HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Actinomyces oris clade-144 (GCA_905373015.1)

Select a Genome:
BAKTA Annotations for GCA_905373015.1
Genome Selected: Actinomyces oris clade-144
ContigsBases CDSrRNA tmRNAtRNA
181 3,114,517 2597 0 1 48
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 5320 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:10]    |    Number of Records Found: 5320 [11 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  11  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
4501 CAJPRK010000103.1 GCA905373015_02248 CDS open 5878-7212 _na     444_aa Peptidase%2C M50 family
4502 CAJPRK010000103.1 GCA905373015_02249 CDS open 7348-8496 _na     382_aa ispG flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase
4503 CAJPRK010000103.1 GCA905373015_02250 CDS open 8636-9535 _na     299_aa N-acetyltransferase domain-containing protein
4504 CAJPRK010000103.1 GCA905373015_02251 CDS open 9600-10292 _na     230_aa hypothetical protein
4505 CAJPRK010000103.1 GCA905373015_02242 gene open 202-954 pyrH
4506 CAJPRK010000103.1 GCA905373015_02243 gene open 1119-1676 frr
4507 CAJPRK010000103.1 GCA905373015_02244 gene open 1741-2679 cdsA
4508 CAJPRK010000103.1 GCA905373015_02245 gene open 2752-4014 rlmN
4509 CAJPRK010000103.1 GCA905373015_02246 gene open 4011-4556
4510 CAJPRK010000103.1 GCA905373015_02247 gene open 4589-5881 dxr
4511 CAJPRK010000103.1 GCA905373015_02248 gene open 5878-7212
4512 CAJPRK010000103.1 GCA905373015_02249 gene open 7348-8496 ispG
4513 CAJPRK010000103.1 GCA905373015_02250 gene open 8636-9535
4514 CAJPRK010000103.1 GCA905373015_02251 gene open 9600-10292
4515 CAJPRK010000104.1 GCA905373015_02252 CDS open 146-1486 _na     446_aa galT DUF4921 domain-containing protein
4516 CAJPRK010000104.1 GCA905373015_02253 CDS open 1660-1956 _na     98_aa DUF1778 domain-containing protein
4517 CAJPRK010000104.1 GCA905373015_02254 CDS open 1953-2468 _na     171_aa GNAT family N-acetyltransferase
4518 CAJPRK010000104.1 GCA905373015_02255 CDS open 2527-3393 _na     288_aa eCM4 GST N-terminal domain-containing protein
4519 CAJPRK010000104.1 GCA905373015_02256 CDS open 3653-6688 _na     1011_aa MalT-like TPR region domain-containing protein
4520 CAJPRK010000104.1 GCA905373015_02257 CDS open 7075-7932 _na     285_aa ybjN YbjN domain-containing protein
4521 CAJPRK010000104.1 GCA905373015_02258 CDS open 7932-8372 _na     146_aa ybjN YbjN domain-containing protein
4522 CAJPRK010000104.1 GCA905373015_02259 CDS open 8496-8978 _na     160_aa Chemotaxis protein
4523 CAJPRK010000104.1 GCA905373015_02260 CDS open 9138-10193 _na     351_aa Zinc ribbon domain-containing protein
4524 CAJPRK010000104.1 GCA905373015_02261 CDS open 10471-10599 _na     42_aa hypothetical protein
4525 CAJPRK010000104.1 GCA905373015_02252 gene open 146-1486 galT
4526 CAJPRK010000104.1 GCA905373015_02253 gene open 1660-1956
4527 CAJPRK010000104.1 GCA905373015_02254 gene open 1953-2468
4528 CAJPRK010000104.1 GCA905373015_02255 gene open 2527-3393 eCM4
4529 CAJPRK010000104.1 GCA905373015_02256 gene open 3653-6688
4530 CAJPRK010000104.1 GCA905373015_02257 gene open 7075-7932 ybjN
4531 CAJPRK010000104.1 GCA905373015_02258 gene open 7932-8372 ybjN
4532 CAJPRK010000104.1 GCA905373015_02259 gene open 8496-8978
4533 CAJPRK010000104.1 GCA905373015_02260 gene open 9138-10193
4534 CAJPRK010000104.1 GCA905373015_02261 gene open 10471-10599
4535 CAJPRK010000105.1 GCA905373015_02262 CDS open 201-854 _na     217_aa hypothetical protein
4536 CAJPRK010000105.1 GCA905373015_02263 CDS open 833-2944 _na     703_aa Tat pathway signal sequence domain protein
4537 CAJPRK010000105.1 GCA905373015_02264 CDS open 2941-4137 _na     398_aa hypothetical protein
4538 CAJPRK010000105.1 GCA905373015_02265 CDS open 4174-6219 _na     681_aa Tat pathway signal sequence domain protein
4539 CAJPRK010000105.1 GCA905373015_02266 CDS open 6219-7379 _na     386_aa hypothetical protein
4540 CAJPRK010000105.1 GCA905373015_02267 CDS open 7413-9521 _na     702_aa ABC transporter permease
4541 CAJPRK010000105.1 GCA905373015_02268 CDS open 9845-10324 _na     159_aa hypothetical protein
4542 CAJPRK010000105.1 GCA905373015_02269 CDS open 10495-10773 _na     92_aa hypothetical protein
4543 CAJPRK010000105.1 GCA905373015_02262 gene open 201-854
4544 CAJPRK010000105.1 GCA905373015_02263 gene open 833-2944
4545 CAJPRK010000105.1 GCA905373015_02264 gene open 2941-4137
4546 CAJPRK010000105.1 GCA905373015_02265 gene open 4174-6219
4547 CAJPRK010000105.1 GCA905373015_02266 gene open 6219-7379
4548 CAJPRK010000105.1 GCA905373015_02267 gene open 7413-9521
4549 CAJPRK010000105.1 GCA905373015_02268 gene open 9845-10324
4550 CAJPRK010000105.1 GCA905373015_02269 gene open 10495-10773
4551 CAJPRK010000106.1 GCA905373015_02270 CDS open 25-1425 _na     466_aa Bacterial transcriptional activator domain-containing protein
4552 CAJPRK010000106.1 GCA905373015_02271 CDS open 1438-6105 _na     1555_aa FtsK/SpoIIIE family protein
4553 CAJPRK010000106.1 GCA905373015_02272 CDS open 6788-8941 _na     717_aa hypothetical protein
4554 CAJPRK010000106.1 GCA905373015_02273 CDS open 8941-9549 _na     202_aa hypothetical protein
4555 CAJPRK010000106.1 GCA905373015_02274 CDS open 9972-10604 _na     210_aa IS481 family transposase
4556 CAJPRK010000106.1 GCA905373015_02270 gene open 25-1425
4557 CAJPRK010000106.1 GCA905373015_02271 gene open 1438-6105
4558 CAJPRK010000106.1 GCA905373015_02272 gene open 6788-8941
