HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Actinomyces oris clade-144 (GCA_905373015.1)

Select a Genome:
BAKTA Annotations for GCA_905373015.1
Genome Selected: Actinomyces oris clade-144
ContigsBases CDSrRNA tmRNAtRNA
181 3114517 2597 0 1 48
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 5320 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:2]    |    Number of Records Found: 5320 [11 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  11  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
501 CAJPRK010000004.1 GCA905373015_00235 gene open 22670-23761
502 CAJPRK010000004.1 GCA905373015_00236 gene open 23754-25457 arc
503 CAJPRK010000004.1 GCA905373015_00237 gene open 25454-27094 dop
504 CAJPRK010000004.1 GCA905373015_00238 gene open 27154-27369
505 CAJPRK010000004.1 GCA905373015_00239 gene open 27372-28811 pafA
506 CAJPRK010000004.1 GCA905373015_00240 gene open 28859-30307
507 CAJPRK010000004.1 GCA905373015_00241 gene open 30304-31074 hisF
508 CAJPRK010000004.1 GCA905373015_00242 gene open 31158-31454
509 CAJPRK010000004.1 GCA905373015_00243 gene open 31594-31929
510 CAJPRK010000004.1 GCA905373015_00244 gene open 32120-32713
511 CAJPRK010000004.1 GCA905373015_00245 gene open 32710-33201
512 CAJPRK010000004.1 GCA905373015_00246 gene open 33214-33591 hisI
513 CAJPRK010000004.1 GCA905373015_00247 gene open 33707-34531 trpC
514 CAJPRK010000004.1 GCA905373015_00248 gene open 34532-35575 lgt
515 CAJPRK010000004.1 GCA905373015_00249 gene open 35698-37128 pyk
516 CAJPRK010000004.1 GCA905373015_00250 gene open 37202-37612 cdd
517 CAJPRK010000004.1 GCA905373015_00252 gene open 37785-38393 amiR
518 CAJPRK010000004.1 GCA905373015_00253 gene open 38427-39065
519 CAJPRK010000004.1 GCA905373015_00254 gene open 39179-41920 polA
520 CAJPRK010000004.1 GCA905373015_00255 gene open 42231-43685 rpsA
521 CAJPRK010000004.1 GCA905373015_00256 gene open 43865-45631
522 CAJPRK010000004.1 GCA905373015_00257 gene open 45759-46352 coaE
523 CAJPRK010000004.1 GCA905373015_00258 gene open 46470-47159
524 CAJPRK010000004.1 GCA905373015_00259 gene open 47175-47264
525 CAJPRK010000004.1 GCA905373015_00260 gene open 47512-49608 uvrB
526 CAJPRK010000004.1 GCA905373015_00261 gene open 49849-50853 terC
527 CAJPRK010000004.1 GCA905373015_00262 gene open 50910-53399
528 CAJPRK010000004.1 GCA905373015_00263 gene open 53425-54072
529 CAJPRK010000004.1 GCA905373015_00264 gene open 54042-54383
530 CAJPRK010000004.1 GCA905373015_00265 gene open 54436-57312 uvrA
531 CAJPRK010000004.1 GCA905373015_00266 gene open 57373-60006
532 CAJPRK010000004.1 GCA905373015_00267 gene open 60215-61591 qRI1
533 CAJPRK010000004.1 GCA905373015_00272 gene open 62365-64512 uvrC
534 CAJPRK010000004.1 GCA905373015_00273 gene open 64563-64775 mopI
535 CAJPRK010000004.1 GCA905373015_00217 gene open 6040-6130 trnL
536 CAJPRK010000004.1 GCA905373015_00251 gene open 37654-37730 trnL
537 CAJPRK010000004.1 GCA905373015_00268 gene open 61761-61833 trnV
538 CAJPRK010000004.1 GCA905373015_00269 gene open 61984-62056 trnG
539 CAJPRK010000004.1 GCA905373015_00270 gene open 62093-62163 trnC
540 CAJPRK010000004.1 GCA905373015_00271 gene open 62165-62239 trnV
541 CAJPRK010000004.1 GCA905373015_00217 tRNA open 6040-6130 trnL tRNA-Leu(gag)
542 CAJPRK010000004.1 GCA905373015_00251 tRNA open 37654-37730 trnL tRNA-Leu(caa)
543 CAJPRK010000004.1 GCA905373015_00268 tRNA open 61761-61833 trnV tRNA-Val(cac)
544 CAJPRK010000004.1 GCA905373015_00269 tRNA open 61984-62056 trnG tRNA-Gly(gcc)
545 CAJPRK010000004.1 GCA905373015_00270 tRNA open 62093-62163 trnC tRNA-Cys(gca)
546 CAJPRK010000004.1 GCA905373015_00271 tRNA open 62165-62239 trnV tRNA-Val(gac)
547 CAJPRK010000005.1 GCA905373015_00274 CDS open 812-1927 _na     371_aa Restriction endonuclease
548 CAJPRK010000005.1 GCA905373015_00275 CDS open 1924-3381 _na     485_aa AAA+ ATPase domain-containing protein
549 CAJPRK010000005.1 GCA905373015_00276 CDS open 3605-3865 _na     86_aa type II toxin-antitoxin system death-on-curing family toxin
550 CAJPRK010000005.1 GCA905373015_00277 CDS open 3889-4764 _na     291_aa TIGR00027 family methyltransferase
551 CAJPRK010000005.1 GCA905373015_00278 CDS open 4862-5644 _na     260_aa dAP2 Non-haem bromoperoxidase BPO-A2
552 CAJPRK010000005.1 GCA905373015_00279 CDS open 5733-6512 _na     259_aa yurZ Carboxymuconolactone decarboxylase-like domain-containing protein
553 CAJPRK010000005.1 GCA905373015_00280 CDS open 6623-7399 _na     258_aa Gluconate 5-dehydrogenase
554 CAJPRK010000005.1 GCA905373015_00281 CDS open 7567-10077 _na     836_aa Beta-1%2C3-N-acetylglucosaminyltransferase
555 CAJPRK010000005.1 GCA905373015_00282 CDS open 10125-11171 _na     348_aa hypothetical protein
556 CAJPRK010000005.1 GCA905373015_00283 CDS open 11523-12527 _na     334_aa Alpha/beta hydrolase fold-3 domain-containing protein
557 CAJPRK010000005.1 GCA905373015_00284 CDS open 12641-13609 _na     322_aa Cell filamentation protein Fic
558 CAJPRK010000005.1 GCA905373015_00285 CDS open 13658-14065 _na     135_aa HTH cro/C1-type domain-containing protein
559 CAJPRK010000005.1 GCA905373015_00286 CDS open 14332-15648 _na     438_aa DUF4143 domain-containing protein
560 CAJPRK010000005.1 GCA905373015_00287 CDS open 15854-15964 _na     36_aa hypothetical protein
561 CAJPRK010000005.1 GCA905373015_00288 CDS open 15973-16161 _na     62_aa response regulator transcription factor
562 CAJPRK010000005.1 GCA905373015_00289 CDS open 16212-16487 _na     91_aa hypothetical protein
563 CAJPRK010000005.1 GCA905373015_00290 CDS open 16524-17234 _na     236_aa hypothetical protein
