HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Hoylesella saccharolytica (GCA_905372675.1)

Select a Genome:
BAKTA Annotations for GCA_905372675.1
Genome Selected: Hoylesella saccharolytica
ContigsBases CDSrRNA tmRNAtRNA
73 2409554 1915 0 1 28
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3893 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:2]    |    Number of Records Found: 3893 [8 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
501 CAJPQO010000002.1 GCA905372675_00329 CDS open 176975-177652 _na     225_aa radC DNA repair protein RadC
502 CAJPQO010000002.1 GCA905372675_00330 CDS open 177924-180626 _na     900_aa DNA gyrase/topoisomerase IV subunit A
503 CAJPQO010000002.1 GCA905372675_00331 CDS open 180643-181515 _na     290_aa DUF3316 domain-containing protein
504 CAJPQO010000002.1 GCA905372675_00332 CDS open 181512-182522 _na     336_aa Peptidase%2C S41 family
505 CAJPQO010000002.1 GCA905372675_00334 CDS open 184120-186108 _na     662_aa Glycosyl hydrolase family 2%2C sugar binding domain protein
506 CAJPQO010000002.1 GCA905372675_00335 CDS open 186359-187462 _na     367_aa Putative carbohydrate metabolism domain-containing protein
507 CAJPQO010000002.1 GCA905372675_00336 CDS open 187472-188431 _na     319_aa Outer membrane protein beta-barrel domain-containing protein
508 CAJPQO010000002.1 GCA905372675_00337 CDS open 188685-189677 _na     330_aa tsf translation elongation factor Ts
509 CAJPQO010000002.1 GCA905372675_00338 CDS open 189773-190735 _na     320_aa rpsB 30S ribosomal protein S2
510 CAJPQO010000002.1 GCA905372675_00339 CDS open 191085-191471 _na     128_aa rpsI 30S ribosomal protein S9
511 CAJPQO010000002.1 GCA905372675_00340 CDS open 191486-191947 _na     153_aa rplM 50S ribosomal protein L13
512 CAJPQO010000002.1 GCA905372675_00341 CDS open 192925-195240 _na     771_aa topA type I DNA topoisomerase
513 CAJPQO010000002.1 GCA905372675_00342 CDS open 195268-195795 _na     175_aa shikimate kinase
514 CAJPQO010000002.1 GCA905372675_00343 CDS open 195856-197748 _na     630_aa speA biosynthetic arginine decarboxylase
515 CAJPQO010000002.1 GCA905372675_00344 CDS open 197767-197934 _na     55_aa hypothetical protein
516 CAJPQO010000002.1 GCA905372675_00345 CDS open 197947-198735 _na     262_aa Acetylglutamate kinase
517 CAJPQO010000002.1 GCA905372675_00346 CDS open 198795-199307 _na     170_aa Sigma-70 region 2
518 CAJPQO010000002.1 GCA905372675_00347 CDS open 199297-199779 _na     160_aa Pyruvate ferredoxin oxidoreductase
519 CAJPQO010000002.1 GCA905372675_00348 CDS open 199995-200432 _na     145_aa Phosphatidic acid phosphatase type 2/haloperoxidase domain-containing protein
520 CAJPQO010000002.1 GCA905372675_00349 CDS open 200737-202074 _na     445_aa Transporter%2C major facilitator family protein
521 CAJPQO010000002.1 GCA905372675_00350 CDS open 202602-203627 _na     341_aa Sugar-binding domain protein
522 CAJPQO010000002.1 GCA905372675_00351 CDS open 204192-207230 _na     1012_aa TonB-dependent receptor plug domain protein
523 CAJPQO010000002.1 GCA905372675_00352 CDS open 207250-208848 _na     532_aa susD SusD family protein
524 CAJPQO010000002.1 GCA905372675_00353 CDS open 208915-210135 _na     406_aa susE SusE outer membrane protein domain-containing protein
525 CAJPQO010000002.1 GCA905372675_00354 CDS open 210197-211603 _na     468_aa Outer membrane protein SusF_SusE
526 CAJPQO010000002.1 GCA905372675_00355 CDS open 211777-212388 _na     203_aa hypothetical protein
527 CAJPQO010000002.1 GCA905372675_00356 CDS open 212401-212955 _na     184_aa Corrinoid adenosyltransferase
528 CAJPQO010000002.1 GCA905372675_00357 CDS open 213014-213235 _na     73_aa DUF2795 domain-containing protein
529 CAJPQO010000002.1 GCA905372675_00358 CDS open 213929-214522 _na     197_aa Lipoprotein
530 CAJPQO010000002.1 GCA905372675_00173 gene open 274-573 hpf
531 CAJPQO010000002.1 GCA905372675_00174 gene open 599-1486 xerA
532 CAJPQO010000002.1 GCA905372675_00175 gene open 1558-1749 rpsU
533 CAJPQO010000002.1 GCA905372675_00176 gene open 2460-3974
534 CAJPQO010000002.1 GCA905372675_00177 gene open 3976-4434
535 CAJPQO010000002.1 GCA905372675_00178 gene open 4439-5839 susD
536 CAJPQO010000002.1 GCA905372675_00179 gene open 5861-8944
537 CAJPQO010000002.1 GCA905372675_00180 gene open 9656-10996 mtaB
538 CAJPQO010000002.1 GCA905372675_00181 gene open 11020-12105
539 CAJPQO010000002.1 GCA905372675_00182 gene open 12198-13910
540 CAJPQO010000002.1 GCA905372675_00183 gene open 14070-14558
541 CAJPQO010000002.1 GCA905372675_00184 gene open 15349-15783
542 CAJPQO010000002.1 GCA905372675_00185 gene open 16038-16289
543 CAJPQO010000002.1 GCA905372675_00186 gene open 16286-16618 hipA
544 CAJPQO010000002.1 GCA905372675_00187 gene open 16611-17555 hipA
545 CAJPQO010000002.1 GCA905372675_00188 gene open 17538-18908
546 CAJPQO010000002.1 GCA905372675_00189 gene open 19017-20204
547 CAJPQO010000002.1 GCA905372675_00190 gene open 20216-20854
548 CAJPQO010000002.1 GCA905372675_00191 gene open 20962-23406
549 CAJPQO010000002.1 GCA905372675_00192 gene open 23431-24045 lolA
550 CAJPQO010000002.1 GCA905372675_00193 gene open 24057-25568
551 CAJPQO010000002.1 GCA905372675_00194 gene open 25665-27362
552 CAJPQO010000002.1 GCA905372675_00195 gene open 27833-28552 arsG