4559 CAJPRK010000106.1 GCA905373015_02273 gene open 8941-9549
4560 CAJPRK010000106.1 GCA905373015_02274 gene open 9972-10604
4561 CAJPRK010000107.1 GCA905373015_02275 CDS open 24-1235 _na     403_aa Tat pathway signal sequence
4562 CAJPRK010000107.1 GCA905373015_02276 CDS open 1232-1918 _na     228_aa Protein-glutamine gamma-glutamyltransferase-like C-terminal domain-containing protein
4563 CAJPRK010000107.1 GCA905373015_02277 CDS open 1926-3278 _na     450_aa Glycerophosphoryl diester phosphodiesterase membrane domain-containing protein
4564 CAJPRK010000107.1 GCA905373015_02278 CDS open 3547-4227 _na     226_aa mtrA MtrAB system response regulator MtrA
4565 CAJPRK010000107.1 GCA905373015_02279 CDS open 4286-6145 _na     619_aa mtrB MtrAB system histidine kinase MtrB
4566 CAJPRK010000107.1 GCA905373015_02280 CDS open 6142-7929 _na     595_aa Spore gernimation protein
4567 CAJPRK010000107.1 GCA905373015_02281 CDS open 8066-8716 _na     216_aa hpf ribosome hibernation-promoting factor%2C HPF/YfiA family
4568 CAJPRK010000107.1 GCA905373015_02282 CDS open 8933-9856 _na     307_aa Phosphoribosyl transferase
4569 CAJPRK010000107.1 GCA905373015_02275 gene open 24-1235
4570 CAJPRK010000107.1 GCA905373015_02276 gene open 1232-1918
4571 CAJPRK010000107.1 GCA905373015_02277 gene open 1926-3278
4572 CAJPRK010000107.1 GCA905373015_02278 gene open 3547-4227 mtrA
4573 CAJPRK010000107.1 GCA905373015_02279 gene open 4286-6145 mtrB
4574 CAJPRK010000107.1 GCA905373015_02280 gene open 6142-7929
4575 CAJPRK010000107.1 GCA905373015_02281 gene open 8066-8716 hpf
4576 CAJPRK010000107.1 GCA905373015_02282 gene open 8933-9856
4577 CAJPRK010000108.1 GCA905373015_02283 CDS open 757-1227 _na     156_aa msrB Peptide methionine sulfoxide reductase MsrB
4578 CAJPRK010000108.1 GCA905373015_02284 CDS open 1328-2770 _na     480_aa Transporter
4579 CAJPRK010000108.1 GCA905373015_02285 CDS open 2936-3265 _na     109_aa padR Transcription regulator PadR N-terminal domain-containing protein
4580 CAJPRK010000108.1 GCA905373015_02286 CDS open 3265-3777 _na     170_aa DUF1700 domain-containing protein
4581 CAJPRK010000108.1 GCA905373015_02290 CDS open 4326-4757 _na     143_aa Metallopeptidase family protein
4582 CAJPRK010000108.1 GCA905373015_02291 CDS open 4836-6155 _na     439_aa Beta-N-acetylhexosaminidase
4583 CAJPRK010000108.1 GCA905373015_02292 CDS open 6252-8339 _na     695_aa Conserved domain protein
4584 CAJPRK010000108.1 GCA905373015_02293 CDS open 8491-9897 _na     468_aa Zeta toxin family protein
4585 CAJPRK010000108.1 GCA905373015_02283 gene open 757-1227 msrB
4586 CAJPRK010000108.1 GCA905373015_02284 gene open 1328-2770
4587 CAJPRK010000108.1 GCA905373015_02285 gene open 2936-3265 padR
4588 CAJPRK010000108.1 GCA905373015_02286 gene open 3265-3777
4589 CAJPRK010000108.1 GCA905373015_02290 gene open 4326-4757
4590 CAJPRK010000108.1 GCA905373015_02291 gene open 4836-6155
4591 CAJPRK010000108.1 GCA905373015_02292 gene open 6252-8339
4592 CAJPRK010000108.1 GCA905373015_02293 gene open 8491-9897
4593 CAJPRK010000108.1 GCA905373015_02287 gene open 3853-3925 trnF
4594 CAJPRK010000108.1 GCA905373015_02288 gene open 3973-4046 trnD
4595 CAJPRK010000108.1 GCA905373015_02289 gene open 4085-4157 trnE
4596 CAJPRK010000108.1 GCA905373015_02287 tRNA open 3853-3925 trnF tRNA-Phe(gaa)
4597 CAJPRK010000108.1 GCA905373015_02288 tRNA open 3973-4046 trnD tRNA-Asp(gtc)
4598 CAJPRK010000108.1 GCA905373015_02289 tRNA open 4085-4157 trnE tRNA-Glu(ttc)
4599 CAJPRK010000109.1 GCA905373015_02294 CDS open 1204-1950 _na     248_aa [ribosomal protein uS5]-alanine N-acetyltransferase
4600 CAJPRK010000109.1 GCA905373015_02295 CDS open 1950-3161 _na     403_aa glp gephyrin-like molybdotransferase Glp
4601 CAJPRK010000109.1 GCA905373015_02296 CDS open 3257-3919 _na     220_aa 5-formyltetrahydrofolate cyclo-ligase
4602 CAJPRK010000109.1 GCA905373015_02297 CDS open 4379-4573 _na     64_aa hypothetical protein
4603 CAJPRK010000109.1 GCA905373015_02298 CDS open 5101-5550 _na     149_aa mscL large conductance mechanosensitive channel protein MscL
4604 CAJPRK010000109.1 GCA905373015_02299 CDS open 6035-6361 _na     108_aa Transcriptional regulator
4605 CAJPRK010000109.1 GCA905373015_02300 CDS open 6406-10434 _na     1342_aa Restriction endonuclease type II-like domain-containing protein
4606 CAJPRK010000109.1 GCA905373015_02294 gene open 1204-1950
4607 CAJPRK010000109.1 GCA905373015_02295 gene open 1950-3161 glp
4608 CAJPRK010000109.1 GCA905373015_02296 gene open 3257-3919
4609 CAJPRK010000109.1 GCA905373015_02297 gene open 4379-4573
4610 CAJPRK010000109.1 GCA905373015_02298 gene open 5101-5550 mscL
4611 CAJPRK010000109.1 GCA905373015_02299 gene open 6035-6361
4612 CAJPRK010000109.1 GCA905373015_02300 gene open 6406-10434
4613 CAJPRK010000110.1 GCA905373015_02301 CDS open 100-546 _na     148_aa HIT family protein
4614 CAJPRK010000110.1 GCA905373015_02302 CDS open 599-1351 _na     250_aa Manganese transport regulator
4615 CAJPRK010000110.1 GCA905373015_02303 CDS open 1360-2094 _na     244_aa Vitamin K epoxide reductase domain-containing protein
4616 CAJPRK010000110.1 GCA905373015_02304 CDS open 2191-4197 _na     668_aa Calcineurin-like phosphoesterase domain-containing protein
4617 CAJPRK010000110.1 GCA905373015_02305 CDS open 4206-5063 _na     285_aa cof HAD hydrolase%2C family IIB
4618 CAJPRK010000110.1 GCA905373015_02306 CDS open 5191-5364 _na     57_aa Methionine/alanine importer small subunit