564 CAJPRK010000005.1 GCA905373015_00291 CDS open 17432-18052 _na     206_aa NAD(P)H-binding protein
565 CAJPRK010000005.1 GCA905373015_00292 CDS open 18409-18804 _na     131_aa flavodoxin
566 CAJPRK010000005.1 GCA905373015_00293 CDS open 18774-19730 _na     318_aa putative peptidase
567 CAJPRK010000005.1 GCA905373015_00294 CDS open 19918-20166 _na     82_aa copG Ribbon-helix-helix protein%2C CopG family
568 CAJPRK010000005.1 GCA905373015_00295 CDS open 20163-20402 _na     79_aa Toxin
569 CAJPRK010000005.1 GCA905373015_00296 CDS open 20526-21206 _na     226_aa DNA-binding response regulator
570 CAJPRK010000005.1 GCA905373015_00297 CDS open 21203-22339 _na     378_aa histidine kinase
571 CAJPRK010000005.1 GCA905373015_00298 CDS open 22535-23518 _na     327_aa ABC transporter%2C ATP-binding protein
572 CAJPRK010000005.1 GCA905373015_00299 CDS open 23520-24662 _na     380_aa ABC-2 type transporter transmembrane domain-containing protein
573 CAJPRK010000005.1 GCA905373015_00300 CDS open 24649-25833 _na     394_aa ABC-2 type transporter transmembrane domain-containing protein
574 CAJPRK010000005.1 GCA905373015_00301 CDS open 25927-26793 _na     288_aa DUF4352 domain-containing protein
575 CAJPRK010000005.1 GCA905373015_00302 CDS open 27535-29250 _na     571_aa guaA glutamine-hydrolyzing GMP synthase
576 CAJPRK010000005.1 GCA905373015_00303 CDS open 29568-29837 _na     89_aa Mandelate racemase
577 CAJPRK010000005.1 GCA905373015_00304 CDS open 30187-31008 _na     273_aa protein-ADP-ribose hydrolase
578 CAJPRK010000005.1 GCA905373015_00305 CDS open 30950-31861 _na     303_aa Deacetylase sirtuin-type domain-containing protein
579 CAJPRK010000005.1 GCA905373015_00306 CDS open 31872-32270 _na     132_aa SnoaL-like domain-containing protein
580 CAJPRK010000005.1 GCA905373015_00307 CDS open 32609-33775 _na     388_aa frmA Enoyl reductase (ER) domain-containing protein
581 CAJPRK010000005.1 GCA905373015_00308 CDS open 33932-35209 _na     425_aa MFS transporter
582 CAJPRK010000005.1 GCA905373015_00309 CDS open 35391-37007 _na     538_aa Major facilitator superfamily (MFS) profile domain-containing protein
583 CAJPRK010000005.1 GCA905373015_00310 CDS open 37167-38036 _na     289_aa ycjR Xylose isomerase-like TIM barrel domain-containing protein
584 CAJPRK010000005.1 GCA905373015_00311 CDS open 38333-39343 _na     336_aa mviM Inositol 2-dehydrogenase
585 CAJPRK010000005.1 GCA905373015_00312 CDS open 39405-40334 _na     309_aa ycjR Inosose dehydratase
586 CAJPRK010000005.1 GCA905373015_00313 CDS open 41093-41662 _na     189_aa hypothetical protein
587 CAJPRK010000005.1 GCA905373015_00314 CDS open 41784-43277 _na     497_aa adhE Methylmalonate-semialdehyde dehydrogenase (Acylating)
588 CAJPRK010000005.1 GCA905373015_00315 CDS open 43637-45544 _na     635_aa iolD 3D-(3%2C5/4)-trihydroxycyclohexane-1%2C2-dione acylhydrolase (decyclizing)
589 CAJPRK010000005.1 GCA905373015_00316 CDS open 45598-46512 _na     304_aa iolB 5-deoxy-glucuronate isomerase
590 CAJPRK010000005.1 GCA905373015_00317 CDS open 46638-47552 _na     304_aa Cgl0159-like domain-containing protein
591 CAJPRK010000005.1 GCA905373015_00318 CDS open 47563-48600 _na     345_aa rbsK Carbohydrate kinase PfkB domain-containing protein
592 CAJPRK010000005.1 GCA905373015_00319 CDS open 48844-49596 _na     250_aa mngR HTH gntR-type domain-containing protein
593 CAJPRK010000005.1 GCA905373015_00320 CDS open 49722-50825 _na     367_aa talA Transaldolase
594 CAJPRK010000005.1 GCA905373015_00321 CDS open 51015-52004 _na     329_aa iolG inositol 2-dehydrogenase
595 CAJPRK010000005.1 GCA905373015_00322 CDS open 51880-52647 _na     255_aa hypothetical protein
596 CAJPRK010000005.1 GCA905373015_00323 CDS open 52789-53187 _na     132_aa hypothetical protein
597 CAJPRK010000005.1 GCA905373015_00274 gene open 812-1927
598 CAJPRK010000005.1 GCA905373015_00275 gene open 1924-3381
599 CAJPRK010000005.1 GCA905373015_00276 gene open 3605-3865
600 CAJPRK010000005.1 GCA905373015_00277 gene open 3889-4764
601 CAJPRK010000005.1 GCA905373015_00278 gene open 4862-5644 dAP2
602 CAJPRK010000005.1 GCA905373015_00279 gene open 5733-6512 yurZ
603 CAJPRK010000005.1 GCA905373015_00280 gene open 6623-7399
604 CAJPRK010000005.1 GCA905373015_00281 gene open 7567-10077
605 CAJPRK010000005.1 GCA905373015_00282 gene open 10125-11171
606 CAJPRK010000005.1 GCA905373015_00283 gene open 11523-12527
607 CAJPRK010000005.1 GCA905373015_00284 gene open 12641-13609
608 CAJPRK010000005.1 GCA905373015_00285 gene open 13658-14065
609 CAJPRK010000005.1 GCA905373015_00286 gene open 14332-15648
610 CAJPRK010000005.1 GCA905373015_00287 gene open 15854-15964
611 CAJPRK010000005.1 GCA905373015_00288 gene open 15973-16161
612 CAJPRK010000005.1 GCA905373015_00289 gene open 16212-16487
613 CAJPRK010000005.1 GCA905373015_00290 gene open 16524-17234
614 CAJPRK010000005.1 GCA905373015_00291 gene open 17432-18052
615 CAJPRK010000005.1 GCA905373015_00292 gene open 18409-18804
616 CAJPRK010000005.1 GCA905373015_00293 gene open 18774-19730
617 CAJPRK010000005.1 GCA905373015_00294 gene open 19918-20166 copG
618 CAJPRK010000005.1 GCA905373015_00295 gene open 20163-20402
619 CAJPRK010000005.1 GCA905373015_00296 gene open 20526-21206
620 CAJPRK010000005.1 GCA905373015_00297 gene open 21203-22339
621 CAJPRK010000005.1 GCA905373015_00298 gene open 22535-23518
622 CAJPRK010000005.1 GCA905373015_00299 gene open 23520-24662
623 CAJPRK010000005.1 GCA905373015_00300 gene open 24649-25833
624 CAJPRK010000005.1 GCA905373015_00301 gene open 25927-26793
625 CAJPRK010000005.1 GCA905373015_00302 gene open 27535-29250 guaA
