDS open 38106-39431 _na     441_aa AMP-dependent synthetase/ligase domain-containing protein
31 CAJPQO010000001.1 GCA905372675_00031 CDS open 39461-40414 _na     317_aa BD-FAE-like domain-containing protein
32 CAJPQO010000001.1 GCA905372675_00032 CDS open 40419-41909 _na     496_aa FAD dependent oxidoreductase
33 CAJPQO010000001.1 GCA905372675_00033 CDS open 41906-43414 _na     502_aa FAD dependent oxidoreductase
34 CAJPQO010000001.1 GCA905372675_00034 CDS open 43622-44713 _na     363_aa dinB DNA polymerase IV
35 CAJPQO010000001.1 GCA905372675_00035 CDS open 45673-47100 _na     475_aa Glycosyltransferase RgtA/B/C/D-like domain-containing protein
36 CAJPQO010000001.1 GCA905372675_00036 CDS open 47076-49088 _na     670_aa porZ TSS9 PorZ N-terminal beta-propeller domain-containing protein
37 CAJPQO010000001.1 GCA905372675_00037 CDS open 49093-49716 _na     207_aa non-canonical purine NTP diphosphatase
38 CAJPQO010000001.1 GCA905372675_00038 CDS open 49768-50751 _na     327_aa DUF2179 domain-containing protein
39 CAJPQO010000001.1 GCA905372675_00039 CDS open 50897-53800 _na     967_aa leuS leucine--tRNA ligase
40 CAJPQO010000001.1 GCA905372675_00040 CDS open 54682-56376 _na     564_aa Arylsulfatase
41 CAJPQO010000001.1 GCA905372675_00041 CDS open 56770-58017 _na     415_aa BamA/TamA family outer membrane protein
42 CAJPQO010000001.1 GCA905372675_00042 CDS open 57998-58951 _na     317_aa PCMD domain-containing protein
43 CAJPQO010000001.1 GCA905372675_00043 CDS open 59129-61750 _na     873_aa mutS DNA mismatch repair protein MutS
44 CAJPQO010000001.1 GCA905372675_00044 CDS open 61812-62621 _na     269_aa DUF3108 domain-containing protein
45 CAJPQO010000001.1 GCA905372675_00045 CDS open 62655-64715 _na     686_aa sbsA SbsA Ig-like domain-containing protein
46 CAJPQO010000001.1 GCA905372675_00046 CDS open 64917-66425 _na     502_aa GH3 auxin-responsive promoter
47 CAJPQO010000001.1 GCA905372675_00047 CDS open 66622-67446 _na     274_aa lgt prolipoprotein diacylglyceryl transferase
48 CAJPQO010000001.1 GCA905372675_00048 CDS open 67484-67894 _na     136_aa DUF559 domain-containing protein
49 CAJPQO010000001.1 GCA905372675_00049 CDS open 68320-69420 _na     366_aa ychF redox-regulated ATPase YchF
50 CAJPQO010000001.1 GCA905372675_00050 CDS open 69915-70088 _na     57_aa hypothetical protein
51 CAJPQO010000001.1 GCA905372675_00051 CDS open 70085-71095 _na     336_aa DNA-binding protein
52 CAJPQO010000001.1 GCA905372675_00052 CDS open 71116-73878 _na     920_aa polA DNA polymerase I
53 CAJPQO010000001.1 GCA905372675_00053 CDS open 73964-74941 _na     325_aa Polyprenyl synthetase
54 CAJPQO010000001.1 GCA905372675_00054 CDS open 75203-76315 _na     370_aa Lipoprotein
55 CAJPQO010000001.1 GCA905372675_00055 CDS open 76400-77875 _na     491_aa algI Alginate O-acetyltransferase AlgI family protein
56 CAJPQO010000001.1 GCA905372675_00056 CDS open 77872-79260 _na     462_aa SGNH hydrolase-type esterase domain-containing protein
57 CAJPQO010000001.1 GCA905372675_00057 CDS open 79306-80244 _na     312_aa deoC deoxyribose-phosphate aldolase
58 CAJPQO010000001.1 GCA905372675_00058 CDS open 80332-80673 _na     113_aa mazG MazG nucleotide pyrophosphohydrolase domain protein
59 CAJPQO010000001.1 GCA905372675_00059 CDS open 80806-81258 _na     150_aa dtd D-aminoacyl-tRNA deacylase
60 CAJPQO010000001.1 GCA905372675_00060 CDS open 82721-84556 _na     611_aa uvrC excinuclease ABC subunit UvrC
61 CAJPQO010000001.1 GCA905372675_00061 CDS open 85217-85747 _na     176_aa adenine phosphoribosyltransferase
62 CAJPQO010000001.1 GCA905372675_00062 CDS open 85844-87715 _na     623_aa mnmG tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG
63 CAJPQO010000001.1 GCA905372675_00063 CDS open 88004-88690 _na     228_aa Succinate dehydrogenase cytochrome B subunit%2C b558 family
64 CAJPQO010000001.1 GCA905372675_00064 CDS open 88721-90703 _na     660_aa sdhA Succinate dehydrogenase or fumarate reductase%2C flavoprotein subunit
65 CAJPQO010000001.1 GCA905372675_00065 CDS open 90756-90914 _na     52_aa hypothetical protein
66 CAJPQO010000001.1 GCA905372675_00066 CDS open 90946-91701 _na     251_aa Succinate dehydrogenase/fumarate reductase iron-sulfur subunit
67 CAJPQO010000001.1 GCA905372675_00067 CDS open 92918-94687 _na     589_aa N-acetyltransferase domain-containing protein
68 CAJPQO010000001.1 GCA905372675_00068 CDS open 94954-95976 _na     340_aa pta phosphate acetyltransferase
69 CAJPQO010000001.1 GCA905372675_00069 CDS open 96023-97225 _na     400_aa Acetate kinase
70 CAJPQO010000001.1 GCA905372675_00070 CDS open 97385-98935 _na     516_aa rmuC RmuC domain protein
71 CAJPQO010000001.1 GCA905372675_00071 CDS open 99740-100699 _na     319_aa Methylenetetrahydrofolate reductase
72 CAJPQO010000001.1 GCA905372675_00072 CDS open 100696-101835 _na     379_aa Putative DNA polymerase III%2C delta' subunit
73 CAJPQO010000001.1 GCA905372675_00073 CDS open 101924-103174 _na     416_aa PSP1 protein
74 CAJPQO010000001.1 GCA905372675_00074 CDS open 103140-103649 _na     169_aa gldH Gliding motility-associated lipoprotein GldH
75 CAJPQO010000001.1 GCA905372675_00075 CDS open 103891-105891 _na     666_aa Glycosyl hydrolase family 9
76 CAJPQO010000001.1 GCA905372675_00076 CDS open 105978-109937 _na     1319_aa histidine kinase
77 CAJPQO010000001.1 GCA905372675_00077 CDS open 110886-110984 _na     32_aa hypothetical protein
78 CAJPQO010000001.1 GCA905372675_00078 CDS open 111923-112549 _na     208_aa CDP-alcohol phosphatidyltransferase
79 CAJPQO010000001.1 GCA905372675_00079 CDS open 112577-113617 _na     346_aa PNPLA domain-containing protein
