HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Bulleidia extructa (GCA_905373065.1)

Select a Genome:
BAKTA Annotations for GCA_905373065.1
Genome Selected: Bulleidia extructa
ContigsBases CDSrRNA tmRNAtRNA
94 1,266,912 1225 0 0 40
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 2549 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:4]    |    Number of Records Found: 2549 [6 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1501 CAJPRC010000027.1 GCA905373065_00748 CDS open 5805-7451 _na     548_aa Phosphoribulokinase/uridine kinase family protein
1502 CAJPRC010000027.1 GCA905373065_00749 CDS open 7432-7950 _na     172_aa msrA Peptide methionine sulfoxide reductase MsrA
1503 CAJPRC010000027.1 GCA905373065_00750 CDS open 8003-10252 _na     749_aa tex Tex-like protein N-terminal domain protein
1504 CAJPRC010000027.1 GCA905373065_00751 CDS open 10350-11327 _na     325_aa SPFH/Band 7/PHB domain protein
1505 CAJPRC010000027.1 GCA905373065_00752 CDS open 11330-11587 _na     85_aa hypothetical protein
1506 CAJPRC010000027.1 GCA905373065_00753 CDS open 11533-11670 _na     45_aa hypothetical protein
1507 CAJPRC010000027.1 GCA905373065_00754 CDS open 11667-14375 _na     902_aa Nuclease SbcCD subunit C
1508 CAJPRC010000027.1 GCA905373065_00755 CDS open 14372-15502 _na     376_aa Nuclease SbcCD subunit D
1509 CAJPRC010000027.1 GCA905373065_00756 CDS open 15592-15909 _na     105_aa hypothetical protein
1510 CAJPRC010000027.1 GCA905373065_00744 gene open 102-581
1511 CAJPRC010000027.1 GCA905373065_00745 gene open 617-1903 bcsA
1512 CAJPRC010000027.1 GCA905373065_00746 gene open 2093-3910
1513 CAJPRC010000027.1 GCA905373065_00747 gene open 3920-5725
1514 CAJPRC010000027.1 GCA905373065_00748 gene open 5805-7451
1515 CAJPRC010000027.1 GCA905373065_00749 gene open 7432-7950 msrA
1516 CAJPRC010000027.1 GCA905373065_00750 gene open 8003-10252 tex
1517 CAJPRC010000027.1 GCA905373065_00751 gene open 10350-11327
1518 CAJPRC010000027.1 GCA905373065_00752 gene open 11330-11587
1519 CAJPRC010000027.1 GCA905373065_00753 gene open 11533-11670
1520 CAJPRC010000027.1 GCA905373065_00754 gene open 11667-14375
1521 CAJPRC010000027.1 GCA905373065_00755 gene open 14372-15502
1522 CAJPRC010000027.1 GCA905373065_00756 gene open 15592-15909
1523 CAJPRC010000028.1 GCA905373065_00757 CDS open 58-894 _na     278_aa SUF system FeS cluster assembly SufBD core domain-containing protein
1524 CAJPRC010000028.1 GCA905373065_00758 CDS open 878-1411 _na     177_aa 5-formyltetrahydrofolate cyclo-ligase
1525 CAJPRC010000028.1 GCA905373065_00759 CDS open 1465-3624 _na     719_aa priA primosomal protein N'
1526 CAJPRC010000028.1 GCA905373065_00760 CDS open 3627-4823 _na     398_aa rsmB 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB
1527 CAJPRC010000028.1 GCA905373065_00761 CDS open 4820-5893 _na     357_aa rlmN 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN
1528 CAJPRC010000028.1 GCA905373065_00762 CDS open 5890-6636 _na     248_aa Stp1/IreP family PP2C-type Ser/Thr phosphatase
1529 CAJPRC010000028.1 GCA905373065_00763 CDS open 6633-8252 _na     539_aa pknB Stk1 family PASTA domain-containing Ser/Thr kinase
1530 CAJPRC010000028.1 GCA905373065_00764 CDS open 8260-9129 _na     289_aa rsgA ribosome small subunit-dependent GTPase A
1531 CAJPRC010000028.1 GCA905373065_00765 CDS open 9126-9755 _na     209_aa rpe ribulose-phosphate 3-epimerase
1532 CAJPRC010000028.1 GCA905373065_00766 CDS open 9752-10360 _na     202_aa thiamine diphosphokinase
1533 CAJPRC010000028.1 GCA905373065_00767 CDS open 10409-10612 _na     67_aa rpmB 50S ribosomal protein L28
1534 CAJPRC010000028.1 GCA905373065_00768 CDS open 10765-12132 _na     455_aa norM putative multidrug resistance protein NorM
1535 CAJPRC010000028.1 GCA905373065_00769 CDS open 12186-13445 _na     419_aa ftsA Putative cell division protein FtsA
1536 CAJPRC010000028.1 GCA905373065_00770 CDS open 13464-14516 _na     350_aa ftsZ cell division protein FtsZ
1537 CAJPRC010000028.1 GCA905373065_00757 gene open 58-894
1538 CAJPRC010000028.1 GCA905373065_00758 gene open 878-1411
1539 CAJPRC010000028.1 GCA905373065_00759 gene open 1465-3624 priA
1540 CAJPRC010000028.1 GCA905373065_00760 gene open 3627-4823 rsmB
1541 CAJPRC010000028.1 GCA905373065_00761 gene open 4820-5893 rlmN
1542 CAJPRC010000028.1 GCA905373065_00762 gene open 5890-6636
1543 CAJPRC010000028.1 GCA905373065_00763 gene open 6633-8252 pknB
1544 CAJPRC010000028.1 GCA905373065_00764 gene open 8260-9129 rsgA
1545 CAJPRC010000028.1 GCA905373065_00765 gene open 9126-9755 rpe
1546 CAJPRC010000028.1 GCA905373065_00766 gene open 9752-10360
1547 CAJPRC010000028.1 GCA905373065_00767 gene open 10409-10612 rpmB
1548 CAJPRC010000028.1 GCA905373065_00768 gene open 10765-12132 norM
1549 CAJPRC010000028.1 GCA905373065_00769 gene open 12186-13445 ftsA
1550 CAJPRC010000028.1 GCA905373065_00770 gene open 13464-14516 ftsZ
1551 CAJPRC010000029.1 GCA905373065_00771 CDS open 329-703 _na     124_aa hypothetical protein
1552 CAJPRC010000029.1 GCA905373065_00772 CDS open 861-1622 _na     253_aa Tyrosine specific protein phosphatases domain-containing protein
1553 CAJPRC010000029.1 GCA905373065_00773 CDS open 1679-3196 _na     505_aa 5'-nucleotidase%2C C-terminal domain protein
1554 CAJPRC010000029.1 GCA905373065_00774 CDS open 3349-4422 _na     357_aa hypothetical protein
1555 CAJPRC010000029.1 GCA905373065_00775 CDS open 4480-5052 _na     190_aa hypothetical protein
1556 CAJPRC010000029.1 GCA905373065_00776 CDS open 5096-6109 _na     337_aa Lipoprotein
1557 CAJPRC010000029.1 GCA905373065_00777 CDS open 6207-6884 _na     225_aa Lipoprotein