553 CAJPQO010000002.1 GCA905372675_00196 gene open 28567-28998 arsF
554 CAJPQO010000002.1 GCA905372675_00197 gene open 29028-29267
555 CAJPQO010000002.1 GCA905372675_00198 gene open 29303-31030
556 CAJPQO010000002.1 GCA905372675_00199 gene open 31074-33863
557 CAJPQO010000002.1 GCA905372675_00200 gene open 33905-35167
558 CAJPQO010000002.1 GCA905372675_00201 gene open 35192-35302
559 CAJPQO010000002.1 GCA905372675_00202 gene open 35664-36530
560 CAJPQO010000002.1 GCA905372675_00203 gene open 36713-37015
561 CAJPQO010000002.1 GCA905372675_00204 gene open 37027-42807
562 CAJPQO010000002.1 GCA905372675_00205 gene open 42981-43700
563 CAJPQO010000002.1 GCA905372675_00206 gene open 43702-44529
564 CAJPQO010000002.1 GCA905372675_00207 gene open 44522-45043
565 CAJPQO010000002.1 GCA905372675_00208 gene open 45033-45845
566 CAJPQO010000002.1 GCA905372675_00209 gene open 45881-46156 lysM
567 CAJPQO010000002.1 GCA905372675_00210 gene open 46141-46596
568 CAJPQO010000002.1 GCA905372675_00211 gene open 46607-47050
569 CAJPQO010000002.1 GCA905372675_00212 gene open 47047-47538
570 CAJPQO010000002.1 GCA905372675_00213 gene open 47550-47855
571 CAJPQO010000002.1 GCA905372675_00214 gene open 47860-48324 ytfJ
572 CAJPQO010000002.1 GCA905372675_00215 gene open 48332-49285
573 CAJPQO010000002.1 GCA905372675_00216 gene open 49289-49918
574 CAJPQO010000002.1 GCA905372675_00217 gene open 49935-51695
575 CAJPQO010000002.1 GCA905372675_00218 gene open 51864-52148 pqqD
576 CAJPQO010000002.1 GCA905372675_00219 gene open 52170-52577
577 CAJPQO010000002.1 GCA905372675_00220 gene open 52634-53788
578 CAJPQO010000002.1 GCA905372675_00221 gene open 53839-54750
579 CAJPQO010000002.1 GCA905372675_00222 gene open 54797-55906
580 CAJPQO010000002.1 GCA905372675_00223 gene open 56090-56545
581 CAJPQO010000002.1 GCA905372675_00224 gene open 56542-58077
582 CAJPQO010000002.1 GCA905372675_00225 gene open 58079-58519
583 CAJPQO010000002.1 GCA905372675_00226 gene open 58545-59873
584 CAJPQO010000002.1 GCA905372675_00227 gene open 60026-61294
585 CAJPQO010000002.1 GCA905372675_00228 gene open 61272-61382
586 CAJPQO010000002.1 GCA905372675_00229 gene open 61408-62007
587 CAJPQO010000002.1 GCA905372675_00230 gene open 61988-62479
588 CAJPQO010000002.1 GCA905372675_00231 gene open 62421-62711
589 CAJPQO010000002.1 GCA905372675_00232 gene open 62789-63454
590 CAJPQO010000002.1 GCA905372675_00233 gene open 63461-63928
591 CAJPQO010000002.1 GCA905372675_00234 gene open 63885-64223
592 CAJPQO010000002.1 GCA905372675_00235 gene open 64342-64560
593 CAJPQO010000002.1 GCA905372675_00236 gene open 64578-65045
594 CAJPQO010000002.1 GCA905372675_00237 gene open 65054-65239
595 CAJPQO010000002.1 GCA905372675_00238 gene open 65331-65567
596 CAJPQO010000002.1 GCA905372675_00239 gene open 65511-65702
597 CAJPQO010000002.1 GCA905372675_00240 gene open 65729-66019
598 CAJPQO010000002.1 GCA905372675_00241 gene open 66022-66645
599 CAJPQO010000002.1 GCA905372675_00242 gene open 66648-66839
600 CAJPQO010000002.1 GCA905372675_00243 gene open 66836-67714
601 CAJPQO010000002.1 GCA905372675_00244 gene open 67750-69756
602 CAJPQO010000002.1 GCA905372675_00245 gene open 69771-70169
603 CAJPQO010000002.1 GCA905372675_00246 gene open 70186-70584
604 CAJPQO010000002.1 GCA905372675_00247 gene open 70695-71408
605 CAJPQO010000002.1 GCA905372675_00248 gene open 71851-72078
606 CAJPQO010000002.1 GCA905372675_00249 gene open 73059-74279
607 CAJPQO010000002.1 GCA905372675_00250 gene open 74304-75821 gltX
608 CAJPQO010000002.1 GCA905372675_00251 gene open 75864-78005
609 CAJPQO010000002.1 GCA905372675_00252 gene open 78116-79045
610 CAJPQO010000002.1 GCA905372675_00253 gene open 79111-79590
611 CAJPQO010000002.1 GCA905372675_00254 gene open 79654-80277
612 CAJPQO010000002.1 GCA905372675_00255 gene open 80468-80620
613 CAJPQO010000002.1 GCA905372675_00256 gene open 80914-83103
614 CAJPQO010000002.1 GCA905372675_00257 gene open 83146-84318
615 CAJPQO010000002.1 GCA905372675_00258 gene open 84324-85208
616 CAJPQO010000002.1 GCA905372675_00259 gene open 85394-86623
617 CAJPQO010000002.1 GCA905372675_00260 gene open 86626-86868
618 CAJPQO010000002.1 GCA905372675_00261 gene open 87035-87868 murI
619 CAJPQO010000002.1 GCA905372675_00262 gene open 87881-88408
620 CAJPQO010000002.1 GCA905372675_00263 gene open 88526-89026
621 CAJPQO010000002.1 GCA905372675_00264 gene open 89068-89580
622 CAJPQO010000002.1 GCA905372675_00265 gene open 89651-92224
623 CAJPQO010000002.1 GCA905372675_00266 gene open 92296-93033
624 CAJPQO010000002.1 GCA905372675_00267 gene open 93033-93713
625 CAJPQO010000002.1 GCA905372675_00268 gene open 93756-95183
626 CAJPQO010000002.1 GCA905372675_00269 gene open 95506-95730
627 CAJPQO010000002.1 GCA905372675_00270 gene open 96617-98284
628 CAJPQO010000002.1 GCA905372675_00271 gene open 98353-100020
629 CAJPQO010000002.1 GCA905372675_00272 gene open 100314-101141 coaW
630 CAJPQO010000002.1 GCA905372675_00273 gene open 101181-103178 ligA
631 CAJPQO010000002.1 GCA905372675_00274 gene open 103238-104044
632 CAJPQO010000002.1 GCA905372675_00275 gene open 104067-105383
633 CAJPQO010000002.1 GCA905372675_00276 gene open 105423-106022 rfbC
634 CAJPQO010000002.1 GCA905372675_00277 gene open 106085-106900 thiF
