HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Actinomyces oris clade-144 (GCA_905373015.1)

Select a Genome:
BAKTA Annotations for GCA_905373015.1
Genome Selected: Actinomyces oris clade-144
ContigsBases CDSrRNA tmRNAtRNA
181 3114517 2597 0 1 48
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 5320 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:6]    |    Number of Records Found: 5320 [11 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  11  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
2501 CAJPRK010000036.1 GCA905373015_01246 gene open 16760-17065
2502 CAJPRK010000036.1 GCA905373015_01247 gene open 17404-18864 sepH
2503 CAJPRK010000036.1 GCA905373015_01248 gene open 18890-20218
2504 CAJPRK010000036.1 GCA905373015_01249 gene open 20230-20859
2505 CAJPRK010000036.1 GCA905373015_01250 gene open 21001-23547 gyrA
2506 CAJPRK010000036.1 GCA905373015_01251 gene open 23614-25257
2507 CAJPRK010000037.1 regulatory_region open 10123-10181 msiK RNA
2508 CAJPRK010000037.1 GCA905373015_01252 CDS open 171-1517 _na     448_aa Serpin
2509 CAJPRK010000037.1 GCA905373015_01253 CDS open 1826-3190 _na     454_aa PAS domain S-box protein
2510 CAJPRK010000037.1 GCA905373015_01254 CDS open 3199-4425 _na     408_aa 23S rRNA methyluridine methyltransferase
2511 CAJPRK010000037.1 GCA905373015_01256 CDS open 4756-5673 _na     305_aa thioredoxin domain-containing protein
2512 CAJPRK010000037.1 GCA905373015_01257 CDS open 5915-6217 _na     100_aa hypothetical protein
2513 CAJPRK010000037.1 GCA905373015_01258 CDS open 6214-6372 _na     52_aa hypothetical protein
2514 CAJPRK010000037.1 GCA905373015_01259 CDS open 7053-7655 _na     200_aa DUF4870 domain-containing protein
2515 CAJPRK010000037.1 GCA905373015_01260 CDS open 7750-9801 _na     683_aa non-specific serine/threonine protein kinase
2516 CAJPRK010000037.1 GCA905373015_01261 CDS open 10185-11312 _na     375_aa malK ABC transporter domain-containing protein
2517 CAJPRK010000037.1 GCA905373015_01262 CDS open 11495-12871 _na     458_aa DUF4032 domain-containing protein
2518 CAJPRK010000037.1 GCA905373015_01263 CDS open 12976-13455 _na     159_aa hypothetical protein
2519 CAJPRK010000037.1 GCA905373015_01264 CDS open 13496-13960 _na     154_aa Serine/threonine protein kinase
2520 CAJPRK010000037.1 GCA905373015_01265 CDS open 14136-14858 _na     240_aa hypothetical protein
2521 CAJPRK010000037.1 GCA905373015_01266 CDS open 15106-16398 _na     430_aa IS1634 family transposase
2522 CAJPRK010000037.1 GCA905373015_01267 CDS open 16391-17203 _na     270_aa IS1634 family transposase
2523 CAJPRK010000037.1 GCA905373015_01268 CDS open 17278-17934 _na     218_aa Transposase
2524 CAJPRK010000037.1 GCA905373015_01269 CDS open 18038-18367 _na     109_aa Transposase%2C IS4-like family protein
2525 CAJPRK010000037.1 GCA905373015_01270 CDS open 19111-20046 _na     311_aa hypothetical protein
2526 CAJPRK010000037.1 GCA905373015_01271 CDS open 20036-20989 _na     317_aa hypothetical protein
2527 CAJPRK010000037.1 GCA905373015_01272 CDS open 21022-22263 _na     413_aa Tat pathway signal sequence domain protein
2528 CAJPRK010000037.1 GCA905373015_01273 CDS open 22426-23424 _na     332_aa rlmB 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB
2529 CAJPRK010000037.1 GCA905373015_01274 CDS open 23488-25005 _na     505_aa cysS cysteine--tRNA ligase
2530 CAJPRK010000037.1 GCA905373015_01252 gene open 171-1517
2531 CAJPRK010000037.1 GCA905373015_01253 gene open 1826-3190
2532 CAJPRK010000037.1 GCA905373015_01254 gene open 3199-4425
2533 CAJPRK010000037.1 GCA905373015_01256 gene open 4756-5673
2534 CAJPRK010000037.1 GCA905373015_01257 gene open 5915-6217
2535 CAJPRK010000037.1 GCA905373015_01258 gene open 6214-6372
2536 CAJPRK010000037.1 GCA905373015_01259 gene open 7053-7655
2537 CAJPRK010000037.1 GCA905373015_01260 gene open 7750-9801
2538 CAJPRK010000037.1 GCA905373015_01261 gene open 10185-11312 malK
2539 CAJPRK010000037.1 GCA905373015_01262 gene open 11495-12871
2540 CAJPRK010000037.1 GCA905373015_01263 gene open 12976-13455
2541 CAJPRK010000037.1 GCA905373015_01264 gene open 13496-13960
2542 CAJPRK010000037.1 GCA905373015_01265 gene open 14136-14858
2543 CAJPRK010000037.1 GCA905373015_01266 gene open 15106-16398
2544 CAJPRK010000037.1 GCA905373015_01267 gene open 16391-17203
2545 CAJPRK010000037.1 GCA905373015_01268 gene open 17278-17934
2546 CAJPRK010000037.1 GCA905373015_01269 gene open 18038-18367
2547 CAJPRK010000037.1 GCA905373015_01270 gene open 19111-20046
2548 CAJPRK010000037.1 GCA905373015_01271 gene open 20036-20989
2549 CAJPRK010000037.1 GCA905373015_01272 gene open 21022-22263
2550 CAJPRK010000037.1 GCA905373015_01273 gene open 22426-23424 rlmB
2551 CAJPRK010000037.1 GCA905373015_01274 gene open 23488-25005 cysS
2552 CAJPRK010000037.1 GCA905373015_01255 gene open 4514-4589 trnT
2553 CAJPRK010000037.1 GCA905373015_01255 tRNA open 4514-4589 trnT tRNA-Thr(tgt)
2554 CAJPRK010000038.1 GCA905373015_01275 CDS open 34-897 _na     287_aa Thioredoxin domain-containing protein
2555 CAJPRK010000038.1 GCA905373015_01276 CDS open 1198-1695 _na     165_aa fluC Fluoride-specific ion channel FluC
2556 CAJPRK010000038.1 GCA905373015_01277 CDS open 1692-2369 _na     225_aa fluC Fluoride-specific ion channel FluC
2557 CAJPRK010000038.1 GCA905373015_01278 CDS open 2362-4044 _na     560_aa DUF2079 domain-containing protein
2558 CAJPRK010000038.1 GCA905373015_01279 CDS open 4125-5591 _na     488_aa ansP Amino acid permease/ SLC12A domain-containing protein
2559 CAJPRK010000038.1 GCA905373015_01280 CDS open 5588-6454 _na     288_aa Inositol-1-monophosphatase
