HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Capnocytophaga granulosa (GCA_905372915.1)

Select a Genome:
BAKTA Annotations for GCA_905372915.1
Genome Selected: Capnocytophaga granulosa
ContigsBases CDSrRNA tmRNAtRNA
87 2588185 2401 0 1 42
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4904 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:3]    |    Number of Records Found: 4904 [10 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1001 CAJPRD010000006.1 GCA905372915_00490 gene open 57651-59912
1002 CAJPRD010000006.1 GCA905372915_00491 gene open 59948-60961 menC
1003 CAJPRD010000006.1 GCA905372915_00492 gene open 61175-62125 gldB
1004 CAJPRD010000006.1 GCA905372915_00493 gene open 62129-62461 gldC
1005 CAJPRD010000006.1 GCA905372915_00494 gene open 62472-63467
1006 CAJPRD010000006.1 GCA905372915_00495 gene open 63534-64616
1007 CAJPRD010000006.1 GCA905372915_00496 gene open 64620-65201
1008 CAJPRD010000006.1 GCA905372915_00497 gene open 65317-65814
1009 CAJPRD010000006.1 GCA905372915_00498 gene open 65966-66940
1010 CAJPRD010000006.1 GCA905372915_00499 gene open 67056-67289
1011 CAJPRD010000006.1 GCA905372915_00500 gene open 67357-67701 fadA
1012 CAJPRD010000006.1 GCA905372915_00501 gene open 67705-67977
1013 CAJPRD010000006.1 GCA905372915_00502 gene open 67943-68569
1014 CAJPRD010000006.1 GCA905372915_00503 gene open 68611-69027
1015 CAJPRD010000006.1 GCA905372915_00504 gene open 69162-69485
1016 CAJPRD010000006.1 GCA905372915_00505 gene open 69554-69889
1017 CAJPRD010000006.1 GCA905372915_00506 gene open 69891-70094
1018 CAJPRD010000006.1 GCA905372915_00507 gene open 70189-70566
1019 CAJPRD010000006.1 GCA905372915_00508 gene open 70704-71153
1020 CAJPRD010000006.1 GCA905372915_00509 gene open 71128-71580
1021 CAJPRD010000006.1 GCA905372915_00510 gene open 71643-72197 kefF
1022 CAJPRD010000006.1 GCA905372915_00511 gene open 72391-72768
1023 CAJPRD010000006.1 GCA905372915_00512 gene open 72845-73594
1024 CAJPRD010000006.1 GCA905372915_00448 gene open 11488-11563 trnH
1025 CAJPRD010000006.1 GCA905372915_00448 tRNA open 11488-11563 trnH tRNA-His(gtg)
1026 CAJPRD010000007.1 GCA905372915_00556 gene open 45202-45311 6S-Flavo
1027 CAJPRD010000007.1 GCA905372915_00556 ncRNA open 45202-45311 6S-Flavo RNA
1028 CAJPRD010000007.1 GCA905372915_00513 CDS open 86-874 _na     262_aa O-methyltransferase
1029 CAJPRD010000007.1 GCA905372915_00514 CDS open 1048-1155 _na     35_aa hypothetical protein
1030 CAJPRD010000007.1 GCA905372915_00515 CDS open 1161-1682 _na     173_aa IS1 family transposase
1031 CAJPRD010000007.1 GCA905372915_00516 CDS open 1669-1938 _na     89_aa hypothetical protein
1032 CAJPRD010000007.1 GCA905372915_00517 CDS open 2014-2802 _na     262_aa O-methyltransferase
1033 CAJPRD010000007.1 GCA905372915_00518 CDS open 2834-4078 _na     414_aa Lipoprotein
1034 CAJPRD010000007.1 GCA905372915_00519 CDS open 4102-6429 _na     775_aa TonB-dependent receptor plug domain protein
1035 CAJPRD010000007.1 GCA905372915_00520 CDS open 6612-7601 _na     329_aa araC Transcriptional regulator%2C AraC family
1036 CAJPRD010000007.1 GCA905372915_00521 CDS open 7651-8877 _na     408_aa Lipoprotein
1037 CAJPRD010000007.1 GCA905372915_00522 CDS open 8904-11159 _na     751_aa TonB-dependent receptor plug domain protein
1038 CAJPRD010000007.1 GCA905372915_00523 CDS open 11462-12451 _na     329_aa araC Transcriptional regulator%2C AraC family
1039 CAJPRD010000007.1 GCA905372915_00524 CDS open 12454-12861 _na     135_aa hypothetical protein
1040 CAJPRD010000007.1 GCA905372915_00525 CDS open 12873-13106 _na     77_aa hypothetical protein
1041 CAJPRD010000007.1 GCA905372915_00526 CDS open 13238-14188 _na     316_aa acetyl-CoA carboxylase carboxyltransferase subunit alpha
1042 CAJPRD010000007.1 GCA905372915_00527 CDS open 14334-16436 _na     700_aa recG ATP-dependent DNA helicase RecG
1043 CAJPRD010000007.1 GCA905372915_00528 CDS open 16442-17758 _na     438_aa mtaB tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB
1044 CAJPRD010000007.1 GCA905372915_00529 CDS open 17927-18352 _na     141_aa Integron-associated effector binding protein domain-containing protein
1045 CAJPRD010000007.1 GCA905372915_00530 CDS open 18481-18942 _na     153_aa PIN domain-containing protein
1046 CAJPRD010000007.1 GCA905372915_00531 CDS open 18945-19289 _na     114_aa hypothetical protein
1047 CAJPRD010000007.1 GCA905372915_00532 CDS open 19445-21721 _na     758_aa AAA domain protein
1048 CAJPRD010000007.1 GCA905372915_00533 CDS open 21774-24335 _na     853_aa clpC Putative ATP-dependent Clp protease ATP-binding subunit ClpC
1049 CAJPRD010000007.1 GCA905372915_00534 CDS open 24476-27115 _na     879_aa valine--tRNA ligase
1050 CAJPRD010000007.1 GCA905372915_00535 CDS open 27275-27655 _na     126_aa DUF1573 domain-containing protein
1051 CAJPRD010000007.1 GCA905372915_00536 CDS open 27739-28191 _na     150_aa Hemerythrin HHE cation-binding domain protein
1052 CAJPRD010000007.1 GCA905372915_00537 CDS open 28255-28851 _na     198_aa def peptide deformylase
1053 CAJPRD010000007.1 GCA905372915_00538 CDS open 28865-29257 _na     130_aa DUF5606 domain-containing protein
1054 CAJPRD010000007.1 GCA905372915_00539 CDS open 29446-30375 _na     309_aa YbbR-like protein
1055 CAJPRD010000007.1 GCA905372915_00540 CDS open 30372-30980 _na     202_aa coaE dephospho-CoA kinase
1056 CAJPRD010000007.1 GCA905372915_00541 CDS open 31042-32637 _na     531_aa histidine kinase
1057 CAJPRD010000007.1 GCA905372915_00542 CDS open 32727-33455 _na     242_aa DNA-binding response regulator
