HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Schaalia cardiffensis (GCA_905373095.1)

Select a Genome:
BAKTA Annotations for GCA_905373095.1
Genome Selected: Schaalia cardiffensis
ContigsBases CDSrRNA tmRNAtRNA
86 2,144,927 1825 0 1 39
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3744 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:5]    |    Number of Records Found: 3744 [8 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
2001 CAJPRS010000020.1 GCA905373095_01008 CDS open 21278-23197 _na     639_aa typA translational GTPase TypA
2002 CAJPRS010000020.1 GCA905373095_01009 CDS open 23913-24236 _na     107_aa fdxA ferredoxin
2003 CAJPRS010000020.1 GCA905373095_01010 CDS open 24253-25395 _na     380_aa dapC succinyldiaminopimelate transaminase
2004 CAJPRS010000020.1 GCA905373095_01011 CDS open 25527-26855 _na     442_aa citrate synthase
2005 CAJPRS010000020.1 GCA905373095_01012 CDS open 27093-28076 _na     327_aa dapD 2%2C3%2C4%2C5-tetrahydropyridine-2%2C6-dicarboxylate N-succinyltransferase
2006 CAJPRS010000020.1 GCA905373095_01013 CDS open 28332-29024 _na     230_aa Nucleoside triphosphate pyrophosphatase
2007 CAJPRS010000020.1 GCA905373095_01014 CDS open 29381-30421 _na     346_aa Adenylate cyclase
2008 CAJPRS010000020.1 GCA905373095_01015 CDS open 30540-31250 _na     236_aa DNA-binding response regulator
2009 CAJPRS010000020.1 GCA905373095_01016 CDS open 31449-32774 _na     441_aa histidine kinase
2010 CAJPRS010000020.1 GCA905373095_01017 CDS open 32822-33976 _na     384_aa 5-(carboxyamino)imidazole ribonucleotide synthase
2011 CAJPRS010000020.1 GCA905373095_01018 CDS open 34081-34650 _na     189_aa N5-carboxyaminoimidazole ribonucleotide mutase
2012 CAJPRS010000020.1 GCA905373095_01019 CDS open 34906-35916 _na     336_aa Cell envelope-related transcriptional attenuator domain-containing protein
2013 CAJPRS010000020.1 GCA905373095_00990 gene open 20-553
2014 CAJPRS010000020.1 GCA905373095_00991 gene open 1575-2054 greA
2015 CAJPRS010000020.1 GCA905373095_00992 gene open 2220-2900
2016 CAJPRS010000020.1 GCA905373095_00993 gene open 3170-3928
2017 CAJPRS010000020.1 GCA905373095_00994 gene open 4204-4512
2018 CAJPRS010000020.1 GCA905373095_00995 gene open 4437-5372
2019 CAJPRS010000020.1 GCA905373095_00996 gene open 5417-5692
2020 CAJPRS010000020.1 GCA905373095_00997 gene open 5694-7781 xseA
2021 CAJPRS010000020.1 GCA905373095_00998 gene open 8245-9321
2022 CAJPRS010000020.1 GCA905373095_00999 gene open 10045-11235
2023 CAJPRS010000020.1 GCA905373095_01000 gene open 11568-12659 ychF
2024 CAJPRS010000020.1 GCA905373095_01001 gene open 13244-14851
2025 CAJPRS010000020.1 GCA905373095_01002 gene open 14802-16541
2026 CAJPRS010000020.1 GCA905373095_01003 gene open 16631-17014
2027 CAJPRS010000020.1 GCA905373095_01004 gene open 16869-17222
2028 CAJPRS010000020.1 GCA905373095_01005 gene open 17315-18286
2029 CAJPRS010000020.1 GCA905373095_01006 gene open 18544-20004
2030 CAJPRS010000020.1 GCA905373095_01007 gene open 20423-21019
2031 CAJPRS010000020.1 GCA905373095_01008 gene open 21278-23197 typA
2032 CAJPRS010000020.1 GCA905373095_01009 gene open 23913-24236 fdxA
2033 CAJPRS010000020.1 GCA905373095_01010 gene open 24253-25395 dapC