4619 CAJPRK010000110.1 GCA905373015_02307 CDS open 5366-6946 _na     526_aa Sodium-dependent transporter
4620 CAJPRK010000110.1 GCA905373015_02308 CDS open 7174-7896 _na     240_aa deoD purine-nucleoside phosphorylase
4621 CAJPRK010000110.1 GCA905373015_02309 CDS open 8270-8548 _na     92_aa DUF1540 domain-containing protein
4622 CAJPRK010000110.1 GCA905373015_02310 CDS open 8673-9533 _na     286_aa DUF2470 domain-containing protein
4623 CAJPRK010000110.1 GCA905373015_02311 CDS open 9688-10383 _na     231_aa UPF0056 membrane protein
4624 CAJPRK010000110.1 GCA905373015_02301 gene open 100-546
4625 CAJPRK010000110.1 GCA905373015_02302 gene open 599-1351
4626 CAJPRK010000110.1 GCA905373015_02303 gene open 1360-2094
4627 CAJPRK010000110.1 GCA905373015_02304 gene open 2191-4197
4628 CAJPRK010000110.1 GCA905373015_02305 gene open 4206-5063 cof
4629 CAJPRK010000110.1 GCA905373015_02306 gene open 5191-5364
4630 CAJPRK010000110.1 GCA905373015_02307 gene open 5366-6946
4631 CAJPRK010000110.1 GCA905373015_02308 gene open 7174-7896 deoD
4632 CAJPRK010000110.1 GCA905373015_02309 gene open 8270-8548
4633 CAJPRK010000110.1 GCA905373015_02310 gene open 8673-9533
4634 CAJPRK010000110.1 GCA905373015_02311 gene open 9688-10383
4635 CAJPRK010000110.1 GCA905373015_02312 gene open 10421-10476 trnA
4636 CAJPRK010000110.1 GCA905373015_02312 tRNA open 10421-10476 trnA tRNA-Ala(ggc)
4637 CAJPRK010000111.1 GCA905373015_02313 CDS open 46-1113 _na     355_aa elyC DUF218 domain-containing protein
4638 CAJPRK010000111.1 GCA905373015_02314 CDS open 1192-1641 _na     149_aa tetR TetR family transcriptional regulator
4639 CAJPRK010000111.1 GCA905373015_02315 CDS open 1723-2088 _na     121_aa Bacterial Pleckstrin-like y domain-containing protein
4640 CAJPRK010000111.1 GCA905373015_02316 CDS open 2711-2992 _na     93_aa hypothetical protein
4641 CAJPRK010000111.1 GCA905373015_02317 CDS open 3500-3733 _na     77_aa hypothetical protein
4642 CAJPRK010000111.1 GCA905373015_02318 CDS open 3730-4047 _na     105_aa DUF4235 domain-containing protein
4643 CAJPRK010000111.1 GCA905373015_02319 CDS open 4424-7015 _na     863_aa Fe-S oxidoreductase
4644 CAJPRK010000111.1 GCA905373015_02320 CDS open 7046-8386 _na     446_aa rarA AAA+ ATPase domain-containing protein
4645 CAJPRK010000111.1 GCA905373015_02321 CDS open 8848-10278 _na     476_aa hypothetical protein
4646 CAJPRK010000111.1 GCA905373015_02313 gene open 46-1113 elyC
4647 CAJPRK010000111.1 GCA905373015_02314 gene open 1192-1641 tetR
4648 CAJPRK010000111.1 GCA905373015_02315 gene open 1723-2088
4649 CAJPRK010000111.1 GCA905373015_02316 gene open 2711-2992
4650 CAJPRK010000111.1 GCA905373015_02317 gene open 3500-3733
4651 CAJPRK010000111.1 GCA905373015_02318 gene open 3730-4047
4652 CAJPRK010000111.1 GCA905373015_02319 gene open 4424-7015
4653 CAJPRK010000111.1 GCA905373015_02320 gene open 7046-8386 rarA
4654 CAJPRK010000111.1 GCA905373015_02321 gene open 8848-10278
4655 CAJPRK010000112.1 GCA905373015_02322 CDS open 425-907 _na     160_aa hypothetical protein
4656 CAJPRK010000112.1 GCA905373015_02323 CDS open 1045-1668 _na     207_aa hypothetical protein
4657 CAJPRK010000112.1 GCA905373015_02324 CDS open 2015-3094 _na     359_aa 1%2C4-dihydroxy-2-naphthoyl-CoA synthase
4658 CAJPRK010000112.1 GCA905373015_02325 CDS open 3160-3831 _na     223_aa citB Response regulatory domain-containing protein
4659 CAJPRK010000112.1 GCA905373015_02326 CDS open 3824-4738 _na     304_aa sensor histidine kinase
4660 CAJPRK010000112.1 GCA905373015_02327 CDS open 5154-5348 _na     64_aa hypothetical protein
4661 CAJPRK010000112.1 GCA905373015_02328 CDS open 5463-6887 _na     474_aa Amidinotransferase
4662 CAJPRK010000112.1 GCA905373015_02329 CDS open 6907-8172 _na     421_aa Galactokinase
4663 CAJPRK010000112.1 GCA905373015_02330 CDS open 8169-9011 _na     280_aa Glucose-1-phosphate thymidylyltransferase
4664 CAJPRK010000112.1 GCA905373015_02331 CDS open 9034-10266 _na     410_aa Phosphoglucomutase
4665 CAJPRK010000112.1 GCA905373015_02322 gene open 425-907
4666 CAJPRK010000112.1 GCA905373015_02323 gene open 1045-1668
4667 CAJPRK010000112.1 GCA905373015_02324 gene open 2015-3094
4668 CAJPRK010000112.1 GCA905373015_02325 gene open 3160-3831 citB
4669 CAJPRK010000112.1 GCA905373015_02326 gene open 3824-4738
4670 CAJPRK010000112.1 GCA905373015_02327 gene open 5154-5348
4671 CAJPRK010000112.1 GCA905373015_02328 gene open 5463-6887
4672 CAJPRK010000112.1 GCA905373015_02329 gene open 6907-8172
4673 CAJPRK010000112.1 GCA905373015_02330 gene open 8169-9011
4674 CAJPRK010000112.1 GCA905373015_02331 gene open 9034-10266
4675 CAJPRK010000113.1 GCA905373015_02332 CDS open 11-229 _na     72_aa hypothetical protein
4676 CAJPRK010000113.1 GCA905373015_02333 CDS open 355-1491 _na     378_aa yfdV Auxin efflux carrier
4677 CAJPRK010000113.1 GCA905373015_02334 CDS open 1638-2579 _na     313_aa rbsK Carbohydrate kinase PfkB domain-containing protein
4678 CAJPRK010000113.1 GCA905373015_02335 CDS open 3163-3501 _na     112_aa exodeoxyribonuclease VII small subunit
4679 CAJPRK010000113.1 GCA905373015_02336 CDS open 4011-5390 _na     459_aa xseA exodeoxyribonuclease VII large subunit
4680 CAJPRK010000113.1 GCA905373015_02337 CDS open 5435-6502 _na     355_aa ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase
4681 CAJPRK010000113.1 GCA905373015_02338 CDS open 6766-8247 _na     493_aa lysP Amino acid permease/ SLC12A domain-containing protein
4682 CAJPRK010000113.1 GCA905373015_02339 CDS open 8378-8635 _na     85_aa Major facilitator superfamily (MFS) profile domain-containing protein