1558 CAJPRC010000029.1 GCA905373065_00778 CDS open 6887-7183 _na     98_aa ftsL Putative cell division protein FtsL
1559 CAJPRC010000029.1 GCA905373065_00779 CDS open 7203-7484 _na     93_aa S4 domain protein
1560 CAJPRC010000029.1 GCA905373065_00780 CDS open 7471-10899 _na     1142_aa mfd transcription-repair coupling factor
1561 CAJPRC010000029.1 GCA905373065_00781 CDS open 10950-11522 _na     190_aa pth aminoacyl-tRNA hydrolase
1562 CAJPRC010000029.1 GCA905373065_00782 CDS open 11519-12346 _na     275_aa hypothetical protein
1563 CAJPRC010000029.1 GCA905373065_00783 CDS open 12422-13180 _na     252_aa Serine-type D-Ala-D-Ala carboxypeptidase
1564 CAJPRC010000029.1 GCA905373065_00784 CDS open 13259-13393 _na     44_aa rpmH 50S ribosomal protein L34
1565 CAJPRC010000029.1 GCA905373065_00785 CDS open 13424-13753 _na     109_aa rnpA ribonuclease P protein component
1566 CAJPRC010000029.1 GCA905373065_00786 CDS open 13774-14685 _na     303_aa Membrane protein insertase%2C YidC/Oxa1 family
1567 CAJPRC010000029.1 GCA905373065_00787 CDS open 14687-15307 _na     206_aa jag R3H domain protein
1568 CAJPRC010000029.1 GCA905373065_00771 gene open 329-703
1569 CAJPRC010000029.1 GCA905373065_00772 gene open 861-1622
1570 CAJPRC010000029.1 GCA905373065_00773 gene open 1679-3196
1571 CAJPRC010000029.1 GCA905373065_00774 gene open 3349-4422
1572 CAJPRC010000029.1 GCA905373065_00775 gene open 4480-5052
1573 CAJPRC010000029.1 GCA905373065_00776 gene open 5096-6109
1574 CAJPRC010000029.1 GCA905373065_00777 gene open 6207-6884
1575 CAJPRC010000029.1 GCA905373065_00778 gene open 6887-7183 ftsL
1576 CAJPRC010000029.1 GCA905373065_00779 gene open 7203-7484
1577 CAJPRC010000029.1 GCA905373065_00780 gene open 7471-10899 mfd
1578 CAJPRC010000029.1 GCA905373065_00781 gene open 10950-11522 pth
1579 CAJPRC010000029.1 GCA905373065_00782 gene open 11519-12346
1580 CAJPRC010000029.1 GCA905373065_00783 gene open 12422-13180
1581 CAJPRC010000029.1 GCA905373065_00784 gene open 13259-13393 rpmH
1582 CAJPRC010000029.1 GCA905373065_00785 gene open 13424-13753 rnpA
1583 CAJPRC010000029.1 GCA905373065_00786 gene open 13774-14685
1584 CAJPRC010000029.1 GCA905373065_00787 gene open 14687-15307 jag
1585 CAJPRC010000030.1 GCA905373065_00788 CDS open 1332-5660 _na     1442_aa PolC-type DNA polymerase III
1586 CAJPRC010000030.1 GCA905373065_00789 CDS open 5772-6452 _na     226_aa rnc ribonuclease III
1587 CAJPRC010000030.1 GCA905373065_00790 CDS open 6439-8442 _na     667_aa recG Putative ATP-dependent DNA helicase RecG
1588 CAJPRC010000030.1 GCA905373065_00791 CDS open 8485-10095 _na     536_aa yloV DAK2 domain fusion protein YloV
1589 CAJPRC010000030.1 GCA905373065_00792 CDS open 10105-10464 _na     119_aa yloU Asp23/Gls24 family envelope stress response protein
1590 CAJPRC010000030.1 GCA905373065_00793 CDS open 10514-11530 _na     338_aa cell division protein FtsQ/DivIB
1591 CAJPRC010000030.1 GCA905373065_00794 CDS open 11509-12417 _na     302_aa murB UDP-N-acetylmuramate dehydrogenase
1592 CAJPRC010000030.1 GCA905373065_00795 CDS open 12407-13483 _na     358_aa UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase
1593 CAJPRC010000030.1 GCA905373065_00796 CDS open 13535-14122 _na     195_aa yihA ribosome biogenesis GTP-binding protein YihA/YsxC
1594 CAJPRC010000030.1 GCA905373065_00797 CDS open 14124-15440 _na     438_aa hypothetical protein
1595 CAJPRC010000030.1 GCA905373065_00788 gene open 1332-5660
1596 CAJPRC010000030.1 GCA905373065_00789 gene open 5772-6452 rnc
1597 CAJPRC010000030.1 GCA905373065_00790 gene open 6439-8442 recG
1598 CAJPRC010000030.1 GCA905373065_00791 gene open 8485-10095 yloV
1599 CAJPRC010000030.1 GCA905373065_00792 gene open 10105-10464 yloU
1600 CAJPRC010000030.1 GCA905373065_00793 gene open 10514-11530
1601 CAJPRC010000030.1 GCA905373065_00794 gene open 11509-12417 murB
1602 CAJPRC010000030.1 GCA905373065_00795 gene open 12407-13483
1603 CAJPRC010000030.1 GCA905373065_00796 gene open 13535-14122 yihA
1604 CAJPRC010000030.1 GCA905373065_00797 gene open 14124-15440
1605 CAJPRC010000031.1 GCA905373065_00798 CDS open 1073-1879 _na     268_aa HAD hydrolase%2C family IIB
1606 CAJPRC010000031.1 GCA905373065_00799 CDS open 1972-2700 _na     242_aa ABC transporter%2C ATP-binding protein
1607 CAJPRC010000031.1 GCA905373065_00800 CDS open 2702-4243 _na     513_aa ABC transporter%2C substrate-binding protein%2C QAT family
1608 CAJPRC010000031.1 GCA905373065_00801 CDS open 4236-4577 _na     113_aa hypothetical protein
1609 CAJPRC010000031.1 GCA905373065_00802 CDS open 4859-6592 _na     577_aa ABC transporter%2C ATP-binding protein
1610 CAJPRC010000031.1 GCA905373065_00803 CDS open 6589-8346 _na     585_aa ABC transporter%2C ATP-binding protein
1611 CAJPRC010000031.1 GCA905373065_00804 CDS open 8449-9738 _na     429_aa uraA Putative permease
1612 CAJPRC010000031.1 GCA905373065_00805 CDS open 9919-11847 _na     642_aa NAD(+) synthase
1613 CAJPRC010000031.1 GCA905373065_00806 CDS open 11844-12449 _na     201_aa nicotinate-nucleotide adenylyltransferase
1614 CAJPRC010000031.1 GCA905373065_00807 CDS open 12446-13966 _na     506_aa pncB nicotinate phosphoribosyltransferase
1615 CAJPRC010000031.1 GCA905373065_00808 CDS open 13963-14490 _na     175_aa nicotinamidase
1616 CAJPRC010000031.1 GCA905373065_00809 CDS open 14487-15368 _na     293_aa Hydrolase%2C NUDIX family
1617 CAJPRC010000031.1 GCA905373065_00798 gene open 1073-1879
1618 CAJPRC010000031.1 GCA905373065_00799 gene open 1972-2700
1619 CAJPRC010000031.1 GCA905373065_00800 gene open 2702-4243