80 CAJPQO010000001.1 GCA905372675_00080 CDS open 113614-114369 _na     251_aa Oxidoreductase%2C short chain dehydrogenase/reductase family protein
81 CAJPQO010000001.1 GCA905372675_00081 CDS open 114417-115643 _na     408_aa PAP2 family protein
82 CAJPQO010000001.1 GCA905372675_00082 CDS open 115624-117321 _na     565_aa Methyltransferase domain protein
83 CAJPQO010000001.1 GCA905372675_00083 CDS open 117302-118345 _na     347_aa Winged helix DNA-binding domain-containing protein
84 CAJPQO010000001.1 GCA905372675_00084 CDS open 119134-121155 _na     673_aa Cadmium-exporting ATPase
85 CAJPQO010000001.1 GCA905372675_00085 CDS open 121294-122328 _na     344_aa ruvB Holliday junction branch migration DNA helicase RuvB
86 CAJPQO010000001.1 GCA905372675_00086 CDS open 122478-122693 _na     71_aa hypothetical protein
87 CAJPQO010000001.1 GCA905372675_00087 CDS open 122656-123228 _na     190_aa Peptidase A2 domain-containing protein
88 CAJPQO010000001.1 GCA905372675_00088 CDS open 123513-123950 _na     145_aa coaD pantetheine-phosphate adenylyltransferase
89 CAJPQO010000001.1 GCA905372675_00089 CDS open 123963-124373 _na     136_aa ybeY rRNA maturation RNase YbeY
90 CAJPQO010000001.1 GCA905372675_00090 CDS open 124458-125675 _na     405_aa AAA family ATPase
91 CAJPQO010000001.1 GCA905372675_00091 CDS open 125665-126135 _na     156_aa hypothetical protein
92 CAJPQO010000001.1 GCA905372675_00092 CDS open 126161-128233 _na     690_aa Peptidase%2C M48 family
93 CAJPQO010000001.1 GCA905372675_00093 CDS open 128853-129194 _na     113_aa Methyltransferase domain-containing protein
94 CAJPQO010000001.1 GCA905372675_00094 CDS open 129387-129635 _na     82_aa hypothetical protein
95 CAJPQO010000001.1 GCA905372675_00095 CDS open 129965-130897 _na     310_aa Acyltransferase
96 CAJPQO010000001.1 GCA905372675_00096 CDS open 130910-131377 _na     155_aa GNAT family N-acetyltransferase
97 CAJPQO010000001.1 GCA905372675_00097 CDS open 131455-132039 _na     194_aa Transposase DDE domain-containing protein
98 CAJPQO010000001.1 GCA905372675_00098 CDS open 132207-132674 _na     155_aa Putative ACR
99 CAJPQO010000001.1 GCA905372675_00099 CDS open 132778-132873 _na     31_aa hypothetical protein
100 CAJPQO010000001.1 GCA905372675_00100 CDS open 133092-133949 _na     285_aa Ftsk gamma domain protein
101 CAJPQO010000001.1 GCA905372675_00101 CDS open 134047-135132 _na     361_aa Nucleotidyltransferase family protein
102 CAJPQO010000001.1 GCA905372675_00102 CDS open 135228-137159 _na     643_aa wbiI Putative epimerase/dehydratase WbiI
103 CAJPQO010000001.1 GCA905372675_00103 CDS open 137234-138370 _na     378_aa DegT/DnrJ/EryC1/StrS aminotransferase family protein
104 CAJPQO010000001.1 GCA905372675_00104 CDS open 138406-139086 _na     226_aa neuD Sugar O-acyltransferase%2C sialic acid O-acetyltransferase NeuD family
105 CAJPQO010000001.1 GCA905372675_00105 CDS open 139088-139696 _na     202_aa Bacterial sugar transferase
106 CAJPQO010000001.1 GCA905372675_00106 CDS open 139706-140878 _na     390_aa Glycosyltransferase%2C group 1 family protein
107 CAJPQO010000001.1 GCA905372675_00107 CDS open 140841-141914 _na     357_aa Glycosyltransferase%2C group 1 family protein
108 CAJPQO010000001.1 GCA905372675_00108 CDS open 142108-142659 _na     183_aa serine O-acetyltransferase
109 CAJPQO010000001.1 GCA905372675_00109 CDS open 142664-143296 _na     210_aa glycosyltransferase family 2 protein
110 CAJPQO010000001.1 GCA905372675_00110 CDS open 143395-143634 _na     79_aa glycosyltransferase family 2 protein
111 CAJPQO010000001.1 GCA905372675_00111 CDS open 143704-144735 _na     343_aa glycosyltransferase
112 CAJPQO010000001.1 GCA905372675_00112 CDS open 144741-145730 _na     329_aa Glycosyltransferase 2-like domain-containing protein
113 CAJPQO010000001.1 GCA905372675_00113 CDS open 145755-146717 _na     320_aa glycosyltransferase family A protein
114 CAJPQO010000001.1 GCA905372675_00114 CDS open 146732-147898 _na     388_aa epsG EpsG family protein
115 CAJPQO010000001.1 GCA905372675_00115 CDS open 147902-148897 _na     331_aa Acyltransferase
116 CAJPQO010000001.1 GCA905372675_00116 CDS open 148974-150179 _na     401_aa Spore protein YkvP/CgeB glycosyl transferase-like domain-containing protein
117 CAJPQO010000001.1 GCA905372675_00117 CDS open 150198-151292 _na     364_aa Glycosyltransferase%2C group 1 family protein
118 CAJPQO010000001.1 GCA905372675_00118 CDS open 151289-152275 _na     328_aa Glycosyltransferase%2C group 2 family protein
119 CAJPQO010000001.1 GCA905372675_00119 CDS open 152282-152938 _na     218_aa Bacterial transferase hexapeptide repeat protein
120 CAJPQO010000001.1 GCA905372675_00120 CDS open 153013-153459 _na     148_aa LICD family protein
121 CAJPQO010000001.1 GCA905372675_00121 CDS open 153893-155035 _na     380_aa aepY phosphonopyruvate decarboxylase
122 CAJPQO010000001.1 GCA905372675_00122 CDS open 155045-156346 _na     433_aa aepX phosphoenolpyruvate mutase
123 CAJPQO010000001.1 GCA905372675_00123 CDS open 156343-157530 _na     395_aa Saccharopine dehydrogenase NADP binding domain-containing protein
124 CAJPQO010000001.1 GCA905372675_00124 CDS open 157517-158278 _na     253_aa DUF6564 domain-containing protein
125 CAJPQO010000001.1 GCA905372675_00125 CDS open 158275-159261 _na     328_aa NAD dependent epimerase/dehydratase family protein
126 CAJPQO010000001.1 GCA905372675_00126 CDS open 159292-160032 _na     246_aa Phosphodiesterase family protein
127 CAJPQO010000001.1 GCA905372675_00127 CDS open 160062-161603 _na     513_aa Polysaccharide biosynthesis protein