626 CAJPRK010000005.1 GCA905373015_00303 gene open 29568-29837
627 CAJPRK010000005.1 GCA905373015_00304 gene open 30187-31008
628 CAJPRK010000005.1 GCA905373015_00305 gene open 30950-31861
629 CAJPRK010000005.1 GCA905373015_00306 gene open 31872-32270
630 CAJPRK010000005.1 GCA905373015_00307 gene open 32609-33775 frmA
631 CAJPRK010000005.1 GCA905373015_00308 gene open 33932-35209
632 CAJPRK010000005.1 GCA905373015_00309 gene open 35391-37007
633 CAJPRK010000005.1 GCA905373015_00310 gene open 37167-38036 ycjR
634 CAJPRK010000005.1 GCA905373015_00311 gene open 38333-39343 mviM
635 CAJPRK010000005.1 GCA905373015_00312 gene open 39405-40334 ycjR
636 CAJPRK010000005.1 GCA905373015_00313 gene open 41093-41662
637 CAJPRK010000005.1 GCA905373015_00314 gene open 41784-43277 adhE
638 CAJPRK010000005.1 GCA905373015_00315 gene open 43637-45544 iolD
639 CAJPRK010000005.1 GCA905373015_00316 gene open 45598-46512 iolB
640 CAJPRK010000005.1 GCA905373015_00317 gene open 46638-47552
641 CAJPRK010000005.1 GCA905373015_00318 gene open 47563-48600 rbsK
642 CAJPRK010000005.1 GCA905373015_00319 gene open 48844-49596 mngR
643 CAJPRK010000005.1 GCA905373015_00320 gene open 49722-50825 talA
644 CAJPRK010000005.1 GCA905373015_00321 gene open 51015-52004 iolG
645 CAJPRK010000005.1 GCA905373015_00322 gene open 51880-52647
646 CAJPRK010000005.1 GCA905373015_00323 gene open 52789-53187
647 CAJPRK010000006.1 rep_origin open 49302-49898
648 CAJPRK010000006.1 GCA905373015_00324 CDS open 4-675 _na     223_aa DUF4352 domain-containing protein
649 CAJPRK010000006.1 GCA905373015_00325 CDS open 1766-2956 _na     396_aa serA D-3-phosphoglycerate dehydrogenase
650 CAJPRK010000006.1 GCA905373015_00326 CDS open 3070-4215 _na     381_aa serC 3-phosphoserine/phosphohydroxythreonine transaminase
651 CAJPRK010000006.1 GCA905373015_00327 CDS open 4579-6018 _na     479_aa DUF4832 domain-containing protein
652 CAJPRK010000006.1 GCA905373015_00328 CDS open 6182-7108 _na     308_aa ADP-ribosylglycohydrolase
653 CAJPRK010000006.1 GCA905373015_00329 CDS open 8712-10028 _na     438_aa csb2 type I-U CRISPR-associated protein Csb2
654 CAJPRK010000006.1 GCA905373015_00330 CDS open 10021-11232 _na     403_aa Type I-U CRISPR-associated protein Cas7
655 CAJPRK010000006.1 GCA905373015_00331 CDS open 11297-11872 _na     191_aa Type I-E CRISPR-associated protein Cas6/Cse3/CasE
656 CAJPRK010000006.1 GCA905373015_00332 CDS open 11897-12808 _na     303_aa hypothetical protein
657 CAJPRK010000006.1 GCA905373015_00333 CDS open 12801-15590 _na     929_aa cas3u type I-U CRISPR-associated helicase/endonuclease Cas3
658 CAJPRK010000006.1 GCA905373015_00334 CDS open 15980-17290 _na     436_aa ATP-binding protein
659 CAJPRK010000006.1 GCA905373015_00335 CDS open 17329-17547 _na     72_aa hypothetical protein
660 CAJPRK010000006.1 GCA905373015_00336 CDS open 18188-19048 _na     286_aa Cytochrome b5 heme-binding domain-containing protein
661 CAJPRK010000006.1 GCA905373015_00337 CDS open 19070-19765 _na     231_aa hypothetical protein
662 CAJPRK010000006.1 GCA905373015_00338 CDS open 20137-20625 _na     162_aa hypothetical protein
663 CAJPRK010000006.1 GCA905373015_00339 CDS open 21258-22766 _na     502_aa galA Alpha-galactosidase
664 CAJPRK010000006.1 GCA905373015_00340 CDS open 22904-24121 _na     405_aa Gfo/Idh/MocA family oxidoreductase
665 CAJPRK010000006.1 GCA905373015_00341 CDS open 24132-25619 _na     495_aa pcnB CCA tRNA nucleotidyltransferase
666 CAJPRK010000006.1 GCA905373015_00342 CDS open 25821-26330 _na     169_aa yjhB Nudix hydrolase domain-containing protein
667 CAJPRK010000006.1 GCA905373015_00343 CDS open 26327-28783 _na     818_aa Conjugal transfer protein
668 CAJPRK010000006.1 GCA905373015_00344 CDS open 28780-33090 _na     1436_aa mviN Integral membrane protein MviN
669 CAJPRK010000006.1 GCA905373015_00345 CDS open 33176-34105 _na     309_aa trxB thioredoxin-disulfide reductase
670 CAJPRK010000006.1 GCA905373015_00346 CDS open 34214-34540 _na     108_aa trxA thioredoxin
671 CAJPRK010000006.1 GCA905373015_00347 CDS open 34780-36216 _na     478_aa thrC threonine synthase
672 CAJPRK010000006.1 GCA905373015_00348 CDS open 36421-37758 _na     445_aa aRO8 Aminotransferase class I/classII large domain-containing protein
673 CAJPRK010000006.1 GCA905373015_00349 CDS open 37767-38714 _na     315_aa ddlA D-alanine--D-alanine ligase
674 CAJPRK010000006.1 GCA905373015_00350 CDS open 43289-44878 _na     529_aa parB Chromosome partitioning protein ParB
675 CAJPRK010000006.1 GCA905373015_00351 CDS open 44878-45780 _na     300_aa parA AAA domain-containing protein
676 CAJPRK010000006.1 GCA905373015_00352 CDS open 45888-46532 _na     214_aa rsmG 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG
677 CAJPRK010000006.1 GCA905373015_00353 CDS open 46535-47176 _na     213_aa R3H domain-containing protein
678 CAJPRK010000006.1 GCA905373015_00354 CDS open 47209-48393 _na     394_aa yidC Membrane protein insertase YidC
679 CAJPRK010000006.1 GCA905373015_00355 CDS open 48487-48744 _na     85_aa yidD membrane protein insertion efficiency factor YidD
680 CAJPRK010000006.1 GCA905373015_00356 CDS open 49886-50170 _na     94_aa hypothetical protein
681 CAJPRK010000006.1 GCA905373015_00324 gene open 4-675
682 CAJPRK010000006.1 GCA905373015_00325 gene open 1766-2956 serA
683 CAJPRK010000006.1 GCA905373015_00326 gene open 3070-4215 serC
684 CAJPRK010000006.1 GCA905373015_00327 gene open 4579-6018
685 CAJPRK010000006.1 GCA905373015_00328 gene open 6182-7108
686 CAJPRK010000006.1 GCA905373015_00329 gene open 8712-10028 csb2
687 CAJPRK010000006.1 GCA905373015_00330 gene open 10021-11232