1620 CAJPRC010000031.1 GCA905373065_00801 gene open 4236-4577
1621 CAJPRC010000031.1 GCA905373065_00802 gene open 4859-6592
1622 CAJPRC010000031.1 GCA905373065_00803 gene open 6589-8346
1623 CAJPRC010000031.1 GCA905373065_00804 gene open 8449-9738 uraA
1624 CAJPRC010000031.1 GCA905373065_00805 gene open 9919-11847
1625 CAJPRC010000031.1 GCA905373065_00806 gene open 11844-12449
1626 CAJPRC010000031.1 GCA905373065_00807 gene open 12446-13966 pncB
1627 CAJPRC010000031.1 GCA905373065_00808 gene open 13963-14490
1628 CAJPRC010000031.1 GCA905373065_00809 gene open 14487-15368
1629 CAJPRC010000032.1 GCA905373065_00810 CDS open 17-832 _na     271_aa hypothetical protein
1630 CAJPRC010000032.1 GCA905373065_00811 CDS open 841-1251 _na     136_aa PTS system fructose IIA component
1631 CAJPRC010000032.1 GCA905373065_00812 CDS open 1276-2139 _na     287_aa pepI proline iminopeptidase
1632 CAJPRC010000032.1 GCA905373065_00813 CDS open 2184-2855 _na     223_aa radC DNA repair protein RadC
1633 CAJPRC010000032.1 GCA905373065_00814 CDS open 2878-3975 _na     365_aa ATP synthase F0%2C A subunit
1634 CAJPRC010000032.1 GCA905373065_00815 CDS open 3959-4954 _na     331_aa ABC transporter%2C substrate-binding protein
1635 CAJPRC010000032.1 GCA905373065_00816 CDS open 4962-7550 _na     862_aa polA DNA polymerase I
1636 CAJPRC010000032.1 GCA905373065_00817 CDS open 7550-8356 _na     268_aa mutM bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase
1637 CAJPRC010000032.1 GCA905373065_00818 CDS open 8353-8970 _na     205_aa coaE dephospho-CoA kinase
1638 CAJPRC010000032.1 GCA905373065_00819 CDS open 8942-10072 _na     376_aa dnaD DnaD domain-containing protein
1639 CAJPRC010000032.1 GCA905373065_00820 CDS open 10072-10977 _na     301_aa dnaI Primosomal protein DnaI
1640 CAJPRC010000032.1 GCA905373065_00821 CDS open 11014-11976 _na     320_aa pfkA 6-phosphofructokinase
1641 CAJPRC010000032.1 GCA905373065_00822 CDS open 11987-13420 _na     477_aa pyk pyruvate kinase
1642 CAJPRC010000032.1 GCA905373065_00824 CDS open 13794-14393 _na     199_aa yitT YitT family protein
1643 CAJPRC010000032.1 GCA905373065_00825 CDS open 15020-15208 _na     62_aa hypothetical protein
1644 CAJPRC010000032.1 GCA905373065_00810 gene open 17-832
1645 CAJPRC010000032.1 GCA905373065_00811 gene open 841-1251
1646 CAJPRC010000032.1 GCA905373065_00812 gene open 1276-2139 pepI
1647 CAJPRC010000032.1 GCA905373065_00813 gene open 2184-2855 radC
1648 CAJPRC010000032.1 GCA905373065_00814 gene open 2878-3975
1649 CAJPRC010000032.1 GCA905373065_00815 gene open 3959-4954
1650 CAJPRC010000032.1 GCA905373065_00816 gene open 4962-7550 polA
1651 CAJPRC010000032.1 GCA905373065_00817 gene open 7550-8356 mutM
1652 CAJPRC010000032.1 GCA905373065_00818 gene open 8353-8970 coaE
1653 CAJPRC010000032.1 GCA905373065_00819 gene open 8942-10072 dnaD
1654 CAJPRC010000032.1 GCA905373065_00820 gene open 10072-10977 dnaI
1655 CAJPRC010000032.1 GCA905373065_00821 gene open 11014-11976 pfkA
1656 CAJPRC010000032.1 GCA905373065_00822 gene open 11987-13420 pyk
1657 CAJPRC010000032.1 GCA905373065_00824 gene open 13794-14393 yitT
1658 CAJPRC010000032.1 GCA905373065_00825 gene open 15020-15208
1659 CAJPRC010000032.1 GCA905373065_00823 gene open 13534-13621 trnS
1660 CAJPRC010000032.1 GCA905373065_00823 tRNA open 13534-13621 trnS tRNA-Ser(gga)
1661 CAJPRC010000033.1 GCA905373065_00826 CDS open 11-244 _na     77_aa DUF1461 domain-containing protein
1662 CAJPRC010000033.1 GCA905373065_00827 CDS open 241-759 _na     172_aa Putative tRNA (cytidine(34)-2'-O)-methyltransferase
1663 CAJPRC010000033.1 GCA905373065_00828 CDS open 822-1280 _na     152_aa Putative endoribonuclease L-PSP
1664 CAJPRC010000033.1 GCA905373065_00829 CDS open 1335-2273 _na     312_aa yitT DUF2179 domain-containing protein
1665 CAJPRC010000033.1 GCA905373065_00830 CDS open 2351-2815 _na     154_aa Hydrolase%2C NUDIX family
1666 CAJPRC010000033.1 GCA905373065_00831 CDS open 2808-3464 _na     218_aa Putative DNA-directed RNA polymerase%2C omega subunit
1667 CAJPRC010000033.1 GCA905373065_00832 CDS open 3529-4287 _na     252_aa DUF4037 domain-containing protein
1668 CAJPRC010000033.1 GCA905373065_00833 CDS open 4359-4766 _na     135_aa Immunity protein 70
1669 CAJPRC010000033.1 GCA905373065_00834 CDS open 5024-5800 _na     258_aa Amidinotransferase
1670 CAJPRC010000033.1 GCA905373065_00835 CDS open 5888-7324 _na     478_aa Amino acid permease
1671 CAJPRC010000033.1 GCA905373065_00836 CDS open 7417-8496 _na     359_aa Alanine racemase domain protein
1672 CAJPRC010000033.1 GCA905373065_00837 CDS open 8524-9303 _na     259_aa Amidinotransferase
1673 CAJPRC010000033.1 GCA905373065_00838 CDS open 9405-10403 _na     332_aa trpS tryptophan--tRNA ligase
1674 CAJPRC010000033.1 GCA905373065_00839 CDS open 10498-10944 _na     148_aa arsC Transcriptional regulator Spx
1675 CAJPRC010000033.1 GCA905373065_00840 CDS open 10981-12117 _na     378_aa mnmA tRNA 2-thiouridine(34) synthase MnmA
1676 CAJPRC010000033.1 GCA905373065_00841 CDS open 12123-14306 _na     727_aa recD2 ATP-dependent RecD2 DNA helicase
1677 CAJPRC010000033.1 GCA905373065_00826 gene open 11-244
1678 CAJPRC010000033.1 GCA905373065_00827 gene open 241-759
1679 CAJPRC010000033.1 GCA905373065_00828 gene open 822-1280
1680 CAJPRC010000033.1 GCA905373065_00829 gene open 1335-2273 yitT
1681 CAJPRC010000033.1 GCA905373065_00830 gene open 2351-2815
1682 CAJPRC010000033.1 GCA905373065_00831 gene open 2808-3464
1683 CAJPRC010000033.1 GCA905373065_00832 gene open 3529-4287
1684 CAJPRC010000033.1 GCA905373065_00833 gene open 4359-4766