2034 CAJPRS010000020.1 GCA905373095_01011 gene open 25527-26855
2035 CAJPRS010000020.1 GCA905373095_01012 gene open 27093-28076 dapD
2036 CAJPRS010000020.1 GCA905373095_01013 gene open 28332-29024
2037 CAJPRS010000020.1 GCA905373095_01014 gene open 29381-30421
2038 CAJPRS010000020.1 GCA905373095_01015 gene open 30540-31250
2039 CAJPRS010000020.1 GCA905373095_01016 gene open 31449-32774
2040 CAJPRS010000020.1 GCA905373095_01017 gene open 32822-33976
2041 CAJPRS010000020.1 GCA905373095_01018 gene open 34081-34650
2042 CAJPRS010000020.1 GCA905373095_01019 gene open 34906-35916
2043 CAJPRS010000021.1 GCA905373095_01020 CDS open 567-1586 _na     339_aa scrR Sucrose operon repressor ScrR
2044 CAJPRS010000021.1 GCA905373095_01021 CDS open 1862-3919 _na     685_aa protein-N(pi)-phosphohistidine--sucrose phosphotransferase
2045 CAJPRS010000021.1 GCA905373095_01022 CDS open 4154-5725 _na     523_aa beta-fructofuranosidase
2046 CAJPRS010000021.1 GCA905373095_01023 CDS open 5865-8177 _na     770_aa hypothetical protein
2047 CAJPRS010000021.1 GCA905373095_01025 CDS open 8900-13579 _na     1559_aa Activator of 2-hydroxyglutaryl-CoA dehydratase (HSP70-class ATPase domain)
2048 CAJPRS010000021.1 GCA905373095_01026 CDS open 13955-14623 _na     222_aa TetR/AcrR family transcriptional regulator
2049 CAJPRS010000021.1 GCA905373095_01027 CDS open 14842-16920 _na     692_aa modB molybdate ABC transporter permease subunit
2050 CAJPRS010000021.1 GCA905373095_01028 CDS open 16917-17720 _na     267_aa modA molybdate ABC transporter substrate-binding protein
2051 CAJPRS010000021.1 GCA905373095_01029 CDS open 18004-18516 _na     170_aa MoaB/Mog domain-containing protein
2052 CAJPRS010000021.1 GCA905373095_01030 CDS open 18523-19314 _na     263_aa tetR TetR family transcriptional regulator
2053 CAJPRS010000021.1 GCA905373095_01031 CDS open 19426-20487 _na     353_aa site-specific DNA-methyltransferase (adenine-specific)
2054 CAJPRS010000021.1 GCA905373095_01032 CDS open 20502-21374 _na     290_aa Restriction endonuclease type II DpnII-like domain-containing protein
2055 CAJPRS010000021.1 GCA905373095_01033 CDS open 21776-22438 _na     220_aa Biotin--[acetyl-CoA-carboxylase] ligase
2056 CAJPRS010000021.1 GCA905373095_01034 CDS open 22435-24366 _na     643_aa biotin carboxylase
2057 CAJPRS010000021.1 GCA905373095_01035 CDS open 24363-26060 _na     565_aa Propionyl-CoA carboxylase
2058 CAJPRS010000021.1 GCA905373095_01036 CDS open 26341-26544 _na     67_aa hypothetical protein
2059 CAJPRS010000021.1 GCA905373095_01037 CDS open 26701-28104 _na     467_aa hypothetical protein
2060 CAJPRS010000021.1 GCA905373095_01038 CDS open 28120-28338 _na     72_aa hypothetical protein
2061 CAJPRS010000021.1 GCA905373095_01039 CDS open 28357-28962 _na     201_aa hypothetical protein
2062 CAJPRS010000021.1 GCA905373095_01040 CDS open 29044-29367 _na     107_aa hypothetical protein
2063 CAJPRS010000021.1 GCA905373095_01041 CDS open 29839-31029 _na     396_aa hypothetical protein
2064 CAJPRS010000021.1 GCA905373095_01042 CDS open 31873-32577 _na     234_aa hypothetical protein
2065 CAJPRS010000021.1 GCA905373095_01043 CDS open 32770-33168 _na     132_aa hypothetical protein
2066 CAJPRS010000021.1 GCA905373095_01044 CDS open 33277-34221 _na     314_aa hypothetical protein