688 CAJPRK010000006.1 GCA905373015_00331 gene open 11297-11872
689 CAJPRK010000006.1 GCA905373015_00332 gene open 11897-12808
690 CAJPRK010000006.1 GCA905373015_00333 gene open 12801-15590 cas3u
691 CAJPRK010000006.1 GCA905373015_00334 gene open 15980-17290
692 CAJPRK010000006.1 GCA905373015_00335 gene open 17329-17547
693 CAJPRK010000006.1 GCA905373015_00336 gene open 18188-19048
694 CAJPRK010000006.1 GCA905373015_00337 gene open 19070-19765
695 CAJPRK010000006.1 GCA905373015_00338 gene open 20137-20625
696 CAJPRK010000006.1 GCA905373015_00339 gene open 21258-22766 galA
697 CAJPRK010000006.1 GCA905373015_00340 gene open 22904-24121
698 CAJPRK010000006.1 GCA905373015_00341 gene open 24132-25619 pcnB
699 CAJPRK010000006.1 GCA905373015_00342 gene open 25821-26330 yjhB
700 CAJPRK010000006.1 GCA905373015_00343 gene open 26327-28783
701 CAJPRK010000006.1 GCA905373015_00344 gene open 28780-33090 mviN
702 CAJPRK010000006.1 GCA905373015_00345 gene open 33176-34105 trxB
703 CAJPRK010000006.1 GCA905373015_00346 gene open 34214-34540 trxA
704 CAJPRK010000006.1 GCA905373015_00347 gene open 34780-36216 thrC
705 CAJPRK010000006.1 GCA905373015_00348 gene open 36421-37758 aRO8
706 CAJPRK010000006.1 GCA905373015_00349 gene open 37767-38714 ddlA
707 CAJPRK010000006.1 GCA905373015_00350 gene open 43289-44878 parB
708 CAJPRK010000006.1 GCA905373015_00351 gene open 44878-45780 parA
709 CAJPRK010000006.1 GCA905373015_00352 gene open 45888-46532 rsmG
710 CAJPRK010000006.1 GCA905373015_00353 gene open 46535-47176
711 CAJPRK010000006.1 GCA905373015_00354 gene open 47209-48393 yidC
712 CAJPRK010000006.1 GCA905373015_00355 gene open 48487-48744 yidD
713 CAJPRK010000006.1 GCA905373015_00356 gene open 49886-50170
714 CAJPRK010000007.1 GCA905373015_00357 CDS open 71-1177 _na     368_aa Glycosyltransferase subfamily 4-like N-terminal domain-containing protein
715 CAJPRK010000007.1 GCA905373015_00358 CDS open 1174-2172 _na     332_aa Glycosyltransferase family 2 protein
716 CAJPRK010000007.1 GCA905373015_00359 CDS open 2307-3407 _na     366_aa Glycosyltransferase family A protein
717 CAJPRK010000007.1 GCA905373015_00360 CDS open 3436-4734 _na     432_aa tagH ABC transporter domain-containing protein
718 CAJPRK010000007.1 GCA905373015_00361 CDS open 4739-5605 _na     288_aa tagG Transport permease protein
719 CAJPRK010000007.1 GCA905373015_00362 CDS open 5610-6704 _na     364_aa NAD-dependent epimerase/dehydratase domain-containing protein
720 CAJPRK010000007.1 GCA905373015_00363 CDS open 6870-7961 _na     363_aa Acyltransferase
721 CAJPRK010000007.1 GCA905373015_00364 CDS open 7964-9844 _na     626_aa Rhamnan synthesis protein F
722 CAJPRK010000007.1 GCA905373015_00365 CDS open 9919-10761 _na     280_aa wcaG NAD-dependent epimerase/dehydratase domain-containing protein
723 CAJPRK010000007.1 GCA905373015_00366 CDS open 10797-12860 _na     687_aa DUF2029 domain-containing protein
724 CAJPRK010000007.1 GCA905373015_00367 CDS open 12850-13317 _na     155_aa gtrA GtrA family protein
725 CAJPRK010000007.1 GCA905373015_00368 CDS open 13314-14339 _na     341_aa Glycosyltransferase family 2 protein
726 CAJPRK010000007.1 GCA905373015_00369 CDS open 14469-16526 _na     685_aa Rhamnan synthesis protein F
727 CAJPRK010000007.1 GCA905373015_00370 CDS open 16650-18722 _na     690_aa Peptidoglycan recognition protein family domain-containing protein
728 CAJPRK010000007.1 GCA905373015_00371 CDS open 19134-20129 _na     331_aa rfbB dTDP-glucose 4%2C6-dehydratase
729 CAJPRK010000007.1 GCA905373015_00372 CDS open 20239-21177 _na     312_aa wcaA Glycosyltransferase%2C group 2 family protein
730 CAJPRK010000007.1 GCA905373015_00373 CDS open 21718-23061 _na     447_aa Glycosyltransferase RgtA/B/C/D-like domain-containing protein
731 CAJPRK010000007.1 GCA905373015_00374 CDS open 23068-23337 _na     89_aa hicA Toxin HicA
732 CAJPRK010000007.1 GCA905373015_00375 CDS open 23334-23675 _na     113_aa hicB Toxin-antitoxin system HicB family antitoxin
733 CAJPRK010000007.1 GCA905373015_00376 CDS open 23722-24006 _na     94_aa Antibiotic biosynthesis monooxygenase
734 CAJPRK010000007.1 GCA905373015_00377 CDS open 24035-26089 _na     684_aa Beta-carotene 15%2C15'-monooxygenase
735 CAJPRK010000007.1 GCA905373015_00378 CDS open 26121-27425 _na     434_aa wecC UDP-glucose/GDP-mannose dehydrogenase C-terminal domain-containing protein
736 CAJPRK010000007.1 GCA905373015_00379 CDS open 27556-29553 _na     665_aa Tat pathway signal sequence
737 CAJPRK010000007.1 GCA905373015_00380 CDS open 29550-30806 _na     418_aa Glycosyltransferase subfamily 4-like N-terminal domain-containing protein
738 CAJPRK010000007.1 GCA905373015_00381 CDS open 30799-31980 _na     393_aa Glycosyl transferase
739 CAJPRK010000007.1 GCA905373015_00382 CDS open 32264-33982 _na     572_aa asparagine synthase (glutamine-hydrolyzing)
740 CAJPRK010000007.1 GCA905373015_00383 CDS open 33994-35115 _na     373_aa Glycosyltransferase
741 CAJPRK010000007.1 GCA905373015_00384 CDS open 35087-36355 _na     422_aa Glycosyltransferase
742 CAJPRK010000007.1 GCA905373015_00385 CDS open 36499-37890 _na     463_aa rfbX RfbX
743 CAJPRK010000007.1 GCA905373015_00386 CDS open 37887-38954 _na     355_aa mviM Gfo/Idh/MocA-like oxidoreductase N-terminal domain-containing protein
744 CAJPRK010000007.1 GCA905373015_00387 CDS open 38956-40089 _na     377_aa wecE DegT/DnrJ/EryC1/StrS family aminotransferase
745 CAJPRK010000007.1 GCA905373015_00388 CDS open 40089-40745 _na     218_aa N-acetyltransferase
746 CAJPRK010000007.1 GCA905373015_00389 CDS open 41040-41714 _na     224_aa Glycosyltransferase 2-like domain-containing protein