635 CAJPQO010000002.1 GCA905372675_00278 gene open 108175-109017 ompA
636 CAJPQO010000002.1 GCA905372675_00279 gene open 109114-110007
637 CAJPQO010000002.1 GCA905372675_00280 gene open 111404-111949 csx28
638 CAJPQO010000002.1 GCA905372675_00281 gene open 111949-115401 cas13b
639 CAJPQO010000002.1 GCA905372675_00282 gene open 115687-119457 purL
640 CAJPQO010000002.1 GCA905372675_00283 gene open 119502-120089
641 CAJPQO010000002.1 GCA905372675_00284 gene open 120201-120776
642 CAJPQO010000002.1 GCA905372675_00285 gene open 121270-121656 doxX
643 CAJPQO010000002.1 GCA905372675_00286 gene open 122052-122372
644 CAJPQO010000002.1 GCA905372675_00287 gene open 122527-123777
645 CAJPQO010000002.1 GCA905372675_00288 gene open 123791-125062
646 CAJPQO010000002.1 GCA905372675_00289 gene open 125111-125287
647 CAJPQO010000002.1 GCA905372675_00290 gene open 125332-128982 czcA
648 CAJPQO010000002.1 GCA905372675_00291 gene open 129206-129589
649 CAJPQO010000002.1 GCA905372675_00292 gene open 129851-130000
650 CAJPQO010000002.1 GCA905372675_00293 gene open 130031-130567
651 CAJPQO010000002.1 GCA905372675_00294 gene open 130961-132145
652 CAJPQO010000002.1 GCA905372675_00295 gene open 132170-133591 rlmD
653 CAJPQO010000002.1 GCA905372675_00296 gene open 133723-136446 ppdK
654 CAJPQO010000002.1 GCA905372675_00297 gene open 136759-137124
655 CAJPQO010000002.1 GCA905372675_00298 gene open 137213-137707 fldA
656 CAJPQO010000002.1 GCA905372675_00299 gene open 138094-138456
657 CAJPQO010000002.1 GCA905372675_00300 gene open 138802-140337
658 CAJPQO010000002.1 GCA905372675_00301 gene open 140453-140767 zapA
659 CAJPQO010000002.1 GCA905372675_00302 gene open 140760-141068 zapB
660 CAJPQO010000002.1 GCA905372675_00303 gene open 141198-141818
661 CAJPQO010000002.1 GCA905372675_00304 gene open 142744-145686
662 CAJPQO010000002.1 GCA905372675_00305 gene open 145700-146104
663 CAJPQO010000002.1 GCA905372675_00306 gene open 146264-146776
664 CAJPQO010000002.1 GCA905372675_00307 gene open 146791-147921
665 CAJPQO010000002.1 GCA905372675_00308 gene open 147941-149062
666 CAJPQO010000002.1 GCA905372675_00309 gene open 149514-151205
667 CAJPQO010000002.1 GCA905372675_00310 gene open 151293-154109
668 CAJPQO010000002.1 GCA905372675_00311 gene open 154265-154369
669 CAJPQO010000002.1 GCA905372675_00312 gene open 154864-157179 pnp
670 CAJPQO010000002.1 GCA905372675_00313 gene open 157459-160893
671 CAJPQO010000002.1 GCA905372675_00314 gene open 160967-161485
672 CAJPQO010000002.1 GCA905372675_00315 gene open 161819-162820
673 CAJPQO010000002.1 GCA905372675_00316 gene open 162862-163026
674 CAJPQO010000002.1 GCA905372675_00317 gene open 163072-164862
675 CAJPQO010000002.1 GCA905372675_00318 gene open 165136-165831
676 CAJPQO010000002.1 GCA905372675_00319 gene open 165908-168022
677 CAJPQO010000002.1 GCA905372675_00320 gene open 168038-169531
678 CAJPQO010000002.1 GCA905372675_00321 gene open 169650-170012
679 CAJPQO010000002.1 GCA905372675_00322 gene open 170132-171364
680 CAJPQO010000002.1 GCA905372675_00323 gene open 171826-171978
681 CAJPQO010000002.1 GCA905372675_00324 gene open 172213-173907 rluA
682 CAJPQO010000002.1 GCA905372675_00325 gene open 174164-174700
683 CAJPQO010000002.1 GCA905372675_00326 gene open 174864-175019 rpmH
684 CAJPQO010000002.1 GCA905372675_00327 gene open 175172-175738 efp
685 CAJPQO010000002.1 GCA905372675_00328 gene open 175895-176944
686 CAJPQO010000002.1 GCA905372675_00329 gene open 176975-177652 radC
687 CAJPQO010000002.1 GCA905372675_00330 gene open 177924-180626
688 CAJPQO010000002.1 GCA905372675_00331 gene open 180643-181515
689 CAJPQO010000002.1 GCA905372675_00332 gene open 181512-182522
690 CAJPQO010000002.1 GCA905372675_00334 gene open 184120-186108
691 CAJPQO010000002.1 GCA905372675_00335 gene open 186359-187462
692 CAJPQO010000002.1 GCA905372675_00336 gene open 187472-188431
693 CAJPQO010000002.1 GCA905372675_00337 gene open 188685-189677 tsf
694 CAJPQO010000002.1 GCA905372675_00338 gene open 189773-190735 rpsB
695 CAJPQO010000002.1 GCA905372675_00339 gene open 191085-191471 rpsI
696 CAJPQO010000002.1 GCA905372675_00340 gene open 191486-191947 rplM
697 CAJPQO010000002.1 GCA905372675_00341 gene open 192925-195240 topA
698 CAJPQO010000002.1 GCA905372675_00342 gene open 195268-195795
699 CAJPQO010000002.1 GCA905372675_00343 gene open 195856-197748 speA
700 CAJPQO010000002.1 GCA905372675_00344 gene open 197767-197934
701 CAJPQO010000002.1 GCA905372675_00345 gene open 197947-198735
702 CAJPQO010000002.1 GCA905372675_00346 gene open 198795-199307
703 CAJPQO010000002.1 GCA905372675_00347 gene open 199297-199779
704 CAJPQO010000002.1 GCA905372675_00348 gene open 199995-200432
705 CAJPQO010000002.1 GCA905372675_00349 gene open 200737-202074
706 CAJPQO010000002.1 GCA905372675_00350 gene open 202602-203627
707 CAJPQO010000002.1 GCA905372675_00351 gene open 204192-207230
708 CAJPQO010000002.1 GCA905372675_00352 gene open 207250-208848 susD
709 CAJPQO010000002.1 GCA905372675_00353 gene open 208915-210135 susE
710 CAJPQO010000002.1 GCA905372675_00354 gene open 210197-211603
711 CAJPQO010000002.1 GCA905372675_00355 gene open 211777-212388
712 CAJPQO010000002.1 GCA905372675_00356 gene open 212401-212955
713 CAJPQO010000002.1 GCA905372675_00357 gene open 213014-213235