1058 CAJPRD010000007.1 GCA905372915_00543 CDS open 33590-33949 _na     119_aa rnpA ribonuclease P protein component
1059 CAJPRD010000007.1 GCA905372915_00544 CDS open 34052-35245 _na     397_aa sucC ADP-forming succinate--CoA ligase subunit beta
1060 CAJPRD010000007.1 GCA905372915_00545 CDS open 35307-36314 _na     335_aa Beta-ketoacyl-[acyl-carrier-protein] synthase III
1061 CAJPRD010000007.1 GCA905372915_00546 CDS open 36261-36887 _na     208_aa 4-amino-4-deoxychorismate lyase
1062 CAJPRD010000007.1 GCA905372915_00547 CDS open 36892-37842 _na     316_aa aminodeoxychorismate synthase component I
1063 CAJPRD010000007.1 GCA905372915_00548 CDS open 37842-38966 _na     374_aa ndpA Nucleoid-associated protein NdpA
1064 CAJPRD010000007.1 GCA905372915_00549 CDS open 39006-39635 _na     209_aa Peptidase%2C S54 family
1065 CAJPRD010000007.1 GCA905372915_00550 CDS open 39641-40156 _na     171_aa Plasmid pRiA4b Orf3-like domain-containing protein
1066 CAJPRD010000007.1 GCA905372915_00551 CDS open 40169-41947 _na     592_aa AMP-binding enzyme
1067 CAJPRD010000007.1 GCA905372915_00552 CDS open 42299-43867 _na     522_aa dnaB replicative DNA helicase
1068 CAJPRD010000007.1 GCA905372915_00553 CDS open 43869-44408 _na     179_aa Isochorismatase family protein
1069 CAJPRD010000007.1 GCA905372915_00554 CDS open 44568-44855 _na     95_aa zapB Cell division protein ZapB
1070 CAJPRD010000007.1 GCA905372915_00555 CDS open 44870-45163 _na     97_aa zapA Cell division protein ZapA
1071 CAJPRD010000007.1 GCA905372915_00557 CDS open 45361-46938 _na     525_aa rny ribonuclease Y
1072 CAJPRD010000007.1 GCA905372915_00558 CDS open 47051-47428 _na     125_aa DUF4296 domain-containing protein
1073 CAJPRD010000007.1 GCA905372915_00559 CDS open 47510-48100 _na     196_aa DUF4271 domain-containing protein
1074 CAJPRD010000007.1 GCA905372915_00560 CDS open 48107-48850 _na     247_aa Uroporphyrinogen-III synthase
1075 CAJPRD010000007.1 GCA905372915_00561 CDS open 48885-49247 _na     120_aa yraN YraN family protein
1076 CAJPRD010000007.1 GCA905372915_00562 CDS open 49536-49976 _na     146_aa tRNA-specific adenosine deaminase
1077 CAJPRD010000007.1 GCA905372915_00563 CDS open 49973-50932 _na     319_aa PhoH-like protein
1078 CAJPRD010000007.1 GCA905372915_00564 CDS open 51019-52017 _na     332_aa putative membrane transporter protein
1079 CAJPRD010000007.1 GCA905372915_00565 CDS open 52030-52977 _na     315_aa Peptidyl-prolyl cis-trans isomerase
1080 CAJPRD010000007.1 GCA905372915_00566 CDS open 53037-53774 _na     245_aa ZIP Zinc transporter
1081 CAJPRD010000007.1 GCA905372915_00567 CDS open 53899-54915 _na     338_aa quinone-dependent dihydroorotate dehydrogenase
1082 CAJPRD010000007.1 GCA905372915_00568 CDS open 54987-56519 _na     510_aa purH bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase
1083 CAJPRD010000007.1 GCA905372915_00569 CDS open 56706-58910 _na     734_aa Putative GTP diphosphokinase
1084 CAJPRD010000007.1 GCA905372915_00570 CDS open 58924-59421 _na     165_aa Bacterial Pleckstrin-like y domain-containing protein
1085 CAJPRD010000007.1 GCA905372915_00571 CDS open 59470-61095 _na     541_aa Peptidase%2C S8/S53 family
1086 CAJPRD010000007.1 GCA905372915_00572 CDS open 61221-61781 _na     186_aa L-threonylcarbamoyladenylate synthase
1087 CAJPRD010000007.1 GCA905372915_00573 CDS open 61860-63134 _na     424_aa Serine hydroxymethyltransferase
1088 CAJPRD010000007.1 GCA905372915_00575 CDS open 63381-63896 _na     171_aa Tetratricopeptide repeat protein
1089 CAJPRD010000007.1 GCA905372915_00576 CDS open 63930-64766 _na     278_aa Alpha/beta hydrolase family protein
1090 CAJPRD010000007.1 GCA905372915_00577 CDS open 64832-65476 _na     214_aa Cupin domain protein
1091 CAJPRD010000007.1 GCA905372915_00578 CDS open 65496-66518 _na     340_aa galE UDP-glucose 4-epimerase GalE
1092 CAJPRD010000007.1 GCA905372915_00579 CDS open 66541-67377 _na     278_aa mechanosensitive ion channel family protein
1093 CAJPRD010000007.1 GCA905372915_00580 CDS open 67482-68885 _na     467_aa ftsA cell division protein FtsA
1094 CAJPRD010000007.1 GCA905372915_00581 CDS open 68969-69787 _na     272_aa ftsQ Cell division protein FtsQ
1095 CAJPRD010000007.1 GCA905372915_00582 CDS open 69901-70818 _na     305_aa lpxD UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase
1096 CAJPRD010000007.1 GCA905372915_00583 CDS open 70838-72136 _na     432_aa Glycosyltransferase Family 4
1097 CAJPRD010000007.1 GCA905372915_00584 CDS open 72113-72748 _na     211_aa hypothetical protein
1098 CAJPRD010000007.1 GCA905372915_00513 gene open 86-874
1099 CAJPRD010000007.1 GCA905372915_00514 gene open 1048-1155
1100 CAJPRD010000007.1 GCA905372915_00515 gene open 1161-1682
1101 CAJPRD010000007.1 GCA905372915_00516 gene open 1669-1938
1102 CAJPRD010000007.1 GCA905372915_00517 gene open 2014-2802
1103 CAJPRD010000007.1 GCA905372915_00518 gene open 2834-4078
1104 CAJPRD010000007.1 GCA905372915_00519 gene open 4102-6429
1105 CAJPRD010000007.1 GCA905372915_00520 gene open 6612-7601 araC
1106 CAJPRD010000007.1 GCA905372915_00521 gene open 7651-8877
1107 CAJPRD010000007.1 GCA905372915_00522 gene open 8904-11159
1108 CAJPRD010000007.1 GCA905372915_00523 gene open 11462-12451 araC
1109 CAJPRD010000007.1 GCA905372915_00524 gene open 12454-12861
1110 CAJPRD010000007.1 GCA905372915_00525 gene open 12873-13106
1111 CAJPRD010000007.1 GCA905372915_00526 gene open 13238-14188
1112 CAJPRD010000007.1 GCA905372915_00527 gene open 14334-16436 recG
1113 CAJPRD010000007.1 GCA905372915_00528 gene open 16442-17758 mtaB