2560 CAJPRK010000038.1 GCA905373015_01281 CDS open 6601-8460 _na     619_aa Peptidase S33 tripeptidyl aminopeptidase-like C-terminal domain-containing protein
2561 CAJPRK010000038.1 GCA905373015_01282 CDS open 8841-9545 _na     234_aa Response regulator transcription factor
2562 CAJPRK010000038.1 GCA905373015_01283 CDS open 9542-10207 _na     221_aa sensor histidine kinase
2563 CAJPRK010000038.1 GCA905373015_01284 CDS open 10997-11752 _na     251_aa mpaM daptide-type RiPP biosynthesis methyltransferase
2564 CAJPRK010000038.1 GCA905373015_01285 CDS open 12204-13157 _na     317_aa ABC transporter ATP-binding protein
2565 CAJPRK010000038.1 GCA905373015_01286 CDS open 13189-14025 _na     278_aa ABC transporter permease subunit
2566 CAJPRK010000038.1 GCA905373015_01287 CDS open 14357-16276 _na     639_aa asparagine synthase (glutamine-hydrolyzing)
2567 CAJPRK010000038.1 GCA905373015_01288 CDS open 16308-16556 _na     82_aa pqqD PqqD family protein
2568 CAJPRK010000038.1 GCA905373015_01289 CDS open 16556-16660 _na     34_aa hypothetical protein
2569 CAJPRK010000038.1 GCA905373015_01290 CDS open 16735-16863 _na     42_aa Lasso RiPP family leader peptide-containing protein
2570 CAJPRK010000038.1 GCA905373015_01291 CDS open 16921-17043 _na     40_aa Lasso RiPP family leader peptide-containing protein
2571 CAJPRK010000038.1 GCA905373015_01292 CDS open 17163-18068 _na     301_aa ABC transporter ATP-binding protein
2572 CAJPRK010000038.1 GCA905373015_01293 CDS open 18065-19033 _na     322_aa ABC-2 type transporter transmembrane domain-containing protein
2573 CAJPRK010000038.1 GCA905373015_01294 CDS open 19030-19947 _na     305_aa ABC transporter ATP-binding protein
2574 CAJPRK010000038.1 GCA905373015_01295 CDS open 20013-20732 _na     239_aa ABC transporter permease
2575 CAJPRK010000038.1 GCA905373015_01296 CDS open 20736-21482 _na     248_aa ABC transporter permease
2576 CAJPRK010000038.1 GCA905373015_01297 CDS open 21571-21996 _na     141_aa Lasso peptide biosynthesis B2 protein
2577 CAJPRK010000038.1 GCA905373015_01298 CDS open 22049-24769 _na     906_aa TIGR00374 family protein
2578 CAJPRK010000038.1 GCA905373015_01275 gene open 34-897
2579 CAJPRK010000038.1 GCA905373015_01276 gene open 1198-1695 fluC
2580 CAJPRK010000038.1 GCA905373015_01277 gene open 1692-2369 fluC
2581 CAJPRK010000038.1 GCA905373015_01278 gene open 2362-4044
2582 CAJPRK010000038.1 GCA905373015_01279 gene open 4125-5591 ansP
2583 CAJPRK010000038.1 GCA905373015_01280 gene open 5588-6454
2584 CAJPRK010000038.1 GCA905373015_01281 gene open 6601-8460
2585 CAJPRK010000038.1 GCA905373015_01282 gene open 8841-9545
2586 CAJPRK010000038.1 GCA905373015_01283 gene open 9542-10207
2587 CAJPRK010000038.1 GCA905373015_01284 gene open 10997-11752 mpaM
2588 CAJPRK010000038.1 GCA905373015_01285 gene open 12204-13157
2589 CAJPRK010000038.1 GCA905373015_01286 gene open 13189-14025
2590 CAJPRK010000038.1 GCA905373015_01287 gene open 14357-16276
2591 CAJPRK010000038.1 GCA905373015_01288 gene open 16308-16556 pqqD
2592 CAJPRK010000038.1 GCA905373015_01289 gene open 16556-16660
2593 CAJPRK010000038.1 GCA905373015_01290 gene open 16735-16863
2594 CAJPRK010000038.1 GCA905373015_01291 gene open 16921-17043
2595 CAJPRK010000038.1 GCA905373015_01292 gene open 17163-18068
2596 CAJPRK010000038.1 GCA905373015_01293 gene open 18065-19033
2597 CAJPRK010000038.1 GCA905373015_01294 gene open 19030-19947
2598 CAJPRK010000038.1 GCA905373015_01295 gene open 20013-20732
2599 CAJPRK010000038.1 GCA905373015_01296 gene open 20736-21482
2600 CAJPRK010000038.1 GCA905373015_01297 gene open 21571-21996
2601 CAJPRK010000038.1 GCA905373015_01298 gene open 22049-24769
2602 CAJPRK010000039.1 GCA905373015_01299 CDS open 358-1608 _na     416_aa rfe Glycosyltransferase%2C group 4 family
2603 CAJPRK010000039.1 GCA905373015_01300 CDS open 1605-2066 _na     153_aa Pseudouridine synthase
2604 CAJPRK010000039.1 GCA905373015_01301 CDS open 2327-3148 _na     273_aa atpB F0F1 ATP synthase subunit A
2605 CAJPRK010000039.1 GCA905373015_01302 CDS open 3225-3431 _na     68_aa atpE ATP synthase F0 subunit C
2606 CAJPRK010000039.1 GCA905373015_01303 CDS open 3431-4021 _na     196_aa F0F1 ATP synthase subunit B
2607 CAJPRK010000039.1 GCA905373015_01304 CDS open 4018-4833 _na     271_aa ATP synthase subunit delta
2608 CAJPRK010000039.1 GCA905373015_01305 CDS open 4939-6570 _na     543_aa atpA F0F1 ATP synthase subunit alpha
2609 CAJPRK010000039.1 GCA905373015_01306 CDS open 6572-7519 _na     315_aa atpG F0F1 ATP synthase subunit gamma
2610 CAJPRK010000039.1 GCA905373015_01307 CDS open 7613-9049 _na     478_aa atpD F0F1 ATP synthase subunit beta
2611 CAJPRK010000039.1 GCA905373015_01308 CDS open 9101-9367 _na     88_aa atpC F0F1 ATP synthase subunit epsilon
2612 CAJPRK010000039.1 GCA905373015_01309 CDS open 9371-9787 _na     138_aa DUF2550 domain-containing protein
2613 CAJPRK010000039.1 GCA905373015_01310 CDS open 10186-13362 _na     1058_aa drmD DISARM system SNF2-like helicase DrmD
2614 CAJPRK010000039.1 GCA905373015_01311 CDS open 13778-14239 _na     153_aa hypothetical protein
2615 CAJPRK010000039.1 GCA905373015_01312 CDS open 14621-17641 _na     1006_aa site-specific DNA-methyltransferase (adenine-specific)
2616 CAJPRK010000039.1 GCA905373015_01313 CDS open 17631-21521 _na     1296_aa drmA DISARM system helicase DrmA
2617 CAJPRK010000039.1 GCA905373015_01314 CDS open 21518-23668 _na     716_aa MrfA-like Zn-binding domain-containing protein
2618 CAJPRK010000039.1 GCA905373015_01315 CDS open 23678-24490 _na     270_aa drmC DISARM system phospholipase D-like protein DrmC
2619 CAJPRK010000039.1 GCA905373015_01299 gene open 358-1608 rfe