747 CAJPRK010000007.1 GCA905373015_00390 CDS open 41738-42151 _na     137_aa DUF2304 domain-containing protein
748 CAJPRK010000007.1 GCA905373015_00391 CDS open 42187-43140 _na     317_aa dTDP-Rha:alpha-D-GlcNAc-pyrophosphate polyprenol%2C alpha-3-L-rhamnosyltransferase
749 CAJPRK010000007.1 GCA905373015_00392 CDS open 43248-44534 _na     428_aa Cell envelope-related transcriptional attenuator domain-containing protein
750 CAJPRK010000007.1 GCA905373015_00393 CDS open 44904-46031 _na     375_aa Transcriptional regulator
751 CAJPRK010000007.1 GCA905373015_00394 CDS open 46123-47112 _na     329_aa galE UDP-glucose 4-epimerase GalE
752 CAJPRK010000007.1 GCA905373015_00395 CDS open 48202-48351 _na     49_aa Integrase
753 CAJPRK010000007.1 GCA905373015_00357 gene open 71-1177
754 CAJPRK010000007.1 GCA905373015_00358 gene open 1174-2172
755 CAJPRK010000007.1 GCA905373015_00359 gene open 2307-3407
756 CAJPRK010000007.1 GCA905373015_00360 gene open 3436-4734 tagH
757 CAJPRK010000007.1 GCA905373015_00361 gene open 4739-5605 tagG
758 CAJPRK010000007.1 GCA905373015_00362 gene open 5610-6704
759 CAJPRK010000007.1 GCA905373015_00363 gene open 6870-7961
760 CAJPRK010000007.1 GCA905373015_00364 gene open 7964-9844
761 CAJPRK010000007.1 GCA905373015_00365 gene open 9919-10761 wcaG
762 CAJPRK010000007.1 GCA905373015_00366 gene open 10797-12860
763 CAJPRK010000007.1 GCA905373015_00367 gene open 12850-13317 gtrA
764 CAJPRK010000007.1 GCA905373015_00368 gene open 13314-14339
765 CAJPRK010000007.1 GCA905373015_00369 gene open 14469-16526
766 CAJPRK010000007.1 GCA905373015_00370 gene open 16650-18722
767 CAJPRK010000007.1 GCA905373015_00371 gene open 19134-20129 rfbB
768 CAJPRK010000007.1 GCA905373015_00372 gene open 20239-21177 wcaA
769 CAJPRK010000007.1 GCA905373015_00373 gene open 21718-23061
770 CAJPRK010000007.1 GCA905373015_00374 gene open 23068-23337 hicA
771 CAJPRK010000007.1 GCA905373015_00375 gene open 23334-23675 hicB
772 CAJPRK010000007.1 GCA905373015_00376 gene open 23722-24006
773 CAJPRK010000007.1 GCA905373015_00377 gene open 24035-26089
774 CAJPRK010000007.1 GCA905373015_00378 gene open 26121-27425 wecC
775 CAJPRK010000007.1 GCA905373015_00379 gene open 27556-29553
776 CAJPRK010000007.1 GCA905373015_00380 gene open 29550-30806
777 CAJPRK010000007.1 GCA905373015_00381 gene open 30799-31980
778 CAJPRK010000007.1 GCA905373015_00382 gene open 32264-33982
779 CAJPRK010000007.1 GCA905373015_00383 gene open 33994-35115
780 CAJPRK010000007.1 GCA905373015_00384 gene open 35087-36355
781 CAJPRK010000007.1 GCA905373015_00385 gene open 36499-37890 rfbX
782 CAJPRK010000007.1 GCA905373015_00386 gene open 37887-38954 mviM
783 CAJPRK010000007.1 GCA905373015_00387 gene open 38956-40089 wecE
784 CAJPRK010000007.1 GCA905373015_00388 gene open 40089-40745
785 CAJPRK010000007.1 GCA905373015_00389 gene open 41040-41714
786 CAJPRK010000007.1 GCA905373015_00390 gene open 41738-42151
787 CAJPRK010000007.1 GCA905373015_00391 gene open 42187-43140
788 CAJPRK010000007.1 GCA905373015_00392 gene open 43248-44534
789 CAJPRK010000007.1 GCA905373015_00393 gene open 44904-46031
790 CAJPRK010000007.1 GCA905373015_00394 gene open 46123-47112 galE
791 CAJPRK010000007.1 GCA905373015_00395 gene open 48202-48351
792 CAJPRK010000008.1 repeat_region open 28-248 CRISPR array with 4 repeats of length 30%2C consensus sequence GTAAACCCCGCGCGAGCGGGGATGATCCGG and spacer length 31
793 CAJPRK010000008.1 repeat_region open 1327-1486 CRISPR array with 3 repeats of length 29%2C consensus sequence CGTAAACCCCGCGCGAGCGGGGATGATCC and spacer length 32
794 CAJPRK010000008.1 GCA905373015_00396 CDS open 424-1173 _na     249_aa Transposase family protein
795 CAJPRK010000008.1 GCA905373015_00397 CDS open 1969-2910 _na     313_aa ATP-grasp fold amidoligase family protein
796 CAJPRK010000008.1 GCA905373015_00398 CDS open 3156-4502 _na     448_aa yveK Polysaccharide biosynthesis tyrosine autokinase
797 CAJPRK010000008.1 GCA905373015_00399 CDS open 5311-7236 _na     641_aa flaA1 Polysaccharide biosynthesis protein
798 CAJPRK010000008.1 GCA905373015_00400 CDS open 7233-8447 _na     404_aa Capsular biosynthesis protein
799 CAJPRK010000008.1 GCA905373015_00401 CDS open 8444-9130 _na     228_aa Bacterial sugar transferase domain-containing protein
800 CAJPRK010000008.1 GCA905373015_00402 CDS open 9162-9944 _na     260_aa wcaA Glycosyltransferase 2-like domain-containing protein
801 CAJPRK010000008.1 GCA905373015_00403 CDS open 10010-11161 _na     383_aa Glycosyltransferase
802 CAJPRK010000008.1 GCA905373015_00404 CDS open 11171-12277 _na     368_aa Polysaccharide polymerase
803 CAJPRK010000008.1 GCA905373015_00405 CDS open 12277-12705 _na     142_aa Serine acetyltransferase
804 CAJPRK010000008.1 GCA905373015_00406 CDS open 12702-12809 _na     35_aa hypothetical protein
805 CAJPRK010000008.1 GCA905373015_00407 CDS open 12793-14256 _na     487_aa Polysaccharide biosynthesis protein C-terminal domain-containing protein
806 CAJPRK010000008.1 GCA905373015_00408 CDS open 14523-15464 _na     313_aa Polysaccharide pyruvyl transferase domain-containing protein
807 CAJPRK010000008.1 GCA905373015_00409 CDS open 15472-16875 _na     467_aa Polysaccharide biosynthesis protein C-terminal domain-containing protein
808 CAJPRK010000008.1 GCA905373015_00410 CDS open 16896-18161 _na     421_aa UDP-glucose 6-dehydrogenase
809 CAJPRK010000008.1 GCA905373015_00411 CDS open 18580-20388 _na     602_aa tetrahydrofolate synthase
810 CAJPRK010000008.1 GCA905373015_00412 CDS open 20403-20723 _na     106_aa hypothetical protein