1114 CAJPRD010000007.1 GCA905372915_00529 gene open 17927-18352
1115 CAJPRD010000007.1 GCA905372915_00530 gene open 18481-18942
1116 CAJPRD010000007.1 GCA905372915_00531 gene open 18945-19289
1117 CAJPRD010000007.1 GCA905372915_00532 gene open 19445-21721
1118 CAJPRD010000007.1 GCA905372915_00533 gene open 21774-24335 clpC
1119 CAJPRD010000007.1 GCA905372915_00534 gene open 24476-27115
1120 CAJPRD010000007.1 GCA905372915_00535 gene open 27275-27655
1121 CAJPRD010000007.1 GCA905372915_00536 gene open 27739-28191
1122 CAJPRD010000007.1 GCA905372915_00537 gene open 28255-28851 def
1123 CAJPRD010000007.1 GCA905372915_00538 gene open 28865-29257
1124 CAJPRD010000007.1 GCA905372915_00539 gene open 29446-30375
1125 CAJPRD010000007.1 GCA905372915_00540 gene open 30372-30980 coaE
1126 CAJPRD010000007.1 GCA905372915_00541 gene open 31042-32637
1127 CAJPRD010000007.1 GCA905372915_00542 gene open 32727-33455
1128 CAJPRD010000007.1 GCA905372915_00543 gene open 33590-33949 rnpA
1129 CAJPRD010000007.1 GCA905372915_00544 gene open 34052-35245 sucC
1130 CAJPRD010000007.1 GCA905372915_00545 gene open 35307-36314
1131 CAJPRD010000007.1 GCA905372915_00546 gene open 36261-36887
1132 CAJPRD010000007.1 GCA905372915_00547 gene open 36892-37842
1133 CAJPRD010000007.1 GCA905372915_00548 gene open 37842-38966 ndpA
1134 CAJPRD010000007.1 GCA905372915_00549 gene open 39006-39635
1135 CAJPRD010000007.1 GCA905372915_00550 gene open 39641-40156
1136 CAJPRD010000007.1 GCA905372915_00551 gene open 40169-41947
1137 CAJPRD010000007.1 GCA905372915_00552 gene open 42299-43867 dnaB
1138 CAJPRD010000007.1 GCA905372915_00553 gene open 43869-44408
1139 CAJPRD010000007.1 GCA905372915_00554 gene open 44568-44855 zapB
1140 CAJPRD010000007.1 GCA905372915_00555 gene open 44870-45163 zapA
1141 CAJPRD010000007.1 GCA905372915_00557 gene open 45361-46938 rny
1142 CAJPRD010000007.1 GCA905372915_00558 gene open 47051-47428
1143 CAJPRD010000007.1 GCA905372915_00559 gene open 47510-48100
1144 CAJPRD010000007.1 GCA905372915_00560 gene open 48107-48850
1145 CAJPRD010000007.1 GCA905372915_00561 gene open 48885-49247 yraN
1146 CAJPRD010000007.1 GCA905372915_00562 gene open 49536-49976
1147 CAJPRD010000007.1 GCA905372915_00563 gene open 49973-50932
1148 CAJPRD010000007.1 GCA905372915_00564 gene open 51019-52017
1149 CAJPRD010000007.1 GCA905372915_00565 gene open 52030-52977
1150 CAJPRD010000007.1 GCA905372915_00566 gene open 53037-53774
1151 CAJPRD010000007.1 GCA905372915_00567 gene open 53899-54915
1152 CAJPRD010000007.1 GCA905372915_00568 gene open 54987-56519 purH
1153 CAJPRD010000007.1 GCA905372915_00569 gene open 56706-58910
1154 CAJPRD010000007.1 GCA905372915_00570 gene open 58924-59421
1155 CAJPRD010000007.1 GCA905372915_00571 gene open 59470-61095
1156 CAJPRD010000007.1 GCA905372915_00572 gene open 61221-61781
1157 CAJPRD010000007.1 GCA905372915_00573 gene open 61860-63134
1158 CAJPRD010000007.1 GCA905372915_00575 gene open 63381-63896
1159 CAJPRD010000007.1 GCA905372915_00576 gene open 63930-64766
1160 CAJPRD010000007.1 GCA905372915_00577 gene open 64832-65476
1161 CAJPRD010000007.1 GCA905372915_00578 gene open 65496-66518 galE
1162 CAJPRD010000007.1 GCA905372915_00579 gene open 66541-67377
1163 CAJPRD010000007.1 GCA905372915_00580 gene open 67482-68885 ftsA
1164 CAJPRD010000007.1 GCA905372915_00581 gene open 68969-69787 ftsQ
1165 CAJPRD010000007.1 GCA905372915_00582 gene open 69901-70818 lpxD
1166 CAJPRD010000007.1 GCA905372915_00583 gene open 70838-72136
1167 CAJPRD010000007.1 GCA905372915_00584 gene open 72113-72748
1168 CAJPRD010000007.1 GCA905372915_00574 gene open 63280-63352 trnP
1169 CAJPRD010000007.1 GCA905372915_00574 tRNA open 63280-63352 trnP tRNA-Pro(ggg)
1170 CAJPRD010000008.1 GCA905372915_00585 CDS open 107-1894 _na     595_aa nrdD anaerobic ribonucleoside-triphosphate reductase
1171 CAJPRD010000008.1 GCA905372915_00586 CDS open 1981-2439 _na     152_aa nrdG anaerobic ribonucleoside-triphosphate reductase activating protein
1172 CAJPRD010000008.1 GCA905372915_00587 CDS open 2864-5956 _na     1030_aa TonB-linked outer membrane protein%2C SusC/RagA family
1173 CAJPRD010000008.1 GCA905372915_00588 CDS open 5989-7650 _na     553_aa Starch-binding associating with outer membrane
1174 CAJPRD010000008.1 GCA905372915_00589 CDS open 7880-10987 _na     1035_aa TonB-linked outer membrane protein%2C SusC/RagA family
1175 CAJPRD010000008.1 GCA905372915_00590 CDS open 11009-12682 _na     557_aa Starch-binding protein%2C SusD-like family
1176 CAJPRD010000008.1 GCA905372915_00591 CDS open 12765-13727 _na     320_aa GSCFA family protein
1177 CAJPRD010000008.1 GCA905372915_00592 CDS open 13901-14080 _na     59_aa hypothetical protein
1178 CAJPRD010000008.1 GCA905372915_00593 CDS open 14104-14352 _na     82_aa hypothetical protein
1179 CAJPRD010000008.1 GCA905372915_00594 CDS open 14366-14983 _na     205_aa DUF4230 domain-containing protein
1180 CAJPRD010000008.1 GCA905372915_00595 CDS open 15053-16360 _na     435_aa Na+/H+ antiporter family protein
1181 CAJPRD010000008.1 GCA905372915_00596 CDS open 16379-17293 _na     304_aa Serine aminopeptidase S33 domain-containing protein
1182 CAJPRD010000008.1 GCA905372915_00597 CDS open 17299-18357 _na     352_aa DUF6688 domain-containing protein
1183 CAJPRD010000008.1 GCA905372915_00598 CDS open 18469-20604 _na     711_aa Dipeptidyl-peptidase
1184 CAJPRD010000008.1 GCA905372915_00599 CDS open 20691-21932 _na     413_aa hlyD HlyD family type I secretion membrane fusion protein