1685 CAJPRC010000033.1 GCA905373065_00834 gene open 5024-5800
1686 CAJPRC010000033.1 GCA905373065_00835 gene open 5888-7324
1687 CAJPRC010000033.1 GCA905373065_00836 gene open 7417-8496
1688 CAJPRC010000033.1 GCA905373065_00837 gene open 8524-9303
1689 CAJPRC010000033.1 GCA905373065_00838 gene open 9405-10403 trpS
1690 CAJPRC010000033.1 GCA905373065_00839 gene open 10498-10944 arsC
1691 CAJPRC010000033.1 GCA905373065_00840 gene open 10981-12117 mnmA
1692 CAJPRC010000033.1 GCA905373065_00841 gene open 12123-14306 recD2
1693 CAJPRC010000034.1 GCA905373065_00842 CDS open 136-1203 _na     355_aa hypothetical protein
1694 CAJPRC010000034.1 GCA905373065_00843 CDS open 1393-2034 _na     213_aa L-2-amino-thiazoline-4-carboxylic acid hydrolase
1695 CAJPRC010000034.1 GCA905373065_00844 CDS open 2086-2550 _na     154_aa ABC transporter permease
1696 CAJPRC010000034.1 GCA905373065_00845 CDS open 2867-4213 _na     448_aa Ser/Thr phosphatase family protein
1697 CAJPRC010000034.1 GCA905373065_00846 CDS open 4257-4469 _na     70_aa yneF UPF0154 protein
1698 CAJPRC010000034.1 GCA905373065_00847 CDS open 4645-7218 _na     857_aa FMN-binding domain protein
1699 CAJPRC010000034.1 GCA905373065_00848 CDS open 7402-10962 _na     1186_aa nifJ pyruvate:ferredoxin (flavodoxin) oxidoreductase
1700 CAJPRC010000034.1 GCA905373065_00849 CDS open 11079-11408 _na     109_aa hypothetical protein
1701 CAJPRC010000034.1 GCA905373065_00850 CDS open 11401-12444 _na     347_aa ATP synthase%2C subunit C
1702 CAJPRC010000034.1 GCA905373065_00851 CDS open 12456-14264 _na     602_aa V-type ATP synthase subunit I
1703 CAJPRC010000034.1 GCA905373065_00852 CDS open 14275-14706 _na     143_aa ATP synthase F(0) sector subunit c
1704 CAJPRC010000034.1 GCA905373065_00842 gene open 136-1203
1705 CAJPRC010000034.1 GCA905373065_00843 gene open 1393-2034
1706 CAJPRC010000034.1 GCA905373065_00844 gene open 2086-2550
1707 CAJPRC010000034.1 GCA905373065_00845 gene open 2867-4213
1708 CAJPRC010000034.1 GCA905373065_00846 gene open 4257-4469 yneF
1709 CAJPRC010000034.1 GCA905373065_00847 gene open 4645-7218
1710 CAJPRC010000034.1 GCA905373065_00848 gene open 7402-10962 nifJ
1711 CAJPRC010000034.1 GCA905373065_00849 gene open 11079-11408
1712 CAJPRC010000034.1 GCA905373065_00850 gene open 11401-12444
1713 CAJPRC010000034.1 GCA905373065_00851 gene open 12456-14264
1714 CAJPRC010000034.1 GCA905373065_00852 gene open 14275-14706
1715 CAJPRC010000035.1 GCA905373065_00853 CDS open 279-1988 _na     569_aa ABC transporter%2C ATP-binding protein
1716 CAJPRC010000035.1 GCA905373065_00854 CDS open 1981-3663 _na     560_aa ABC transporter%2C ATP-binding protein
1717 CAJPRC010000035.1 GCA905373065_00855 CDS open 3643-4590 _na     315_aa Serine-type D-Ala-D-Ala carboxypeptidase
1718 CAJPRC010000035.1 GCA905373065_00856 CDS open 4713-5414 _na     233_aa DUF4272 domain-containing protein
1719 CAJPRC010000035.1 GCA905373065_00857 CDS open 5598-6569 _na     323_aa SsuA/THI5-like domain-containing protein
1720 CAJPRC010000035.1 GCA905373065_00858 CDS open 6541-7308 _na     255_aa ABC transporter%2C permease protein
1721 CAJPRC010000035.1 GCA905373065_00859 CDS open 7305-7886 _na     193_aa ABC transporter%2C ATP-binding protein
1722 CAJPRC010000035.1 GCA905373065_00860 CDS open 7926-9398 _na     490_aa Hydrogenase%2C Fe-only
1723 CAJPRC010000035.1 GCA905373065_00861 CDS open 9382-10248 _na     288_aa Protein kinase domain-containing protein
1724 CAJPRC010000035.1 GCA905373065_00862 CDS open 10284-10973 _na     229_aa 5'-methylthioadenosine/adenosylhomocysteine nucleosidase
1725 CAJPRC010000035.1 GCA905373065_00863 CDS open 10963-11784 _na     273_aa purine-nucleoside phosphorylase
1726 CAJPRC010000035.1 GCA905373065_00864 CDS open 11839-12639 _na     266_aa Type VII secretion system protein EssD-like domain-containing protein
1727 CAJPRC010000035.1 GCA905373065_00865 CDS open 12701-13042 _na     113_aa FMN-binding domain protein
1728 CAJPRC010000035.1 GCA905373065_00866 CDS open 13071-13661 _na     196_aa Uracil-DNA glycosylase%2C family 4
1729 CAJPRC010000035.1 GCA905373065_00853 gene open 279-1988
1730 CAJPRC010000035.1 GCA905373065_00854 gene open 1981-3663
1731 CAJPRC010000035.1 GCA905373065_00855 gene open 3643-4590
1732 CAJPRC010000035.1 GCA905373065_00856 gene open 4713-5414
1733 CAJPRC010000035.1 GCA905373065_00857 gene open 5598-6569
1734 CAJPRC010000035.1 GCA905373065_00858 gene open 6541-7308
1735 CAJPRC010000035.1 GCA905373065_00859 gene open 7305-7886
1736 CAJPRC010000035.1 GCA905373065_00860 gene open 7926-9398
1737 CAJPRC010000035.1 GCA905373065_00861 gene open 9382-10248
1738 CAJPRC010000035.1 GCA905373065_00862 gene open 10284-10973
1739 CAJPRC010000035.1 GCA905373065_00863 gene open 10963-11784
1740 CAJPRC010000035.1 GCA905373065_00864 gene open 11839-12639
1741 CAJPRC010000035.1 GCA905373065_00865 gene open 12701-13042
1742 CAJPRC010000035.1 GCA905373065_00866 gene open 13071-13661
1743 CAJPRC010000036.1 GCA905373065_00867 CDS open 746-1672 _na     308_aa DUF4428 domain-containing protein
1744 CAJPRC010000036.1 GCA905373065_00868 CDS open 1678-2181 _na     167_aa ECF transporter S component
1745 CAJPRC010000036.1 GCA905373065_00869 CDS open 2303-2794 _na     163_aa mreD Rod shape-determining protein MreD
1746 CAJPRC010000036.1 GCA905373065_00870 CDS open 2791-3057 _na     88_aa chorismate mutase
1747 CAJPRC010000036.1 GCA905373065_00871 CDS open 3054-4157 _na     367_aa Cation diffusion facilitator family transporter
1748 CAJPRC010000036.1 GCA905373065_00872 CDS open 4233-4667 _na     144_aa Organic hydroperoxide resistance transcriptional regulator