714 CAJPQO010000002.1 GCA905372675_00358 gene open 213929-214522
715 CAJPQO010000002.1 GCA905372675_00172 gene open 103-176 trnT
716 CAJPQO010000002.1 GCA905372675_00333 gene open 182624-182705 trnL
717 CAJPQO010000002.1 GCA905372675_00172 tRNA open 103-176 trnT tRNA-Thr(tgt)
718 CAJPQO010000002.1 GCA905372675_00333 tRNA open 182624-182705 trnL tRNA-Leu(tag)
719 CAJPQO010000003.1 GCA905372675_00359 CDS open 4-1611 _na     535_aa Lipoprotein
720 CAJPQO010000003.1 GCA905372675_00360 CDS open 1920-3086 _na     388_aa hagB Hemagglutinin protein HagB
721 CAJPQO010000003.1 GCA905372675_00361 CDS open 3386-4402 _na     338_aa L-rhamnose-proton symport protein
722 CAJPQO010000003.1 GCA905372675_00362 CDS open 4406-5659 _na     417_aa L-rhamnose isomerase
723 CAJPQO010000003.1 GCA905372675_00363 CDS open 5730-7205 _na     491_aa rhaB rhamnulokinase
724 CAJPQO010000003.1 GCA905372675_00364 CDS open 7694-10414 _na     906_aa Spi protease inhibitor domain-containing protein
725 CAJPQO010000003.1 GCA905372675_00365 CDS open 11051-12607 _na     518_aa Peptidase%2C S8/S53 family
726 CAJPQO010000003.1 GCA905372675_00366 CDS open 12608-14830 _na     740_aa Peptidase%2C S9A/B/C family%2C catalytic domain protein
727 CAJPQO010000003.1 GCA905372675_00367 CDS open 14867-18175 _na     1102_aa TonB-dependent receptor plug domain protein
728 CAJPQO010000003.1 GCA905372675_00368 CDS open 18208-19602 _na     464_aa susD SusD family protein
729 CAJPQO010000003.1 GCA905372675_00369 CDS open 19621-19839 _na     72_aa hypothetical protein
730 CAJPQO010000003.1 GCA905372675_00370 CDS open 19852-21129 _na     425_aa Calx-beta domain-containing protein
731 CAJPQO010000003.1 GCA905372675_00371 CDS open 21333-21518 _na     61_aa hypothetical protein
732 CAJPQO010000003.1 GCA905372675_00372 CDS open 22136-23182 _na     348_aa Endonuclease/exonuclease/phosphatase family protein
733 CAJPQO010000003.1 GCA905372675_00373 CDS open 23204-24949 _na     581_aa susD SusD family protein
734 CAJPQO010000003.1 GCA905372675_00374 CDS open 24988-28014 _na     1008_aa TonB-dependent receptor plug domain protein
735 CAJPQO010000003.1 GCA905372675_00375 CDS open 28034-29872 _na     612_aa susD SusD family protein
736 CAJPQO010000003.1 GCA905372675_00376 CDS open 29894-33124 _na     1076_aa TonB-dependent receptor plug domain protein
737 CAJPQO010000003.1 GCA905372675_00377 CDS open 33180-34934 _na     584_aa Leucine Rich repeat-containing domain protein
738 CAJPQO010000003.1 GCA905372675_00378 CDS open 35118-37214 _na     698_aa Alpha-galactosidase
739 CAJPQO010000003.1 GCA905372675_00379 CDS open 37211-39322 _na     703_aa Alpha-galactosidase
740 CAJPQO010000003.1 GCA905372675_00380 CDS open 39527-40690 _na     387_aa Transporter%2C major facilitator family protein
741 CAJPQO010000003.1 GCA905372675_00381 CDS open 40716-42317 _na     533_aa Glycoside hydrolase family 5 domain-containing protein
742 CAJPQO010000003.1 GCA905372675_00382 CDS open 42347-42925 _na     192_aa lpcA D-sedoheptulose 7-phosphate isomerase
743 CAJPQO010000003.1 GCA905372675_00383 CDS open 42932-43900 _na     322_aa ROK family protein
744 CAJPQO010000003.1 GCA905372675_00384 CDS open 43965-46376 _na     803_aa beta-mannosidase
745 CAJPQO010000003.1 GCA905372675_00385 CDS open 46484-49126 _na     880_aa alpha-L-rhamnosidase
746 CAJPQO010000003.1 GCA905372675_00386 CDS open 49236-50282 _na     348_aa Sugar-binding domain protein
747 CAJPQO010000003.1 GCA905372675_00387 CDS open 50451-51323 _na     290_aa sucD succinate--CoA ligase subunit alpha
748 CAJPQO010000003.1 GCA905372675_00388 CDS open 51346-52479 _na     377_aa sucC ADP-forming succinate--CoA ligase subunit beta
749 CAJPQO010000003.1 GCA905372675_00389 CDS open 52600-53808 _na     402_aa Putative uracil permease
750 CAJPQO010000003.1 GCA905372675_00390 CDS open 54001-54846 _na     281_aa yitL YitL family protein
751 CAJPQO010000003.1 GCA905372675_00391 CDS open 54954-56315 _na     453_aa hemG protoporphyrinogen oxidase
752 CAJPQO010000003.1 GCA905372675_00392 CDS open 56628-56747 _na     39_aa hypothetical protein
753 CAJPQO010000003.1 GCA905372675_00393 CDS open 56727-56894 _na     55_aa hypothetical protein
754 CAJPQO010000003.1 GCA905372675_00394 CDS open 57121-60324 _na     1067_aa TonB-dependent receptor plug domain protein
755 CAJPQO010000003.1 GCA905372675_00395 CDS open 60487-60642 _na     51_aa Toxin-antitoxin system%2C antitoxin component%2C ribbon-helix-helix domain protein
756 CAJPQO010000003.1 GCA905372675_00396 CDS open 60650-61882 _na     410_aa serB phosphoserine phosphatase SerB
757 CAJPQO010000003.1 GCA905372675_00397 CDS open 61932-62621 _na     229_aa tsaA tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO
758 CAJPQO010000003.1 GCA905372675_00398 CDS open 62831-63325 _na     164_aa Pyridoxamine 5'-phosphate oxidase family protein
759 CAJPQO010000003.1 GCA905372675_00399 CDS open 63403-64089 _na     228_aa WG repeat-containing protein
760 CAJPQO010000003.1 GCA905372675_00400 CDS open 64485-66734 _na     749_aa pflB formate C-acetyltransferase
761 CAJPQO010000003.1 GCA905372675_00401 CDS open 66937-67767 _na     276_aa pflA pyruvate formate-lyase-activating protein
762 CAJPQO010000003.1 GCA905372675_00402 CDS open 67919-69367 _na     482_aa DKNYY family protein