2067 CAJPRS010000021.1 GCA905373095_01020 gene open 567-1586 scrR
2068 CAJPRS010000021.1 GCA905373095_01021 gene open 1862-3919
2069 CAJPRS010000021.1 GCA905373095_01022 gene open 4154-5725
2070 CAJPRS010000021.1 GCA905373095_01023 gene open 5865-8177
2071 CAJPRS010000021.1 GCA905373095_01025 gene open 8900-13579
2072 CAJPRS010000021.1 GCA905373095_01026 gene open 13955-14623
2073 CAJPRS010000021.1 GCA905373095_01027 gene open 14842-16920 modB
2074 CAJPRS010000021.1 GCA905373095_01028 gene open 16917-17720 modA
2075 CAJPRS010000021.1 GCA905373095_01029 gene open 18004-18516
2076 CAJPRS010000021.1 GCA905373095_01030 gene open 18523-19314 tetR
2077 CAJPRS010000021.1 GCA905373095_01031 gene open 19426-20487
2078 CAJPRS010000021.1 GCA905373095_01032 gene open 20502-21374
2079 CAJPRS010000021.1 GCA905373095_01033 gene open 21776-22438
2080 CAJPRS010000021.1 GCA905373095_01034 gene open 22435-24366
2081 CAJPRS010000021.1 GCA905373095_01035 gene open 24363-26060
2082 CAJPRS010000021.1 GCA905373095_01036 gene open 26341-26544
2083 CAJPRS010000021.1 GCA905373095_01037 gene open 26701-28104
2084 CAJPRS010000021.1 GCA905373095_01038 gene open 28120-28338
2085 CAJPRS010000021.1 GCA905373095_01039 gene open 28357-28962
2086 CAJPRS010000021.1 GCA905373095_01040 gene open 29044-29367
2087 CAJPRS010000021.1 GCA905373095_01041 gene open 29839-31029
2088 CAJPRS010000021.1 GCA905373095_01042 gene open 31873-32577
2089 CAJPRS010000021.1 GCA905373095_01043 gene open 32770-33168
2090 CAJPRS010000021.1 GCA905373095_01044 gene open 33277-34221
2091 CAJPRS010000021.1 GCA905373095_01024 gene open 8472-8561 trnS
2092 CAJPRS010000021.1 GCA905373095_01024 tRNA open 8472-8561 trnS tRNA-Ser(cga)
2093 CAJPRS010000022.1 GCA905373095_01045 CDS open 491-1753 _na     420_aa tyrS tyrosine--tRNA ligase
2094 CAJPRS010000022.1 GCA905373095_01046 CDS open 1836-3272 _na     478_aa argH argininosuccinate lyase
2095 CAJPRS010000022.1 GCA905373095_01047 CDS open 3315-4715 _na     466_aa O-antigen ligase-related domain-containing protein
2096 CAJPRS010000022.1 GCA905373095_01048 CDS open 5066-6289 _na     407_aa argG argininosuccinate synthase
2097 CAJPRS010000022.1 GCA905373095_01049 CDS open 6334-6849 _na     171_aa Arginine repressor
2098 CAJPRS010000022.1 GCA905373095_01050 CDS open 6846-8108 _na     420_aa acetylornithine transaminase
2099 CAJPRS010000022.1 GCA905373095_01051 CDS open 8150-9493 _na     447_aa argJ bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ
2100 CAJPRS010000022.1 GCA905373095_01052 CDS open 9490-10563 _na     357_aa argC N-acetyl-gamma-glutamyl-phosphate reductase
2101 CAJPRS010000022.1 GCA905373095_01053 CDS open 10673-11233 _na     186_aa Flavodoxin-like domain-containing protein
2102 CAJPRS010000022.1 GCA905373095_01054 CDS open 11285-13933 _na     882_aa pheT phenylalanine--tRNA ligase subunit beta
2103 CAJPRS010000022.1 GCA905373095_01055 CDS open 13935-15020 _na     361_aa pheS phenylalanine--tRNA ligase subunit alpha
2104 CAJPRS010000022.1 GCA905373095_01056 CDS open 15495-16382 _na     295_aa map type I methionyl aminopeptidase
2105 CAJPRS010000022.1 GCA905373095_01057 CDS open 17008-17757 _na     249_aa ppgK polyphosphate--glucose phosphotransferase