1749 CAJPRC010000036.1 GCA905373065_00873 CDS open 4980-5975 _na     331_aa asnA aspartate--ammonia ligase
1750 CAJPRC010000036.1 GCA905373065_00874 CDS open 6304-6516 _na     70_aa hypothetical protein
1751 CAJPRC010000036.1 GCA905373065_00875 CDS open 6920-7222 _na     100_aa padR Transcriptional regulator%2C PadR family
1752 CAJPRC010000036.1 GCA905373065_00876 CDS open 7219-8253 _na     344_aa DUF4097 domain-containing protein
1753 CAJPRC010000036.1 GCA905373065_00877 CDS open 8298-8519 _na     73_aa hypothetical protein
1754 CAJPRC010000036.1 GCA905373065_00878 CDS open 8661-9392 _na     243_aa pflA pyruvate formate-lyase-activating protein
1755 CAJPRC010000036.1 GCA905373065_00879 CDS open 9445-11697 _na     750_aa pflB formate C-acetyltransferase
1756 CAJPRC010000036.1 GCA905373065_00880 CDS open 11908-12699 _na     263_aa ABC transporter%2C substrate-binding protein%2C family 3
1757 CAJPRC010000036.1 GCA905373065_00867 gene open 746-1672
1758 CAJPRC010000036.1 GCA905373065_00868 gene open 1678-2181
1759 CAJPRC010000036.1 GCA905373065_00869 gene open 2303-2794 mreD
1760 CAJPRC010000036.1 GCA905373065_00870 gene open 2791-3057
1761 CAJPRC010000036.1 GCA905373065_00871 gene open 3054-4157
1762 CAJPRC010000036.1 GCA905373065_00872 gene open 4233-4667
1763 CAJPRC010000036.1 GCA905373065_00873 gene open 4980-5975 asnA
1764 CAJPRC010000036.1 GCA905373065_00874 gene open 6304-6516
1765 CAJPRC010000036.1 GCA905373065_00875 gene open 6920-7222 padR
1766 CAJPRC010000036.1 GCA905373065_00876 gene open 7219-8253
1767 CAJPRC010000036.1 GCA905373065_00877 gene open 8298-8519
1768 CAJPRC010000036.1 GCA905373065_00878 gene open 8661-9392 pflA
1769 CAJPRC010000036.1 GCA905373065_00879 gene open 9445-11697 pflB
1770 CAJPRC010000036.1 GCA905373065_00880 gene open 11908-12699
1771 CAJPRC010000037.1 GCA905373065_00881 CDS open 22-1854 _na     610_aa alaS alanine--tRNA ligase
1772 CAJPRC010000037.1 GCA905373065_00882 CDS open 1876-2148 _na     90_aa ireB IreB family regulatory phosphoprotein
1773 CAJPRC010000037.1 GCA905373065_00883 CDS open 2145-2567 _na     140_aa ruvX Holliday junction resolvase RuvX
1774 CAJPRC010000037.1 GCA905373065_00884 CDS open 2570-2812 _na     80_aa hypothetical protein
1775 CAJPRC010000037.1 GCA905373065_00885 CDS open 2809-3873 _na     354_aa Endolytic murein transglycosylase
1776 CAJPRC010000037.1 GCA905373065_00886 CDS open 3873-4334 _na     153_aa Hydrolase%2C NUDIX family
1777 CAJPRC010000037.1 GCA905373065_00887 CDS open 4331-4963 _na     210_aa udk uridine kinase
1778 CAJPRC010000037.1 GCA905373065_00888 CDS open 4987-5460 _na     157_aa greA transcription elongation factor GreA
1779 CAJPRC010000037.1 GCA905373065_00889 CDS open 5505-5960 _na     151_aa ComEA protein
1780 CAJPRC010000037.1 GCA905373065_00890 CDS open 5929-7602 _na     557_aa ComEC/Rec2-like protein
1781 CAJPRC010000037.1 GCA905373065_00891 CDS open 7571-8572 _na     333_aa holA DNA polymerase III subunit delta
1782 CAJPRC010000037.1 GCA905373065_00892 CDS open 8559-9749 _na     396_aa L-serine ammonia-lyase%2C iron-sulfur-dependent%2C subunit alpha
1783 CAJPRC010000037.1 GCA905373065_00893 CDS open 9743-11899 _na     718_aa Peptidase%2C U32 family
1784 CAJPRC010000037.1 GCA905373065_00894 CDS open 11874-12251 _na     125_aa mscL large conductance mechanosensitive channel protein MscL
1785 CAJPRC010000037.1 GCA905373065_00895 CDS open 12362-12625 _na     87_aa hypothetical protein
1786 CAJPRC010000037.1 GCA905373065_00881 gene open 22-1854 alaS
1787 CAJPRC010000037.1 GCA905373065_00882 gene open 1876-2148 ireB
1788 CAJPRC010000037.1 GCA905373065_00883 gene open 2145-2567 ruvX
1789 CAJPRC010000037.1 GCA905373065_00884 gene open 2570-2812
1790 CAJPRC010000037.1 GCA905373065_00885 gene open 2809-3873
1791 CAJPRC010000037.1 GCA905373065_00886 gene open 3873-4334
1792 CAJPRC010000037.1 GCA905373065_00887 gene open 4331-4963 udk
1793 CAJPRC010000037.1 GCA905373065_00888 gene open 4987-5460 greA
1794 CAJPRC010000037.1 GCA905373065_00889 gene open 5505-5960
1795 CAJPRC010000037.1 GCA905373065_00890 gene open 5929-7602
1796 CAJPRC010000037.1 GCA905373065_00891 gene open 7571-8572 holA
1797 CAJPRC010000037.1 GCA905373065_00892 gene open 8559-9749
1798 CAJPRC010000037.1 GCA905373065_00893 gene open 9743-11899
1799 CAJPRC010000037.1 GCA905373065_00894 gene open 11874-12251 mscL
1800 CAJPRC010000037.1 GCA905373065_00895 gene open 12362-12625
1801 CAJPRC010000038.1 GCA905373065_00896 CDS open 3-1142 _na     379_aa dnaJ molecular chaperone DnaJ
1802 CAJPRC010000038.1 GCA905373065_00897 CDS open 1188-3005 _na     605_aa dnaK molecular chaperone DnaK
1803 CAJPRC010000038.1 GCA905373065_00898 CDS open 3019-3546 _na     175_aa grpE nucleotide exchange factor GrpE
1804 CAJPRC010000038.1 GCA905373065_00899 CDS open 3539-4564 _na     341_aa hrcA heat-inducible transcriptional repressor HrcA
1805 CAJPRC010000038.1 GCA905373065_00900 CDS open 4730-5389 _na     219_aa Haloacid dehalogenase-like hydrolase
1806 CAJPRC010000038.1 GCA905373065_00901 CDS open 5440-6000 _na     186_aa lemA LemA family protein
1807 CAJPRC010000038.1 GCA905373065_00902 CDS open 6016-7005 _na     329_aa DUF3137 domain-containing protein
1808 CAJPRC010000038.1 GCA905373065_00903 CDS open 7091-7561 _na     156_aa DUF4367 domain-containing protein
1809 CAJPRC010000038.1 GCA905373065_00904 CDS open 7639-8601 _na     320_aa Oxidoreductase%2C NAD-binding domain protein
1810 CAJPRC010000038.1 GCA905373065_00905 CDS open 8598-9101 _na     167_aa coaD pantetheine-phosphate adenylyltransferase