763 CAJPQO010000003.1 GCA905372675_00403 CDS open 69433-69945 _na     170_aa Outer membrane protein beta-barrel domain-containing protein
764 CAJPQO010000003.1 GCA905372675_00404 CDS open 70173-71006 _na     277_aa Ser/Thr phosphatase family protein
765 CAJPQO010000003.1 GCA905372675_00405 CDS open 71024-71800 _na     258_aa 5'-nucleotidase protein
766 CAJPQO010000003.1 GCA905372675_00406 CDS open 71903-72559 _na     218_aa Lipoprotein releasing system%2C ATP-binding protein
767 CAJPQO010000003.1 GCA905372675_00407 CDS open 72580-74718 _na     712_aa Transporter%2C CPA2 family
768 CAJPQO010000003.1 GCA905372675_00408 CDS open 74885-75898 _na     337_aa aspartate-semialdehyde dehydrogenase
769 CAJPQO010000003.1 GCA905372675_00409 CDS open 76294-77115 _na     273_aa DNA alkylation repair enzyme
770 CAJPQO010000003.1 GCA905372675_00410 CDS open 77499-78167 _na     222_aa Cyclic nucleotide-binding domain protein
771 CAJPQO010000003.1 GCA905372675_00411 CDS open 78167-79195 _na     342_aa FAD:protein FMN transferase
772 CAJPQO010000003.1 GCA905372675_00412 CDS open 79330-80025 _na     231_aa Outer membrane protein beta-barrel domain-containing protein
773 CAJPQO010000003.1 GCA905372675_00413 CDS open 79976-80455 _na     159_aa Lipoprotein
774 CAJPQO010000003.1 GCA905372675_00414 CDS open 80443-81405 _na     320_aa Glycosyltransferase%2C group 2 family protein
775 CAJPQO010000003.1 GCA905372675_00415 CDS open 81457-81984 _na     175_aa DUF4199 domain-containing protein
776 CAJPQO010000003.1 GCA905372675_00416 CDS open 82257-82685 _na     142_aa Transcriptional regulator%2C Fur family
777 CAJPQO010000003.1 GCA905372675_00417 CDS open 82750-84108 _na     452_aa hisS histidine--tRNA ligase
778 CAJPQO010000003.1 GCA905372675_00418 CDS open 84224-85498 _na     424_aa adenylosuccinate synthase
779 CAJPQO010000003.1 GCA905372675_00419 CDS open 85506-86018 _na     170_aa Transcriptional regulator%2C Fur family
780 CAJPQO010000003.1 GCA905372675_00420 CDS open 86760-86918 _na     52_aa hypothetical protein
781 CAJPQO010000003.1 GCA905372675_00421 CDS open 86953-87069 _na     38_aa hypothetical protein
782 CAJPQO010000003.1 GCA905372675_00422 CDS open 87323-87514 _na     63_aa hypothetical protein
783 CAJPQO010000003.1 GCA905372675_00423 CDS open 87489-88646 _na     385_aa ompA OmpA family protein
784 CAJPQO010000003.1 GCA905372675_00424 CDS open 88678-88767 _na     29_aa hypothetical protein
785 CAJPQO010000003.1 GCA905372675_00425 CDS open 88902-89429 _na     175_aa Adenosylcobinamide kinase
786 CAJPQO010000003.1 GCA905372675_00426 CDS open 89458-90537 _na     359_aa cobT nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase
787 CAJPQO010000003.1 GCA905372675_00427 CDS open 90512-91324 _na     270_aa Adenosylcobinamide-GDP ribazoletransferase
788 CAJPQO010000003.1 GCA905372675_00428 CDS open 91345-91917 _na     190_aa cobC alpha-ribazole phosphatase
789 CAJPQO010000003.1 GCA905372675_00429 CDS open 92198-94033 _na     611_aa ilvD dihydroxy-acid dehydratase
790 CAJPQO010000003.1 GCA905372675_00430 CDS open 94471-96195 _na     574_aa ilvB biosynthetic-type acetolactate synthase large subunit
791 CAJPQO010000003.1 GCA905372675_00431 CDS open 96207-96761 _na     184_aa ilvN acetolactate synthase small subunit
792 CAJPQO010000003.1 GCA905372675_00432 CDS open 96745-97518 _na     257_aa Acyl-ACP thioesterase
793 CAJPQO010000003.1 GCA905372675_00433 CDS open 97531-98574 _na     347_aa ilvC ketol-acid reductoisomerase
794 CAJPQO010000003.1 GCA905372675_00435 CDS open 99230-100048 _na     272_aa Phospholipase/carboxylesterase
795 CAJPQO010000003.1 GCA905372675_00438 CDS open 100457-100912 _na     151_aa bcp thioredoxin-dependent thiol peroxidase
796 CAJPQO010000003.1 GCA905372675_00439 CDS open 101150-102097 _na     315_aa trxB thioredoxin-disulfide reductase
797 CAJPQO010000003.1 GCA905372675_00440 CDS open 102322-102870 _na     182_aa Glutathione peroxidase
798 CAJPQO010000003.1 GCA905372675_00441 CDS open 103095-103667 _na     190_aa Lipocalin-like domain-containing protein
799 CAJPQO010000003.1 GCA905372675_00442 CDS open 103788-104669 _na     293_aa DNA/RNA non-specific endonuclease
800 CAJPQO010000003.1 GCA905372675_00443 CDS open 104783-104983 _na     66_aa type B 50S ribosomal protein L31
801 CAJPQO010000003.1 GCA905372675_00359 gene open 4-1611
802 CAJPQO010000003.1 GCA905372675_00360 gene open 1920-3086 hagB
803 CAJPQO010000003.1 GCA905372675_00361 gene open 3386-4402
804 CAJPQO010000003.1 GCA905372675_00362 gene open 4406-5659
805 CAJPQO010000003.1 GCA905372675_00363 gene open 5730-7205 rhaB
806 CAJPQO010000003.1 GCA905372675_00364 gene open 7694-10414
807 CAJPQO010000003.1 GCA905372675_00365 gene open 11051-12607
808 CAJPQO010000003.1 GCA905372675_00366 gene open 12608-14830
809 CAJPQO010000003.1 GCA905372675_00367 gene open 14867-18175
810 CAJPQO010000003.1 GCA905372675_00368 gene open 18208-19602 susD
811 CAJPQO010000003.1 GCA905372675_00369 gene open 19621-19839
812 CAJPQO010000003.1 GCA905372675_00370 gene open 19852-21129
813 CAJPQO010000003.1 GCA905372675_00371 gene open 21333-21518
814 CAJPQO010000003.1 GCA905372675_00372 gene open 22136-23182
815 CAJPQO010000003.1 GCA905372675_00373 gene open 23204-24949 susD