1185 CAJPRD010000008.1 GCA905372915_00600 CDS open 21976-23415 _na     479_aa SGNH hydrolase-type esterase domain-containing protein
1186 CAJPRD010000008.1 GCA905372915_00601 CDS open 23488-24177 _na     229_aa TIGR02117 family protein
1187 CAJPRD010000008.1 GCA905372915_00602 CDS open 24174-24662 _na     162_aa SMI1 / KNR4 family protein
1188 CAJPRD010000008.1 GCA905372915_00603 CDS open 24685-25368 _na     227_aa RloB-like protein
1189 CAJPRD010000008.1 GCA905372915_00604 CDS open 25374-26633 _na     419_aa ATPase AAA-type core domain-containing protein
1190 CAJPRD010000008.1 GCA905372915_00605 CDS open 26709-27293 _na     194_aa grpB GrpB protein
1191 CAJPRD010000008.1 GCA905372915_00606 CDS open 27311-30097 _na     928_aa polA DNA polymerase I
1192 CAJPRD010000008.1 GCA905372915_00607 CDS open 30187-30756 _na     189_aa YceI-like domain protein
1193 CAJPRD010000008.1 GCA905372915_00608 CDS open 30841-31866 _na     341_aa FAD:protein FMN transferase
1194 CAJPRD010000008.1 GCA905372915_00609 CDS open 31867-32226 _na     119_aa Na(+)-translocating NADH-quinone reductase subunit F
1195 CAJPRD010000008.1 GCA905372915_00610 CDS open 32374-33066 _na     230_aa DNA alkylation repair enzyme
1196 CAJPRD010000008.1 GCA905372915_00611 CDS open 33244-33933 _na     229_aa DUF6994 domain-containing protein
1197 CAJPRD010000008.1 GCA905372915_00612 CDS open 33955-34371 _na     138_aa Glycyl-tRNA synthetase subunit alpha
1198 CAJPRD010000008.1 GCA905372915_00613 CDS open 34420-34677 _na     85_aa hypothetical protein
1199 CAJPRD010000008.1 GCA905372915_00614 CDS open 34729-34995 _na     88_aa hypothetical protein
1200 CAJPRD010000008.1 GCA905372915_00615 CDS open 35213-35479 _na     88_aa DNA-binding helix-turn-helix protein
1201 CAJPRD010000008.1 GCA905372915_00616 CDS open 35530-36204 _na     224_aa ASCH domain protein
1202 CAJPRD010000008.1 GCA905372915_00617 CDS open 36267-36707 _na     146_aa PF07332 family protein
1203 CAJPRD010000008.1 GCA905372915_00618 CDS open 36755-36955 _na     66_aa hypothetical protein
1204 CAJPRD010000008.1 GCA905372915_00619 CDS open 36952-37368 _na     138_aa putative nucleic acid-binding protein%2C contains PIN domain
1205 CAJPRD010000008.1 GCA905372915_00620 CDS open 37389-37766 _na     125_aa DNA-binding helix-turn-helix protein
1206 CAJPRD010000008.1 GCA905372915_00621 CDS open 37900-38475 _na     191_aa Bacterial stress protein
1207 CAJPRD010000008.1 GCA905372915_00622 CDS open 38485-39039 _na     184_aa Bacterial stress protein
1208 CAJPRD010000008.1 GCA905372915_00623 CDS open 39057-39716 _na     219_aa terZ Tellurium resistance protein TerZ
1209 CAJPRD010000008.1 GCA905372915_00624 CDS open 39719-40357 _na     212_aa von Willebrand factor type A domain protein
1210 CAJPRD010000008.1 GCA905372915_00625 CDS open 40361-40999 _na     212_aa von Willebrand factor type A domain protein
1211 CAJPRD010000008.1 GCA905372915_00626 CDS open 41012-42055 _na     347_aa Putative von Willebrand factor type A domain protein
1212 CAJPRD010000008.1 GCA905372915_00627 CDS open 42055-43437 _na     460_aa Death domain-containing protein
1213 CAJPRD010000008.1 GCA905372915_00628 CDS open 43440-44948 _na     502_aa Protein kinase domain-containing protein
1214 CAJPRD010000008.1 GCA905372915_00629 CDS open 44992-47727 _na     911_aa calcium-translocating P-type ATPase%2C PMCA-type
1215 CAJPRD010000008.1 GCA905372915_00631 CDS open 47919-48980 _na     353_aa Glucanase
1216 CAJPRD010000008.1 GCA905372915_00632 CDS open 49002-49706 _na     234_aa SPFH/Band 7/PHB domain protein
1217 CAJPRD010000008.1 GCA905372915_00633 CDS open 50103-50549 _na     148_aa hypothetical protein
1218 CAJPRD010000008.1 GCA905372915_00634 CDS open 50561-51277 _na     238_aa MAE_28990/MAE_18760 family HEPN-like nuclease
1219 CAJPRD010000008.1 GCA905372915_00635 CDS open 51267-52373 _na     368_aa DUF262 domain-containing protein
1220 CAJPRD010000008.1 GCA905372915_00636 CDS open 52375-53439 _na     354_aa DNA (cytosine-5-)-methyltransferase
1221 CAJPRD010000008.1 GCA905372915_00637 CDS open 53553-56405 _na     950_aa carB carbamoyl-phosphate synthase large subunit
1222 CAJPRD010000008.1 GCA905372915_00638 CDS open 56422-57567 _na     381_aa PD-(D/E)XK nuclease family protein
1223 CAJPRD010000008.1 GCA905372915_00640 CDS open 57910-61212 _na     1100_aa DUF2723 domain-containing protein
1224 CAJPRD010000008.1 GCA905372915_00642 CDS open 61527-64775 _na     1082_aa Type I restriction enzyme endonuclease subunit
1225 CAJPRD010000008.1 GCA905372915_00643 CDS open 64781-66439 _na     552_aa class I SAM-dependent DNA methyltransferase
1226 CAJPRD010000008.1 GCA905372915_00585 gene open 107-1894 nrdD
1227 CAJPRD010000008.1 GCA905372915_00586 gene open 1981-2439 nrdG
1228 CAJPRD010000008.1 GCA905372915_00587 gene open 2864-5956
1229 CAJPRD010000008.1 GCA905372915_00588 gene open 5989-7650
1230 CAJPRD010000008.1 GCA905372915_00589 gene open 7880-10987
1231 CAJPRD010000008.1 GCA905372915_00590 gene open 11009-12682
1232 CAJPRD010000008.1 GCA905372915_00591 gene open 12765-13727
1233 CAJPRD010000008.1 GCA905372915_00592 gene open 13901-14080
1234 CAJPRD010000008.1 GCA905372915_00593 gene open 14104-14352
1235 CAJPRD010000008.1 GCA905372915_00594 gene open 14366-14983
1236 CAJPRD010000008.1 GCA905372915_00595 gene open 15053-16360
1237 CAJPRD010000008.1 GCA905372915_00596 gene open 16379-17293
1238 CAJPRD010000008.1 GCA905372915_00597 gene open 17299-18357
1239 CAJPRD010000008.1 GCA905372915_00598 gene open 18469-20604
1240 CAJPRD010000008.1 GCA905372915_00599 gene open 20691-21932 hlyD