1811 CAJPRC010000038.1 GCA905373065_00906 CDS open 9098-9649 _na     183_aa rsmD 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD
1812 CAJPRC010000038.1 GCA905373065_00907 CDS open 9646-10842 _na     398_aa ftsW putative peptidoglycan glycosyltransferase FtsW
1813 CAJPRC010000038.1 GCA905373065_00908 CDS open 10925-11491 _na     188_aa def peptide deformylase
1814 CAJPRC010000038.1 GCA905373065_00896 gene open 3-1142 dnaJ
1815 CAJPRC010000038.1 GCA905373065_00897 gene open 1188-3005 dnaK
1816 CAJPRC010000038.1 GCA905373065_00898 gene open 3019-3546 grpE
1817 CAJPRC010000038.1 GCA905373065_00899 gene open 3539-4564 hrcA
1818 CAJPRC010000038.1 GCA905373065_00900 gene open 4730-5389
1819 CAJPRC010000038.1 GCA905373065_00901 gene open 5440-6000 lemA
1820 CAJPRC010000038.1 GCA905373065_00902 gene open 6016-7005
1821 CAJPRC010000038.1 GCA905373065_00903 gene open 7091-7561
1822 CAJPRC010000038.1 GCA905373065_00904 gene open 7639-8601
1823 CAJPRC010000038.1 GCA905373065_00905 gene open 8598-9101 coaD
1824 CAJPRC010000038.1 GCA905373065_00906 gene open 9098-9649 rsmD
1825 CAJPRC010000038.1 GCA905373065_00907 gene open 9646-10842 ftsW
1826 CAJPRC010000038.1 GCA905373065_00908 gene open 10925-11491 def
1827 CAJPRC010000039.1 GCA905373065_00909 CDS open 187-576 _na     129_aa Prepilin-type cleavage/methylation N-terminal domain protein
1828 CAJPRC010000039.1 GCA905373065_00910 CDS open 519-719 _na     66_aa hypothetical protein
1829 CAJPRC010000039.1 GCA905373065_00911 CDS open 736-1005 _na     89_aa prepilin-type N-terminal cleavage/methylation domain-containing protein
1830 CAJPRC010000039.1 GCA905373065_00912 CDS open 1019-1321 _na     100_aa comGC competence type IV pilus major pilin ComGC
1831 CAJPRC010000039.1 GCA905373065_00913 CDS open 1336-2283 _na     315_aa Bacterial type II secretion system domain protein F
1832 CAJPRC010000039.1 GCA905373065_00914 CDS open 2297-3244 _na     315_aa Type II/IV secretion system protein
1833 CAJPRC010000039.1 GCA905373065_00915 CDS open 3298-3888 _na     196_aa Metallo-beta-lactamase domain protein
1834 CAJPRC010000039.1 GCA905373065_00916 CDS open 3918-4070 _na     50_aa rpmG 50S ribosomal protein L33
1835 CAJPRC010000039.1 GCA905373065_00917 CDS open 4169-5245 _na     358_aa ispG flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase
1836 CAJPRC010000039.1 GCA905373065_00918 CDS open 5242-6612 _na     456_aa DEAD/DEAH box helicase
1837 CAJPRC010000039.1 GCA905373065_00919 CDS open 6668-7570 _na     300_aa ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase
1838 CAJPRC010000039.1 GCA905373065_00920 CDS open 7550-8245 _na     231_aa Pseudouridine synthase
1839 CAJPRC010000039.1 GCA905373065_00921 CDS open 8245-9891 _na     548_aa Polysaccharide biosynthesis protein
1840 CAJPRC010000039.1 GCA905373065_00922 CDS open 9903-10394 _na     163_aa Lipoprotein
1841 CAJPRC010000039.1 GCA905373065_00923 CDS open 10582-11013 _na     143_aa hypothetical protein
1842 CAJPRC010000039.1 GCA905373065_00924 CDS open 11258-11794 _na     178_aa tyrS tyrosine--tRNA ligase
1843 CAJPRC010000039.1 GCA905373065_00909 gene open 187-576
1844 CAJPRC010000039.1 GCA905373065_00910 gene open 519-719
1845 CAJPRC010000039.1 GCA905373065_00911 gene open 736-1005
1846 CAJPRC010000039.1 GCA905373065_00912 gene open 1019-1321 comGC
1847 CAJPRC010000039.1 GCA905373065_00913 gene open 1336-2283
1848 CAJPRC010000039.1 GCA905373065_00914 gene open 2297-3244
1849 CAJPRC010000039.1 GCA905373065_00915 gene open 3298-3888
1850 CAJPRC010000039.1 GCA905373065_00916 gene open 3918-4070 rpmG
1851 CAJPRC010000039.1 GCA905373065_00917 gene open 4169-5245 ispG
1852 CAJPRC010000039.1 GCA905373065_00918 gene open 5242-6612
1853 CAJPRC010000039.1 GCA905373065_00919 gene open 6668-7570 ispH
1854 CAJPRC010000039.1 GCA905373065_00920 gene open 7550-8245
1855 CAJPRC010000039.1 GCA905373065_00921 gene open 8245-9891
1856 CAJPRC010000039.1 GCA905373065_00922 gene open 9903-10394
1857 CAJPRC010000039.1 GCA905373065_00923 gene open 10582-11013
1858 CAJPRC010000039.1 GCA905373065_00924 gene open 11258-11794 tyrS
1859 CAJPRC010000040.1 GCA905373065_00925 CDS open 1203-1568 _na     121_aa hypothetical protein
1860 CAJPRC010000040.1 GCA905373065_00926 CDS open 1745-2467 _na     240_aa NAD-dependent protein deacylase
1861 CAJPRC010000040.1 GCA905373065_00927 CDS open 2673-4601 _na     642_aa Alpha amylase%2C catalytic domain protein
1862 CAJPRC010000040.1 GCA905373065_00928 CDS open 4613-6181 _na     522_aa glgA glycogen synthase GlgA
1863 CAJPRC010000040.1 GCA905373065_00929 CDS open 6187-7281 _na     364_aa glgD glucose-1-phosphate adenylyltransferase subunit GlgD
1864 CAJPRC010000040.1 GCA905373065_00930 CDS open 7293-8426 _na     377_aa glgC glucose-1-phosphate adenylyltransferase
1865 CAJPRC010000040.1 GCA905373065_00931 CDS open 8452-10848 _na     798_aa Alpha-1%2C4 glucan phosphorylase
1866 CAJPRC010000040.1 GCA905373065_00932 CDS open 10867-11721 _na     284_aa hypothetical protein
1867 CAJPRC010000040.1 GCA905373065_00925 gene open 1203-1568
1868 CAJPRC010000040.1 GCA905373065_00926 gene open 1745-2467
1869 CAJPRC010000040.1 GCA905373065_00927 gene open 2673-4601
1870 CAJPRC010000040.1 GCA905373065_00928 gene open 4613-6181 glgA
1871 CAJPRC010000040.1 GCA905373065_00929 gene open 6187-7281 glgD
1872 CAJPRC010000040.1 GCA905373065_00930 gene open 7293-8426 glgC
1873 CAJPRC010000040.1 GCA905373065_00931 gene open 8452-10848
1874 CAJPRC010000040.1 GCA905373065_00932 gene open 10867-11721