2106 CAJPRS010000022.1 GCA905373095_01058 CDS open 17982-20672 _na     896_aa acnA aconitate hydratase AcnA
2107 CAJPRS010000022.1 GCA905373095_01059 CDS open 21110-22429 _na     439_aa rumA 23S rRNA (Uracil-5-)-methyltransferase RumA
2108 CAJPRS010000022.1 GCA905373095_01060 CDS open 22496-24460 _na     654_aa APC family amino acid transporter
2109 CAJPRS010000022.1 GCA905373095_01061 CDS open 24828-25478 _na     216_aa trkA Trk system potassium uptake protein TrkA
2110 CAJPRS010000022.1 GCA905373095_01062 CDS open 25480-26184 _na     234_aa trkA Trk system potassium uptake protein TrkA
2111 CAJPRS010000022.1 GCA905373095_01063 CDS open 26368-27063 _na     231_aa Putative transmembrane protein
2112 CAJPRS010000022.1 GCA905373095_01064 CDS open 27060-27455 _na     131_aa DNA-binding protein
2113 CAJPRS010000022.1 GCA905373095_01065 CDS open 27448-28095 _na     215_aa DUF3710 domain-containing protein
2114 CAJPRS010000022.1 GCA905373095_01066 CDS open 28106-28438 _na     110_aa dUTPase
2115 CAJPRS010000022.1 GCA905373095_01067 CDS open 28585-29784 _na     399_aa sepH septation protein SepH
2116 CAJPRS010000022.1 GCA905373095_01068 CDS open 29953-31110 _na     385_aa Type I phosphodiesterase/nucleotide pyrophosphatase
2117 CAJPRS010000022.1 GCA905373095_01069 CDS open 31107-31580 _na     157_aa Phosphodiesterase
2118 CAJPRS010000022.1 GCA905373095_01070 CDS open 31710-34181 _na     823_aa DNA topoisomerase (ATP-hydrolyzing)
2119 CAJPRS010000022.1 GCA905373095_01045 gene open 491-1753 tyrS
2120 CAJPRS010000022.1 GCA905373095_01046 gene open 1836-3272 argH
2121 CAJPRS010000022.1 GCA905373095_01047 gene open 3315-4715
2122 CAJPRS010000022.1 GCA905373095_01048 gene open 5066-6289 argG
2123 CAJPRS010000022.1 GCA905373095_01049 gene open 6334-6849
2124 CAJPRS010000022.1 GCA905373095_01050 gene open 6846-8108
2125 CAJPRS010000022.1 GCA905373095_01051 gene open 8150-9493 argJ
2126 CAJPRS010000022.1 GCA905373095_01052 gene open 9490-10563 argC
2127 CAJPRS010000022.1 GCA905373095_01053 gene open 10673-11233
2128 CAJPRS010000022.1 GCA905373095_01054 gene open 11285-13933 pheT
2129 CAJPRS010000022.1 GCA905373095_01055 gene open 13935-15020 pheS
2130 CAJPRS010000022.1 GCA905373095_01056 gene open 15495-16382 map
2131 CAJPRS010000022.1 GCA905373095_01057 gene open 17008-17757 ppgK
2132 CAJPRS010000022.1 GCA905373095_01058 gene open 17982-20672 acnA
2133 CAJPRS010000022.1 GCA905373095_01059 gene open 21110-22429 rumA
2134 CAJPRS010000022.1 GCA905373095_01060 gene open 22496-24460
2135 CAJPRS010000022.1 GCA905373095_01061 gene open 24828-25478 trkA
2136 CAJPRS010000022.1 GCA905373095_01062 gene open 25480-26184 trkA
2137 CAJPRS010000022.1 GCA905373095_01063 gene open 26368-27063
2138 CAJPRS010000022.1 GCA905373095_01064 gene open 27060-27455
2139 CAJPRS010000022.1 GCA905373095_01065 gene open 27448-28095
2140 CAJPRS010000022.1 GCA905373095_01066 gene open 28106-28438
2141 CAJPRS010000022.1 GCA905373095_01067 gene open 28585-29784 sepH
2142 CAJPRS010000022.1 GCA905373095_01068 gene open 29953-31110
2143 CAJPRS010000022.1 GCA905373095_01069 gene open 31107-31580
2144 CAJPRS010000022.1 GCA905373095_01070 gene open 31710-34181
2145 CAJPRS010000023.1 GCA905373095_01071 CDS open 83-904 _na     273_aa hypothetical protein