2620 CAJPRK010000039.1 GCA905373015_01300 gene open 1605-2066
2621 CAJPRK010000039.1 GCA905373015_01301 gene open 2327-3148 atpB
2622 CAJPRK010000039.1 GCA905373015_01302 gene open 3225-3431 atpE
2623 CAJPRK010000039.1 GCA905373015_01303 gene open 3431-4021
2624 CAJPRK010000039.1 GCA905373015_01304 gene open 4018-4833
2625 CAJPRK010000039.1 GCA905373015_01305 gene open 4939-6570 atpA
2626 CAJPRK010000039.1 GCA905373015_01306 gene open 6572-7519 atpG
2627 CAJPRK010000039.1 GCA905373015_01307 gene open 7613-9049 atpD
2628 CAJPRK010000039.1 GCA905373015_01308 gene open 9101-9367 atpC
2629 CAJPRK010000039.1 GCA905373015_01309 gene open 9371-9787
2630 CAJPRK010000039.1 GCA905373015_01310 gene open 10186-13362 drmD
2631 CAJPRK010000039.1 GCA905373015_01311 gene open 13778-14239
2632 CAJPRK010000039.1 GCA905373015_01312 gene open 14621-17641
2633 CAJPRK010000039.1 GCA905373015_01313 gene open 17631-21521 drmA
2634 CAJPRK010000039.1 GCA905373015_01314 gene open 21518-23668
2635 CAJPRK010000039.1 GCA905373015_01315 gene open 23678-24490 drmC
2636 CAJPRK010000040.1 regulatory_region open 18795-18884 ZMP/ZTP riboswitch aptamer (pfl RNA motif)
2637 CAJPRK010000040.1 GCA905373015_01316 CDS open 264-1313 _na     349_aa Tat pathway signal protein
2638 CAJPRK010000040.1 GCA905373015_01317 CDS open 1310-3085 _na     591_aa Glycosyltransferase
2639 CAJPRK010000040.1 GCA905373015_01318 CDS open 3226-3396 _na     56_aa hypothetical protein
2640 CAJPRK010000040.1 GCA905373015_01319 CDS open 3548-5176 _na     542_aa Cell division protein DivIVA
2641 CAJPRK010000040.1 GCA905373015_01320 CDS open 5186-5677 _na     163_aa sseB SseB protein N-terminal domain-containing protein
2642 CAJPRK010000040.1 GCA905373015_01321 CDS open 5721-6011 _na     96_aa ATP/GTP-binding protein
2643 CAJPRK010000040.1 GCA905373015_01322 CDS open 6116-6970 _na     284_aa ugpE ABC transmembrane type-1 domain-containing protein
2644 CAJPRK010000040.1 GCA905373015_01323 CDS open 6977-7906 _na     309_aa ugpA ABC transmembrane type-1 domain-containing protein
2645 CAJPRK010000040.1 GCA905373015_01324 CDS open 8049-9368 _na     439_aa ugpB putative sugar-binding periplasmic protein
2646 CAJPRK010000040.1 GCA905373015_01325 CDS open 9756-10742 _na     328_aa mdh malate dehydrogenase
2647 CAJPRK010000040.1 GCA905373015_01326 CDS open 10997-12823 _na     608_aa ABC transporter ATP-binding protein
2648 CAJPRK010000040.1 GCA905373015_01327 CDS open 12820-14673 _na     617_aa cydC Thiol reductant ABC exporter%2C CydC subunit
2649 CAJPRK010000040.1 GCA905373015_01328 CDS open 14774-16339 _na     521_aa gltP Sodium:proton antiporter
2650 CAJPRK010000040.1 GCA905373015_01329 CDS open 16520-16819 _na     99_aa DUF3017 domain-containing protein
2651 CAJPRK010000040.1 GCA905373015_01330 CDS open 16928-18769 _na     613_aa purH bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase
2652 CAJPRK010000040.1 GCA905373015_01331 CDS open 19032-21527 _na     831_aa Tat pathway signal sequence domain protein
2653 CAJPRK010000040.1 GCA905373015_01332 CDS open 21828-23105 _na     425_aa Beta-carotene 15%2C15'-monooxygenase
2654 CAJPRK010000040.1 GCA905373015_01333 CDS open 23102-24043 _na     313_aa sucD succinate--CoA ligase subunit alpha
2655 CAJPRK010000040.1 GCA905373015_01334 CDS open 24047-24505 _na     152_aa ATP-citrate synthase/succinyl-CoA ligase C-terminal domain-containing protein
2656 CAJPRK010000040.1 GCA905373015_01316 gene open 264-1313
2657 CAJPRK010000040.1 GCA905373015_01317 gene open 1310-3085
2658 CAJPRK010000040.1 GCA905373015_01318 gene open 3226-3396
2659 CAJPRK010000040.1 GCA905373015_01319 gene open 3548-5176
2660 CAJPRK010000040.1 GCA905373015_01320 gene open 5186-5677 sseB
2661 CAJPRK010000040.1 GCA905373015_01321 gene open 5721-6011
2662 CAJPRK010000040.1 GCA905373015_01322 gene open 6116-6970 ugpE
2663 CAJPRK010000040.1 GCA905373015_01323 gene open 6977-7906 ugpA
2664 CAJPRK010000040.1 GCA905373015_01324 gene open 8049-9368 ugpB
2665 CAJPRK010000040.1 GCA905373015_01325 gene open 9756-10742 mdh
2666 CAJPRK010000040.1 GCA905373015_01326 gene open 10997-12823
2667 CAJPRK010000040.1 GCA905373015_01327 gene open 12820-14673 cydC
2668 CAJPRK010000040.1 GCA905373015_01328 gene open 14774-16339 gltP
2669 CAJPRK010000040.1 GCA905373015_01329 gene open 16520-16819
2670 CAJPRK010000040.1 GCA905373015_01330 gene open 16928-18769 purH
2671 CAJPRK010000040.1 GCA905373015_01331 gene open 19032-21527
2672 CAJPRK010000040.1 GCA905373015_01332 gene open 21828-23105
2673 CAJPRK010000040.1 GCA905373015_01333 gene open 23102-24043 sucD
2674 CAJPRK010000040.1 GCA905373015_01334 gene open 24047-24505
2675 CAJPRK010000041.1 regulatory_region open 9318-9406 TPP riboswitch aptamer (THI element)
2676 CAJPRK010000041.1 GCA905373015_01335 CDS open 447-1499 _na     350_aa rimI N-acetyltransferase domain-containing protein
2677 CAJPRK010000041.1 GCA905373015_01336 CDS open 1630-3882 _na     750_aa gyrB DNA topoisomerase (ATP-hydrolyzing)
2678 CAJPRK010000041.1 GCA905373015_01337 CDS open 3982-4323 _na     113_aa hypothetical protein
2679 CAJPRK010000041.1 GCA905373015_01338 CDS open 4271-4759 _na     162_aa hypothetical protein
2680 CAJPRK010000041.1 GCA905373015_01339 CDS open 4953-5216 _na     87_aa ClpX-type ZB domain-containing protein
2681 CAJPRK010000041.1 GCA905373015_01340 CDS open 5459-5848 _na     129_aa Rhodanese
2682 CAJPRK010000041.1 GCA905373015_01341 CDS open 5896-6798 _na     300_aa speB Arginase
2683 CAJPRK010000041.1 GCA905373015_01342 CDS open 7003-7830 _na     275_aa thiD Bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase
