HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Prevotella pallens (GCA_905372815.1)

Select a Genome:
BAKTA Annotations for GCA_905372815.1
Genome Selected: Prevotella pallens
ContigsBases CDSrRNA tmRNAtRNA
191 2,977,182 2466 0 1 35
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 5021 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:11]    |    Number of Records Found: 5021 [11 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  11  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
5001 CAJPQL010000186.1 GCA905372815_02502 gene open 1336-2451
5002 CAJPQL010000186.1 GCA905372815_02503 gene open 2458-2709
5003 CAJPQL010000187.1 GCA905372815_02504 CDS open 409-777 _na     122_aa Superoxide reductase
5004 CAJPQL010000187.1 GCA905372815_02505 CDS open 1054-1500 _na     148_aa Lipocalin-like domain-containing protein
5005 CAJPQL010000187.1 GCA905372815_02506 CDS open 1654-2535 _na     293_aa hypothetical protein
5006 CAJPQL010000187.1 GCA905372815_02504 gene open 409-777
5007 CAJPQL010000187.1 GCA905372815_02505 gene open 1054-1500
5008 CAJPQL010000187.1 GCA905372815_02506 gene open 1654-2535
5009 CAJPQL010000188.1 GCA905372815_02507 CDS open 1166-2662 _na     498_aa class I SAM-dependent DNA methyltransferase
5010 CAJPQL010000188.1 GCA905372815_02507 gene open 1166-2662
5011 CAJPQL010000189.1 repeat_region open 831-1308 CRISPR array with 7 repeats of length 37%2C consensus sequence GTCTTAATCCTTGTTGTAATGGAATATACTTAATAAT and spacer length 34
5012 CAJPQL010000189.1 GCA905372815_02508 CDS open 1377-1895 _na     172_aa N-acetyltransferase
5013 CAJPQL010000189.1 GCA905372815_02509 CDS open 2219-2623 _na     134_aa Phage tail protein
5014 CAJPQL010000189.1 GCA905372815_02508 gene open 1377-1895
5015 CAJPQL010000189.1 GCA905372815_02509 gene open 2219-2623
5016 CAJPQL010000190.1 GCA905372815_02510 CDS open 255-2417 _na     720_aa Tetratricopeptide (TPR) domain protein
5017 CAJPQL010000190.1 GCA905372815_02510 gene open 255-2417
5018 CAJPQL010000191.1 GCA905372815_02511 CDS open 34-417 _na     127_aa BrxA/BrxB family bacilliredoxin
5019 CAJPQL010000191.1 GCA905372815_02512 CDS open 496-2547 _na     683_aa hypothetical protein
5020 CAJPQL010000191.1 GCA905372815_02511 gene open 34-417
5021 CAJPQL010000191.1 GCA905372815_02512 gene open 496-2547