128 CAJPQO010000001.1 GCA905372675_00128 CDS open 161610-162473 _na     287_aa LICD family protein
129 CAJPQO010000001.1 GCA905372675_00129 CDS open 162525-163505 _na     326_aa acyltransferase family protein
130 CAJPQO010000001.1 GCA905372675_00130 CDS open 163683-164696 _na     337_aa acyltransferase family protein
131 CAJPQO010000001.1 GCA905372675_00131 CDS open 164741-165883 _na     380_aa glf UDP-galactopyranose mutase
132 CAJPQO010000001.1 GCA905372675_00132 CDS open 166519-166632 _na     37_aa hypothetical protein
133 CAJPQO010000001.1 GCA905372675_00133 CDS open 166851-167297 _na     148_aa Putative DNA-binding protein
134 CAJPQO010000001.1 GCA905372675_00134 CDS open 167465-167938 _na     157_aa hypothetical protein
135 CAJPQO010000001.1 GCA905372675_00135 CDS open 168207-168917 _na     236_aa D-alanyl-D-alanine dipeptidase
136 CAJPQO010000001.1 GCA905372675_00136 CDS open 168937-170193 _na     418_aa hypothetical protein
137 CAJPQO010000001.1 GCA905372675_00137 CDS open 170174-170674 _na     166_aa hypothetical protein
138 CAJPQO010000001.1 GCA905372675_00138 CDS open 171550-172701 _na     383_aa N-acetyltransferase domain-containing protein
139 CAJPQO010000001.1 GCA905372675_00139 CDS open 172956-174893 _na     645_aa DNA topoisomerase (ATP-hydrolyzing)
140 CAJPQO010000001.1 GCA905372675_00140 CDS open 175010-176590 _na     526_aa Peptidase%2C S41 family
141 CAJPQO010000001.1 GCA905372675_00141 CDS open 177326-177472 _na     48_aa hypothetical protein
142 CAJPQO010000001.1 GCA905372675_00142 CDS open 177540-178814 _na     424_aa Glycosyltransferase%2C group 1 family protein
143 CAJPQO010000001.1 GCA905372675_00143 CDS open 178811-179596 _na     261_aa Glycosyltransferase%2C group 2 family protein
144 CAJPQO010000001.1 GCA905372675_00144 CDS open 179745-180713 _na     322_aa Peptidase%2C M23 family
145 CAJPQO010000001.1 GCA905372675_00145 CDS open 181520-181789 _na     89_aa hypothetical protein
146 CAJPQO010000001.1 GCA905372675_00146 CDS open 181917-182690 _na     257_aa Acid phosphatase
147 CAJPQO010000001.1 GCA905372675_00147 CDS open 182776-185712 _na     978_aa TonB-dependent receptor
148 CAJPQO010000001.1 GCA905372675_00148 CDS open 185760-187097 _na     445_aa DUF4957 domain-containing protein
149 CAJPQO010000001.1 GCA905372675_00149 CDS open 187139-189049 _na     636_aa Heparinase II/III-like protein
150 CAJPQO010000001.1 GCA905372675_00150 CDS open 189124-190320 _na     398_aa Glycosyl hydrolase%2C family 88
151 CAJPQO010000001.1 GCA905372675_00151 CDS open 190653-191717 _na     354_aa Peptidase dimerization domain protein
152 CAJPQO010000001.1 GCA905372675_00152 CDS open 191763-192293 _na     176_aa hypothetical protein
153 CAJPQO010000001.1 GCA905372675_00153 CDS open 192361-193956 _na     531_aa Peptidase%2C M23 family
154 CAJPQO010000001.1 GCA905372675_00154 CDS open 194102-194995 _na     297_aa DUF4292 domain-containing protein
155 CAJPQO010000001.1 GCA905372675_00155 CDS open 194998-196791 _na     597_aa Tetratricopeptide repeat protein
156 CAJPQO010000001.1 GCA905372675_00156 CDS open 196797-197234 _na     145_aa dut dUTP diphosphatase
157 CAJPQO010000001.1 GCA905372675_00157 CDS open 197362-198750 _na     462_aa Putative dGTPase
158 CAJPQO010000001.1 GCA905372675_00158 CDS open 198754-199503 _na     249_aa OmpR/PhoB-type domain-containing protein
159 CAJPQO010000001.1 GCA905372675_00159 CDS open 199689-201704 _na     671_aa Outer membrane protein beta-barrel domain-containing protein
160 CAJPQO010000001.1 GCA905372675_00160 CDS open 201847-202833 _na     328_aa Hemolysin
161 CAJPQO010000001.1 GCA905372675_00161 CDS open 202897-203670 _na     257_aa Acyltransferase
162 CAJPQO010000001.1 GCA905372675_00162 CDS open 203889-204764 _na     291_aa Type II methyltransferase M2-MboI
163 CAJPQO010000001.1 GCA905372675_00163 CDS open 204882-205727 _na     281_aa mboI Type II restriction enzyme MboI
164 CAJPQO010000001.1 GCA905372675_00164 CDS open 205696-206685 _na     329_aa site-specific DNA-methyltransferase (adenine-specific)
165 CAJPQO010000001.1 GCA905372675_00165 CDS open 207675-209492 _na     605_aa argS arginine--tRNA ligase
166 CAJPQO010000001.1 GCA905372675_00166 CDS open 209497-209967 _na     156_aa Ribonuclease H
167 CAJPQO010000001.1 GCA905372675_00167 CDS open 210028-211008 _na     326_aa dusB tRNA dihydrouridine synthase DusB
168 CAJPQO010000001.1 GCA905372675_00168 CDS open 211055-211840 _na     261_aa Methyltransferase domain protein
169 CAJPQO010000001.1 GCA905372675_00169 CDS open 212038-212148 _na     36_aa hypothetical protein
170 CAJPQO010000001.1 GCA905372675_00170 CDS open 212413-212904 _na     163_aa nrdG anaerobic ribonucleoside-triphosphate reductase activating protein
171 CAJPQO010000001.1 GCA905372675_00171 CDS open 213096-215318 _na     740_aa anaerobic ribonucleoside triphosphate reductase
172 CAJPQO010000001.1 GCA905372675_00001 gene open 42-137
173 CAJPQO010000001.1 GCA905372675_00002 gene open 735-2576
174 CAJPQO010000001.1 GCA905372675_00003 gene open 2664-3596
175 CAJPQO010000001.1 GCA905372675_00004 gene open 3611-7030
176 CAJPQO010000001.1 GCA905372675_00005 gene open 7042-8775 susD
177 CAJPQO010000001.1 GCA905372675_00006 gene open 8863-9627
178 CAJPQO010000001.1 GCA905372675_00007 gene open 9730-10734
179 CAJPQO010000001.1 GCA905372675_00008 gene open 10760-12925
180 CAJPQO010000001.1 GCA905372675_00009 gene open 13231-15423
181 CAJPQO010000001.1 GCA905372675_00010 gene open 15525-16118
182 CAJPQO010000001.1 GCA905372675_00011 gene open 16377-16976