1241 CAJPRD010000008.1 GCA905372915_00600 gene open 21976-23415
1242 CAJPRD010000008.1 GCA905372915_00601 gene open 23488-24177
1243 CAJPRD010000008.1 GCA905372915_00602 gene open 24174-24662
1244 CAJPRD010000008.1 GCA905372915_00603 gene open 24685-25368
1245 CAJPRD010000008.1 GCA905372915_00604 gene open 25374-26633
1246 CAJPRD010000008.1 GCA905372915_00605 gene open 26709-27293 grpB
1247 CAJPRD010000008.1 GCA905372915_00606 gene open 27311-30097 polA
1248 CAJPRD010000008.1 GCA905372915_00607 gene open 30187-30756
1249 CAJPRD010000008.1 GCA905372915_00608 gene open 30841-31866
1250 CAJPRD010000008.1 GCA905372915_00609 gene open 31867-32226
1251 CAJPRD010000008.1 GCA905372915_00610 gene open 32374-33066
1252 CAJPRD010000008.1 GCA905372915_00611 gene open 33244-33933
1253 CAJPRD010000008.1 GCA905372915_00612 gene open 33955-34371
1254 CAJPRD010000008.1 GCA905372915_00613 gene open 34420-34677
1255 CAJPRD010000008.1 GCA905372915_00614 gene open 34729-34995
1256 CAJPRD010000008.1 GCA905372915_00615 gene open 35213-35479
1257 CAJPRD010000008.1 GCA905372915_00616 gene open 35530-36204
1258 CAJPRD010000008.1 GCA905372915_00617 gene open 36267-36707
1259 CAJPRD010000008.1 GCA905372915_00618 gene open 36755-36955
1260 CAJPRD010000008.1 GCA905372915_00619 gene open 36952-37368
1261 CAJPRD010000008.1 GCA905372915_00620 gene open 37389-37766
1262 CAJPRD010000008.1 GCA905372915_00621 gene open 37900-38475
1263 CAJPRD010000008.1 GCA905372915_00622 gene open 38485-39039
1264 CAJPRD010000008.1 GCA905372915_00623 gene open 39057-39716 terZ
1265 CAJPRD010000008.1 GCA905372915_00624 gene open 39719-40357
1266 CAJPRD010000008.1 GCA905372915_00625 gene open 40361-40999
1267 CAJPRD010000008.1 GCA905372915_00626 gene open 41012-42055
1268 CAJPRD010000008.1 GCA905372915_00627 gene open 42055-43437
1269 CAJPRD010000008.1 GCA905372915_00628 gene open 43440-44948
1270 CAJPRD010000008.1 GCA905372915_00629 gene open 44992-47727
1271 CAJPRD010000008.1 GCA905372915_00631 gene open 47919-48980
1272 CAJPRD010000008.1 GCA905372915_00632 gene open 49002-49706
1273 CAJPRD010000008.1 GCA905372915_00633 gene open 50103-50549
1274 CAJPRD010000008.1 GCA905372915_00634 gene open 50561-51277
1275 CAJPRD010000008.1 GCA905372915_00635 gene open 51267-52373
1276 CAJPRD010000008.1 GCA905372915_00636 gene open 52375-53439
1277 CAJPRD010000008.1 GCA905372915_00637 gene open 53553-56405 carB
1278 CAJPRD010000008.1 GCA905372915_00638 gene open 56422-57567
1279 CAJPRD010000008.1 GCA905372915_00640 gene open 57910-61212
1280 CAJPRD010000008.1 GCA905372915_00642 gene open 61527-64775
1281 CAJPRD010000008.1 GCA905372915_00643 gene open 64781-66439
1282 CAJPRD010000008.1 GCA905372915_00630 gene open 47838-47909 trnR
1283 CAJPRD010000008.1 GCA905372915_00639 gene open 57756-57828 trnG
1284 CAJPRD010000008.1 GCA905372915_00641 gene open 61360-61430 trnQ
1285 CAJPRD010000008.1 GCA905372915_00630 tRNA open 47838-47909 trnR tRNA-Arg(cct)
1286 CAJPRD010000008.1 GCA905372915_00639 tRNA open 57756-57828 trnG tRNA-Gly(ccc)
1287 CAJPRD010000008.1 GCA905372915_00641 tRNA open 61360-61430 trnQ tRNA-Gln(ttg)
1288 CAJPRD010000009.1 repeat_region open 452-1478 CRISPR array with 14 repeats of length 45%2C consensus sequence GTTGTGAGTTGCTTTCAAATTCGTAACTTTGTGACCTCAAACAAC and spacer length 29
1289 CAJPRD010000009.1 GCA905372915_00644 CDS open 1680-1985 _na     101_aa CRISP-associated protein Cas1
1290 CAJPRD010000009.1 GCA905372915_00645 CDS open 2026-6360 _na     1444_aa cas9 type II CRISPR RNA-guided endonuclease Cas9
1291 CAJPRD010000009.1 GCA905372915_00646 CDS open 6599-7207 _na     202_aa Thymidylate synthase
1292 CAJPRD010000009.1 GCA905372915_00647 CDS open 7212-8285 _na     357_aa aroC chorismate synthase
1293 CAJPRD010000009.1 GCA905372915_00648 CDS open 8267-10270 _na     667_aa uvrB excinuclease ABC subunit UvrB
1294 CAJPRD010000009.1 GCA905372915_00649 CDS open 10378-11538 _na     386_aa Ser/Thr phosphatase family protein
1295 CAJPRD010000009.1 GCA905372915_00650 CDS open 11552-12106 _na     184_aa DUF5063 domain-containing protein
1296 CAJPRD010000009.1 GCA905372915_00651 CDS open 12138-12950 _na     270_aa glycosyltransferase
1297 CAJPRD010000009.1 GCA905372915_00652 CDS open 12955-13722 _na     255_aa wbuO WbuO protein
1298 CAJPRD010000009.1 GCA905372915_00653 CDS open 13724-14347 _na     207_aa Haloacid dehalogenase
1299 CAJPRD010000009.1 GCA905372915_00654 CDS open 14353-15213 _na     286_aa glycosyltransferase family 2 protein
1300 CAJPRD010000009.1 GCA905372915_00655 CDS open 15164-16351 _na     395_aa Polymerase
1301 CAJPRD010000009.1 GCA905372915_00656 CDS open 16341-17309 _na     322_aa Lipopolysaccharide biosynthesis protein
1302 CAJPRD010000009.1 GCA905372915_00657 CDS open 17306-18448 _na     380_aa UDP-glucose 4-epimerase
1303 CAJPRD010000009.1 GCA905372915_00658 CDS open 18448-19044 _na     198_aa Bacterial transferase hexapeptide repeat protein
1304 CAJPRD010000009.1 GCA905372915_00659 CDS open 19080-20498 _na     472_aa Polysaccharide biosynthesis protein
1305 CAJPRD010000009.1 GCA905372915_00660 CDS open 20495-21826 _na     443_aa Capsule polysaccharide biosynthesis protein
1306 CAJPRD010000009.1 GCA905372915_00661 CDS open 21828-22889 _na     353_aa acyltransferase
1307 CAJPRD010000009.1 GCA905372915_00662 CDS open 22924-24024 _na     366_aa N-acetyl sugar amidotransferase
1308 CAJPRD010000009.1 GCA905372915_00663 CDS open 24031-24711 _na     226_aa cytidylyltransferase domain-containing protein
1309 CAJPRD010000009.1 GCA905372915_00664 CDS open 24708-25751 _na     347_aa nucleotidyltransferase family protein