1875 CAJPRC010000041.1 repeat_region open 284-527 CRISPR array with 4 repeats of length 37%2C consensus sequence AGTTTTTGTACTCTAAAGTTTTAAGTGAATGTAAAAC and spacer length 29
1876 CAJPRC010000041.1 GCA905373065_00935 CDS open 938-2293 _na     451_aa mgtE magnesium transporter
1877 CAJPRC010000041.1 GCA905373065_00936 CDS open 2276-3295 _na     339_aa Methyltransferase
1878 CAJPRC010000041.1 GCA905373065_00937 CDS open 3347-4615 _na     422_aa Citrate transporter
1879 CAJPRC010000041.1 GCA905373065_00938 CDS open 4676-5101 _na     141_aa Flavodoxin domain-containing protein
1880 CAJPRC010000041.1 GCA905373065_00939 CDS open 5227-6996 _na     589_aa Urocanate reductase
1881 CAJPRC010000041.1 GCA905373065_00940 CDS open 7065-8672 _na     535_aa Histidine kinase
1882 CAJPRC010000041.1 GCA905373065_00941 CDS open 8675-9397 _na     240_aa Response regulator receiver domain protein
1883 CAJPRC010000041.1 GCA905373065_00942 CDS open 9432-10037 _na     201_aa plsY glycerol-3-phosphate 1-O-acyltransferase PlsY
1884 CAJPRC010000041.1 GCA905373065_00935 gene open 938-2293 mgtE
1885 CAJPRC010000041.1 GCA905373065_00936 gene open 2276-3295
1886 CAJPRC010000041.1 GCA905373065_00937 gene open 3347-4615
1887 CAJPRC010000041.1 GCA905373065_00938 gene open 4676-5101
1888 CAJPRC010000041.1 GCA905373065_00939 gene open 5227-6996
1889 CAJPRC010000041.1 GCA905373065_00940 gene open 7065-8672
1890 CAJPRC010000041.1 GCA905373065_00941 gene open 8675-9397
1891 CAJPRC010000041.1 GCA905373065_00942 gene open 9432-10037 plsY
1892 CAJPRC010000041.1 GCA905373065_00933 gene open 690-760 trnC
1893 CAJPRC010000041.1 GCA905373065_00934 gene open 766-848 trnL
1894 CAJPRC010000041.1 GCA905373065_00933 tRNA open 690-760 trnC tRNA-Cys(gca)
1895 CAJPRC010000041.1 GCA905373065_00934 tRNA open 766-848 trnL tRNA-Leu(taa)
1896 CAJPRC010000042.1 GCA905373065_00943 CDS open 114-6005 _na     1963_aa Repeat protein
1897 CAJPRC010000042.1 GCA905373065_00944 CDS open 6224-7033 _na     269_aa O-methyltransferase domain protein
1898 CAJPRC010000042.1 GCA905373065_00946 CDS open 7421-8779 _na     452_aa Carboxylic ester hydrolase
1899 CAJPRC010000042.1 GCA905373065_00947 CDS open 8784-9446 _na     220_aa DUF1275 domain-containing protein
1900 CAJPRC010000042.1 GCA905373065_00948 CDS open 9492-10430 _na     312_aa GTP-binding protein
1901 CAJPRC010000042.1 GCA905373065_00949 CDS open 10430-11314 _na     294_aa hypothetical protein
1902 CAJPRC010000042.1 GCA905373065_00943 gene open 114-6005
1903 CAJPRC010000042.1 GCA905373065_00944 gene open 6224-7033
1904 CAJPRC010000042.1 GCA905373065_00946 gene open 7421-8779
1905 CAJPRC010000042.1 GCA905373065_00947 gene open 8784-9446
1906 CAJPRC010000042.1 GCA905373065_00948 gene open 9492-10430
1907 CAJPRC010000042.1 GCA905373065_00949 gene open 10430-11314
1908 CAJPRC010000042.1 GCA905373065_00945 gene open 7168-7241 trnR
1909 CAJPRC010000042.1 GCA905373065_00945 tRNA open 7168-7241 trnR tRNA-Arg(cct)
1910 CAJPRC010000043.1 GCA905373065_00950 CDS open 3-680 _na     225_aa DEAD/DEAH box helicase
1911 CAJPRC010000043.1 GCA905373065_00951 CDS open 743-3322 _na     859_aa Putative translation elongation factor G
1912 CAJPRC010000043.1 GCA905373065_00952 CDS open 3412-3999 _na     195_aa DUF4352 domain-containing protein
1913 CAJPRC010000043.1 GCA905373065_00953 CDS open 4018-7047 _na     1009_aa Mannosyl-glycoprotein endo-beta-N-acetylglucosaminidase
1914 CAJPRC010000043.1 GCA905373065_00954 CDS open 7157-7834 _na     225_aa B3/B4 tRNA-binding domain-containing protein
1915 CAJPRC010000043.1 GCA905373065_00955 CDS open 7891-8727 _na     278_aa degV EDD domain protein%2C DegV family
1916 CAJPRC010000043.1 GCA905373065_00956 CDS open 8765-9490 _na     241_aa B3/4 domain protein
1917 CAJPRC010000043.1 GCA905373065_00957 CDS open 9522-11234 _na     570_aa Phosphoenolpyruvate carboxykinase (ATP)
1918 CAJPRC010000043.1 GCA905373065_00950 gene open 3-680
1919 CAJPRC010000043.1 GCA905373065_00951 gene open 743-3322
1920 CAJPRC010000043.1 GCA905373065_00952 gene open 3412-3999
1921 CAJPRC010000043.1 GCA905373065_00953 gene open 4018-7047
1922 CAJPRC010000043.1 GCA905373065_00954 gene open 7157-7834
1923 CAJPRC010000043.1 GCA905373065_00955 gene open 7891-8727 degV
1924 CAJPRC010000043.1 GCA905373065_00956 gene open 8765-9490
1925 CAJPRC010000043.1 GCA905373065_00957 gene open 9522-11234
1926 CAJPRC010000044.1 GCA905373065_00958 CDS open 1177-2673 _na     498_aa Metal-dependent carboxypeptidase
1927 CAJPRC010000044.1 GCA905373065_00959 CDS open 2926-3990 _na     354_aa Ketopantoate reductase PanE/ApbA
1928 CAJPRC010000044.1 GCA905373065_00960 CDS open 4138-5079 _na     313_aa nupQ Branched-chain amino acid ABC transporter%2C permease protein
1929 CAJPRC010000044.1 GCA905373065_00961 CDS open 5076-6191 _na     371_aa nupP Branched-chain amino acid ABC transporter%2C permease protein
1930 CAJPRC010000044.1 GCA905373065_00962 CDS open 6181-7728 _na     515_aa nupO ABC transporter%2C ATP-binding protein
1931 CAJPRC010000044.1 GCA905373065_00963 CDS open 7841-9037 _na     398_aa Basic membrane protein
1932 CAJPRC010000044.1 GCA905373065_00964 CDS open 9164-10489 _na     441_aa rlmD 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD
1933 CAJPRC010000044.1 GCA905373065_00958 gene open 1177-2673
1934 CAJPRC010000044.1 GCA905373065_00959 gene open 2926-3990
1935 CAJPRC010000044.1 GCA905373065_00960 gene open 4138-5079 nupQ
1936 CAJPRC010000044.1 GCA905373065_00961 gene open 5076-6191 nupP
1937 CAJPRC010000044.1 GCA905373065_00962 gene open 6181-7728 nupO
1938 CAJPRC010000044.1 GCA905373065_00963 gene open 7841-9037
1939 CAJPRC010000044.1 GCA905373065_00964 gene open 9164-10489 rlmD