183 CAJPQO010000001.1 GCA905372675_00012 gene open 17133-18080
184 CAJPQO010000001.1 GCA905372675_00013 gene open 18300-19607 eno
185 CAJPQO010000001.1 GCA905372675_00014 gene open 19743-21236 cysS
186 CAJPQO010000001.1 GCA905372675_00015 gene open 21368-22246 pfkB
187 CAJPQO010000001.1 GCA905372675_00016 gene open 22251-24044
188 CAJPQO010000001.1 GCA905372675_00017 gene open 24463-24615
189 CAJPQO010000001.1 GCA905372675_00018 gene open 25003-25917
190 CAJPQO010000001.1 GCA905372675_00019 gene open 26087-26911
191 CAJPQO010000001.1 GCA905372675_00020 gene open 27046-28179
192 CAJPQO010000001.1 GCA905372675_00021 gene open 28201-28956
193 CAJPQO010000001.1 GCA905372675_00022 gene open 28989-29813 lptB
194 CAJPQO010000001.1 GCA905372675_00023 gene open 29947-30693
195 CAJPQO010000001.1 GCA905372675_00024 gene open 30704-31480
196 CAJPQO010000001.1 GCA905372675_00025 gene open 31633-32532
197 CAJPQO010000001.1 GCA905372675_00026 gene open 32564-32947
198 CAJPQO010000001.1 GCA905372675_00027 gene open 33205-33387
199 CAJPQO010000001.1 GCA905372675_00028 gene open 33819-36956
200 CAJPQO010000001.1 GCA905372675_00029 gene open 36958-38091
201 CAJPQO010000001.1 GCA905372675_00030 gene open 38106-39431
202 CAJPQO010000001.1 GCA905372675_00031 gene open 39461-40414
203 CAJPQO010000001.1 GCA905372675_00032 gene open 40419-41909
204 CAJPQO010000001.1 GCA905372675_00033 gene open 41906-43414
205 CAJPQO010000001.1 GCA905372675_00034 gene open 43622-44713 dinB
206 CAJPQO010000001.1 GCA905372675_00035 gene open 45673-47100
207 CAJPQO010000001.1 GCA905372675_00036 gene open 47076-49088 porZ
208 CAJPQO010000001.1 GCA905372675_00037 gene open 49093-49716
209 CAJPQO010000001.1 GCA905372675_00038 gene open 49768-50751
210 CAJPQO010000001.1 GCA905372675_00039 gene open 50897-53800 leuS
211 CAJPQO010000001.1 GCA905372675_00040 gene open 54682-56376
212 CAJPQO010000001.1 GCA905372675_00041 gene open 56770-58017
213 CAJPQO010000001.1 GCA905372675_00042 gene open 57998-58951
214 CAJPQO010000001.1 GCA905372675_00043 gene open 59129-61750 mutS
215 CAJPQO010000001.1 GCA905372675_00044 gene open 61812-62621
216 CAJPQO010000001.1 GCA905372675_00045 gene open 62655-64715 sbsA
217 CAJPQO010000001.1 GCA905372675_00046 gene open 64917-66425
218 CAJPQO010000001.1 GCA905372675_00047 gene open 66622-67446 lgt
219 CAJPQO010000001.1 GCA905372675_00048 gene open 67484-67894
220 CAJPQO010000001.1 GCA905372675_00049 gene open 68320-69420 ychF
221 CAJPQO010000001.1 GCA905372675_00050 gene open 69915-70088
222 CAJPQO010000001.1 GCA905372675_00051 gene open 70085-71095
223 CAJPQO010000001.1 GCA905372675_00052 gene open 71116-73878 polA
224 CAJPQO010000001.1 GCA905372675_00053 gene open 73964-74941
225 CAJPQO010000001.1 GCA905372675_00054 gene open 75203-76315
226 CAJPQO010000001.1 GCA905372675_00055 gene open 76400-77875 algI
227 CAJPQO010000001.1 GCA905372675_00056 gene open 77872-79260
228 CAJPQO010000001.1 GCA905372675_00057 gene open 79306-80244 deoC
229 CAJPQO010000001.1 GCA905372675_00058 gene open 80332-80673 mazG
230 CAJPQO010000001.1 GCA905372675_00059 gene open 80806-81258 dtd
231 CAJPQO010000001.1 GCA905372675_00060 gene open 82721-84556 uvrC
232 CAJPQO010000001.1 GCA905372675_00061 gene open 85217-85747
233 CAJPQO010000001.1 GCA905372675_00062 gene open 85844-87715 mnmG
234 CAJPQO010000001.1 GCA905372675_00063 gene open 88004-88690
235 CAJPQO010000001.1 GCA905372675_00064 gene open 88721-90703 sdhA
236 CAJPQO010000001.1 GCA905372675_00065 gene open 90756-90914
237 CAJPQO010000001.1 GCA905372675_00066 gene open 90946-91701
238 CAJPQO010000001.1 GCA905372675_00067 gene open 92918-94687
239 CAJPQO010000001.1 GCA905372675_00068 gene open 94954-95976 pta
240 CAJPQO010000001.1 GCA905372675_00069 gene open 96023-97225
241 CAJPQO010000001.1 GCA905372675_00070 gene open 97385-98935 rmuC
242 CAJPQO010000001.1 GCA905372675_00071 gene open 99740-100699
243 CAJPQO010000001.1 GCA905372675_00072 gene open 100696-101835
244 CAJPQO010000001.1 GCA905372675_00073 gene open 101924-103174
245 CAJPQO010000001.1 GCA905372675_00074 gene open 103140-103649 gldH
246 CAJPQO010000001.1 GCA905372675_00075 gene open 103891-105891
247 CAJPQO010000001.1 GCA905372675_00076 gene open 105978-109937
248 CAJPQO010000001.1 GCA905372675_00077 gene open 110886-110984
249 CAJPQO010000001.1 GCA905372675_00078 gene open 111923-112549
250 CAJPQO010000001.1 GCA905372675_00079 gene open 112577-113617
251 CAJPQO010000001.1 GCA905372675_00080 gene open 113614-114369
252 CAJPQO010000001.1 GCA905372675_00081 gene open 114417-115643
253 CAJPQO010000001.1 GCA905372675_00082 gene open 115624-117321
254 CAJPQO010000001.1 GCA905372675_00083 gene open 117302-118345
255 CAJPQO010000001.1 GCA905372675_00084 gene open 119134-121155
256 CAJPQO010000001.1 GCA905372675_00085 gene open 121294-122328 ruvB
257 CAJPQO010000001.1 GCA905372675_00086 gene open 122478-122693
258 CAJPQO010000001.1 GCA905372675_00087 gene open 122656-123228
259 CAJPQO010000001.1 GCA905372675_00088 gene open 123513-123950 coaD
260 CAJPQO010000001.1 GCA905372675_00089 gene open 123963-124373 ybeY
261 CAJPQO010000001.1 GCA905372675_00090 gene open 124458-125675
262 CAJPQO010000001.1 GCA905372675_00091 gene open 125665-126135
263 CAJPQO010000001.1 GCA905372675_00092 gene open 126161-128233
264 CAJPQO010000001.1 GCA905372675_00093 gene open 128853-129194
265 CAJPQO010000001.1 GCA905372675_00094 gene open 129387-129635
266 CAJPQO010000001.1 GCA905372675_00095 gene open 129965-130897
267 CAJPQO010000001.1 GCA905372675_00096 gene open 130910-131377
268 CAJPQO010000001.1 GCA905372675_00097 gene open 131455-132039