2684 CAJPRK010000041.1 GCA905373015_01343 CDS open 7827-8489 _na     220_aa thiE Thiamine-phosphate synthase
2685 CAJPRK010000041.1 GCA905373015_01344 CDS open 8486-9328 _na     280_aa thiM hydroxyethylthiazole kinase
2686 CAJPRK010000041.1 GCA905373015_01345 CDS open 9513-11159 _na     548_aa rpoD RNA polymerase sigma factor
2687 CAJPRK010000041.1 GCA905373015_01346 CDS open 11384-12544 _na     386_aa Geranylgeranyl pyrophosphate synthase
2688 CAJPRK010000041.1 GCA905373015_01347 CDS open 12719-14671 _na     650_aa pknB Stk1 family PASTA domain-containing Ser/Thr kinase
2689 CAJPRK010000041.1 GCA905373015_01348 CDS open 14749-16098 _na     449_aa aroG2 class II 3-deoxy-7-phosphoheptulonate synthase
2690 CAJPRK010000041.1 GCA905373015_01349 CDS open 16371-17600 _na     409_aa pyrophosphate--fructose-6-phosphate 1-phosphotransferase
2691 CAJPRK010000041.1 GCA905373015_01350 CDS open 17641-22155 _na     1504_aa hypothetical protein
2692 CAJPRK010000041.1 GCA905373015_01351 CDS open 22290-23168 _na     292_aa plsC Phospholipid/glycerol acyltransferase domain-containing protein
2693 CAJPRK010000041.1 GCA905373015_01352 CDS open 23345-23629 _na     94_aa hypothetical protein
2694 CAJPRK010000041.1 GCA905373015_01335 gene open 447-1499 rimI
2695 CAJPRK010000041.1 GCA905373015_01336 gene open 1630-3882 gyrB
2696 CAJPRK010000041.1 GCA905373015_01337 gene open 3982-4323
2697 CAJPRK010000041.1 GCA905373015_01338 gene open 4271-4759
2698 CAJPRK010000041.1 GCA905373015_01339 gene open 4953-5216
2699 CAJPRK010000041.1 GCA905373015_01340 gene open 5459-5848
2700 CAJPRK010000041.1 GCA905373015_01341 gene open 5896-6798 speB
2701 CAJPRK010000041.1 GCA905373015_01342 gene open 7003-7830 thiD
2702 CAJPRK010000041.1 GCA905373015_01343 gene open 7827-8489 thiE
2703 CAJPRK010000041.1 GCA905373015_01344 gene open 8486-9328 thiM
2704 CAJPRK010000041.1 GCA905373015_01345 gene open 9513-11159 rpoD
2705 CAJPRK010000041.1 GCA905373015_01346 gene open 11384-12544
2706 CAJPRK010000041.1 GCA905373015_01347 gene open 12719-14671 pknB
2707 CAJPRK010000041.1 GCA905373015_01348 gene open 14749-16098 aroG2
2708 CAJPRK010000041.1 GCA905373015_01349 gene open 16371-17600
2709 CAJPRK010000041.1 GCA905373015_01350 gene open 17641-22155
2710 CAJPRK010000041.1 GCA905373015_01351 gene open 22290-23168 plsC
2711 CAJPRK010000041.1 GCA905373015_01352 gene open 23345-23629
2712 CAJPRK010000042.1 GCA905373015_01353 CDS open 109-459 _na     116_aa fdxA ferredoxin
2713 CAJPRK010000042.1 GCA905373015_01354 CDS open 881-985 _na     34_aa hypothetical protein
2714 CAJPRK010000042.1 GCA905373015_01355 CDS open 986-2305 _na     439_aa Putative membrane protein
2715 CAJPRK010000042.1 GCA905373015_01356 CDS open 2473-5100 _na     875_aa Transcriptional initiation protein Tat
2716 CAJPRK010000042.1 GCA905373015_01357 CDS open 5116-7038 _na     640_aa typA translational GTPase TypA
2717 CAJPRK010000042.1 GCA905373015_01358 CDS open 7207-7950 _na     247_aa PH domain-containing protein
2718 CAJPRK010000042.1 GCA905373015_01359 CDS open 7947-9836 _na     629_aa nikD nickel import ATP-binding protein NikD
2719 CAJPRK010000042.1 GCA905373015_01360 CDS open 9833-10831 _na     332_aa dppC ABC transmembrane type-1 domain-containing protein
2720 CAJPRK010000042.1 GCA905373015_01361 CDS open 10824-11753 _na     309_aa dppB ABC transmembrane type-1 domain-containing protein
2721 CAJPRK010000042.1 GCA905373015_01362 CDS open 11768-13393 _na     541_aa oppA Solute-binding protein family 5 domain-containing protein
2722 CAJPRK010000042.1 GCA905373015_01363 CDS open 13558-14673 _na     371_aa LLM class flavin-dependent oxidoreductase
2723 CAJPRK010000042.1 GCA905373015_01364 CDS open 14789-15376 _na     195_aa Biotin transporter
2724 CAJPRK010000042.1 GCA905373015_01365 CDS open 15508-16533 _na     341_aa alpha/beta fold hydrolase
2725 CAJPRK010000042.1 GCA905373015_01366 CDS open 16914-17480 _na     188_aa NUDIX hydrolase
2726 CAJPRK010000042.1 GCA905373015_01367 CDS open 17483-18319 _na     278_aa Patatin family protein
2727 CAJPRK010000042.1 GCA905373015_01368 CDS open 18629-19744 _na     371_aa fadH NADH:flavin oxidoreductase/NADH oxidase N-terminal domain-containing protein
2728 CAJPRK010000042.1 GCA905373015_01369 CDS open 19785-20240 _na     151_aa ychJ UPF0225 protein FBF36_10920
2729 CAJPRK010000042.1 GCA905373015_01370 CDS open 20243-21628 _na     461_aa lAP4 M18 family aminopeptidase
2730 CAJPRK010000042.1 GCA905373015_01371 CDS open 21711-22364 _na     217_aa Hydrolase
2731 CAJPRK010000042.1 GCA905373015_01372 CDS open 22461-23024 _na     187_aa GtrA/DPMS transmembrane domain-containing protein
2732 CAJPRK010000042.1 GCA905373015_01373 CDS open 23283-23543 _na     86_aa Aminoacyl-tRNA hydrolase
2733 CAJPRK010000042.1 GCA905373015_01353 gene open 109-459 fdxA
2734 CAJPRK010000042.1 GCA905373015_01354 gene open 881-985
2735 CAJPRK010000042.1 GCA905373015_01355 gene open 986-2305
2736 CAJPRK010000042.1 GCA905373015_01356 gene open 2473-5100
2737 CAJPRK010000042.1 GCA905373015_01357 gene open 5116-7038 typA
2738 CAJPRK010000042.1 GCA905373015_01358 gene open 7207-7950
2739 CAJPRK010000042.1 GCA905373015_01359 gene open 7947-9836 nikD
2740 CAJPRK010000042.1 GCA905373015_01360 gene open 9833-10831 dppC
2741 CAJPRK010000042.1 GCA905373015_01361 gene open 10824-11753 dppB
2742 CAJPRK010000042.1 GCA905373015_01362 gene open 11768-13393 oppA
2743 CAJPRK010000042.1 GCA905373015_01363 gene open 13558-14673
2744 CAJPRK010000042.1 GCA905373015_01364 gene open 14789-15376
2745 CAJPRK010000042.1 GCA905373015_01365 gene open 15508-16533
2746 CAJPRK010000042.1 GCA905373015_01366 gene open 16914-17480