811 CAJPRK010000008.1 GCA905373015_00413 CDS open 21428-23113 _na     561_aa amyA Glucohydrolase
812 CAJPRK010000008.1 GCA905373015_00414 CDS open 23168-25219 _na     683_aa nagE PTS beta-glucoside transporter subunit IIABC
813 CAJPRK010000008.1 GCA905373015_00415 CDS open 25386-26117 _na     243_aa mngR Trehalose operon transcriptional repressor
814 CAJPRK010000008.1 GCA905373015_00416 CDS open 26492-27172 _na     226_aa dhaL dihydroxyacetone kinase subunit DhaL
815 CAJPRK010000008.1 GCA905373015_00417 CDS open 27258-27698 _na     146_aa ndk nucleoside-diphosphate kinase
816 CAJPRK010000008.1 GCA905373015_00418 CDS open 27827-29071 _na     414_aa natB ABC-2 family transporter protein
817 CAJPRK010000008.1 GCA905373015_00419 CDS open 29071-30018 _na     315_aa ATP-binding cassette domain-containing protein
818 CAJPRK010000008.1 GCA905373015_00420 CDS open 30051-33989 _na     1312_aa Chromosome partition protein Smc
819 CAJPRK010000008.1 GCA905373015_00421 CDS open 34160-34525 _na     121_aa Cell division protein DivIVA
820 CAJPRK010000008.1 GCA905373015_00422 CDS open 34887-36047 _na     386_aa ftsY signal recognition particle-docking protein FtsY
821 CAJPRK010000008.1 GCA905373015_00423 CDS open 36178-36789 _na     203_aa citB Two component system response regulator
822 CAJPRK010000008.1 GCA905373015_00424 CDS open 36868-38025 _na     385_aa Signal transduction histidine kinase subgroup 3 dimerisation and phosphoacceptor domain-containing protein
823 CAJPRK010000008.1 GCA905373015_00425 CDS open 38054-38923 _na     289_aa ABC-2 type transporter transmembrane domain-containing protein
824 CAJPRK010000008.1 GCA905373015_00426 CDS open 38920-39912 _na     330_aa ABC transporter domain-containing protein
825 CAJPRK010000008.1 GCA905373015_00427 CDS open 40285-41970 _na     561_aa ffh signal recognition particle protein
826 CAJPRK010000008.1 GCA905373015_00428 CDS open 41985-42596 _na     203_aa citB Response regulatory domain-containing protein
827 CAJPRK010000008.1 GCA905373015_00429 CDS open 42593-43813 _na     406_aa Histidine kinase
828 CAJPRK010000008.1 GCA905373015_00430 CDS open 43822-44706 _na     294_aa ABC transporter
829 CAJPRK010000008.1 GCA905373015_00431 CDS open 44757-45776 _na     339_aa rbbA Multidrug ABC transporter ATP-binding protein
830 CAJPRK010000008.1 GCA905373015_00432 CDS open 45890-47047 _na     385_aa Serine/arginine repetitive matrix protein 1
831 CAJPRK010000008.1 GCA905373015_00396 gene open 424-1173
832 CAJPRK010000008.1 GCA905373015_00397 gene open 1969-2910
833 CAJPRK010000008.1 GCA905373015_00398 gene open 3156-4502 yveK
834 CAJPRK010000008.1 GCA905373015_00399 gene open 5311-7236 flaA1
835 CAJPRK010000008.1 GCA905373015_00400 gene open 7233-8447
836 CAJPRK010000008.1 GCA905373015_00401 gene open 8444-9130
837 CAJPRK010000008.1 GCA905373015_00402 gene open 9162-9944 wcaA
838 CAJPRK010000008.1 GCA905373015_00403 gene open 10010-11161
839 CAJPRK010000008.1 GCA905373015_00404 gene open 11171-12277
840 CAJPRK010000008.1 GCA905373015_00405 gene open 12277-12705
841 CAJPRK010000008.1 GCA905373015_00406 gene open 12702-12809
842 CAJPRK010000008.1 GCA905373015_00407 gene open 12793-14256
843 CAJPRK010000008.1 GCA905373015_00408 gene open 14523-15464
844 CAJPRK010000008.1 GCA905373015_00409 gene open 15472-16875
845 CAJPRK010000008.1 GCA905373015_00410 gene open 16896-18161
846 CAJPRK010000008.1 GCA905373015_00411 gene open 18580-20388
847 CAJPRK010000008.1 GCA905373015_00412 gene open 20403-20723
848 CAJPRK010000008.1 GCA905373015_00413 gene open 21428-23113 amyA
849 CAJPRK010000008.1 GCA905373015_00414 gene open 23168-25219 nagE
850 CAJPRK010000008.1 GCA905373015_00415 gene open 25386-26117 mngR
851 CAJPRK010000008.1 GCA905373015_00416 gene open 26492-27172 dhaL
852 CAJPRK010000008.1 GCA905373015_00417 gene open 27258-27698 ndk
853 CAJPRK010000008.1 GCA905373015_00418 gene open 27827-29071 natB
854 CAJPRK010000008.1 GCA905373015_00419 gene open 29071-30018
855 CAJPRK010000008.1 GCA905373015_00420 gene open 30051-33989
856 CAJPRK010000008.1 GCA905373015_00421 gene open 34160-34525
857 CAJPRK010000008.1 GCA905373015_00422 gene open 34887-36047 ftsY
858 CAJPRK010000008.1 GCA905373015_00423 gene open 36178-36789 citB
859 CAJPRK010000008.1 GCA905373015_00424 gene open 36868-38025
860 CAJPRK010000008.1 GCA905373015_00425 gene open 38054-38923
861 CAJPRK010000008.1 GCA905373015_00426 gene open 38920-39912
862 CAJPRK010000008.1 GCA905373015_00427 gene open 40285-41970 ffh
863 CAJPRK010000008.1 GCA905373015_00428 gene open 41985-42596 citB
864 CAJPRK010000008.1 GCA905373015_00429 gene open 42593-43813
865 CAJPRK010000008.1 GCA905373015_00430 gene open 43822-44706
866 CAJPRK010000008.1 GCA905373015_00431 gene open 44757-45776 rbbA
867 CAJPRK010000008.1 GCA905373015_00432 gene open 45890-47047
868 CAJPRK010000009.1 GCA905373015_00433 CDS open 45-2153 _na     702_aa MFS transporter
869 CAJPRK010000009.1 GCA905373015_00434 CDS open 2150-3394 _na     414_aa Lipoprotein
870 CAJPRK010000009.1 GCA905373015_00435 CDS open 3414-5489 _na     691_aa Tat pathway signal sequence domain protein
871 CAJPRK010000009.1 GCA905373015_00436 CDS open 5486-6442 _na     318_aa Lipoprotein
872 CAJPRK010000009.1 GCA905373015_00437 CDS open 6519-8741 _na     740_aa MFS transporter
873 CAJPRK010000009.1 GCA905373015_00438 CDS open 8738-9952 _na     404_aa Lipoprotein
874 CAJPRK010000009.1 GCA905373015_00439 CDS open 9956-12229 _na     757_aa MFS transporter
875 CAJPRK010000009.1 GCA905373015_00440 CDS open 12226-13440 _na     404_aa Lipoprotein