269 CAJPQO010000001.1 GCA905372675_00098 gene open 132207-132674
270 CAJPQO010000001.1 GCA905372675_00099 gene open 132778-132873
271 CAJPQO010000001.1 GCA905372675_00100 gene open 133092-133949
272 CAJPQO010000001.1 GCA905372675_00101 gene open 134047-135132
273 CAJPQO010000001.1 GCA905372675_00102 gene open 135228-137159 wbiI
274 CAJPQO010000001.1 GCA905372675_00103 gene open 137234-138370
275 CAJPQO010000001.1 GCA905372675_00104 gene open 138406-139086 neuD
276 CAJPQO010000001.1 GCA905372675_00105 gene open 139088-139696
277 CAJPQO010000001.1 GCA905372675_00106 gene open 139706-140878
278 CAJPQO010000001.1 GCA905372675_00107 gene open 140841-141914
279 CAJPQO010000001.1 GCA905372675_00108 gene open 142108-142659
280 CAJPQO010000001.1 GCA905372675_00109 gene open 142664-143296
281 CAJPQO010000001.1 GCA905372675_00110 gene open 143395-143634
282 CAJPQO010000001.1 GCA905372675_00111 gene open 143704-144735
283 CAJPQO010000001.1 GCA905372675_00112 gene open 144741-145730
284 CAJPQO010000001.1 GCA905372675_00113 gene open 145755-146717
285 CAJPQO010000001.1 GCA905372675_00114 gene open 146732-147898 epsG
286 CAJPQO010000001.1 GCA905372675_00115 gene open 147902-148897
287 CAJPQO010000001.1 GCA905372675_00116 gene open 148974-150179
288 CAJPQO010000001.1 GCA905372675_00117 gene open 150198-151292
289 CAJPQO010000001.1 GCA905372675_00118 gene open 151289-152275
290 CAJPQO010000001.1 GCA905372675_00119 gene open 152282-152938
291 CAJPQO010000001.1 GCA905372675_00120 gene open 153013-153459
292 CAJPQO010000001.1 GCA905372675_00121 gene open 153893-155035 aepY
293 CAJPQO010000001.1 GCA905372675_00122 gene open 155045-156346 aepX
294 CAJPQO010000001.1 GCA905372675_00123 gene open 156343-157530
295 CAJPQO010000001.1 GCA905372675_00124 gene open 157517-158278
296 CAJPQO010000001.1 GCA905372675_00125 gene open 158275-159261
297 CAJPQO010000001.1 GCA905372675_00126 gene open 159292-160032
298 CAJPQO010000001.1 GCA905372675_00127 gene open 160062-161603
299 CAJPQO010000001.1 GCA905372675_00128 gene open 161610-162473
300 CAJPQO010000001.1 GCA905372675_00129 gene open 162525-163505
301 CAJPQO010000001.1 GCA905372675_00130 gene open 163683-164696
302 CAJPQO010000001.1 GCA905372675_00131 gene open 164741-165883 glf
303 CAJPQO010000001.1 GCA905372675_00132 gene open 166519-166632
304 CAJPQO010000001.1 GCA905372675_00133 gene open 166851-167297
305 CAJPQO010000001.1 GCA905372675_00134 gene open 167465-167938
306 CAJPQO010000001.1 GCA905372675_00135 gene open 168207-168917
307 CAJPQO010000001.1 GCA905372675_00136 gene open 168937-170193
308 CAJPQO010000001.1 GCA905372675_00137 gene open 170174-170674
309 CAJPQO010000001.1 GCA905372675_00138 gene open 171550-172701
310 CAJPQO010000001.1 GCA905372675_00139 gene open 172956-174893
311 CAJPQO010000001.1 GCA905372675_00140 gene open 175010-176590
312 CAJPQO010000001.1 GCA905372675_00141 gene open 177326-177472
313 CAJPQO010000001.1 GCA905372675_00142 gene open 177540-178814
314 CAJPQO010000001.1 GCA905372675_00143 gene open 178811-179596
315 CAJPQO010000001.1 GCA905372675_00144 gene open 179745-180713
316 CAJPQO010000001.1 GCA905372675_00145 gene open 181520-181789
317 CAJPQO010000001.1 GCA905372675_00146 gene open 181917-182690
318 CAJPQO010000001.1 GCA905372675_00147 gene open 182776-185712
319 CAJPQO010000001.1 GCA905372675_00148 gene open 185760-187097
320 CAJPQO010000001.1 GCA905372675_00149 gene open 187139-189049
321 CAJPQO010000001.1 GCA905372675_00150 gene open 189124-190320
322 CAJPQO010000001.1 GCA905372675_00151 gene open 190653-191717
323 CAJPQO010000001.1 GCA905372675_00152 gene open 191763-192293
324 CAJPQO010000001.1 GCA905372675_00153 gene open 192361-193956
325 CAJPQO010000001.1 GCA905372675_00154 gene open 194102-194995
326 CAJPQO010000001.1 GCA905372675_00155 gene open 194998-196791
327 CAJPQO010000001.1 GCA905372675_00156 gene open 196797-197234 dut
328 CAJPQO010000001.1 GCA905372675_00157 gene open 197362-198750
329 CAJPQO010000001.1 GCA905372675_00158 gene open 198754-199503
330 CAJPQO010000001.1 GCA905372675_00159 gene open 199689-201704
331 CAJPQO010000001.1 GCA905372675_00160 gene open 201847-202833
332 CAJPQO010000001.1 GCA905372675_00161 gene open 202897-203670
333 CAJPQO010000001.1 GCA905372675_00162 gene open 203889-204764
334 CAJPQO010000001.1 GCA905372675_00163 gene open 204882-205727 mboI
335 CAJPQO010000001.1 GCA905372675_00164 gene open 205696-206685
336 CAJPQO010000001.1 GCA905372675_00165 gene open 207675-209492 argS
337 CAJPQO010000001.1 GCA905372675_00166 gene open 209497-209967
338 CAJPQO010000001.1 GCA905372675_00167 gene open 210028-211008 dusB
339 CAJPQO010000001.1 GCA905372675_00168 gene open 211055-211840
340 CAJPQO010000001.1 GCA905372675_00169 gene open 212038-212148
341 CAJPQO010000001.1 GCA905372675_00170 gene open 212413-212904 nrdG
342 CAJPQO010000001.1 GCA905372675_00171 gene open 213096-215318
343 CAJPQO010000002.1 regulatory_region open 192003-192077 L13-Bacteroidia ribosomal protein leader
344 CAJPQO010000002.1 repeat_region open 110664-111367 CRISPR array with 11 repeats of length 36%2C consensus sequence GTTGTTTTTACCCCTCAAAAAGGAGGTAGACACAAC and spacer length 29
345 CAJPQO010000002.1 GCA905372675_00173 CDS open 274-573 _na     99_aa hpf ribosome hibernation-promoting factor%2C HPF/YfiA family
346 CAJPQO010000002.1 GCA905372675_00174 CDS open 599-1486 _na     295_aa xerA site-specific tyrosine recombinase/integron integrase
347 CAJPQO010000002.1 GCA905372675_00175 CDS open 1558-1749 _na     63_aa rpsU 30S ribosomal protein S21