2146 CAJPRS010000023.1 GCA905373095_01072 CDS open 1009-2193 _na     394_aa cysteine desulfurase
2147 CAJPRS010000023.1 GCA905373095_01073 CDS open 2271-3269 _na     332_aa Electron transfer flavoprotein alpha subunit
2148 CAJPRS010000023.1 GCA905373095_01074 CDS open 3271-4089 _na     272_aa Electron transfer flavoprotein beta subunit
2149 CAJPRS010000023.1 GCA905373095_01075 CDS open 4282-6573 _na     763_aa glgX glycogen debranching protein GlgX
2150 CAJPRS010000023.1 GCA905373095_01076 CDS open 6756-7856 _na     366_aa trpS tryptophan--tRNA ligase
2151 CAJPRS010000023.1 GCA905373095_01077 CDS open 8171-10204 _na     677_aa Alpha-1%2C4-glucan:maltose-1-phosphate maltosyltransferase
2152 CAJPRS010000023.1 GCA905373095_01078 CDS open 10415-12598 _na     727_aa glgB 1%2C4-alpha-glucan branching protein GlgB
2153 CAJPRS010000023.1 GCA905373095_01079 CDS open 12850-14292 _na     480_aa 1%2C4-alpha-glucan branching enzyme
2154 CAJPRS010000023.1 GCA905373095_01080 CDS open 14349-15221 _na     290_aa Thioredoxin domain-containing protein
2155 CAJPRS010000023.1 GCA905373095_01081 CDS open 15249-16253 _na     334_aa Lipoprotein
2156 CAJPRS010000023.1 GCA905373095_01082 CDS open 16250-17662 _na     470_aa hypothetical protein
2157 CAJPRS010000023.1 GCA905373095_01083 CDS open 17879-18127 _na     82_aa hypothetical protein
2158 CAJPRS010000023.1 GCA905373095_01084 CDS open 18139-19341 _na     400_aa N-acetylglucosamine-6-phosphate deacetylase
2159 CAJPRS010000023.1 GCA905373095_01085 CDS open 19420-20118 _na     232_aa nucS endonuclease NucS
2160 CAJPRS010000023.1 GCA905373095_01086 CDS open 20222-20632 _na     136_aa Secreted protein
2161 CAJPRS010000023.1 GCA905373095_01087 CDS open 20697-20960 _na     87_aa F0F1 ATP synthase subunit epsilon
2162 CAJPRS010000023.1 GCA905373095_01088 CDS open 20960-22408 _na     482_aa atpD F0F1 ATP synthase subunit beta
2163 CAJPRS010000023.1 GCA905373095_01089 CDS open 22432-23361 _na     309_aa F0F1 ATP synthase subunit gamma
2164 CAJPRS010000023.1 GCA905373095_01090 CDS open 23365-25002 _na     545_aa atpA F0F1 ATP synthase subunit alpha
2165 CAJPRS010000023.1 GCA905373095_01091 CDS open 25044-25862 _na     272_aa F0F1 ATP synthase subunit delta
2166 CAJPRS010000023.1 GCA905373095_01092 CDS open 25859-26431 _na     190_aa F0F1 ATP synthase subunit B
2167 CAJPRS010000023.1 GCA905373095_01093 CDS open 26428-26634 _na     68_aa atpE ATP synthase F0 subunit C
2168 CAJPRS010000023.1 GCA905373095_01094 CDS open 26690-27595 _na     301_aa atpB F0F1 ATP synthase subunit A
2169 CAJPRS010000023.1 GCA905373095_01095 CDS open 27705-28109 _na     134_aa hypothetical protein
2170 CAJPRS010000023.1 GCA905373095_01096 CDS open 28096-29223 _na     375_aa Putative glycosyltransferase
2171 CAJPRS010000023.1 GCA905373095_01097 CDS open 29269-29916 _na     215_aa L-threonylcarbamoyladenylate synthase
2172 CAJPRS010000023.1 GCA905373095_01098 CDS open 29913-30800 _na     295_aa prmC peptide chain release factor N(5)-glutamine methyltransferase
2173 CAJPRS010000023.1 GCA905373095_01099 CDS open 30797-31903 _na     368_aa prfA peptide chain release factor 1
2174 CAJPRS010000023.1 GCA905373095_01100 CDS open 32049-32270 _na     73_aa rpmE 50S ribosomal protein L31