2747 CAJPRK010000042.1 GCA905373015_01367 gene open 17483-18319
2748 CAJPRK010000042.1 GCA905373015_01368 gene open 18629-19744 fadH
2749 CAJPRK010000042.1 GCA905373015_01369 gene open 19785-20240 ychJ
2750 CAJPRK010000042.1 GCA905373015_01370 gene open 20243-21628 lAP4
2751 CAJPRK010000042.1 GCA905373015_01371 gene open 21711-22364
2752 CAJPRK010000042.1 GCA905373015_01372 gene open 22461-23024
2753 CAJPRK010000042.1 GCA905373015_01373 gene open 23283-23543
2754 CAJPRK010000043.1 repeat_region open 579-1280 CRISPR array with 10 repeats of length 37%2C consensus sequence GTCAGAAAGCACCCAGCACCAGAAGGTGCATTAAGAC and spacer length 35
2755 CAJPRK010000043.1 repeat_region open 14718-14932 CRISPR array with 3 repeats of length 37%2C consensus sequence GTCAGAAAGCACCCAGCACCAGAAGGTGCATTAAGAC and spacer length 35
2756 CAJPRK010000043.1 repeat_region open 16465-16867 CRISPR array with 6 repeats of length 37%2C consensus sequence GTCAGAAAGCACCCAGCACCAGAAGGTGCATTAAGAC and spacer length 34
2757 CAJPRK010000043.1 GCA905373015_01374 CDS open 1768-2673 _na     301_aa hypothetical protein
2758 CAJPRK010000043.1 GCA905373015_01375 CDS open 2691-3371 _na     226_aa hypothetical protein
2759 CAJPRK010000043.1 GCA905373015_01376 CDS open 3618-5918 _na     766_aa CRISPR-associated RAMP family protein
2760 CAJPRK010000043.1 GCA905373015_01377 CDS open 5920-6489 _na     189_aa hypothetical protein
2761 CAJPRK010000043.1 GCA905373015_01378 CDS open 6482-8206 _na     574_aa CRISPR-associated protein
2762 CAJPRK010000043.1 GCA905373015_01379 CDS open 8203-10125 _na     640_aa CRISPR-associated RAMP protein
2763 CAJPRK010000043.1 GCA905373015_01380 CDS open 10122-12014 _na     630_aa Cas10/Cmr2 second palm domain-containing protein
2764 CAJPRK010000043.1 GCA905373015_01381 CDS open 12052-13338 _na     428_aa SAVED domain-containing protein
2765 CAJPRK010000043.1 GCA905373015_01382 CDS open 13772-14455 _na     227_aa hypothetical protein
2766 CAJPRK010000043.1 GCA905373015_01383 CDS open 15475-16068 _na     197_aa HTH cro/C1-type domain-containing protein
2767 CAJPRK010000043.1 GCA905373015_01384 CDS open 17457-18812 _na     451_aa NlpC/P60 domain-containing protein
2768 CAJPRK010000043.1 GCA905373015_01385 CDS open 18991-19545 _na     184_aa hpt hypoxanthine phosphoribosyltransferase
2769 CAJPRK010000043.1 GCA905373015_01386 CDS open 19659-20882 _na     407_aa Zinc-dependent metalloprotease
2770 CAJPRK010000043.1 GCA905373015_01387 CDS open 20964-22358 _na     464_aa dacB D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase
2771 CAJPRK010000043.1 GCA905373015_01388 CDS open 22594-23094 _na     166_aa ppa Inorganic pyrophosphatase
2772 CAJPRK010000043.1 GCA905373015_01389 CDS open 23184-23516 _na     110_aa C40 family peptidase
2773 CAJPRK010000043.1 GCA905373015_01374 gene open 1768-2673
2774 CAJPRK010000043.1 GCA905373015_01375 gene open 2691-3371
2775 CAJPRK010000043.1 GCA905373015_01376 gene open 3618-5918
2776 CAJPRK010000043.1 GCA905373015_01377 gene open 5920-6489
2777 CAJPRK010000043.1 GCA905373015_01378 gene open 6482-8206
2778 CAJPRK010000043.1 GCA905373015_01379 gene open 8203-10125
2779 CAJPRK010000043.1 GCA905373015_01380 gene open 10122-12014
2780 CAJPRK010000043.1 GCA905373015_01381 gene open 12052-13338
2781 CAJPRK010000043.1 GCA905373015_01382 gene open 13772-14455
2782 CAJPRK010000043.1 GCA905373015_01383 gene open 15475-16068
2783 CAJPRK010000043.1 GCA905373015_01384 gene open 17457-18812
2784 CAJPRK010000043.1 GCA905373015_01385 gene open 18991-19545 hpt
2785 CAJPRK010000043.1 GCA905373015_01386 gene open 19659-20882
2786 CAJPRK010000043.1 GCA905373015_01387 gene open 20964-22358 dacB
2787 CAJPRK010000043.1 GCA905373015_01388 gene open 22594-23094 ppa
2788 CAJPRK010000043.1 GCA905373015_01389 gene open 23184-23516
2789 CAJPRK010000044.1 GCA905373015_01390 CDS open 202-453 _na     83_aa hypothetical protein
2790 CAJPRK010000044.1 GCA905373015_01391 CDS open 481-810 _na     109_aa transposase
2791 CAJPRK010000044.1 GCA905373015_01392 CDS open 807-1181 _na     124_aa transposase
2792 CAJPRK010000044.1 GCA905373015_01393 CDS open 2087-2638 _na     183_aa CAAX protease
2793 CAJPRK010000044.1 GCA905373015_01394 CDS open 2728-3282 _na     184_aa N5-carboxyaminoimidazole ribonucleotide mutase
2794 CAJPRK010000044.1 GCA905373015_01395 CDS open 3346-4641 _na     431_aa purK 5-(carboxyamino)imidazole ribonucleotide synthase
2795 CAJPRK010000044.1 GCA905373015_01396 CDS open 4708-5979 _na     423_aa Integral membrane protein
2796 CAJPRK010000044.1 GCA905373015_01397 CDS open 6029-6583 _na     184_aa GtrA/DPMS transmembrane domain-containing protein
2797 CAJPRK010000044.1 GCA905373015_01398 CDS open 6764-7408 _na     214_aa VTT domain-containing protein
2798 CAJPRK010000044.1 GCA905373015_01399 CDS open 7461-8537 _na     358_aa baeS Signal transduction histidine-protein kinase/phosphatase MprB
2799 CAJPRK010000044.1 GCA905373015_01400 CDS open 8633-9328 _na     231_aa ompR DNA-binding response regulator
2800 CAJPRK010000044.1 GCA905373015_01401 CDS open 9523-10611 _na     362_aa Adenylate/guanylate cyclase domain-containing protein
2801 CAJPRK010000044.1 GCA905373015_01402 CDS open 10772-11680 _na     302_aa BPL/LPL catalytic domain-containing protein
2802 CAJPRK010000044.1 GCA905373015_01403 CDS open 11715-12380 _na     221_aa nucleoside triphosphate pyrophosphatase
2803 CAJPRK010000044.1 GCA905373015_01404 CDS open 12402-13070 _na     222_aa HTH marR-type domain-containing protein
2804 CAJPRK010000044.1 GCA905373015_01405 CDS open 13578-14126 _na     182_aa MaoC/PaaZ C-terminal domain-containing protein