4683 CAJPRK010000113.1 GCA905373015_02340 CDS open 8795-10066 _na     423_aa rmuC DNA recombination protein RmuC
4684 CAJPRK010000113.1 GCA905373015_02332 gene open 11-229
4685 CAJPRK010000113.1 GCA905373015_02333 gene open 355-1491 yfdV
4686 CAJPRK010000113.1 GCA905373015_02334 gene open 1638-2579 rbsK
4687 CAJPRK010000113.1 GCA905373015_02335 gene open 3163-3501
4688 CAJPRK010000113.1 GCA905373015_02336 gene open 4011-5390 xseA
4689 CAJPRK010000113.1 GCA905373015_02337 gene open 5435-6502 ispH
4690 CAJPRK010000113.1 GCA905373015_02338 gene open 6766-8247 lysP
4691 CAJPRK010000113.1 GCA905373015_02339 gene open 8378-8635
4692 CAJPRK010000113.1 GCA905373015_02340 gene open 8795-10066 rmuC
4693 CAJPRK010000114.1 GCA905373015_02341 CDS open 2-928 _na     308_aa signal peptidase I
4694 CAJPRK010000114.1 GCA905373015_02342 CDS open 925-1647 _na     240_aa ribonuclease HII
4695 CAJPRK010000114.1 GCA905373015_02343 CDS open 1659-2060 _na     133_aa Protein often found in actinomycetes clustered with signal peptidase and/or RNaseHII
4696 CAJPRK010000114.1 GCA905373015_02344 CDS open 2224-2784 _na     186_aa yraN YraN family protein
4697 CAJPRK010000114.1 GCA905373015_02345 CDS open 2775-4346 _na     523_aa yifB Mg chelatase
4698 CAJPRK010000114.1 GCA905373015_02346 CDS open 4343-5722 _na     459_aa dprA DNA-processing protein DprA
4699 CAJPRK010000114.1 GCA905373015_02347 CDS open 5900-6823 _na     307_aa xerC Tyrosine recombinase XerC
4700 CAJPRK010000114.1 GCA905373015_02348 CDS open 6850-7503 _na     217_aa Peptidase M23 domain-containing protein
4701 CAJPRK010000114.1 GCA905373015_02349 CDS open 8160-9008 _na     282_aa rpsB 30S ribosomal protein S2
4702 CAJPRK010000114.1 GCA905373015_02350 CDS open 9117-9956 _na     279_aa tsf translation elongation factor Ts
4703 CAJPRK010000114.1 GCA905373015_02341 gene open 2-928
4704 CAJPRK010000114.1 GCA905373015_02342 gene open 925-1647
4705 CAJPRK010000114.1 GCA905373015_02343 gene open 1659-2060
4706 CAJPRK010000114.1 GCA905373015_02344 gene open 2224-2784 yraN
4707 CAJPRK010000114.1 GCA905373015_02345 gene open 2775-4346 yifB
4708 CAJPRK010000114.1 GCA905373015_02346 gene open 4343-5722 dprA
4709 CAJPRK010000114.1 GCA905373015_02347 gene open 5900-6823 xerC
4710 CAJPRK010000114.1 GCA905373015_02348 gene open 6850-7503
4711 CAJPRK010000114.1 GCA905373015_02349 gene open 8160-9008 rpsB
4712 CAJPRK010000114.1 GCA905373015_02350 gene open 9117-9956 tsf
4713 CAJPRK010000115.1 GCA905373015_02351 CDS open 59-289 _na     76_aa hypothetical protein
4714 CAJPRK010000115.1 GCA905373015_02352 CDS open 449-1396 _na     315_aa pdxI NADP-dependent oxidoreductase domain-containing protein
4715 CAJPRK010000115.1 GCA905373015_02353 CDS open 1935-5306 _na     1123_aa ileS isoleucine--tRNA ligase
4716 CAJPRK010000115.1 GCA905373015_02354 CDS open 5737-7104 _na     455_aa CRISPR-associated endonuclease Cas3''
4717 CAJPRK010000115.1 GCA905373015_02355 CDS open 7562-8920 _na     452_aa MFS transporter
4718 CAJPRK010000115.1 GCA905373015_02351 gene open 59-289
4719 CAJPRK010000115.1 GCA905373015_02352 gene open 449-1396 pdxI
4720 CAJPRK010000115.1 GCA905373015_02353 gene open 1935-5306 ileS
4721 CAJPRK010000115.1 GCA905373015_02354 gene open 5737-7104
4722 CAJPRK010000115.1 GCA905373015_02355 gene open 7562-8920
4723 CAJPRK010000116.1 GCA905373015_02356 CDS open 259-894 _na     211_aa DJ-1/PfpI family protein
4724 CAJPRK010000116.1 GCA905373015_02357 CDS open 1127-2122 _na     331_aa GroES-like protein
4725 CAJPRK010000116.1 GCA905373015_02358 CDS open 2158-2622 _na     154_aa HTH marR-type domain-containing protein
4726 CAJPRK010000116.1 GCA905373015_02359 CDS open 2733-3443 _na     236_aa DUF6597 domain-containing protein
4727 CAJPRK010000116.1 GCA905373015_02360 CDS open 3380-3772 _na     130_aa phnB VOC domain-containing protein
4728 CAJPRK010000116.1 GCA905373015_02361 CDS open 3965-4270 _na     101_aa nucleotidyltransferase family protein
4729 CAJPRK010000116.1 GCA905373015_02362 CDS open 4373-5269 _na     298_aa prmC peptide chain release factor N(5)-glutamine methyltransferase
4730 CAJPRK010000116.1 GCA905373015_02363 CDS open 5259-6353 _na     364_aa prfA peptide chain release factor 1
4731 CAJPRK010000116.1 GCA905373015_02364 CDS open 6473-6685 _na     70_aa rpmE 50S ribosomal protein L31
4732 CAJPRK010000116.1 GCA905373015_02365 CDS open 6826-8931 _na     701_aa rho transcription termination factor Rho
4733 CAJPRK010000116.1 GCA905373015_02356 gene open 259-894
4734 CAJPRK010000116.1 GCA905373015_02357 gene open 1127-2122
4735 CAJPRK010000116.1 GCA905373015_02358 gene open 2158-2622
4736 CAJPRK010000116.1 GCA905373015_02359 gene open 2733-3443
4737 CAJPRK010000116.1 GCA905373015_02360 gene open 3380-3772 phnB
4738 CAJPRK010000116.1 GCA905373015_02361 gene open 3965-4270
4739 CAJPRK010000116.1 GCA905373015_02362 gene open 4373-5269 prmC
4740 CAJPRK010000116.1 GCA905373015_02363 gene open 5259-6353 prfA
4741 CAJPRK010000116.1 GCA905373015_02364 gene open 6473-6685 rpmE
4742 CAJPRK010000116.1 GCA905373015_02365 gene open 6826-8931 rho
4743 CAJPRK010000117.1 GCA905373015_02366 CDS open 208-504 _na     98_aa Transposase
4744 CAJPRK010000117.1 GCA905373015_02367 CDS open 761-1273 _na     170_aa DDE-type integrase/transposase/recombinase
4745 CAJPRK010000117.1 GCA905373015_02368 CDS open 1337-1495 _na     52_aa Conserved domain protein