348 CAJPQO010000002.1 GCA905372675_00176 CDS open 2460-3974 _na     504_aa DUF5018 domain-containing protein
349 CAJPQO010000002.1 GCA905372675_00177 CDS open 3976-4434 _na     152_aa DUF1735 domain-containing protein
350 CAJPQO010000002.1 GCA905372675_00178 CDS open 4439-5839 _na     466_aa susD SusD family protein
351 CAJPQO010000002.1 GCA905372675_00179 CDS open 5861-8944 _na     1027_aa TonB-dependent receptor plug domain protein
352 CAJPQO010000002.1 GCA905372675_00180 CDS open 9656-10996 _na     446_aa mtaB tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB
353 CAJPQO010000002.1 GCA905372675_00181 CDS open 11020-12105 _na     361_aa Glycosyltransferase%2C group 2 family protein
354 CAJPQO010000002.1 GCA905372675_00182 CDS open 12198-13910 _na     570_aa Glycosyl hydrolase-like 10 domain-containing protein
355 CAJPQO010000002.1 GCA905372675_00183 CDS open 14070-14558 _na     162_aa Outer membrane protein beta-barrel domain-containing protein
356 CAJPQO010000002.1 GCA905372675_00184 CDS open 15349-15783 _na     144_aa DUF6078 domain-containing protein
357 CAJPQO010000002.1 GCA905372675_00185 CDS open 16038-16289 _na     83_aa helix-turn-helix transcriptional regulator
358 CAJPQO010000002.1 GCA905372675_00186 CDS open 16286-16618 _na     110_aa hipA HipA N-terminal domain-containing protein
359 CAJPQO010000002.1 GCA905372675_00187 CDS open 16611-17555 _na     314_aa hipA HipA domain-containing protein
360 CAJPQO010000002.1 GCA905372675_00188 CDS open 17538-18908 _na     456_aa tRNA(Ile)-lysidine synthase
361 CAJPQO010000002.1 GCA905372675_00189 CDS open 19017-20204 _na     395_aa Putative 23S rRNA m5C1962 methyltransferase
362 CAJPQO010000002.1 GCA905372675_00190 CDS open 20216-20854 _na     212_aa 3'-5' exonuclease
363 CAJPQO010000002.1 GCA905372675_00191 CDS open 20962-23406 _na     814_aa FtsK/SpoIIIE family protein
364 CAJPQO010000002.1 GCA905372675_00192 CDS open 23431-24045 _na     204_aa lolA Outer membrane lipoprotein carrier protein LolA
365 CAJPQO010000002.1 GCA905372675_00193 CDS open 24057-25568 _na     503_aa ATP synthase F0%2C A subunit
366 CAJPQO010000002.1 GCA905372675_00194 CDS open 25665-27362 _na     565_aa putative transporter
367 CAJPQO010000002.1 GCA905372675_00195 CDS open 27833-28552 _na     239_aa arsG aromatic aminobenezylarsenical efflux permease ArsG family transporter
368 CAJPQO010000002.1 GCA905372675_00196 CDS open 28567-28998 _na     143_aa arsF nitrophenyl compound nitroreductase subunit ArsF family protein
369 CAJPQO010000002.1 GCA905372675_00197 CDS open 29028-29267 _na     79_aa thioredoxin family protein
370 CAJPQO010000002.1 GCA905372675_00198 CDS open 29303-31030 _na     575_aa DUF6850 domain-containing protein
371 CAJPQO010000002.1 GCA905372675_00199 CDS open 31074-33863 _na     929_aa TonB-dependent receptor
372 CAJPQO010000002.1 GCA905372675_00200 CDS open 33905-35167 _na     420_aa LTD domain-containing protein
373 CAJPQO010000002.1 GCA905372675_00201 CDS open 35192-35302 _na     36_aa hypothetical protein
374 CAJPQO010000002.1 GCA905372675_00202 CDS open 35664-36530 _na     288_aa DNA adenine methylase
375 CAJPQO010000002.1 GCA905372675_00203 CDS open 36713-37015 _na     100_aa hypothetical protein
376 CAJPQO010000002.1 GCA905372675_00204 CDS open 37027-42807 _na     1926_aa hypothetical protein
377 CAJPQO010000002.1 GCA905372675_00205 CDS open 42981-43700 _na     239_aa hypothetical protein
378 CAJPQO010000002.1 GCA905372675_00206 CDS open 43702-44529 _na     275_aa hypothetical protein
379 CAJPQO010000002.1 GCA905372675_00207 CDS open 44522-45043 _na     173_aa hypothetical protein
380 CAJPQO010000002.1 GCA905372675_00208 CDS open 45033-45845 _na     270_aa Baseplate protein J-like domain-containing protein
381 CAJPQO010000002.1 GCA905372675_00209 CDS open 45881-46156 _na     91_aa lysM LysM domain-containing protein
382 CAJPQO010000002.1 GCA905372675_00210 CDS open 46141-46596 _na     151_aa hypothetical protein
383 CAJPQO010000002.1 GCA905372675_00211 CDS open 46607-47050 _na     147_aa N-acetylmuramoyl-L-alanine amidase
384 CAJPQO010000002.1 GCA905372675_00212 CDS open 47047-47538 _na     163_aa phage holin family protein
385 CAJPQO010000002.1 GCA905372675_00213 CDS open 47550-47855 _na     101_aa hypothetical protein
386 CAJPQO010000002.1 GCA905372675_00214 CDS open 47860-48324 _na     154_aa ytfJ Sporulation protein YtfJ
387 CAJPQO010000002.1 GCA905372675_00215 CDS open 48332-49285 _na     317_aa Phage tail protein
388 CAJPQO010000002.1 GCA905372675_00216 CDS open 49289-49918 _na     209_aa DUF6046 domain-containing protein
389 CAJPQO010000002.1 GCA905372675_00217 CDS open 49935-51695 _na     586_aa Tape measure protein N-terminal domain-containing protein
390 CAJPQO010000002.1 GCA905372675_00218 CDS open 51864-52148 _na     94_aa pqqD PqqD family protein
391 CAJPQO010000002.1 GCA905372675_00219 CDS open 52170-52577 _na     135_aa hypothetical protein
392 CAJPQO010000002.1 GCA905372675_00220 CDS open 52634-53788 _na     384_aa DUF2586 domain-containing protein
393 CAJPQO010000002.1 GCA905372675_00221 CDS open 53839-54750 _na     303_aa Phage capsid family protein
394 CAJPQO010000002.1 GCA905372675_00222 CDS open 54797-55906 _na     369_aa head maturation protease%2C ClpP-related
395 CAJPQO010000002.1 GCA905372675_00223 CDS open 56090-56545 _na     151_aa terminase gpP N-terminus-related DNA-binding protein
396 CAJPQO010000002.1 GCA905372675_00224 CDS open 56542-58077 _na     511_aa Terminase
397 CAJPQO010000002.1 GCA905372675_00225 CDS open 58079-58519 _na     146_aa DUF1320 domain-containing protein