2805 CAJPRK010000044.1 GCA905373015_01406 CDS open 14495-14665 _na     56_aa rpmG 50S ribosomal protein L33
2806 CAJPRK010000044.1 GCA905373015_01410 CDS open 15260-15757 _na     165_aa yajQ YajQ family cyclic di-GMP-binding protein
2807 CAJPRK010000044.1 GCA905373015_01411 CDS open 15776-16420 _na     214_aa citB DNA-binding response regulator
2808 CAJPRK010000044.1 GCA905373015_01412 CDS open 16408-17676 _na     422_aa comP histidine kinase
2809 CAJPRK010000044.1 GCA905373015_01413 CDS open 17773-18759 _na     328_aa Aminoglycoside phosphotransferase domain-containing protein
2810 CAJPRK010000044.1 GCA905373015_01414 CDS open 18764-19633 _na     289_aa htpX zinc metalloprotease HtpX
2811 CAJPRK010000044.1 GCA905373015_01415 CDS open 19667-20251 _na     194_aa N-acetyltransferase domain-containing protein
2812 CAJPRK010000044.1 GCA905373015_01416 CDS open 20255-21370 _na     371_aa ald alanine dehydrogenase
2813 CAJPRK010000044.1 GCA905373015_01417 CDS open 21461-22948 _na     495_aa gltD ferredoxin--NADP(+) reductase
2814 CAJPRK010000044.1 GCA905373015_01390 gene open 202-453
2815 CAJPRK010000044.1 GCA905373015_01391 gene open 481-810
2816 CAJPRK010000044.1 GCA905373015_01392 gene open 807-1181
2817 CAJPRK010000044.1 GCA905373015_01393 gene open 2087-2638
2818 CAJPRK010000044.1 GCA905373015_01394 gene open 2728-3282
2819 CAJPRK010000044.1 GCA905373015_01395 gene open 3346-4641 purK
2820 CAJPRK010000044.1 GCA905373015_01396 gene open 4708-5979
2821 CAJPRK010000044.1 GCA905373015_01397 gene open 6029-6583
2822 CAJPRK010000044.1 GCA905373015_01398 gene open 6764-7408
2823 CAJPRK010000044.1 GCA905373015_01399 gene open 7461-8537 baeS
2824 CAJPRK010000044.1 GCA905373015_01400 gene open 8633-9328 ompR
2825 CAJPRK010000044.1 GCA905373015_01401 gene open 9523-10611
2826 CAJPRK010000044.1 GCA905373015_01402 gene open 10772-11680
2827 CAJPRK010000044.1 GCA905373015_01403 gene open 11715-12380
2828 CAJPRK010000044.1 GCA905373015_01404 gene open 12402-13070
2829 CAJPRK010000044.1 GCA905373015_01405 gene open 13578-14126
2830 CAJPRK010000044.1 GCA905373015_01406 gene open 14495-14665 rpmG
2831 CAJPRK010000044.1 GCA905373015_01410 gene open 15260-15757 yajQ
2832 CAJPRK010000044.1 GCA905373015_01411 gene open 15776-16420 citB
2833 CAJPRK010000044.1 GCA905373015_01412 gene open 16408-17676 comP
2834 CAJPRK010000044.1 GCA905373015_01413 gene open 17773-18759
2835 CAJPRK010000044.1 GCA905373015_01414 gene open 18764-19633 htpX
2836 CAJPRK010000044.1 GCA905373015_01415 gene open 19667-20251
2837 CAJPRK010000044.1 GCA905373015_01416 gene open 20255-21370 ald
2838 CAJPRK010000044.1 GCA905373015_01417 gene open 21461-22948 gltD
2839 CAJPRK010000044.1 GCA905373015_01407 gene open 14726-14799 trnM
2840 CAJPRK010000044.1 GCA905373015_01408 gene open 14838-14910 trnT
2841 CAJPRK010000044.1 GCA905373015_01409 gene open 15020-15101 trnY
2842 CAJPRK010000044.1 GCA905373015_01407 tRNA open 14726-14799 trnM tRNA-Met(cat)
2843 CAJPRK010000044.1 GCA905373015_01408 tRNA open 14838-14910 trnT tRNA-Thr(ggt)
2844 CAJPRK010000044.1 GCA905373015_01409 tRNA open 15020-15101 trnY tRNA-Tyr(gta)
2845 CAJPRK010000045.1 GCA905373015_01425 gene open 5899-5993 Bacteria_small_SRP
2846 CAJPRK010000045.1 GCA905373015_01425 ncRNA open 5899-5993 Bacterial small signal recognition particle RNA
2847 CAJPRK010000045.1 GCA905373015_01418 CDS open 59-688 _na     209_aa hypothetical protein
2848 CAJPRK010000045.1 GCA905373015_01419 CDS open 837-1301 _na     154_aa hypothetical protein
2849 CAJPRK010000045.1 GCA905373015_01420 CDS open 1358-2527 _na     389_aa hypothetical protein
2850 CAJPRK010000045.1 GCA905373015_01421 CDS open 2814-3752 _na     312_aa BsuBI/PstI restriction endonuclease C-terminus
2851 CAJPRK010000045.1 GCA905373015_01422 CDS open 3749-5275 _na     508_aa site-specific DNA-methyltransferase (adenine-specific)
2852 CAJPRK010000045.1 GCA905373015_01423 CDS open 5328-5678 _na     116_aa Carbonic anhydrase
2853 CAJPRK010000045.1 GCA905373015_01424 CDS open 5654-5899 _na     81_aa hypothetical protein
2854 CAJPRK010000045.1 GCA905373015_01427 CDS open 6479-7090 _na     203_aa Septum formation-related domain-containing protein
2855 CAJPRK010000045.1 GCA905373015_01428 CDS open 7338-7811 _na     157_aa Septum formation-related domain-containing protein
2856 CAJPRK010000045.1 GCA905373015_01429 CDS open 8033-8740 _na     235_aa tetR TetR family transcriptional regulator
2857 CAJPRK010000045.1 GCA905373015_01430 CDS open 8809-9885 _na     358_aa Ig-like domain-containing protein
2858 CAJPRK010000045.1 GCA905373015_01431 CDS open 10275-10613 _na     112_aa Transcription regulator of the Arc/MetJ class
2859 CAJPRK010000045.1 GCA905373015_01432 CDS open 10770-11345 _na     191_aa lytR LytR family transcriptional regulator
2860 CAJPRK010000045.1 GCA905373015_01433 CDS open 11627-13081 _na     484_aa Nitrate reductase
2861 CAJPRK010000045.1 GCA905373015_01434 CDS open 13335-13715 _na     126_aa DUF4190 domain-containing protein
2862 CAJPRK010000045.1 GCA905373015_01435 CDS open 13776-14498 _na     240_aa guaA1 Glutamine amidotransferase domain-containing protein
2863 CAJPRK010000045.1 GCA905373015_01436 CDS open 14588-16024 _na     478_aa Annexin A7
2864 CAJPRK010000045.1 GCA905373015_01437 CDS open 16098-17606 _na     502_aa hypothetical protein
2865 CAJPRK010000045.1 GCA905373015_01438 CDS open 17766-18023 _na     85_aa NAD(P)H-binding protein
2866 CAJPRK010000045.1 GCA905373015_01439 CDS open 18496-19230 _na     244_aa guaA1 glutamine amidotransferase
2867 CAJPRK010000045.1 GCA905373015_01440 CDS open 19298-20119 _na     273_aa Purine-nucleoside phosphorylase