1310 CAJPRD010000009.1 GCA905372915_00665 CDS open 25759-26916 _na     385_aa neuC UDP-N-acetylglucosamine 2-epimerase
1311 CAJPRD010000009.1 GCA905372915_00666 CDS open 26913-27923 _na     336_aa neuB N-acetylneuraminate synthase
1312 CAJPRD010000009.1 GCA905372915_00667 CDS open 27925-28560 _na     211_aa acetyltransferase
1313 CAJPRD010000009.1 GCA905372915_00668 CDS open 28563-29564 _na     333_aa ketoacyl-ACP synthase III
1314 CAJPRD010000009.1 GCA905372915_00669 CDS open 29569-30315 _na     248_aa SDR family NAD(P)-dependent oxidoreductase
1315 CAJPRD010000009.1 GCA905372915_00670 CDS open 30322-30552 _na     76_aa phosphopantetheine-binding protein
1316 CAJPRD010000009.1 GCA905372915_00671 CDS open 30568-31716 _na     382_aa Aminotransferase%2C LLPSF_NHT_00031 family
1317 CAJPRD010000009.1 GCA905372915_00672 CDS open 31753-32961 _na     402_aa UDP-N-acetylglucosamine 4%2C6-dehydratase
1318 CAJPRD010000009.1 GCA905372915_00673 CDS open 33031-33879 _na     282_aa NAD-dependent epimerase/dehydratase family protein
1319 CAJPRD010000009.1 GCA905372915_00674 CDS open 33883-35202 _na     439_aa UDP-glucose/GDP-mannose dehydrogenase family protein
1320 CAJPRD010000009.1 GCA905372915_00675 CDS open 35248-36234 _na     328_aa pfkA 6-phosphofructokinase
1321 CAJPRD010000009.1 GCA905372915_00676 CDS open 36355-38112 _na     585_aa ABC transporter%2C ATP-binding protein
1322 CAJPRD010000009.1 GCA905372915_00677 CDS open 38315-38764 _na     149_aa Glutamyl-tRNA amidotransferase
1323 CAJPRD010000009.1 GCA905372915_00679 CDS open 39232-39339 _na     35_aa hypothetical protein
1324 CAJPRD010000009.1 GCA905372915_00680 CDS open 39779-40210 _na     143_aa HD domain protein
1325 CAJPRD010000009.1 GCA905372915_00681 CDS open 40179-40808 _na     209_aa hypothetical protein
1326 CAJPRD010000009.1 GCA905372915_00682 CDS open 40854-41810 _na     318_aa Tryptophan-specific transport protein
1327 CAJPRD010000009.1 GCA905372915_00683 CDS open 41850-43073 _na     407_aa Aromatic amino acid transport protein
1328 CAJPRD010000009.1 GCA905372915_00684 CDS open 43102-44343 _na     413_aa mtr tryptophan permease
1329 CAJPRD010000009.1 GCA905372915_00685 CDS open 44355-45065 _na     236_aa hypothetical protein
1330 CAJPRD010000009.1 GCA905372915_00686 CDS open 45145-45642 _na     165_aa Rare lipoprotein B family protein
1331 CAJPRD010000009.1 GCA905372915_00687 CDS open 45642-46505 _na     287_aa Tetratricopeptide repeat protein
1332 CAJPRD010000009.1 GCA905372915_00688 CDS open 46514-46882 _na     122_aa secG preprotein translocase subunit SecG
1333 CAJPRD010000009.1 GCA905372915_00689 CDS open 47031-47945 _na     304_aa RHS repeat protein
1334 CAJPRD010000009.1 GCA905372915_00690 CDS open 48036-48818 _na     260_aa mazG nucleoside triphosphate pyrophosphohydrolase
1335 CAJPRD010000009.1 GCA905372915_00691 CDS open 48983-50638 _na     551_aa ribonucleoside-diphosphate reductase subunit alpha
1336 CAJPRD010000009.1 GCA905372915_00692 CDS open 50758-51651 _na     297_aa xerD site-specific tyrosine recombinase XerD
1337 CAJPRD010000009.1 GCA905372915_00693 CDS open 51694-54159 _na     821_aa Aminopeptidase N
1338 CAJPRD010000009.1 GCA905372915_00694 CDS open 54269-55075 _na     268_aa M48 family peptidase
1339 CAJPRD010000009.1 GCA905372915_00695 CDS open 55197-57320 _na     707_aa S1 motif domain-containing protein
1340 CAJPRD010000009.1 GCA905372915_00696 CDS open 57353-59401 _na     682_aa Peptidase%2C S9A/B/C family%2C catalytic domain protein
1341 CAJPRD010000009.1 GCA905372915_00697 CDS open 59586-60644 _na     352_aa Tetratricopeptide repeat-containing protein
1342 CAJPRD010000009.1 GCA905372915_00698 CDS open 60687-62507 _na     606_aa Oxygen tolerance protein
1343 CAJPRD010000009.1 GCA905372915_00699 CDS open 62519-64573 _na     684_aa ppk1 polyphosphate kinase 1
1344 CAJPRD010000009.1 GCA905372915_00700 CDS open 64711-64968 _na     85_aa rpsT 30S ribosomal protein S20
1345 CAJPRD010000009.1 GCA905372915_00644 gene open 1680-1985
1346 CAJPRD010000009.1 GCA905372915_00645 gene open 2026-6360 cas9
1347 CAJPRD010000009.1 GCA905372915_00646 gene open 6599-7207
1348 CAJPRD010000009.1 GCA905372915_00647 gene open 7212-8285 aroC
1349 CAJPRD010000009.1 GCA905372915_00648 gene open 8267-10270 uvrB
1350 CAJPRD010000009.1 GCA905372915_00649 gene open 10378-11538
1351 CAJPRD010000009.1 GCA905372915_00650 gene open 11552-12106
1352 CAJPRD010000009.1 GCA905372915_00651 gene open 12138-12950
1353 CAJPRD010000009.1 GCA905372915_00652 gene open 12955-13722 wbuO
1354 CAJPRD010000009.1 GCA905372915_00653 gene open 13724-14347
1355 CAJPRD010000009.1 GCA905372915_00654 gene open 14353-15213
1356 CAJPRD010000009.1 GCA905372915_00655 gene open 15164-16351
1357 CAJPRD010000009.1 GCA905372915_00656 gene open 16341-17309
1358 CAJPRD010000009.1 GCA905372915_00657 gene open 17306-18448
1359 CAJPRD010000009.1 GCA905372915_00658 gene open 18448-19044
1360 CAJPRD010000009.1 GCA905372915_00659 gene open 19080-20498
1361 CAJPRD010000009.1 GCA905372915_00660 gene open 20495-21826
1362 CAJPRD010000009.1 GCA905372915_00661 gene open 21828-22889
1363 CAJPRD010000009.1 GCA905372915_00662 gene open 22924-24024
1364 CAJPRD010000009.1 GCA905372915_00663 gene open 24031-24711
1365 CAJPRD010000009.1 GCA905372915_00664 gene open 24708-25751
1366 CAJPRD010000009.1 GCA905372915_00665 gene open 25759-26916 neuC
1367 CAJPRD010000009.1 GCA905372915_00666 gene open 26913-27923 neuB
1368 CAJPRD010000009.1 GCA905372915_00667 gene open 27925-28560