876 CAJPRK010000009.1 GCA905373015_00441 CDS open 13465-15669 _na     734_aa Tat pathway signal sequence domain protein
877 CAJPRK010000009.1 GCA905373015_00442 CDS open 15676-16872 _na     398_aa lpqB Lipoprotein LpqB beta-propeller domain-containing protein
878 CAJPRK010000009.1 GCA905373015_00443 CDS open 17005-19227 _na     740_aa Tat pathway signal sequence domain protein
879 CAJPRK010000009.1 GCA905373015_00444 CDS open 19230-20432 _na     400_aa Tat pathway signal sequence domain protein
880 CAJPRK010000009.1 GCA905373015_00445 CDS open 20538-21521 _na     327_aa Ribokinase
881 CAJPRK010000009.1 GCA905373015_00446 CDS open 21551-22543 _na     330_aa HTH lacI-type domain-containing protein
882 CAJPRK010000009.1 GCA905373015_00447 CDS open 22595-24046 _na     483_aa MFS transporter
883 CAJPRK010000009.1 GCA905373015_00448 CDS open 24043-24993 _na     316_aa Ribonucleoside hydrolase
884 CAJPRK010000009.1 GCA905373015_00449 CDS open 25108-26010 _na     300_aa lysR HTH lysR-type domain-containing protein
885 CAJPRK010000009.1 GCA905373015_00450 CDS open 26102-27127 _na     341_aa Tryptophan synthase beta chain-like PALP domain-containing protein
886 CAJPRK010000009.1 GCA905373015_00451 CDS open 27577-32661 _na     1694_aa AMP-binding enzyme
887 CAJPRK010000009.1 GCA905373015_00452 CDS open 32658-37862 _na     1734_aa Carrier domain-containing protein
888 CAJPRK010000009.1 GCA905373015_00453 CDS open 37822-37992 _na     56_aa hypothetical protein
889 CAJPRK010000009.1 GCA905373015_00454 CDS open 38047-39189 _na     380_aa NAD dependent epimerase/dehydratase family
890 CAJPRK010000009.1 GCA905373015_00455 CDS open 39186-39965 _na     259_aa Thioesterase domain-containing protein
891 CAJPRK010000009.1 GCA905373015_00456 CDS open 39990-40688 _na     232_aa ABC transporter%2C ATP-binding protein
892 CAJPRK010000009.1 GCA905373015_00457 CDS open 40700-42940 _na     746_aa ABC3 transporter permease C-terminal domain-containing protein
893 CAJPRK010000009.1 GCA905373015_00458 CDS open 43060-43677 _na     205_aa hypothetical protein
894 CAJPRK010000009.1 GCA905373015_00459 CDS open 43781-44269 _na     162_aa DUF3995 domain-containing protein
895 CAJPRK010000009.1 GCA905373015_00460 CDS open 44458-44886 _na     142_aa dtd D-aminoacyl-tRNA deacylase
896 CAJPRK010000009.1 GCA905373015_00461 CDS open 44886-45275 _na     129_aa DUF2516 domain-containing protein
897 CAJPRK010000009.1 GCA905373015_00462 CDS open 45504-46622 _na     372_aa Aminomethyltransferase
898 CAJPRK010000009.1 GCA905373015_00433 gene open 45-2153
899 CAJPRK010000009.1 GCA905373015_00434 gene open 2150-3394
900 CAJPRK010000009.1 GCA905373015_00435 gene open 3414-5489
901 CAJPRK010000009.1 GCA905373015_00436 gene open 5486-6442
902 CAJPRK010000009.1 GCA905373015_00437 gene open 6519-8741
903 CAJPRK010000009.1 GCA905373015_00438 gene open 8738-9952
904 CAJPRK010000009.1 GCA905373015_00439 gene open 9956-12229
905 CAJPRK010000009.1 GCA905373015_00440 gene open 12226-13440
906 CAJPRK010000009.1 GCA905373015_00441 gene open 13465-15669
907 CAJPRK010000009.1 GCA905373015_00442 gene open 15676-16872 lpqB
908 CAJPRK010000009.1 GCA905373015_00443 gene open 17005-19227
909 CAJPRK010000009.1 GCA905373015_00444 gene open 19230-20432
910 CAJPRK010000009.1 GCA905373015_00445 gene open 20538-21521
911 CAJPRK010000009.1 GCA905373015_00446 gene open 21551-22543
912 CAJPRK010000009.1 GCA905373015_00447 gene open 22595-24046
913 CAJPRK010000009.1 GCA905373015_00448 gene open 24043-24993
914 CAJPRK010000009.1 GCA905373015_00449 gene open 25108-26010 lysR
915 CAJPRK010000009.1 GCA905373015_00450 gene open 26102-27127
916 CAJPRK010000009.1 GCA905373015_00451 gene open 27577-32661
917 CAJPRK010000009.1 GCA905373015_00452 gene open 32658-37862
918 CAJPRK010000009.1 GCA905373015_00453 gene open 37822-37992
919 CAJPRK010000009.1 GCA905373015_00454 gene open 38047-39189
920 CAJPRK010000009.1 GCA905373015_00455 gene open 39186-39965
921 CAJPRK010000009.1 GCA905373015_00456 gene open 39990-40688
922 CAJPRK010000009.1 GCA905373015_00457 gene open 40700-42940
923 CAJPRK010000009.1 GCA905373015_00458 gene open 43060-43677
924 CAJPRK010000009.1 GCA905373015_00459 gene open 43781-44269
925 CAJPRK010000009.1 GCA905373015_00460 gene open 44458-44886 dtd
926 CAJPRK010000009.1 GCA905373015_00461 gene open 44886-45275
927 CAJPRK010000009.1 GCA905373015_00462 gene open 45504-46622
928 CAJPRK010000010.1 regulatory_region open 37014-37164 FMN riboswitch aptamer (RFN element)
929 CAJPRK010000010.1 GCA905373015_00463 CDS open 46-930 _na     294_aa pyrF orotidine-5'-phosphate decarboxylase
930 CAJPRK010000010.1 GCA905373015_00464 CDS open 1083-1394 _na     103_aa Integration host factor-like helix-two turn-helix domain-containing protein
931 CAJPRK010000010.1 GCA905373015_00465 CDS open 1434-2045 _na     203_aa gmk guanylate kinase
932 CAJPRK010000010.1 GCA905373015_00466 CDS open 2091-2489 _na     132_aa rpoZ DNA-directed RNA polymerase subunit omega
933 CAJPRK010000010.1 GCA905373015_00467 CDS open 2502-3839 _na     445_aa coaBC bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC
934 CAJPRK010000010.1 GCA905373015_00468 CDS open 3909-5114 _na     401_aa metK methionine adenosyltransferase
935 CAJPRK010000010.1 GCA905373015_00469 CDS open 5154-7301 _na     715_aa putative primosomal protein N'
936 CAJPRK010000010.1 GCA905373015_00470 CDS open 7348-8010 _na     220_aa tetR TetR family transcriptional regulator
937 CAJPRK010000010.1 GCA905373015_00471 CDS open 8213-9571 _na     452_aa Major facilitator superfamily (MFS) profile domain-containing protein