2868 CAJPRK010000045.1 GCA905373015_01441 CDS open 20377-20889 _na     170_aa DUF2178 domain-containing protein
2869 CAJPRK010000045.1 GCA905373015_01442 CDS open 20882-21070 _na     62_aa xRE HTH cro/C1-type domain-containing protein
2870 CAJPRK010000045.1 GCA905373015_01443 CDS open 21107-21502 _na     131_aa PTS sugar transporter
2871 CAJPRK010000045.1 GCA905373015_01444 CDS open 21918-22325 _na     135_aa SRPBCC family protein
2872 CAJPRK010000045.1 GCA905373015_01418 gene open 59-688
2873 CAJPRK010000045.1 GCA905373015_01419 gene open 837-1301
2874 CAJPRK010000045.1 GCA905373015_01420 gene open 1358-2527
2875 CAJPRK010000045.1 GCA905373015_01421 gene open 2814-3752
2876 CAJPRK010000045.1 GCA905373015_01422 gene open 3749-5275
2877 CAJPRK010000045.1 GCA905373015_01423 gene open 5328-5678
2878 CAJPRK010000045.1 GCA905373015_01424 gene open 5654-5899
2879 CAJPRK010000045.1 GCA905373015_01427 gene open 6479-7090
2880 CAJPRK010000045.1 GCA905373015_01428 gene open 7338-7811
2881 CAJPRK010000045.1 GCA905373015_01429 gene open 8033-8740 tetR
2882 CAJPRK010000045.1 GCA905373015_01430 gene open 8809-9885
2883 CAJPRK010000045.1 GCA905373015_01431 gene open 10275-10613
2884 CAJPRK010000045.1 GCA905373015_01432 gene open 10770-11345 lytR
2885 CAJPRK010000045.1 GCA905373015_01433 gene open 11627-13081
2886 CAJPRK010000045.1 GCA905373015_01434 gene open 13335-13715
2887 CAJPRK010000045.1 GCA905373015_01435 gene open 13776-14498 guaA1
2888 CAJPRK010000045.1 GCA905373015_01436 gene open 14588-16024
2889 CAJPRK010000045.1 GCA905373015_01437 gene open 16098-17606
2890 CAJPRK010000045.1 GCA905373015_01438 gene open 17766-18023
2891 CAJPRK010000045.1 GCA905373015_01439 gene open 18496-19230 guaA1
2892 CAJPRK010000045.1 GCA905373015_01440 gene open 19298-20119
2893 CAJPRK010000045.1 GCA905373015_01441 gene open 20377-20889
2894 CAJPRK010000045.1 GCA905373015_01442 gene open 20882-21070 xRE
2895 CAJPRK010000045.1 GCA905373015_01443 gene open 21107-21502
2896 CAJPRK010000045.1 GCA905373015_01444 gene open 21918-22325
2897 CAJPRK010000045.1 GCA905373015_01426 gene open 6271-6358 trnS
2898 CAJPRK010000045.1 GCA905373015_01426 tRNA open 6271-6358 trnS tRNA-Ser(gga)
2899 CAJPRK010000046.1 GCA905373015_01445 CDS open 95-1216 _na     373_aa rfaB Glycosyltransferase subfamily 4-like N-terminal domain-containing protein
2900 CAJPRK010000046.1 GCA905373015_01446 CDS open 1337-2287 _na     316_aa dTDP-4-dehydrorhamnose reductase
2901 CAJPRK010000046.1 GCA905373015_01447 CDS open 2353-3918 _na     521_aa DUF2142 domain-containing protein
2902 CAJPRK010000046.1 GCA905373015_01448 CDS open 4001-4090 _na     29_aa hypothetical protein
2903 CAJPRK010000046.1 GCA905373015_01449 CDS open 4096-4893 _na     265_aa IS1634 family transposase
2904 CAJPRK010000046.1 GCA905373015_01450 CDS open 4859-5689 _na     276_aa IS1634 family transposase
2905 CAJPRK010000046.1 GCA905373015_01451 CDS open 5885-6898 _na     337_aa rfbA glucose-1-phosphate thymidylyltransferase RfbA
2906 CAJPRK010000046.1 GCA905373015_01452 CDS open 6962-7543 _na     193_aa rfbC dTDP-4-dehydrorhamnose 3%2C5-epimerase
2907 CAJPRK010000046.1 GCA905373015_01453 CDS open 7576-8766 _na     396_aa manA mannose-6-phosphate isomerase%2C class I
2908 CAJPRK010000046.1 GCA905373015_01454 CDS open 8787-9602 _na     271_aa TIGR03089 family protein
2909 CAJPRK010000046.1 GCA905373015_01455 CDS open 9931-10251 _na     106_aa whiB Transcriptional regulator WhiB
2910 CAJPRK010000046.1 GCA905373015_01456 CDS open 10248-14297 _na     1349_aa glycosyltransferase
2911 CAJPRK010000046.1 GCA905373015_01457 CDS open 14294-16168 _na     624_aa Prevent-host-death protein
2912 CAJPRK010000046.1 GCA905373015_01458 CDS open 16281-16757 _na     158_aa Peptidase
2913 CAJPRK010000046.1 GCA905373015_01459 CDS open 16866-17252 _na     128_aa DUF3499 domain-containing protein
2914 CAJPRK010000046.1 GCA905373015_01460 CDS open 17249-17491 _na     80_aa Tetraacyldisaccharide 4'-kinase
2915 CAJPRK010000046.1 GCA905373015_01461 CDS open 17550-18431 _na     293_aa RDD family protein
2916 CAJPRK010000046.1 GCA905373015_01462 CDS open 18500-19441 _na     313_aa Stage II sporulation protein M
2917 CAJPRK010000046.1 GCA905373015_01463 CDS open 19465-20757 _na     430_aa DUF58 domain-containing protein
2918 CAJPRK010000046.1 GCA905373015_01464 CDS open 20823-21749 _na     308_aa AAA family ATPase
2919 CAJPRK010000046.1 GCA905373015_01445 gene open 95-1216 rfaB
2920 CAJPRK010000046.1 GCA905373015_01446 gene open 1337-2287
2921 CAJPRK010000046.1 GCA905373015_01447 gene open 2353-3918
2922 CAJPRK010000046.1 GCA905373015_01448 gene open 4001-4090
2923 CAJPRK010000046.1 GCA905373015_01449 gene open 4096-4893
2924 CAJPRK010000046.1 GCA905373015_01450 gene open 4859-5689
2925 CAJPRK010000046.1 GCA905373015_01451 gene open 5885-6898 rfbA
2926 CAJPRK010000046.1 GCA905373015_01452 gene open 6962-7543 rfbC
2927 CAJPRK010000046.1 GCA905373015_01453 gene open 7576-8766 manA
2928 CAJPRK010000046.1 GCA905373015_01454 gene open 8787-9602
2929 CAJPRK010000046.1 GCA905373015_01455 gene open 9931-10251 whiB
2930 CAJPRK010000046.1 GCA905373015_01456 gene open 10248-14297
2931 CAJPRK010000046.1 GCA905373015_01457 gene open 14294-16168
2932 CAJPRK010000046.1 GCA905373015_01458 gene open 16281-16757
2933 CAJPRK010000046.1 GCA905373015_01459 gene open 16866-17252
2934 CAJPRK010000046.1 GCA905373015_01460 gene open 17249-17491
2935 CAJPRK010000046.1 GCA905373015_01461 gene open 17550-18431
2936 CAJPRK010000046.1 GCA905373015_01462 gene open 18500-19441
2937 CAJPRK010000046.1 GCA905373015_01463 gene open 19465-20757