4746 CAJPRK010000117.1 GCA905373015_02369 CDS open 1570-2847 _na     425_aa MFS transporter
4747 CAJPRK010000117.1 GCA905373015_02370 CDS open 2844-3752 _na     302_aa Radical SAM protein
4748 CAJPRK010000117.1 GCA905373015_02371 CDS open 3756-4706 _na     316_aa Radical SAM protein
4749 CAJPRK010000117.1 GCA905373015_02372 CDS open 4703-6454 _na     583_aa Carbamoyltransferase C-terminal domain-containing protein
4750 CAJPRK010000117.1 GCA905373015_02373 CDS open 6451-7692 _na     413_aa Aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme
4751 CAJPRK010000117.1 GCA905373015_02374 CDS open 7689-8021 _na     110_aa hypothetical protein
4752 CAJPRK010000117.1 GCA905373015_02375 CDS open 8018-8905 _na     295_aa Radical SAM protein
4753 CAJPRK010000117.1 GCA905373015_02376 CDS open 8956-9234 _na     92_aa hypothetical protein
4754 CAJPRK010000117.1 GCA905373015_02366 gene open 208-504
4755 CAJPRK010000117.1 GCA905373015_02367 gene open 761-1273
4756 CAJPRK010000117.1 GCA905373015_02368 gene open 1337-1495
4757 CAJPRK010000117.1 GCA905373015_02369 gene open 1570-2847
4758 CAJPRK010000117.1 GCA905373015_02370 gene open 2844-3752
4759 CAJPRK010000117.1 GCA905373015_02371 gene open 3756-4706
4760 CAJPRK010000117.1 GCA905373015_02372 gene open 4703-6454
4761 CAJPRK010000117.1 GCA905373015_02373 gene open 6451-7692
4762 CAJPRK010000117.1 GCA905373015_02374 gene open 7689-8021
4763 CAJPRK010000117.1 GCA905373015_02375 gene open 8018-8905
4764 CAJPRK010000117.1 GCA905373015_02376 gene open 8956-9234
4765 CAJPRK010000118.1 GCA905373015_02377 CDS open 868-3789 _na     973_aa pulA Pullulanase
4766 CAJPRK010000118.1 GCA905373015_02378 CDS open 4007-4741 _na     244_aa citB Response regulatory domain-containing protein
4767 CAJPRK010000118.1 GCA905373015_02379 CDS open 4869-6065 _na     398_aa sensor histidine kinase
4768 CAJPRK010000118.1 GCA905373015_02380 CDS open 6530-7714 _na     394_aa ABC transporter ATP-binding protein
4769 CAJPRK010000118.1 GCA905373015_02381 CDS open 7714-8631 _na     305_aa ABC transporter permease
4770 CAJPRK010000118.1 GCA905373015_02377 gene open 868-3789 pulA
4771 CAJPRK010000118.1 GCA905373015_02378 gene open 4007-4741 citB
4772 CAJPRK010000118.1 GCA905373015_02379 gene open 4869-6065
4773 CAJPRK010000118.1 GCA905373015_02380 gene open 6530-7714
4774 CAJPRK010000118.1 GCA905373015_02381 gene open 7714-8631
4775 CAJPRK010000119.1 GCA905373015_02382 CDS open 203-910 _na     235_aa narL Putative nitrate/nitrite response regulator protein NarL
4776 CAJPRK010000119.1 GCA905373015_02383 CDS open 998-2392 _na     464_aa Histidine kinase
4777 CAJPRK010000119.1 GCA905373015_02384 CDS open 2491-4566 _na     691_aa pspC PspC domain-containing protein
4778 CAJPRK010000119.1 GCA905373015_02385 CDS open 4647-5144 _na     165_aa LPXTG-motif protein cell wall anchor domain protein
4779 CAJPRK010000119.1 GCA905373015_02386 CDS open 5323-5685 _na     120_aa SdpI/YhfL family protein
4780 CAJPRK010000119.1 GCA905373015_02387 CDS open 5754-6347 _na     197_aa yajL DJ-1 family glyoxalase III
4781 CAJPRK010000119.1 GCA905373015_02388 CDS open 6458-7990 _na     510_aa amyA alpha-amylase
4782 CAJPRK010000119.1 GCA905373015_02382 gene open 203-910 narL
4783 CAJPRK010000119.1 GCA905373015_02383 gene open 998-2392
4784 CAJPRK010000119.1 GCA905373015_02384 gene open 2491-4566 pspC
4785 CAJPRK010000119.1 GCA905373015_02385 gene open 4647-5144
4786 CAJPRK010000119.1 GCA905373015_02386 gene open 5323-5685
4787 CAJPRK010000119.1 GCA905373015_02387 gene open 5754-6347 yajL
4788 CAJPRK010000119.1 GCA905373015_02388 gene open 6458-7990 amyA
4789 CAJPRK010000120.1 GCA905373015_02389 CDS open 483-668 _na     61_aa hypothetical protein
4790 CAJPRK010000120.1 GCA905373015_02390 CDS open 790-2178 _na     462_aa sfcA NADP-dependent malic enzyme
4791 CAJPRK010000120.1 GCA905373015_02391 CDS open 2502-3998 _na     498_aa gatB Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB
4792 CAJPRK010000120.1 GCA905373015_02392 CDS open 3995-5536 _na     513_aa gatA Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA
4793 CAJPRK010000120.1 GCA905373015_02393 CDS open 5533-5838 _na     101_aa Aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C
4794 CAJPRK010000120.1 GCA905373015_02394 CDS open 6253-8103 _na     616_aa L%2CD-TPase catalytic domain-containing protein
4795 CAJPRK010000120.1 GCA905373015_02389 gene open 483-668
4796 CAJPRK010000120.1 GCA905373015_02390 gene open 790-2178 sfcA
4797 CAJPRK010000120.1 GCA905373015_02391 gene open 2502-3998 gatB
4798 CAJPRK010000120.1 GCA905373015_02392 gene open 3995-5536 gatA
4799 CAJPRK010000120.1 GCA905373015_02393 gene open 5533-5838
4800 CAJPRK010000120.1 GCA905373015_02394 gene open 6253-8103
4801 CAJPRK010000121.1 GCA905373015_02395 CDS open 443-592 _na     49_aa hypothetical protein
4802 CAJPRK010000121.1 GCA905373015_02396 CDS open 884-1240 _na     118_aa hypothetical protein
4803 CAJPRK010000121.1 GCA905373015_02397 CDS open 1480-1992 _na     170_aa hypothetical protein
4804 CAJPRK010000121.1 GCA905373015_02398 CDS open 1999-2115 _na     38_aa hypothetical protein
4805 CAJPRK010000121.1 GCA905373015_02399 CDS open 2522-3034 _na     170_aa hypothetical protein
4806 CAJPRK010000121.1 GCA905373015_02400 CDS open 3132-3719 _na     195_aa hypothetical protein
4807 CAJPRK010000121.1 GCA905373015_02401 CDS open 3792-4625 _na     277_aa hypothetical protein
4808 CAJPRK010000121.1 GCA905373015_02402 CDS open 4773-5288 _na     171_aa hypothetical protein