398 CAJPQO010000002.1 GCA905372675_00226 CDS open 58545-59873 _na     442_aa DUF935 domain-containing protein
399 CAJPQO010000002.1 GCA905372675_00227 CDS open 60026-61294 _na     422_aa phage minor head protein
400 CAJPQO010000002.1 GCA905372675_00228 CDS open 61272-61382 _na     36_aa hypothetical protein
401 CAJPQO010000002.1 GCA905372675_00229 CDS open 61408-62007 _na     199_aa Phage virion morphogenesis protein
402 CAJPQO010000002.1 GCA905372675_00230 CDS open 61988-62479 _na     163_aa Gp37 protein
403 CAJPQO010000002.1 GCA905372675_00231 CDS open 62421-62711 _na     96_aa transposase
404 CAJPQO010000002.1 GCA905372675_00232 CDS open 62789-63454 _na     221_aa DUF3164 domain-containing protein
405 CAJPQO010000002.1 GCA905372675_00233 CDS open 63461-63928 _na     155_aa Mobilization protein
406 CAJPQO010000002.1 GCA905372675_00234 CDS open 63885-64223 _na     112_aa Phage protein
407 CAJPQO010000002.1 GCA905372675_00235 CDS open 64342-64560 _na     72_aa Rubredoxin-like domain-containing protein
408 CAJPQO010000002.1 GCA905372675_00236 CDS open 64578-65045 _na     155_aa putative dsRNA-binding protein
409 CAJPQO010000002.1 GCA905372675_00237 CDS open 65054-65239 _na     61_aa hypothetical protein
410 CAJPQO010000002.1 GCA905372675_00238 CDS open 65331-65567 _na     78_aa hypothetical protein
411 CAJPQO010000002.1 GCA905372675_00239 CDS open 65511-65702 _na     63_aa hypothetical protein
412 CAJPQO010000002.1 GCA905372675_00240 CDS open 65729-66019 _na     96_aa hypothetical protein
413 CAJPQO010000002.1 GCA905372675_00241 CDS open 66022-66645 _na     207_aa AAA family ATPase
414 CAJPQO010000002.1 GCA905372675_00242 CDS open 66648-66839 _na     63_aa hypothetical protein
415 CAJPQO010000002.1 GCA905372675_00243 CDS open 66836-67714 _na     292_aa ATP-binding protein
416 CAJPQO010000002.1 GCA905372675_00244 CDS open 67750-69756 _na     668_aa Kinase
417 CAJPQO010000002.1 GCA905372675_00245 CDS open 69771-70169 _na     132_aa hypothetical protein
418 CAJPQO010000002.1 GCA905372675_00246 CDS open 70186-70584 _na     132_aa hypothetical protein
419 CAJPQO010000002.1 GCA905372675_00247 CDS open 70695-71408 _na     237_aa helix-turn-helix transcriptional regulator
420 CAJPQO010000002.1 GCA905372675_00248 CDS open 71851-72078 _na     75_aa DUF190 domain-containing protein
421 CAJPQO010000002.1 GCA905372675_00249 CDS open 73059-74279 _na     406_aa 3-deoxy-D-manno-octulosonic acid transferase
422 CAJPQO010000002.1 GCA905372675_00250 CDS open 74304-75821 _na     505_aa gltX glutamate--tRNA ligase
423 CAJPQO010000002.1 GCA905372675_00251 CDS open 75864-78005 _na     713_aa 7TM receptor with intracellular HD hydrolase
424 CAJPQO010000002.1 GCA905372675_00252 CDS open 78116-79045 _na     309_aa hypothetical protein
425 CAJPQO010000002.1 GCA905372675_00253 CDS open 79111-79590 _na     159_aa DUF4476 domain-containing protein
426 CAJPQO010000002.1 GCA905372675_00254 CDS open 79654-80277 _na     207_aa CHAP domain protein
427 CAJPQO010000002.1 GCA905372675_00255 CDS open 80468-80620 _na     50_aa hypothetical protein
428 CAJPQO010000002.1 GCA905372675_00256 CDS open 80914-83103 _na     729_aa Glutamate--ammonia ligase%2C catalytic domain protein
429 CAJPQO010000002.1 GCA905372675_00257 CDS open 83146-84318 _na     390_aa Acyltransferase 3 domain-containing protein
430 CAJPQO010000002.1 GCA905372675_00258 CDS open 84324-85208 _na     294_aa DUF2179 domain-containing protein
431 CAJPQO010000002.1 GCA905372675_00259 CDS open 85394-86623 _na     409_aa Efflux ABC transporter%2C permease protein
432 CAJPQO010000002.1 GCA905372675_00260 CDS open 86626-86868 _na     80_aa Ribosome-binding factor A
433 CAJPQO010000002.1 GCA905372675_00261 CDS open 87035-87868 _na     277_aa murI glutamate racemase
434 CAJPQO010000002.1 GCA905372675_00262 CDS open 87881-88408 _na     175_aa Outer membrane protein
435 CAJPQO010000002.1 GCA905372675_00263 CDS open 88526-89026 _na     166_aa Outer membrane protein
436 CAJPQO010000002.1 GCA905372675_00264 CDS open 89068-89580 _na     170_aa Outer membrane protein
437 CAJPQO010000002.1 GCA905372675_00265 CDS open 89651-92224 _na     857_aa Outer membrane protein%2C OMP85 family
438 CAJPQO010000002.1 GCA905372675_00266 CDS open 92296-93033 _na     245_aa isoprenyl transferase
439 CAJPQO010000002.1 GCA905372675_00267 CDS open 93033-93713 _na     226_aa DUF6089 domain-containing protein
440 CAJPQO010000002.1 GCA905372675_00268 CDS open 93756-95183 _na     475_aa DUF6242 domain-containing protein
441 CAJPQO010000002.1 GCA905372675_00269 CDS open 95506-95730 _na     74_aa hypothetical protein
442 CAJPQO010000002.1 GCA905372675_00270 CDS open 96617-98284 _na     555_aa AMP-binding enzyme
443 CAJPQO010000002.1 GCA905372675_00271 CDS open 98353-100020 _na     555_aa AMP-binding enzyme
444 CAJPQO010000002.1 GCA905372675_00272 CDS open 100314-101141 _na     275_aa coaW type II pantothenate kinase
445 CAJPQO010000002.1 GCA905372675_00273 CDS open 101181-103178 _na     665_aa ligA NAD-dependent DNA ligase LigA
446 CAJPQO010000002.1 GCA905372675_00274 CDS open 103238-104044 _na     268_aa DUF4738 domain-containing protein
447 CAJPQO010000002.1 GCA905372675_00275 CDS open 104067-105383 _na     438_aa UDP-glucose 6-dehydrogenase
448 CAJPQO010000002.1 GCA905372675_00276 CDS open 105423-106022 _na     199_aa rfbC dTDP-4-dehydrorhamnose 3%2C5-epimerase
449 CAJPQO010000002.1 GCA905372675_00277 CDS open 106085-106900 _na     271_aa thiF ThiF family protein
450 CAJPQO010000002.1 GCA905372675_00278 CDS open 108175-109017 _na     280_aa ompA OmpA family protein