938 CAJPRK010000010.1 GCA905373015_00472 CDS open 9701-10714 _na     337_aa eamA EamA family transporter
939 CAJPRK010000010.1 GCA905373015_00473 CDS open 10902-12029 _na     375_aa Inosamine-phosphate amidinotransferase 1
940 CAJPRK010000010.1 GCA905373015_00474 CDS open 12239-13219 _na     326_aa arcC carbamate kinase
941 CAJPRK010000010.1 GCA905373015_00475 CDS open 13223-14230 _na     335_aa argF ornithine carbamoyltransferase
942 CAJPRK010000010.1 GCA905373015_00476 CDS open 14296-15519 _na     407_aa arcA Arginine deiminase
943 CAJPRK010000010.1 GCA905373015_00477 CDS open 15865-16545 _na     226_aa Haloacid dehalogenase
944 CAJPRK010000010.1 GCA905373015_00478 CDS open 16585-17559 _na     324_aa fmt methionyl-tRNA formyltransferase
945 CAJPRK010000010.1 GCA905373015_00479 CDS open 17559-19166 _na     535_aa Methyltransferase
946 CAJPRK010000010.1 GCA905373015_00480 CDS open 19205-19900 _na     231_aa rpe ribulose-phosphate 3-epimerase
947 CAJPRK010000010.1 GCA905373015_00481 CDS open 20305-22140 _na     611_aa biotin carboxylase
948 CAJPRK010000010.1 GCA905373015_00482 CDS open 22144-23775 _na     543_aa mmdA Propionyl-CoA carboxylase subunit beta
949 CAJPRK010000010.1 GCA905373015_00483 CDS open 23900-33352 _na     3150_aa 3-oxoacyl-[acyl-carrier-protein] synthase 2
950 CAJPRK010000010.1 GCA905373015_00484 CDS open 33490-33996 _na     168_aa holo-ACP synthase
951 CAJPRK010000010.1 GCA905373015_00485 CDS open 34257-35750 _na     497_aa putP sodium/proline symporter PutP
952 CAJPRK010000010.1 GCA905373015_00486 CDS open 35782-36936 _na     384_aa Glycerate kinase
953 CAJPRK010000010.1 GCA905373015_00487 CDS open 37347-38294 _na     315_aa tauC Hydrogenase
954 CAJPRK010000010.1 GCA905373015_00488 CDS open 38347-39393 _na     348_aa tauA Myristoyl transferase
955 CAJPRK010000010.1 GCA905373015_00489 CDS open 39428-40081 _na     217_aa soxR HTH merR-type domain-containing protein
956 CAJPRK010000010.1 GCA905373015_00490 CDS open 40433-41800 _na     455_aa araJ Major facilitator superfamily (MFS) profile domain-containing protein
957 CAJPRK010000010.1 GCA905373015_00491 CDS open 41777-42622 _na     281_aa hisG ATP phosphoribosyltransferase
958 CAJPRK010000010.1 GCA905373015_00492 CDS open 42681-42944 _na     87_aa phosphoribosyl-ATP diphosphatase
959 CAJPRK010000010.1 GCA905373015_00463 gene open 46-930 pyrF
960 CAJPRK010000010.1 GCA905373015_00464 gene open 1083-1394
961 CAJPRK010000010.1 GCA905373015_00465 gene open 1434-2045 gmk
962 CAJPRK010000010.1 GCA905373015_00466 gene open 2091-2489 rpoZ
963 CAJPRK010000010.1 GCA905373015_00467 gene open 2502-3839 coaBC
964 CAJPRK010000010.1 GCA905373015_00468 gene open 3909-5114 metK
965 CAJPRK010000010.1 GCA905373015_00469 gene open 5154-7301
966 CAJPRK010000010.1 GCA905373015_00470 gene open 7348-8010 tetR
967 CAJPRK010000010.1 GCA905373015_00471 gene open 8213-9571
968 CAJPRK010000010.1 GCA905373015_00472 gene open 9701-10714 eamA
969 CAJPRK010000010.1 GCA905373015_00473 gene open 10902-12029
970 CAJPRK010000010.1 GCA905373015_00474 gene open 12239-13219 arcC
971 CAJPRK010000010.1 GCA905373015_00475 gene open 13223-14230 argF
972 CAJPRK010000010.1 GCA905373015_00476 gene open 14296-15519 arcA
973 CAJPRK010000010.1 GCA905373015_00477 gene open 15865-16545
974 CAJPRK010000010.1 GCA905373015_00478 gene open 16585-17559 fmt
975 CAJPRK010000010.1 GCA905373015_00479 gene open 17559-19166
976 CAJPRK010000010.1 GCA905373015_00480 gene open 19205-19900 rpe
977 CAJPRK010000010.1 GCA905373015_00481 gene open 20305-22140
978 CAJPRK010000010.1 GCA905373015_00482 gene open 22144-23775 mmdA
979 CAJPRK010000010.1 GCA905373015_00483 gene open 23900-33352
980 CAJPRK010000010.1 GCA905373015_00484 gene open 33490-33996
981 CAJPRK010000010.1 GCA905373015_00485 gene open 34257-35750 putP
982 CAJPRK010000010.1 GCA905373015_00486 gene open 35782-36936
983 CAJPRK010000010.1 GCA905373015_00487 gene open 37347-38294 tauC
984 CAJPRK010000010.1 GCA905373015_00488 gene open 38347-39393 tauA
985 CAJPRK010000010.1 GCA905373015_00489 gene open 39428-40081 soxR
986 CAJPRK010000010.1 GCA905373015_00490 gene open 40433-41800 araJ
987 CAJPRK010000010.1 GCA905373015_00491 gene open 41777-42622 hisG
988 CAJPRK010000010.1 GCA905373015_00492 gene open 42681-42944
989 CAJPRK010000011.1 GCA905373015_00493 CDS open 129-659 _na     176_aa diacylglycerol/lipid kinase family protein
990 CAJPRK010000011.1 GCA905373015_00494 CDS open 711-2126 _na     471_aa Peptidase M20 domain-containing protein 2
991 CAJPRK010000011.1 GCA905373015_00495 CDS open 2419-3984 _na     521_aa Major facilitator superfamily (MFS) profile domain-containing protein
992 CAJPRK010000011.1 GCA905373015_00496 CDS open 3981-7172 _na     1063_aa lacZ Beta-galactosidase
993 CAJPRK010000011.1 GCA905373015_00497 CDS open 7422-8408 _na     328_aa purR HTH lacI-type domain-containing protein
994 CAJPRK010000011.1 GCA905373015_00498 CDS open 8637-9494 _na     285_aa Suppressor of fused protein (SUFU)
995 CAJPRK010000011.1 GCA905373015_00499 CDS open 9491-10906 _na     471_aa LssY-like C-terminal domain-containing protein
996 CAJPRK010000011.1 GCA905373015_00500 CDS open 11073-11801 _na     242_aa Lipoprotein
997 CAJPRK010000011.1 GCA905373015_00501 CDS open 11913-12887 _na     324_aa nrdF class 1b ribonucleoside-diphosphate reductase subunit beta
998 CAJPRK010000011.1 GCA905373015_00502 CDS open 13044-13832 _na     262_aa hypothetical protein
999 CAJPRK010000011.1 GCA905373015_00503 CDS open 14066-15013 _na     315_aa Tat pathway signal sequence
1000 CAJPRK010000011.1 GCA905373015_00504 CDS open 15095-16033 _na     312_aa GerMN domain-containing protein