4809 CAJPRK010000121.1 GCA905373015_02403 CDS open 5414-5587 _na     57_aa Beta-galactosidase C-terminal domain-containing protein
4810 CAJPRK010000121.1 GCA905373015_02404 CDS open 5616-6233 _na     205_aa MFS transporter
4811 CAJPRK010000121.1 GCA905373015_02405 CDS open 6355-7869 _na     504_aa beta-galactosidase
4812 CAJPRK010000121.1 GCA905373015_02395 gene open 443-592
4813 CAJPRK010000121.1 GCA905373015_02396 gene open 884-1240
4814 CAJPRK010000121.1 GCA905373015_02397 gene open 1480-1992
4815 CAJPRK010000121.1 GCA905373015_02398 gene open 1999-2115
4816 CAJPRK010000121.1 GCA905373015_02399 gene open 2522-3034
4817 CAJPRK010000121.1 GCA905373015_02400 gene open 3132-3719
4818 CAJPRK010000121.1 GCA905373015_02401 gene open 3792-4625
4819 CAJPRK010000121.1 GCA905373015_02402 gene open 4773-5288
4820 CAJPRK010000121.1 GCA905373015_02403 gene open 5414-5587
4821 CAJPRK010000121.1 GCA905373015_02404 gene open 5616-6233
4822 CAJPRK010000121.1 GCA905373015_02405 gene open 6355-7869
4823 CAJPRK010000122.1 GCA905373015_02406 CDS open 231-2450 _na     739_aa Peptidase
4824 CAJPRK010000122.1 GCA905373015_02407 CDS open 2548-3396 _na     282_aa PhnB-like domain-containing protein
4825 CAJPRK010000122.1 GCA905373015_02408 CDS open 3630-5051 _na     473_aa gltA citrate synthase
4826 CAJPRK010000122.1 GCA905373015_02409 CDS open 5312-6547 _na     411_aa Orc1-like AAA ATPase domain-containing protein
4827 CAJPRK010000122.1 GCA905373015_02410 CDS open 6564-7631 _na     355_aa dapC succinyldiaminopimelate transaminase
4828 CAJPRK010000122.1 GCA905373015_02406 gene open 231-2450
4829 CAJPRK010000122.1 GCA905373015_02407 gene open 2548-3396
4830 CAJPRK010000122.1 GCA905373015_02408 gene open 3630-5051 gltA
4831 CAJPRK010000122.1 GCA905373015_02409 gene open 5312-6547
4832 CAJPRK010000122.1 GCA905373015_02410 gene open 6564-7631 dapC
4833 CAJPRK010000123.1 GCA905373015_02411 CDS open 69-389 _na     106_aa hypothetical protein
4834 CAJPRK010000123.1 GCA905373015_02412 CDS open 433-1446 _na     337_aa lacI Transcriptional regulator%2C LacI family
4835 CAJPRK010000123.1 GCA905373015_02413 CDS open 1642-2571 _na     309_aa malG ABC transmembrane type-1 domain-containing protein
4836 CAJPRK010000123.1 GCA905373015_02414 CDS open 2602-4176 _na     524_aa Maltose/maltodextrin transport system permease protein
4837 CAJPRK010000123.1 GCA905373015_02415 CDS open 4266-5609 _na     447_aa Maltose ABC transporter substrate-binding protein
4838 CAJPRK010000123.1 GCA905373015_02416 CDS open 5668-7044 _na     458_aa Glycosidase
4839 CAJPRK010000123.1 GCA905373015_02417 CDS open 7135-7419 _na     94_aa hypothetical protein
4840 CAJPRK010000123.1 GCA905373015_02411 gene open 69-389
4841 CAJPRK010000123.1 GCA905373015_02412 gene open 433-1446 lacI
4842 CAJPRK010000123.1 GCA905373015_02413 gene open 1642-2571 malG
4843 CAJPRK010000123.1 GCA905373015_02414 gene open 2602-4176
4844 CAJPRK010000123.1 GCA905373015_02415 gene open 4266-5609
4845 CAJPRK010000123.1 GCA905373015_02416 gene open 5668-7044
4846 CAJPRK010000123.1 GCA905373015_02417 gene open 7135-7419
4847 CAJPRK010000124.1 GCA905373015_02418 CDS open 11-754 _na     247_aa Exonuclease domain-containing protein
4848 CAJPRK010000124.1 GCA905373015_02419 CDS open 1126-2253 _na     375_aa PRTRC system protein E
4849 CAJPRK010000124.1 GCA905373015_02420 CDS open 2250-2885 _na     211_aa dcd dCTP deaminase
4850 CAJPRK010000124.1 GCA905373015_02421 CDS open 2965-3483 _na     172_aa TM2 domain-containing protein
4851 CAJPRK010000124.1 GCA905373015_02423 CDS open 3835-5052 _na     405_aa ABC transporter substrate-binding protein
4852 CAJPRK010000124.1 GCA905373015_02424 CDS open 5239-5946 _na     235_aa Integral membrane protein
4853 CAJPRK010000124.1 GCA905373015_02425 CDS open 6001-6693 _na     230_aa HTH tetR-type domain-containing protein
4854 CAJPRK010000124.1 GCA905373015_02426 CDS open 6842-7339 _na     165_aa 8-oxo-dGTP diphosphatase
4855 CAJPRK010000124.1 GCA905373015_02418 gene open 11-754
4856 CAJPRK010000124.1 GCA905373015_02419 gene open 1126-2253
4857 CAJPRK010000124.1 GCA905373015_02420 gene open 2250-2885 dcd
4858 CAJPRK010000124.1 GCA905373015_02421 gene open 2965-3483
4859 CAJPRK010000124.1 GCA905373015_02423 gene open 3835-5052
4860 CAJPRK010000124.1 GCA905373015_02424 gene open 5239-5946
4861 CAJPRK010000124.1 GCA905373015_02425 gene open 6001-6693
4862 CAJPRK010000124.1 GCA905373015_02426 gene open 6842-7339
4863 CAJPRK010000124.1 GCA905373015_02422 gene open 3650-3723 trnG
4864 CAJPRK010000124.1 GCA905373015_02422 tRNA open 3650-3723 trnG tRNA-Gly(ccc)
4865 CAJPRK010000125.1 GCA905373015_02427 CDS open 261-785 _na     174_aa Mce-associated membrane protein
4866 CAJPRK010000125.1 GCA905373015_02428 CDS open 1199-2884 _na     561_aa DUF3027 domain-containing protein
4867 CAJPRK010000125.1 GCA905373015_02429 CDS open 2909-3745 _na     278_aa udg4 Type-5 uracil-DNA glycosylase
4868 CAJPRK010000125.1 GCA905373015_02430 CDS open 3813-7391 _na     1192_aa DEAD/H associated
4869 CAJPRK010000125.1 GCA905373015_02427 gene open 261-785
4870 CAJPRK010000125.1 GCA905373015_02428 gene open 1199-2884
4871 CAJPRK010000125.1 GCA905373015_02429 gene open 2909-3745 udg4
4872 CAJPRK010000125.1 GCA905373015_02430 gene open 3813-7391
4873 CAJPRK010000126.1 GCA905373015_02431 CDS open 740-1021 _na     93_aa frmR Copper-sensing transcriptional repressor CsoR
4874 CAJPRK010000126.1 GCA905373015_02432 CDS open 1106-1375 _na     89_aa copZ HMA domain-containing protein