816 CAJPQO010000003.1 GCA905372675_00374 gene open 24988-28014
817 CAJPQO010000003.1 GCA905372675_00375 gene open 28034-29872 susD
818 CAJPQO010000003.1 GCA905372675_00376 gene open 29894-33124
819 CAJPQO010000003.1 GCA905372675_00377 gene open 33180-34934
820 CAJPQO010000003.1 GCA905372675_00378 gene open 35118-37214
821 CAJPQO010000003.1 GCA905372675_00379 gene open 37211-39322
822 CAJPQO010000003.1 GCA905372675_00380 gene open 39527-40690
823 CAJPQO010000003.1 GCA905372675_00381 gene open 40716-42317
824 CAJPQO010000003.1 GCA905372675_00382 gene open 42347-42925 lpcA
825 CAJPQO010000003.1 GCA905372675_00383 gene open 42932-43900
826 CAJPQO010000003.1 GCA905372675_00384 gene open 43965-46376
827 CAJPQO010000003.1 GCA905372675_00385 gene open 46484-49126
828 CAJPQO010000003.1 GCA905372675_00386 gene open 49236-50282
829 CAJPQO010000003.1 GCA905372675_00387 gene open 50451-51323 sucD
830 CAJPQO010000003.1 GCA905372675_00388 gene open 51346-52479 sucC
831 CAJPQO010000003.1 GCA905372675_00389 gene open 52600-53808
832 CAJPQO010000003.1 GCA905372675_00390 gene open 54001-54846 yitL
833 CAJPQO010000003.1 GCA905372675_00391 gene open 54954-56315 hemG
834 CAJPQO010000003.1 GCA905372675_00392 gene open 56628-56747
835 CAJPQO010000003.1 GCA905372675_00393 gene open 56727-56894
836 CAJPQO010000003.1 GCA905372675_00394 gene open 57121-60324
837 CAJPQO010000003.1 GCA905372675_00395 gene open 60487-60642
838 CAJPQO010000003.1 GCA905372675_00396 gene open 60650-61882 serB
839 CAJPQO010000003.1 GCA905372675_00397 gene open 61932-62621 tsaA
840 CAJPQO010000003.1 GCA905372675_00398 gene open 62831-63325
841 CAJPQO010000003.1 GCA905372675_00399 gene open 63403-64089
842 CAJPQO010000003.1 GCA905372675_00400 gene open 64485-66734 pflB
843 CAJPQO010000003.1 GCA905372675_00401 gene open 66937-67767 pflA
844 CAJPQO010000003.1 GCA905372675_00402 gene open 67919-69367
845 CAJPQO010000003.1 GCA905372675_00403 gene open 69433-69945
846 CAJPQO010000003.1 GCA905372675_00404 gene open 70173-71006
847 CAJPQO010000003.1 GCA905372675_00405 gene open 71024-71800
848 CAJPQO010000003.1 GCA905372675_00406 gene open 71903-72559
849 CAJPQO010000003.1 GCA905372675_00407 gene open 72580-74718
850 CAJPQO010000003.1 GCA905372675_00408 gene open 74885-75898
851 CAJPQO010000003.1 GCA905372675_00409 gene open 76294-77115
852 CAJPQO010000003.1 GCA905372675_00410 gene open 77499-78167
853 CAJPQO010000003.1 GCA905372675_00411 gene open 78167-79195
854 CAJPQO010000003.1 GCA905372675_00412 gene open 79330-80025
855 CAJPQO010000003.1 GCA905372675_00413 gene open 79976-80455
856 CAJPQO010000003.1 GCA905372675_00414 gene open 80443-81405
857 CAJPQO010000003.1 GCA905372675_00415 gene open 81457-81984
858 CAJPQO010000003.1 GCA905372675_00416 gene open 82257-82685
859 CAJPQO010000003.1 GCA905372675_00417 gene open 82750-84108 hisS
860 CAJPQO010000003.1 GCA905372675_00418 gene open 84224-85498
861 CAJPQO010000003.1 GCA905372675_00419 gene open 85506-86018
862 CAJPQO010000003.1 GCA905372675_00420 gene open 86760-86918
863 CAJPQO010000003.1 GCA905372675_00421 gene open 86953-87069
864 CAJPQO010000003.1 GCA905372675_00422 gene open 87323-87514
865 CAJPQO010000003.1 GCA905372675_00423 gene open 87489-88646 ompA
866 CAJPQO010000003.1 GCA905372675_00424 gene open 88678-88767
867 CAJPQO010000003.1 GCA905372675_00425 gene open 88902-89429
868 CAJPQO010000003.1 GCA905372675_00426 gene open 89458-90537 cobT
869 CAJPQO010000003.1 GCA905372675_00427 gene open 90512-91324
870 CAJPQO010000003.1 GCA905372675_00428 gene open 91345-91917 cobC
871 CAJPQO010000003.1 GCA905372675_00429 gene open 92198-94033 ilvD
872 CAJPQO010000003.1 GCA905372675_00430 gene open 94471-96195 ilvB
873 CAJPQO010000003.1 GCA905372675_00431 gene open 96207-96761 ilvN
874 CAJPQO010000003.1 GCA905372675_00432 gene open 96745-97518
875 CAJPQO010000003.1 GCA905372675_00433 gene open 97531-98574 ilvC
876 CAJPQO010000003.1 GCA905372675_00435 gene open 99230-100048
877 CAJPQO010000003.1 GCA905372675_00438 gene open 100457-100912 bcp
878 CAJPQO010000003.1 GCA905372675_00439 gene open 101150-102097 trxB
879 CAJPQO010000003.1 GCA905372675_00440 gene open 102322-102870
880 CAJPQO010000003.1 GCA905372675_00441 gene open 103095-103667
881 CAJPQO010000003.1 GCA905372675_00442 gene open 103788-104669
882 CAJPQO010000003.1 GCA905372675_00443 gene open 104783-104983
883 CAJPQO010000003.1 GCA905372675_00434 gene open 98696-98783 trnS
884 CAJPQO010000003.1 GCA905372675_00436 gene open 100128-100199 trnE
885 CAJPQO010000003.1 GCA905372675_00437 gene open 100219-100305 trnS
886 CAJPQO010000003.1 GCA905372675_00434 tRNA open 98696-98783 trnS tRNA-Ser(gga)
887 CAJPQO010000003.1 GCA905372675_00436 tRNA open 100128-100199 trnE tRNA-Glu(ctc)
888 CAJPQO010000003.1 GCA905372675_00437 tRNA open 100219-100305 trnS tRNA-Ser(gct)
889 CAJPQO010000004.1 repeat_region open 44713-45927 CRISPR array with 16 repeats of length 47%2C consensus sequence GTTGTGATTTGCTTGAATTTTAATACCTTTGTACTATAGGCAACAAC and spacer length 30
890 CAJPQO010000004.1 GCA905372675_00444 CDS open 1195-2664 _na     489_aa Cell cycle protein%2C FtsW/RodA/SpoVE family
891 CAJPQO010000004.1 GCA905372675_00445 CDS open 2645-4495 _na     616_aa mrdA penicillin-binding protein 2