1369 CAJPRD010000009.1 GCA905372915_00668 gene open 28563-29564
1370 CAJPRD010000009.1 GCA905372915_00669 gene open 29569-30315
1371 CAJPRD010000009.1 GCA905372915_00670 gene open 30322-30552
1372 CAJPRD010000009.1 GCA905372915_00671 gene open 30568-31716
1373 CAJPRD010000009.1 GCA905372915_00672 gene open 31753-32961
1374 CAJPRD010000009.1 GCA905372915_00673 gene open 33031-33879
1375 CAJPRD010000009.1 GCA905372915_00674 gene open 33883-35202
1376 CAJPRD010000009.1 GCA905372915_00675 gene open 35248-36234 pfkA
1377 CAJPRD010000009.1 GCA905372915_00676 gene open 36355-38112
1378 CAJPRD010000009.1 GCA905372915_00677 gene open 38315-38764
1379 CAJPRD010000009.1 GCA905372915_00679 gene open 39232-39339
1380 CAJPRD010000009.1 GCA905372915_00680 gene open 39779-40210
1381 CAJPRD010000009.1 GCA905372915_00681 gene open 40179-40808
1382 CAJPRD010000009.1 GCA905372915_00682 gene open 40854-41810
1383 CAJPRD010000009.1 GCA905372915_00683 gene open 41850-43073
1384 CAJPRD010000009.1 GCA905372915_00684 gene open 43102-44343 mtr
1385 CAJPRD010000009.1 GCA905372915_00685 gene open 44355-45065
1386 CAJPRD010000009.1 GCA905372915_00686 gene open 45145-45642
1387 CAJPRD010000009.1 GCA905372915_00687 gene open 45642-46505
1388 CAJPRD010000009.1 GCA905372915_00688 gene open 46514-46882 secG
1389 CAJPRD010000009.1 GCA905372915_00689 gene open 47031-47945
1390 CAJPRD010000009.1 GCA905372915_00690 gene open 48036-48818 mazG
1391 CAJPRD010000009.1 GCA905372915_00691 gene open 48983-50638
1392 CAJPRD010000009.1 GCA905372915_00692 gene open 50758-51651 xerD
1393 CAJPRD010000009.1 GCA905372915_00693 gene open 51694-54159
1394 CAJPRD010000009.1 GCA905372915_00694 gene open 54269-55075
1395 CAJPRD010000009.1 GCA905372915_00695 gene open 55197-57320
1396 CAJPRD010000009.1 GCA905372915_00696 gene open 57353-59401
1397 CAJPRD010000009.1 GCA905372915_00697 gene open 59586-60644
1398 CAJPRD010000009.1 GCA905372915_00698 gene open 60687-62507
1399 CAJPRD010000009.1 GCA905372915_00699 gene open 62519-64573 ppk1
1400 CAJPRD010000009.1 GCA905372915_00700 gene open 64711-64968 rpsT
1401 CAJPRD010000009.1 GCA905372915_00678 gene open 38785-38858 trnR
1402 CAJPRD010000009.1 GCA905372915_00701 gene open 65017-65088 trnE
1403 CAJPRD010000009.1 GCA905372915_00678 tRNA open 38785-38858 trnR tRNA-Arg(tcg)
1404 CAJPRD010000009.1 GCA905372915_00701 tRNA open 65017-65088 trnE tRNA-Glu(ttc)
1405 CAJPRD010000010.1 GCA905372915_00702 CDS open 81-1700 _na     539_aa uup ABC transporter domain-containing protein
1406 CAJPRD010000010.1 GCA905372915_00703 CDS open 1779-2006 _na     75_aa hypothetical protein
1407 CAJPRD010000010.1 GCA905372915_00704 CDS open 2031-2522 _na     163_aa DUF1877 domain-containing protein
1408 CAJPRD010000010.1 GCA905372915_00705 CDS open 2537-3376 _na     279_aa Lipoprotein
1409 CAJPRD010000010.1 GCA905372915_00706 CDS open 3426-4121 _na     231_aa Methyltransferase domain protein
1410 CAJPRD010000010.1 GCA905372915_00707 CDS open 4224-16664 _na     4146_aa gliding motility-associated C-terminal domain-containing protein
1411 CAJPRD010000010.1 GCA905372915_00708 CDS open 17243-18679 _na     478_aa pyk pyruvate kinase
1412 CAJPRD010000010.1 GCA905372915_00709 CDS open 18693-19172 _na     159_aa IPExxxVDY family protein
1413 CAJPRD010000010.1 GCA905372915_00710 CDS open 19191-19631 _na     146_aa Cytidine and deoxycytidylate deaminase zinc-binding region
1414 CAJPRD010000010.1 GCA905372915_00711 CDS open 19693-20547 _na     284_aa molR WGR domain-containing protein%2C putative DNA-binding domain in MolR
1415 CAJPRD010000010.1 GCA905372915_00712 CDS open 20599-21120 _na     173_aa hypothetical protein
1416 CAJPRD010000010.1 GCA905372915_00713 CDS open 21180-22385 _na     401_aa lysA diaminopimelate decarboxylase
1417 CAJPRD010000010.1 GCA905372915_00714 CDS open 22450-22794 _na     114_aa rplT 50S ribosomal protein L20
1418 CAJPRD010000010.1 GCA905372915_00715 CDS open 22883-23080 _na     65_aa rpmI 50S ribosomal protein L35
1419 CAJPRD010000010.1 GCA905372915_00716 CDS open 23122-23616 _na     164_aa infC translation initiation factor IF-3
1420 CAJPRD010000010.1 GCA905372915_00717 CDS open 23691-25640 _na     649_aa thrS threonine--tRNA ligase
1421 CAJPRD010000010.1 GCA905372915_00718 CDS open 25685-26098 _na     137_aa DUF721 domain-containing protein
1422 CAJPRD010000010.1 GCA905372915_00719 CDS open 26115-27278 _na     387_aa cysteine-S-conjugate beta-lyase
1423 CAJPRD010000010.1 GCA905372915_00720 CDS open 27290-28333 _na     347_aa Endolytic murein transglycosylase
1424 CAJPRD010000010.1 GCA905372915_00721 CDS open 28347-29030 _na     227_aa DUF4421 domain-containing protein
1425 CAJPRD010000010.1 GCA905372915_00722 CDS open 29033-29260 _na     75_aa hypothetical protein
1426 CAJPRD010000010.1 GCA905372915_00723 CDS open 29321-30919 _na     532_aa MORN repeat protein
1427 CAJPRD010000010.1 GCA905372915_00724 CDS open 31084-32601 _na     505_aa Aromatic amino acid lyase
1428 CAJPRD010000010.1 GCA905372915_00725 CDS open 32625-34214 _na     529_aa lnt apolipoprotein N-acyltransferase
1429 CAJPRD010000010.1 GCA905372915_00726 CDS open 34215-34934 _na     239_aa PF10988 family protein
1430 CAJPRD010000010.1 GCA905372915_00727 CDS open 34957-35232 _na     91_aa merR MerR HTH family regulatory protein
1431 CAJPRD010000010.1 GCA905372915_00728 CDS open 35216-36130 _na     304_aa Curved DNA-binding protein
1432 CAJPRD010000010.1 GCA905372915_00729 CDS open 36310-37149 _na     279_aa TonB-dependent receptor