4875 CAJPRK010000126.1 GCA905373015_02433 CDS open 1463-4189 _na     908_aa Copper-exporting P-type ATPase A
4876 CAJPRK010000126.1 GCA905373015_02434 CDS open 4360-6309 _na     649_aa VirD4-like conjugal transfer protein%2C CD1115 family
4877 CAJPRK010000126.1 GCA905373015_02435 CDS open 6350-6982 _na     210_aa hypothetical protein
4878 CAJPRK010000126.1 GCA905373015_02431 gene open 740-1021 frmR
4879 CAJPRK010000126.1 GCA905373015_02432 gene open 1106-1375 copZ
4880 CAJPRK010000126.1 GCA905373015_02433 gene open 1463-4189
4881 CAJPRK010000126.1 GCA905373015_02434 gene open 4360-6309
4882 CAJPRK010000126.1 GCA905373015_02435 gene open 6350-6982
4883 CAJPRK010000127.1 GCA905373015_02436 CDS open 45-341 _na     98_aa hypothetical protein
4884 CAJPRK010000127.1 GCA905373015_02437 CDS open 494-922 _na     142_aa hypothetical protein
4885 CAJPRK010000127.1 GCA905373015_02438 CDS open 1005-1169 _na     54_aa DUF5655 domain-containing protein
4886 CAJPRK010000127.1 GCA905373015_02439 CDS open 1178-2212 _na     344_aa DUF418 domain-containing protein
4887 CAJPRK010000127.1 GCA905373015_02440 CDS open 2328-3011 _na     227_aa DNA-binding response regulator
4888 CAJPRK010000127.1 GCA905373015_02441 CDS open 3008-4366 _na     452_aa histidine kinase
4889 CAJPRK010000127.1 GCA905373015_02442 CDS open 4538-5731 _na     397_aa Type I-U CRISPR-associated RAMP protein Csb1/Cas7u
4890 CAJPRK010000127.1 GCA905373015_02443 CDS open 5731-6972 _na     413_aa hypothetical protein
4891 CAJPRK010000127.1 GCA905373015_02436 gene open 45-341
4892 CAJPRK010000127.1 GCA905373015_02437 gene open 494-922
4893 CAJPRK010000127.1 GCA905373015_02438 gene open 1005-1169
4894 CAJPRK010000127.1 GCA905373015_02439 gene open 1178-2212
4895 CAJPRK010000127.1 GCA905373015_02440 gene open 2328-3011
4896 CAJPRK010000127.1 GCA905373015_02441 gene open 3008-4366
4897 CAJPRK010000127.1 GCA905373015_02442 gene open 4538-5731
4898 CAJPRK010000127.1 GCA905373015_02443 gene open 5731-6972
4899 CAJPRK010000128.1 GCA905373015_02444 CDS open 626-1306 _na     226_aa AT hook motif
4900 CAJPRK010000128.1 GCA905373015_02445 CDS open 1552-4233 _na     893_aa clpB ATP-dependent chaperone ClpB
4901 CAJPRK010000128.1 GCA905373015_02446 CDS open 4377-5171 _na     264_aa hypothetical protein
4902 CAJPRK010000128.1 GCA905373015_02447 CDS open 5569-6132 _na     187_aa RES domain-containing protein
4903 CAJPRK010000128.1 GCA905373015_02448 CDS open 6195-6803 _na     202_aa DNA-binding protein
4904 CAJPRK010000128.1 GCA905373015_02444 gene open 626-1306
4905 CAJPRK010000128.1 GCA905373015_02445 gene open 1552-4233 clpB
4906 CAJPRK010000128.1 GCA905373015_02446 gene open 4377-5171
4907 CAJPRK010000128.1 GCA905373015_02447 gene open 5569-6132
4908 CAJPRK010000128.1 GCA905373015_02448 gene open 6195-6803
4909 CAJPRK010000129.1 GCA905373015_02449 CDS open 536-1318 _na     260_aa ydfG Oxidoreductase
4910 CAJPRK010000129.1 GCA905373015_02450 CDS open 1434-1604 _na     56_aa hypothetical protein
4911 CAJPRK010000129.1 GCA905373015_02451 CDS open 1637-2800 _na     387_aa Glutamine transporter 1
4912 CAJPRK010000129.1 GCA905373015_02452 CDS open 2889-3713 _na     274_aa proC pyrroline-5-carboxylate reductase
4913 CAJPRK010000129.1 GCA905373015_02453 CDS open 4179-5882 _na     567_aa cysI assimilatory sulfite reductase (ferredoxin)
4914 CAJPRK010000129.1 GCA905373015_02454 CDS open 5879-6670 _na     263_aa phosphoadenylyl-sulfate reductase
4915 CAJPRK010000129.1 GCA905373015_02449 gene open 536-1318 ydfG
4916 CAJPRK010000129.1 GCA905373015_02450 gene open 1434-1604
4917 CAJPRK010000129.1 GCA905373015_02451 gene open 1637-2800
4918 CAJPRK010000129.1 GCA905373015_02452 gene open 2889-3713 proC
4919 CAJPRK010000129.1 GCA905373015_02453 gene open 4179-5882 cysI
4920 CAJPRK010000129.1 GCA905373015_02454 gene open 5879-6670
4921 CAJPRK010000130.1 GCA905373015_02455 CDS open 18-1967 _na     649_aa ATPase of the ABC class
4922 CAJPRK010000130.1 GCA905373015_02456 CDS open 2113-2667 _na     184_aa ssuE NADPH-dependent FMN reductase-like domain-containing protein
4923 CAJPRK010000130.1 GCA905373015_02457 CDS open 2878-4464 _na     528_aa ilvA threonine ammonia-lyase%2C biosynthetic
4924 CAJPRK010000130.1 GCA905373015_02458 CDS open 4592-4945 _na     117_aa RelE/StbE family addiction module toxin
4925 CAJPRK010000130.1 GCA905373015_02459 CDS open 4942-5265 _na     107_aa Transcriptional regulator
4926 CAJPRK010000130.1 GCA905373015_02460 CDS open 5422-5955 _na     177_aa DUF4242 domain-containing protein
4927 CAJPRK010000130.1 GCA905373015_02461 CDS open 6116-6808 _na     230_aa ABC transporter permease subunit
4928 CAJPRK010000130.1 GCA905373015_02455 gene open 18-1967
4929 CAJPRK010000130.1 GCA905373015_02456 gene open 2113-2667 ssuE
4930 CAJPRK010000130.1 GCA905373015_02457 gene open 2878-4464 ilvA
4931 CAJPRK010000130.1 GCA905373015_02458 gene open 4592-4945
4932 CAJPRK010000130.1 GCA905373015_02459 gene open 4942-5265
4933 CAJPRK010000130.1 GCA905373015_02460 gene open 5422-5955
4934 CAJPRK010000130.1 GCA905373015_02461 gene open 6116-6808
4935 CAJPRK010000131.1 GCA905373015_02463 CDS open 490-1200 _na     236_aa orn oligoribonuclease
4936 CAJPRK010000131.1 GCA905373015_02464 CDS open 1285-3798 _na     837_aa non-specific serine/threonine protein kinase
4937 CAJPRK010000131.1 GCA905373015_02465 CDS open 3897-6587 _na     896_aa ABC transporter domain-containing protein
4938 CAJPRK010000131.1 GCA905373015_02463 gene open 490-1200 orn