1940 CAJPRC010000045.1 GCA905373065_00965 CDS open 191-457 _na     88_aa ptsH phosphocarrier protein HPr
1941 CAJPRC010000045.1 GCA905373065_00966 CDS open 511-2193 _na     560_aa Phosphoglucomutase
1942 CAJPRC010000045.1 GCA905373065_00967 CDS open 2193-3986 _na     597_aa DUF885 domain-containing protein
1943 CAJPRC010000045.1 GCA905373065_00968 CDS open 3979-4632 _na     217_aa uracil-DNA glycosylase
1944 CAJPRC010000045.1 GCA905373065_00969 CDS open 4692-4862 _na     56_aa hypothetical protein
1945 CAJPRC010000045.1 GCA905373065_00970 CDS open 4867-5355 _na     162_aa DUF304 domain-containing protein
1946 CAJPRC010000045.1 GCA905373065_00971 CDS open 5745-5924 _na     59_aa hypothetical protein
1947 CAJPRC010000045.1 GCA905373065_00972 CDS open 6300-7478 _na     392_aa pgk Phosphoglycerate kinase
1948 CAJPRC010000045.1 GCA905373065_00973 CDS open 7516-8232 _na     238_aa tpiA triose-phosphate isomerase
1949 CAJPRC010000045.1 GCA905373065_00974 CDS open 8259-9608 _na     449_aa eno phosphopyruvate hydratase
1950 CAJPRC010000045.1 GCA905373065_00975 CDS open 9711-10346 _na     211_aa Bacteriocin transport accessory protein
1951 CAJPRC010000045.1 GCA905373065_00976 CDS open 10402-10635 _na     77_aa secG preprotein translocase subunit SecG
1952 CAJPRC010000045.1 GCA905373065_00965 gene open 191-457 ptsH
1953 CAJPRC010000045.1 GCA905373065_00966 gene open 511-2193
1954 CAJPRC010000045.1 GCA905373065_00967 gene open 2193-3986
1955 CAJPRC010000045.1 GCA905373065_00968 gene open 3979-4632
1956 CAJPRC010000045.1 GCA905373065_00969 gene open 4692-4862
1957 CAJPRC010000045.1 GCA905373065_00970 gene open 4867-5355
1958 CAJPRC010000045.1 GCA905373065_00971 gene open 5745-5924
1959 CAJPRC010000045.1 GCA905373065_00972 gene open 6300-7478 pgk
1960 CAJPRC010000045.1 GCA905373065_00973 gene open 7516-8232 tpiA
1961 CAJPRC010000045.1 GCA905373065_00974 gene open 8259-9608 eno
1962 CAJPRC010000045.1 GCA905373065_00975 gene open 9711-10346
1963 CAJPRC010000045.1 GCA905373065_00976 gene open 10402-10635 secG
1964 CAJPRC010000046.1 GCA905373065_00977 CDS open 327-1139 _na     270_aa potC ABC transporter%2C permease protein
1965 CAJPRC010000046.1 GCA905373065_00978 CDS open 1139-1918 _na     259_aa ABC transporter%2C permease protein
1966 CAJPRC010000046.1 GCA905373065_00979 CDS open 1918-3492 _na     524_aa potA Spermidine/putrescine import ATP-binding protein PotA
1967 CAJPRC010000046.1 GCA905373065_00980 CDS open 3502-4044 _na     180_aa hipB DNA-binding helix-turn-helix protein
1968 CAJPRC010000046.1 GCA905373065_00981 CDS open 4190-4498 _na     102_aa trxA thioredoxin
1969 CAJPRC010000046.1 GCA905373065_00982 CDS open 4558-5289 _na     243_aa nagB glucosamine-6-phosphate deaminase
1970 CAJPRC010000046.1 GCA905373065_00983 CDS open 5301-6113 _na     270_aa Aldose 1-epimerase
1971 CAJPRC010000046.1 GCA905373065_00984 CDS open 6204-7205 _na     333_aa pta phosphate acetyltransferase
1972 CAJPRC010000046.1 GCA905373065_00985 CDS open 7283-7837 _na     184_aa HAD phosphoserine phosphatase-like hydrolase%2C family IB
1973 CAJPRC010000046.1 GCA905373065_00986 CDS open 7834-9366 _na     510_aa hypothetical protein
1974 CAJPRC010000046.1 GCA905373065_00987 CDS open 9538-9651 _na     37_aa hypothetical protein
1975 CAJPRC010000046.1 GCA905373065_00988 CDS open 9693-10142 _na     149_aa hypothetical protein
1976 CAJPRC010000046.1 GCA905373065_00989 CDS open 10253-10540 _na     95_aa cueR Putative HTH-type transcriptional regulator CueR
1977 CAJPRC010000046.1 GCA905373065_00977 gene open 327-1139 potC
1978 CAJPRC010000046.1 GCA905373065_00978 gene open 1139-1918
1979 CAJPRC010000046.1 GCA905373065_00979 gene open 1918-3492 potA
1980 CAJPRC010000046.1 GCA905373065_00980 gene open 3502-4044 hipB
1981 CAJPRC010000046.1 GCA905373065_00981 gene open 4190-4498 trxA
1982 CAJPRC010000046.1 GCA905373065_00982 gene open 4558-5289 nagB
1983 CAJPRC010000046.1 GCA905373065_00983 gene open 5301-6113
1984 CAJPRC010000046.1 GCA905373065_00984 gene open 6204-7205 pta
1985 CAJPRC010000046.1 GCA905373065_00985 gene open 7283-7837
1986 CAJPRC010000046.1 GCA905373065_00986 gene open 7834-9366
1987 CAJPRC010000046.1 GCA905373065_00987 gene open 9538-9651
1988 CAJPRC010000046.1 GCA905373065_00988 gene open 9693-10142
1989 CAJPRC010000046.1 GCA905373065_00989 gene open 10253-10540 cueR
1990 CAJPRC010000047.1 GCA905373065_00990 CDS open 253-1773 _na     506_aa Peptidase%2C S41 family
1991 CAJPRC010000047.1 GCA905373065_00991 CDS open 1822-2721 _na     299_aa ftsX permease-like cell division protein FtsX
1992 CAJPRC010000047.1 GCA905373065_00992 CDS open 2702-3394 _na     230_aa ftsE cell division ATP-binding protein FtsE
1993 CAJPRC010000047.1 GCA905373065_00993 CDS open 3406-4248 _na     280_aa DUF2179 domain-containing protein
1994 CAJPRC010000047.1 GCA905373065_00994 CDS open 4369-5580 _na     403_aa femB Putative aminoacyltransferase FemB
1995 CAJPRC010000047.1 GCA905373065_00995 CDS open 5617-7083 _na     488_aa Peptidase%2C M23 family
1996 CAJPRC010000047.1 GCA905373065_00996 CDS open 7100-7573 _na     157_aa ybaK Cys-tRNA(Pro) deacylase
1997 CAJPRC010000047.1 GCA905373065_00997 CDS open 7648-8364 _na     238_aa thiF ThiF family protein
1998 CAJPRC010000047.1 GCA905373065_00998 CDS open 8722-8916 _na     64_aa copG Ribbon-helix-helix protein CopG domain-containing protein
1999 CAJPRC010000047.1 GCA905373065_00999 CDS open 8859-8993 _na     44_aa hypothetical protein
2000 CAJPRC010000047.1 GCA905373065_01001 CDS open 9501-10418 _na     305_aa Pyridine nucleotide-disulfide oxidoreductase