892 CAJPQO010000004.1 GCA905372675_00446 CDS open 4507-5001 _na     164_aa mreD rod shape-determining protein MreD
893 CAJPQO010000004.1 GCA905372675_00447 CDS open 5137-5994 _na     285_aa mreC rod shape-determining protein MreC
894 CAJPQO010000004.1 GCA905372675_00448 CDS open 5999-7051 _na     350_aa mreB Cell shape-determining protein MreB
895 CAJPQO010000004.1 GCA905372675_00449 CDS open 7100-7693 _na     197_aa MGS-like domain protein
896 CAJPQO010000004.1 GCA905372675_00450 CDS open 8611-9804 _na     397_aa Metallo-beta-lactamase domain protein
897 CAJPQO010000004.1 GCA905372675_00451 CDS open 9806-10975 _na     389_aa Transporter%2C dicarboxylate/amino acid:cation Na+/H+ symporter family protein
898 CAJPQO010000004.1 GCA905372675_00452 CDS open 11060-13138 _na     692_aa TonB-dependent receptor
899 CAJPQO010000004.1 GCA905372675_00453 CDS open 13209-14672 _na     487_aa Glycosyltransferase%2C group 2 family protein
900 CAJPQO010000004.1 GCA905372675_00454 CDS open 14665-15027 _na     120_aa FabA-like domain protein
901 CAJPQO010000004.1 GCA905372675_00455 CDS open 15011-15424 _na     137_aa hypothetical protein
902 CAJPQO010000004.1 GCA905372675_00456 CDS open 15405-16052 _na     215_aa lolA Outer membrane lipoprotein carrier protein LolA
903 CAJPQO010000004.1 GCA905372675_00457 CDS open 16076-16435 _na     119_aa eamA EamA domain-containing protein
904 CAJPQO010000004.1 GCA905372675_00458 CDS open 16414-18165 _na     583_aa Beta-ketoacyl synthase protein
905 CAJPQO010000004.1 GCA905372675_00459 CDS open 18162-18419 _na     85_aa Putative acyl carrier protein
906 CAJPQO010000004.1 GCA905372675_00460 CDS open 18448-20199 _na     583_aa Beta-ketoacyl synthase protein
907 CAJPQO010000004.1 GCA905372675_00461 CDS open 20213-20635 _na     140_aa Acyl-CoA thioester hydrolase%2C YbgC/YbaW family
908 CAJPQO010000004.1 GCA905372675_00462 CDS open 20656-21102 _na     148_aa FabA-like domain protein
909 CAJPQO010000004.1 GCA905372675_00463 CDS open 21066-21968 _na     300_aa Lipid A biosynthesis (KDO)2-(Lauroyl)-lipid IVA acyltransferase
910 CAJPQO010000004.1 GCA905372675_00464 CDS open 21991-22233 _na     80_aa Acyl carrier protein
911 CAJPQO010000004.1 GCA905372675_00465 CDS open 22286-23380 _na     364_aa O-methyltransferase
912 CAJPQO010000004.1 GCA905372675_00466 CDS open 23396-23968 _na     190_aa DUF4410 domain-containing protein
913 CAJPQO010000004.1 GCA905372675_00467 CDS open 23988-25205 _na     405_aa 3-oxoacyl-[acyl-carrier-protein] synthase 1
914 CAJPQO010000004.1 GCA905372675_00468 CDS open 25257-25985 _na     242_aa fabG 3-oxoacyl-ACP reductase FabG
915 CAJPQO010000004.1 GCA905372675_00469 CDS open 26063-27598 _na     511_aa Phenylalanine and histidine ammonia-lyase
916 CAJPQO010000004.1 GCA905372675_00470 CDS open 28018-28530 _na     170_aa hypothetical protein
917 CAJPQO010000004.1 GCA905372675_00471 CDS open 28722-29078 _na     118_aa hypothetical protein
918 CAJPQO010000004.1 GCA905372675_00472 CDS open 29131-30693 _na     520_aa Leucine Rich repeat-containing domain protein
919 CAJPQO010000004.1 GCA905372675_00473 CDS open 31523-32272 _na     249_aa fhuC Putative ferrichrome ABC transporter%2C ATP-binding protein FhuC
920 CAJPQO010000004.1 GCA905372675_00474 CDS open 32404-32796 _na     130_aa Transcriptional regulator
921 CAJPQO010000004.1 GCA905372675_00475 CDS open 32807-34159 _na     450_aa MATE efflux family protein
922 CAJPQO010000004.1 GCA905372675_00476 CDS open 34350-35378 _na     342_aa NAD dependent epimerase/dehydratase family protein
923 CAJPQO010000004.1 GCA905372675_00477 CDS open 35369-36352 _na     327_aa PAP2 family protein
924 CAJPQO010000004.1 GCA905372675_00478 CDS open 36368-37036 _na     222_aa HAD hydrolase%2C family IA%2C variant 3
925 CAJPQO010000004.1 GCA905372675_00479 CDS open 37388-39001 _na     537_aa pckA phosphoenolpyruvate carboxykinase (ATP)
926 CAJPQO010000004.1 GCA905372675_00480 CDS open 39250-39909 _na     219_aa upp uracil phosphoribosyltransferase
927 CAJPQO010000004.1 GCA905372675_00481 CDS open 39947-40372 _na     141_aa doxX DoxX family protein
928 CAJPQO010000004.1 GCA905372675_00482 CDS open 40397-40927 _na     176_aa Hydrolase%2C NUDIX family
929 CAJPQO010000004.1 GCA905372675_00483 CDS open 40998-41399 _na     133_aa Histidine triad domain protein
930 CAJPQO010000004.1 GCA905372675_00484 CDS open 41404-41871 _na     155_aa greA transcription elongation factor GreA
931 CAJPQO010000004.1 GCA905372675_00485 CDS open 42187-42315 _na     42_aa hypothetical protein
932 CAJPQO010000004.1 GCA905372675_00486 CDS open 43164-44534 _na     456_aa Lipoprotein-associated type-17 domain-containing protein
933 CAJPQO010000004.1 GCA905372675_00487 CDS open 46116-46421 _na     101_aa cas2 CRISPR-associated endonuclease Cas2
934 CAJPQO010000004.1 GCA905372675_00488 CDS open 46464-47396 _na     310_aa cas1 type II CRISPR-associated endonuclease Cas1
935 CAJPQO010000004.1 GCA905372675_00489 CDS open 47402-50659 _na     1085_aa type II CRISPR RNA-guided endonuclease Cas9
936 CAJPQO010000004.1 GCA905372675_00490 CDS open 50686-51912 _na     408_aa CRISPR-associated endonuclease Cas9 bridge helix domain-containing protein
937 CAJPQO010000004.1 GCA905372675_00491 CDS open 52590-52844 _na     84_aa hypothetical protein