2938 CAJPRK010000046.1 GCA905373015_01464 gene open 20823-21749
2939 CAJPRK010000047.1 GCA905373015_01465 CDS open 46-2502 _na     818_aa ligA NAD-dependent DNA ligase LigA
2940 CAJPRK010000047.1 GCA905373015_01466 CDS open 2644-6261 _na     1205_aa ftsK Cell division protein FtsK
2941 CAJPRK010000047.1 GCA905373015_01467 CDS open 6468-6716 _na     82_aa whiB Transcriptional regulator WhiB
2942 CAJPRK010000047.1 GCA905373015_01468 CDS open 6815-8290 _na     491_aa histidine kinase
2943 CAJPRK010000047.1 GCA905373015_01469 CDS open 8469-8975 _na     168_aa DUF2505 domain-containing protein
2944 CAJPRK010000047.1 GCA905373015_01470 CDS open 9132-9572 _na     146_aa yhfA OsmC-like protein
2945 CAJPRK010000047.1 GCA905373015_01471 CDS open 9648-10346 _na     232_aa ecsC EcsC family protein
2946 CAJPRK010000047.1 GCA905373015_01472 CDS open 10343-11236 _na     297_aa thymidylate synthase
2947 CAJPRK010000047.1 GCA905373015_01473 CDS open 11233-11823 _na     196_aa folA dihydrofolate reductase
2948 CAJPRK010000047.1 GCA905373015_01474 CDS open 11864-12271 _na     135_aa hxlR HTH hxlR-type domain-containing protein
2949 CAJPRK010000047.1 GCA905373015_01475 CDS open 12375-12998 _na     207_aa Pyrroline-5-carboxylate reductase catalytic N-terminal domain-containing protein
2950 CAJPRK010000047.1 GCA905373015_01476 CDS open 13153-14139 _na     328_aa osmF ABC-type glycine betaine transport system substrate-binding domain-containing protein
2951 CAJPRK010000047.1 GCA905373015_01477 CDS open 14136-14816 _na     226_aa ABC transmembrane type-1 domain-containing protein
2952 CAJPRK010000047.1 GCA905373015_01478 CDS open 14813-15517 _na     234_aa ABC transporter permease subunit
2953 CAJPRK010000047.1 GCA905373015_01479 CDS open 15514-16383 _na     289_aa proV Glycine betaine/L-proline transport ATP-binding protein ProV
2954 CAJPRK010000047.1 GCA905373015_01480 CDS open 16674-17060 _na     128_aa DUF1304 domain-containing protein
2955 CAJPRK010000047.1 GCA905373015_01481 CDS open 17163-18992 _na     609_aa subtype A tannase
2956 CAJPRK010000047.1 GCA905373015_01482 CDS open 19227-20663 _na     478_aa fumC class II fumarate hydratase
2957 CAJPRK010000047.1 GCA905373015_01465 gene open 46-2502 ligA
2958 CAJPRK010000047.1 GCA905373015_01466 gene open 2644-6261 ftsK
2959 CAJPRK010000047.1 GCA905373015_01467 gene open 6468-6716 whiB
2960 CAJPRK010000047.1 GCA905373015_01468 gene open 6815-8290
2961 CAJPRK010000047.1 GCA905373015_01469 gene open 8469-8975
2962 CAJPRK010000047.1 GCA905373015_01470 gene open 9132-9572 yhfA
2963 CAJPRK010000047.1 GCA905373015_01471 gene open 9648-10346 ecsC
2964 CAJPRK010000047.1 GCA905373015_01472 gene open 10343-11236
2965 CAJPRK010000047.1 GCA905373015_01473 gene open 11233-11823 folA
2966 CAJPRK010000047.1 GCA905373015_01474 gene open 11864-12271 hxlR
2967 CAJPRK010000047.1 GCA905373015_01475 gene open 12375-12998
2968 CAJPRK010000047.1 GCA905373015_01476 gene open 13153-14139 osmF
2969 CAJPRK010000047.1 GCA905373015_01477 gene open 14136-14816
2970 CAJPRK010000047.1 GCA905373015_01478 gene open 14813-15517
2971 CAJPRK010000047.1 GCA905373015_01479 gene open 15514-16383 proV
2972 CAJPRK010000047.1 GCA905373015_01480 gene open 16674-17060
2973 CAJPRK010000047.1 GCA905373015_01481 gene open 17163-18992
2974 CAJPRK010000047.1 GCA905373015_01482 gene open 19227-20663 fumC
2975 CAJPRK010000048.1 GCA905373015_01483 CDS open 1387-1947 _na     186_aa EXLDI protein
2976 CAJPRK010000048.1 GCA905373015_01484 CDS open 2423-4126 _na     567_aa ATPase
2977 CAJPRK010000048.1 GCA905373015_01485 CDS open 4397-6010 _na     537_aa uup ABC transporter domain-containing protein
2978 CAJPRK010000048.1 GCA905373015_01486 CDS open 6090-6905 _na     271_aa gloB Metallo-beta-lactamase domain-containing protein
2979 CAJPRK010000048.1 GCA905373015_01487 CDS open 6966-8402 _na     478_aa hisS histidine--tRNA ligase
2980 CAJPRK010000048.1 GCA905373015_01488 CDS open 8399-10195 _na     598_aa Dynamin N-terminal domain-containing protein
2981 CAJPRK010000048.1 GCA905373015_01489 CDS open 10192-11910 _na     572_aa G domain-containing protein
2982 CAJPRK010000048.1 GCA905373015_01490 CDS open 11973-12599 _na     208_aa copG CopG family transcriptional regulator
2983 CAJPRK010000048.1 GCA905373015_01491 CDS open 12711-13445 _na     244_aa DUF4097 domain-containing protein
2984 CAJPRK010000048.1 GCA905373015_01492 CDS open 13536-16118 _na     860_aa RNA helicase
2985 CAJPRK010000048.1 GCA905373015_01493 CDS open 16425-17306 _na     293_aa ABC transporter domain-containing protein
2986 CAJPRK010000048.1 GCA905373015_01494 CDS open 17311-18387 _na     358_aa ABC transmembrane type-1 domain-containing protein
2987 CAJPRK010000048.1 GCA905373015_01495 CDS open 18394-19593 _na     399_aa SsuA/THI5-like domain-containing protein
2988 CAJPRK010000048.1 GCA905373015_01483 gene open 1387-1947
2989 CAJPRK010000048.1 GCA905373015_01484 gene open 2423-4126
2990 CAJPRK010000048.1 GCA905373015_01485 gene open 4397-6010 uup
2991 CAJPRK010000048.1 GCA905373015_01486 gene open 6090-6905 gloB
2992 CAJPRK010000048.1 GCA905373015_01487 gene open 6966-8402 hisS
2993 CAJPRK010000048.1 GCA905373015_01488 gene open 8399-10195
2994 CAJPRK010000048.1 GCA905373015_01489 gene open 10192-11910
2995 CAJPRK010000048.1 GCA905373015_01490 gene open 11973-12599 copG
2996 CAJPRK010000048.1 GCA905373015_01491 gene open 12711-13445
2997 CAJPRK010000048.1 GCA905373015_01492 gene open 13536-16118
2998 CAJPRK010000048.1 GCA905373015_01493 gene open 16425-17306
2999 CAJPRK010000048.1 GCA905373015_01494 gene open 17311-18387
3000 CAJPRK010000048.1 GCA905373015_01495 gene open 18394-19593