4939 CAJPRK010000131.1 GCA905373015_02464 gene open 1285-3798
4940 CAJPRK010000131.1 GCA905373015_02465 gene open 3897-6587
4941 CAJPRK010000131.1 GCA905373015_02462 gene open 296-371 trnH
4942 CAJPRK010000131.1 GCA905373015_02462 tRNA open 296-371 trnH tRNA-His(gtg)
4943 CAJPRK010000132.1 GCA905373015_02466 CDS open 325-903 _na     192_aa hypothetical protein
4944 CAJPRK010000132.1 GCA905373015_02467 CDS open 981-2054 _na     357_aa suhB Histidinol-phosphatase
4945 CAJPRK010000132.1 GCA905373015_02468 CDS open 2161-3273 _na     370_aa Orc1-like AAA ATPase domain-containing protein
4946 CAJPRK010000132.1 GCA905373015_02469 CDS open 3521-4351 _na     276_aa undecaprenyl-diphosphate phosphatase
4947 CAJPRK010000132.1 GCA905373015_02470 CDS open 5915-6025 _na     36_aa hypothetical protein
4948 CAJPRK010000132.1 GCA905373015_02471 CDS open 6041-6403 _na     120_aa hypothetical protein
4949 CAJPRK010000132.1 GCA905373015_02466 gene open 325-903
4950 CAJPRK010000132.1 GCA905373015_02467 gene open 981-2054 suhB
4951 CAJPRK010000132.1 GCA905373015_02468 gene open 2161-3273
4952 CAJPRK010000132.1 GCA905373015_02469 gene open 3521-4351
4953 CAJPRK010000132.1 GCA905373015_02470 gene open 5915-6025
4954 CAJPRK010000132.1 GCA905373015_02471 gene open 6041-6403
4955 CAJPRK010000133.1 GCA905373015_02472 CDS open 62-2152 _na     696_aa tkt transketolase
4956 CAJPRK010000133.1 GCA905373015_02473 CDS open 2385-3746 _na     453_aa Major facilitator superfamily (MFS) profile domain-containing protein
4957 CAJPRK010000133.1 GCA905373015_02474 CDS open 3940-5409 _na     489_aa yqiK Band 7 domain-containing protein
4958 CAJPRK010000133.1 GCA905373015_02475 CDS open 5513-6016 _na     167_aa nfeD Nodulation protein NfeD
4959 CAJPRK010000133.1 GCA905373015_02472 gene open 62-2152 tkt
4960 CAJPRK010000133.1 GCA905373015_02473 gene open 2385-3746
4961 CAJPRK010000133.1 GCA905373015_02474 gene open 3940-5409 yqiK
4962 CAJPRK010000133.1 GCA905373015_02475 gene open 5513-6016 nfeD
4963 CAJPRK010000134.1 GCA905373015_02476 CDS open 58-1002 _na     314_aa hemB porphobilinogen synthase
4964 CAJPRK010000134.1 GCA905373015_02477 CDS open 1490-2968 _na     492_aa hemL glutamate-1-semialdehyde 2%2C1-aminomutase
4965 CAJPRK010000134.1 GCA905373015_02478 CDS open 3196-4137 _na     313_aa Protein-ADP-ribose hydrolase
4966 CAJPRK010000134.1 GCA905373015_02479 CDS open 4276-4656 _na     126_aa cnoX Thioredoxin
4967 CAJPRK010000134.1 GCA905373015_02480 CDS open 5117-6112 _na     331_aa DUF1648 domain-containing protein
4968 CAJPRK010000134.1 GCA905373015_02476 gene open 58-1002 hemB
4969 CAJPRK010000134.1 GCA905373015_02477 gene open 1490-2968 hemL
4970 CAJPRK010000134.1 GCA905373015_02478 gene open 3196-4137
4971 CAJPRK010000134.1 GCA905373015_02479 gene open 4276-4656 cnoX
4972 CAJPRK010000134.1 GCA905373015_02480 gene open 5117-6112
4973 CAJPRK010000135.1 GCA905373015_02481 CDS open 118-1137 _na     339_aa pstC phosphate ABC transporter permease subunit PstC
4974 CAJPRK010000135.1 GCA905373015_02482 CDS open 1229-2302 _na     357_aa pstS phosphate ABC transporter substrate-binding protein PstS
4975 CAJPRK010000135.1 GCA905373015_02483 CDS open 2499-2828 _na     109_aa cell surface protein
4976 CAJPRK010000135.1 GCA905373015_02484 CDS open 2944-3972 _na     342_aa yjhB Nudix hydrolase domain-containing protein
4977 CAJPRK010000135.1 GCA905373015_02485 CDS open 3985-5934 _na     649_aa RNA degradosome polyphosphate kinase
4978 CAJPRK010000135.1 GCA905373015_02481 gene open 118-1137 pstC
4979 CAJPRK010000135.1 GCA905373015_02482 gene open 1229-2302 pstS
4980 CAJPRK010000135.1 GCA905373015_02483 gene open 2499-2828
4981 CAJPRK010000135.1 GCA905373015_02484 gene open 2944-3972 yjhB
4982 CAJPRK010000135.1 GCA905373015_02485 gene open 3985-5934
4983 CAJPRK010000136.1 GCA905373015_02486 CDS open 46-1695 _na     549_aa Glucoside ABC transporter substrate-binding protein
4984 CAJPRK010000136.1 GCA905373015_02487 CDS open 1695-2759 _na     354_aa Haloacid dehalogenase
4985 CAJPRK010000136.1 GCA905373015_02488 CDS open 2771-4051 _na     426_aa serS serine--tRNA ligase
4986 CAJPRK010000136.1 GCA905373015_02489 CDS open 4612-5544 _na     310_aa lysR putative hydrogen peroxide-inducible genes activator
4987 CAJPRK010000136.1 GCA905373015_02486 gene open 46-1695
4988 CAJPRK010000136.1 GCA905373015_02487 gene open 1695-2759
4989 CAJPRK010000136.1 GCA905373015_02488 gene open 2771-4051 serS
4990 CAJPRK010000136.1 GCA905373015_02489 gene open 4612-5544 lysR
4991 CAJPRK010000137.1 repeat_region open 5717-5940 CRISPR array with 4 repeats of length 32%2C consensus sequence GATCCTGTCCCCGGGCGCGCAGGGTGTCCCCC and spacer length 29
4992 CAJPRK010000137.1 GCA905373015_02490 CDS open 25-546 _na     173_aa hypothetical protein
4993 CAJPRK010000137.1 GCA905373015_02491 CDS open 543-1622 _na     359_aa asd aspartate-semialdehyde dehydrogenase
4994 CAJPRK010000137.1 GCA905373015_02492 CDS open 1753-2517 _na     254_aa hypothetical protein
4995 CAJPRK010000137.1 GCA905373015_02493 CDS open 3041-3742 _na     233_aa Ion transporter
4996 CAJPRK010000137.1 GCA905373015_02494 CDS open 3836-4630 _na     264_aa Lipoprotein
4997 CAJPRK010000137.1 GCA905373015_02495 CDS open 4620-5417 _na     265_aa terC Tellurium resistance protein TerC
4998 CAJPRK010000137.1 GCA905373015_02490 gene open 25-546
4999 CAJPRK010000137.1 GCA905373015_02491 gene open 543-1622 asd
5000 CAJPRK010000137.1 GCA905373015_02492 gene open 1753-2517