938 CAJPQO010000004.1 GCA905372675_00492 CDS open 53160-54017 _na     285_aa Enoyl-[acyl-carrier-protein] reductase [NADH]
939 CAJPQO010000004.1 GCA905372675_00493 CDS open 54738-57827 _na     1029_aa TonB-dependent receptor
940 CAJPQO010000004.1 GCA905372675_00494 CDS open 57840-59708 _na     622_aa RagB/SusD family nutrient uptake outer membrane protein
941 CAJPQO010000004.1 GCA905372675_00495 CDS open 59750-60442 _na     230_aa DUF3823 domain-containing protein
942 CAJPQO010000004.1 GCA905372675_00496 CDS open 60708-62702 _na     664_aa hypothetical protein
943 CAJPQO010000004.1 GCA905372675_00497 CDS open 62897-63634 _na     245_aa SIMPL domain-containing protein
944 CAJPQO010000004.1 GCA905372675_00498 CDS open 63994-65301 _na     435_aa Inositol-3-phosphate synthase
945 CAJPQO010000004.1 GCA905372675_00499 CDS open 65403-66104 _na     233_aa WbqC-like protein
946 CAJPQO010000004.1 GCA905372675_00500 CDS open 66091-67536 _na     481_aa lepB signal peptidase I
947 CAJPQO010000004.1 GCA905372675_00501 CDS open 67628-68386 _na     252_aa dapB 4-hydroxy-tetrahydrodipicolinate reductase
948 CAJPQO010000004.1 GCA905372675_00502 CDS open 69241-71151 _na     636_aa Alpha-amylase
949 CAJPQO010000004.1 GCA905372675_00503 CDS open 71289-72983 _na     564_aa ABC transporter%2C ATP-binding protein
950 CAJPQO010000004.1 GCA905372675_00504 CDS open 73010-73903 _na     297_aa NAD kinase
951 CAJPQO010000004.1 GCA905372675_00505 CDS open 74032-74517 _na     161_aa FG-GAP repeat protein
952 CAJPQO010000004.1 GCA905372675_00506 CDS open 74579-77008 _na     809_aa YARHG domain-containing protein
953 CAJPQO010000004.1 GCA905372675_00507 CDS open 77119-78090 _na     323_aa Bacterial capsule synthesis protein
954 CAJPQO010000004.1 GCA905372675_00508 CDS open 79624-79971 _na     115_aa DUF1893 domain-containing protein
955 CAJPQO010000004.1 GCA905372675_00509 CDS open 80175-81890 _na     571_aa Putative Na/Pi-cotransporter II-like protein
956 CAJPQO010000004.1 GCA905372675_00510 CDS open 81979-83640 _na     553_aa Phosphoribulokinase/uridine kinase family protein
957 CAJPQO010000004.1 GCA905372675_00511 CDS open 83897-85756 _na     619_aa Alpha amylase%2C catalytic domain protein
958 CAJPQO010000004.1 GCA905372675_00512 CDS open 85794-87716 _na     640_aa pulA type I pullulanase
959 CAJPQO010000004.1 GCA905372675_00513 CDS open 88190-88330 _na     46_aa hypothetical protein
960 CAJPQO010000004.1 GCA905372675_00514 CDS open 88364-91105 _na     913_aa malQ 4-alpha-glucanotransferase
961 CAJPQO010000004.1 GCA905372675_00515 CDS open 91338-92885 _na     515_aa Mg chelatase-like protein
962 CAJPQO010000004.1 GCA905372675_00516 CDS open 92902-93903 _na     333_aa Antioxidant%2C AhpC/TSA family
963 CAJPQO010000004.1 GCA905372675_00517 CDS open 93900-95576 _na     558_aa Tetratricopeptide repeat protein
964 CAJPQO010000004.1 GCA905372675_00520 CDS open 96740-97315 _na     191_aa Bacterial group 2 Ig-like protein
965 CAJPQO010000004.1 GCA905372675_00444 gene open 1195-2664
966 CAJPQO010000004.1 GCA905372675_00445 gene open 2645-4495 mrdA
967 CAJPQO010000004.1 GCA905372675_00446 gene open 4507-5001 mreD
968 CAJPQO010000004.1 GCA905372675_00447 gene open 5137-5994 mreC
969 CAJPQO010000004.1 GCA905372675_00448 gene open 5999-7051 mreB
970 CAJPQO010000004.1 GCA905372675_00449 gene open 7100-7693
971 CAJPQO010000004.1 GCA905372675_00450 gene open 8611-9804
972 CAJPQO010000004.1 GCA905372675_00451 gene open 9806-10975
973 CAJPQO010000004.1 GCA905372675_00452 gene open 11060-13138
974 CAJPQO010000004.1 GCA905372675_00453 gene open 13209-14672
975 CAJPQO010000004.1 GCA905372675_00454 gene open 14665-15027
976 CAJPQO010000004.1 GCA905372675_00455 gene open 15011-15424
977 CAJPQO010000004.1 GCA905372675_00456 gene open 15405-16052 lolA
978 CAJPQO010000004.1 GCA905372675_00457 gene open 16076-16435 eamA
979 CAJPQO010000004.1 GCA905372675_00458 gene open 16414-18165
980 CAJPQO010000004.1 GCA905372675_00459 gene open 18162-18419
981 CAJPQO010000004.1 GCA905372675_00460 gene open 18448-20199
982 CAJPQO010000004.1 GCA905372675_00461 gene open 20213-20635
983 CAJPQO010000004.1 GCA905372675_00462 gene open 20656-21102
984 CAJPQO010000004.1 GCA905372675_00463 gene open 21066-21968
985 CAJPQO010000004.1 GCA905372675_00464 gene open 21991-22233
986 CAJPQO010000004.1 GCA905372675_00465 gene open 22286-23380
987 CAJPQO010000004.1 GCA905372675_00466 gene open 23396-23968
988 CAJPQO010000004.1 GCA905372675_00467 gene open 23988-25205
989 CAJPQO010000004.1 GCA905372675_00468 gene open 25257-25985 fabG
990 CAJPQO010000004.1 GCA905372675_00469 gene open 26063-27598
991 CAJPQO010000004.1 GCA905372675_00470 gene open 28018-28530
992 CAJPQO010000004.1 GCA905372675_00471 gene open 28722-29078
993 CAJPQO010000004.1 GCA905372675_00472 gene open 29131-30693
994 CAJPQO010000004.1 GCA905372675_00473 gene open 31523-32272 fhuC
995 CAJPQO010000004.1 GCA905372675_00474 gene open 32404-32796
996 CAJPQO010000004.1 GCA905372675_00475 gene open 32807-34159
997 CAJPQO010000004.1 GCA905372675_00476 gene open 34350-35378
998 CAJPQO010000004.1 GCA905372675_00477 gene open 35369-36352
999 CAJPQO010000004.1 GCA905372675_00478 gene open 36368-37036
1000 CAJPQO010000004.1 GCA905372675_00479 gene open 37388-39001 pckA