451 CAJPQO010000002.1 GCA905372675_00279 CDS open 109114-110007 _na     297_aa Putative membrane protein
452 CAJPQO010000002.1 GCA905372675_00280 CDS open 111404-111949 _na     181_aa csx28 CRISPR-associated protein Csx28
453 CAJPQO010000002.1 GCA905372675_00281 CDS open 111949-115401 _na     1150_aa cas13b type VI-B CRISPR-associated RNA-guided ribonuclease Cas13b
454 CAJPQO010000002.1 GCA905372675_00282 CDS open 115687-119457 _na     1256_aa purL phosphoribosylformylglycinamidine synthase
455 CAJPQO010000002.1 GCA905372675_00283 CDS open 119502-120089 _na     195_aa Chromate transport protein
456 CAJPQO010000002.1 GCA905372675_00284 CDS open 120201-120776 _na     191_aa Chromate transport protein
457 CAJPQO010000002.1 GCA905372675_00285 CDS open 121270-121656 _na     128_aa doxX DoxX family protein
458 CAJPQO010000002.1 GCA905372675_00286 CDS open 122052-122372 _na     106_aa Heavy metal-associated domain protein
459 CAJPQO010000002.1 GCA905372675_00287 CDS open 122527-123777 _na     416_aa Efflux transporter%2C RND family%2C MFP subunit
460 CAJPQO010000002.1 GCA905372675_00288 CDS open 123791-125062 _na     423_aa Outer membrane efflux protein
461 CAJPQO010000002.1 GCA905372675_00289 CDS open 125111-125287 _na     58_aa hypothetical protein
462 CAJPQO010000002.1 GCA905372675_00290 CDS open 125332-128982 _na     1216_aa czcA Heavy metal efflux pump%2C CzcA family
463 CAJPQO010000002.1 GCA905372675_00291 CDS open 129206-129589 _na     127_aa hypothetical protein
464 CAJPQO010000002.1 GCA905372675_00292 CDS open 129851-130000 _na     49_aa hypothetical protein
465 CAJPQO010000002.1 GCA905372675_00293 CDS open 130031-130567 _na     178_aa hypothetical protein
466 CAJPQO010000002.1 GCA905372675_00294 CDS open 130961-132145 _na     394_aa Phosphate-selective porin O and P
467 CAJPQO010000002.1 GCA905372675_00295 CDS open 132170-133591 _na     473_aa rlmD 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD
468 CAJPQO010000002.1 GCA905372675_00296 CDS open 133723-136446 _na     907_aa ppdK pyruvate%2C phosphate dikinase
469 CAJPQO010000002.1 GCA905372675_00297 CDS open 136759-137124 _na     121_aa DUF2023 domain-containing protein
470 CAJPQO010000002.1 GCA905372675_00298 CDS open 137213-137707 _na     164_aa fldA flavodoxin FldA
471 CAJPQO010000002.1 GCA905372675_00299 CDS open 138094-138456 _na     120_aa DUF4168 domain-containing protein
472 CAJPQO010000002.1 GCA905372675_00300 CDS open 138802-140337 _na     511_aa Ribonuclease Y
473 CAJPQO010000002.1 GCA905372675_00301 CDS open 140453-140767 _na     104_aa zapA Cell division protein ZapA
474 CAJPQO010000002.1 GCA905372675_00302 CDS open 140760-141068 _na     102_aa zapB Cell division protein ZapB
475 CAJPQO010000002.1 GCA905372675_00303 CDS open 141198-141818 _na     206_aa Bacteriophage Mx8 p63 C-terminal domain-containing protein
476 CAJPQO010000002.1 GCA905372675_00304 CDS open 142744-145686 _na     980_aa TonB-dependent receptor
477 CAJPQO010000002.1 GCA905372675_00305 CDS open 145700-146104 _na     134_aa DUF3823 domain-containing protein
478 CAJPQO010000002.1 GCA905372675_00306 CDS open 146264-146776 _na     170_aa Secretion system C-terminal sorting domain-containing protein
479 CAJPQO010000002.1 GCA905372675_00307 CDS open 146791-147921 _na     376_aa DUF4876 domain-containing protein
480 CAJPQO010000002.1 GCA905372675_00308 CDS open 147941-149062 _na     373_aa DUF4876 domain-containing protein
481 CAJPQO010000002.1 GCA905372675_00309 CDS open 149514-151205 _na     563_aa DUF6850 domain-containing protein
482 CAJPQO010000002.1 GCA905372675_00310 CDS open 151293-154109 _na     938_aa Peptidase M16 inactive domain protein
483 CAJPQO010000002.1 GCA905372675_00311 CDS open 154265-154369 _na     34_aa hypothetical protein
484 CAJPQO010000002.1 GCA905372675_00312 CDS open 154864-157179 _na     771_aa pnp polyribonucleotide nucleotidyltransferase
485 CAJPQO010000002.1 GCA905372675_00313 CDS open 157459-160893 _na     1144_aa hypothetical protein
486 CAJPQO010000002.1 GCA905372675_00314 CDS open 160967-161485 _na     172_aa Sigma-70 region 2
487 CAJPQO010000002.1 GCA905372675_00315 CDS open 161819-162820 _na     333_aa Lactate/malate dehydrogenase%2C NAD binding domain protein
488 CAJPQO010000002.1 GCA905372675_00316 CDS open 162862-163026 _na     54_aa hypothetical protein
489 CAJPQO010000002.1 GCA905372675_00317 CDS open 163072-164862 _na     596_aa Creatinase
490 CAJPQO010000002.1 GCA905372675_00318 CDS open 165136-165831 _na     231_aa DUF4294 domain-containing protein
491 CAJPQO010000002.1 GCA905372675_00319 CDS open 165908-168022 _na     704_aa Dipeptidyl-peptidase
492 CAJPQO010000002.1 GCA905372675_00320 CDS open 168038-169531 _na     497_aa Polysaccharide biosynthesis protein
493 CAJPQO010000002.1 GCA905372675_00321 CDS open 169650-170012 _na     120_aa four helix bundle protein
494 CAJPQO010000002.1 GCA905372675_00322 CDS open 170132-171364 _na     410_aa Transporter gate domain protein
495 CAJPQO010000002.1 GCA905372675_00323 CDS open 171826-171978 _na     50_aa hypothetical protein
496 CAJPQO010000002.1 GCA905372675_00324 CDS open 172213-173907 _na     564_aa rluA Pseudouridine synthase%2C RluA family
497 CAJPQO010000002.1 GCA905372675_00325 CDS open 174164-174700 _na     178_aa Hydrolase%2C NUDIX family
498 CAJPQO010000002.1 GCA905372675_00326 CDS open 174864-175019 _na     51_aa rpmH 50S ribosomal protein L34
499 CAJPQO010000002.1 GCA905372675_00327 CDS open 175172-175738 _na     188_aa efp elongation factor P
500 CAJPQO010000002.1 GCA905372675_00328 CDS open 175895-176944 _na     349_aa Glycosyltransferase%2C group 2 family protein