1433 CAJPRD010000010.1 GCA905372915_00730 CDS open 37156-37503 _na     115_aa ExbD/TolR family biopolymer transport protein
1434 CAJPRD010000010.1 GCA905372915_00731 CDS open 37550-38242 _na     230_aa Transporter%2C MotA/TolQ/ExbB proton channel family protein
1435 CAJPRD010000010.1 GCA905372915_00732 CDS open 38630-39160 _na     176_aa hypothetical protein
1436 CAJPRD010000010.1 GCA905372915_00734 CDS open 39615-41006 _na     463_aa speA Arginine decarboxylase
1437 CAJPRD010000010.1 GCA905372915_00735 CDS open 41071-41223 _na     50_aa hypothetical protein
1438 CAJPRD010000010.1 GCA905372915_00736 CDS open 41278-41391 _na     37_aa hypothetical protein
1439 CAJPRD010000010.1 GCA905372915_00737 CDS open 41392-42582 _na     396_aa ompA OmpA family protein
1440 CAJPRD010000010.1 GCA905372915_00738 CDS open 42714-44627 _na     637_aa lysM LysM peptidoglycan-binding domain-containing protein
1441 CAJPRD010000010.1 GCA905372915_00739 CDS open 44639-45610 _na     323_aa trpS tryptophan--tRNA ligase
1442 CAJPRD010000010.1 GCA905372915_00740 CDS open 45761-46219 _na     152_aa smpB SsrA-binding protein SmpB
1443 CAJPRD010000010.1 GCA905372915_00741 CDS open 46280-46930 _na     216_aa tRNA1(Val) (adenine(37)-N6)-methyltransferase
1444 CAJPRD010000010.1 GCA905372915_00742 CDS open 47178-49286 _na     702_aa TonB-dependent receptor plug domain protein
1445 CAJPRD010000010.1 GCA905372915_00743 CDS open 49485-51299 _na     604_aa Acyltransferase
1446 CAJPRD010000010.1 GCA905372915_00744 CDS open 51494-51883 _na     129_aa Histidine triad domain protein
1447 CAJPRD010000010.1 GCA905372915_00745 CDS open 51894-52364 _na     156_aa greA transcription elongation factor GreA
1448 CAJPRD010000010.1 GCA905372915_00746 CDS open 52726-53391 _na     221_aa Outer membrane protein beta-barrel domain protein
1449 CAJPRD010000010.1 GCA905372915_00747 CDS open 53455-54975 _na     506_aa Carbohydrate-binding domain-containing protein
1450 CAJPRD010000010.1 GCA905372915_00748 CDS open 55102-56079 _na     325_aa DUF4837 domain-containing protein
1451 CAJPRD010000010.1 GCA905372915_00749 CDS open 56076-56750 _na     224_aa NAD(P)-dependent dehydrogenase%2C short-chain alcohol dehydrogenase family
1452 CAJPRD010000010.1 GCA905372915_00750 CDS open 56755-57930 _na     391_aa Beta-lactamase
1453 CAJPRD010000010.1 GCA905372915_00751 CDS open 58035-60134 _na     699_aa Peptidase%2C S41 family
1454 CAJPRD010000010.1 GCA905372915_00752 CDS open 60235-61014 _na     259_aa NH(3)-dependent NAD(+) synthetase
1455 CAJPRD010000010.1 GCA905372915_00753 CDS open 62102-62581 _na     159_aa hypothetical protein
1456 CAJPRD010000010.1 GCA905372915_00754 CDS open 62830-63192 _na     120_aa hypothetical protein
1457 CAJPRD010000010.1 GCA905372915_00702 gene open 81-1700 uup
1458 CAJPRD010000010.1 GCA905372915_00703 gene open 1779-2006
1459 CAJPRD010000010.1 GCA905372915_00704 gene open 2031-2522
1460 CAJPRD010000010.1 GCA905372915_00705 gene open 2537-3376
1461 CAJPRD010000010.1 GCA905372915_00706 gene open 3426-4121
1462 CAJPRD010000010.1 GCA905372915_00707 gene open 4224-16664
1463 CAJPRD010000010.1 GCA905372915_00708 gene open 17243-18679 pyk
1464 CAJPRD010000010.1 GCA905372915_00709 gene open 18693-19172
1465 CAJPRD010000010.1 GCA905372915_00710 gene open 19191-19631
1466 CAJPRD010000010.1 GCA905372915_00711 gene open 19693-20547 molR
1467 CAJPRD010000010.1 GCA905372915_00712 gene open 20599-21120
1468 CAJPRD010000010.1 GCA905372915_00713 gene open 21180-22385 lysA
1469 CAJPRD010000010.1 GCA905372915_00714 gene open 22450-22794 rplT
1470 CAJPRD010000010.1 GCA905372915_00715 gene open 22883-23080 rpmI
1471 CAJPRD010000010.1 GCA905372915_00716 gene open 23122-23616 infC
1472 CAJPRD010000010.1 GCA905372915_00717 gene open 23691-25640 thrS
1473 CAJPRD010000010.1 GCA905372915_00718 gene open 25685-26098
1474 CAJPRD010000010.1 GCA905372915_00719 gene open 26115-27278
1475 CAJPRD010000010.1 GCA905372915_00720 gene open 27290-28333
1476 CAJPRD010000010.1 GCA905372915_00721 gene open 28347-29030
1477 CAJPRD010000010.1 GCA905372915_00722 gene open 29033-29260
1478 CAJPRD010000010.1 GCA905372915_00723 gene open 29321-30919
1479 CAJPRD010000010.1 GCA905372915_00724 gene open 31084-32601
1480 CAJPRD010000010.1 GCA905372915_00725 gene open 32625-34214 lnt
1481 CAJPRD010000010.1 GCA905372915_00726 gene open 34215-34934
1482 CAJPRD010000010.1 GCA905372915_00727 gene open 34957-35232 merR
1483 CAJPRD010000010.1 GCA905372915_00728 gene open 35216-36130
1484 CAJPRD010000010.1 GCA905372915_00729 gene open 36310-37149
1485 CAJPRD010000010.1 GCA905372915_00730 gene open 37156-37503
1486 CAJPRD010000010.1 GCA905372915_00731 gene open 37550-38242
1487 CAJPRD010000010.1 GCA905372915_00732 gene open 38630-39160
1488 CAJPRD010000010.1 GCA905372915_00734 gene open 39615-41006 speA
1489 CAJPRD010000010.1 GCA905372915_00735 gene open 41071-41223
1490 CAJPRD010000010.1 GCA905372915_00736 gene open 41278-41391
1491 CAJPRD010000010.1 GCA905372915_00737 gene open 41392-42582 ompA
1492 CAJPRD010000010.1 GCA905372915_00738 gene open 42714-44627 lysM
1493 CAJPRD010000010.1 GCA905372915_00739 gene open 44639-45610 trpS
1494 CAJPRD010000010.1 GCA905372915_00740 gene open 45761-46219 smpB
1495 CAJPRD010000010.1 GCA905372915_00741 gene open 46280-46930
1496 CAJPRD010000010.1 GCA905372915_00742 gene open 47178-49286
1497 CAJPRD010000010.1 GCA905372915_00743 gene open 49485-51299
1498 CAJPRD010000010.1 GCA905372915_00744 gene open 51494-51883
1499 CAJPRD010000010.1 GCA905372915_00745 gene open 51894-52364 greA
1500 CAJPRD010000010.1 GCA905372915_00746 gene open 52726-53391