2175 CAJPRS010000023.1 GCA905373095_01071 gene open 83-904
2176 CAJPRS010000023.1 GCA905373095_01072 gene open 1009-2193
2177 CAJPRS010000023.1 GCA905373095_01073 gene open 2271-3269
2178 CAJPRS010000023.1 GCA905373095_01074 gene open 3271-4089
2179 CAJPRS010000023.1 GCA905373095_01075 gene open 4282-6573 glgX
2180 CAJPRS010000023.1 GCA905373095_01076 gene open 6756-7856 trpS
2181 CAJPRS010000023.1 GCA905373095_01077 gene open 8171-10204
2182 CAJPRS010000023.1 GCA905373095_01078 gene open 10415-12598 glgB
2183 CAJPRS010000023.1 GCA905373095_01079 gene open 12850-14292
2184 CAJPRS010000023.1 GCA905373095_01080 gene open 14349-15221
2185 CAJPRS010000023.1 GCA905373095_01081 gene open 15249-16253
2186 CAJPRS010000023.1 GCA905373095_01082 gene open 16250-17662
2187 CAJPRS010000023.1 GCA905373095_01083 gene open 17879-18127
2188 CAJPRS010000023.1 GCA905373095_01084 gene open 18139-19341
2189 CAJPRS010000023.1 GCA905373095_01085 gene open 19420-20118 nucS
2190 CAJPRS010000023.1 GCA905373095_01086 gene open 20222-20632
2191 CAJPRS010000023.1 GCA905373095_01087 gene open 20697-20960
2192 CAJPRS010000023.1 GCA905373095_01088 gene open 20960-22408 atpD
2193 CAJPRS010000023.1 GCA905373095_01089 gene open 22432-23361
2194 CAJPRS010000023.1 GCA905373095_01090 gene open 23365-25002 atpA
2195 CAJPRS010000023.1 GCA905373095_01091 gene open 25044-25862
2196 CAJPRS010000023.1 GCA905373095_01092 gene open 25859-26431
2197 CAJPRS010000023.1 GCA905373095_01093 gene open 26428-26634 atpE
2198 CAJPRS010000023.1 GCA905373095_01094 gene open 26690-27595 atpB
2199 CAJPRS010000023.1 GCA905373095_01095 gene open 27705-28109
2200 CAJPRS010000023.1 GCA905373095_01096 gene open 28096-29223
2201 CAJPRS010000023.1 GCA905373095_01097 gene open 29269-29916
2202 CAJPRS010000023.1 GCA905373095_01098 gene open 29913-30800 prmC
2203 CAJPRS010000023.1 GCA905373095_01099 gene open 30797-31903 prfA
2204 CAJPRS010000023.1 GCA905373095_01100 gene open 32049-32270 rpmE
2205 CAJPRS010000024.1 GCA905373095_01101 CDS open 42-2729 _na     895_aa DUF5682 domain-containing protein
2206 CAJPRS010000024.1 GCA905373095_01102 CDS open 2726-4741 _na     671_aa SWIM-type domain-containing protein
2207 CAJPRS010000024.1 GCA905373095_01103 CDS open 5235-6818 _na     527_aa thrC threonine synthase
2208 CAJPRS010000024.1 GCA905373095_01104 CDS open 7366-8010 _na     214_aa 2-C-methyl-D-erythritol 2%2C4-cyclodiphosphate synthase
2209 CAJPRS010000024.1 GCA905373095_01105 CDS open 8399-9124 _na     241_aa Methyltransferase
2210 CAJPRS010000024.1 GCA905373095_01106 CDS open 9335-10699 _na     454_aa MFS family major facilitator superfamily transporter
2211 CAJPRS010000024.1 GCA905373095_01107 CDS open 11225-12169 _na     314_aa 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase
2212 CAJPRS010000024.1 GCA905373095_01108 CDS open 12166-12678 _na     170_aa carD CarD family transcriptional regulator
2213 CAJPRS010000024.1 GCA905373095_01109 CDS open 12906-13640 _na     244_aa phosphoglyceromutase
2214 CAJPRS010000024.1 GCA905373095_01110 CDS open 13708-14040 _na     110_aa Lsr2 protein
2215 CAJPRS010000024.1 GCA905373095_01111 CDS open 15537-15971 _na     144_aa Chloride channel protein
2216 CAJPRS010000024.1 GCA905373095_01112 CDS open 16265-17344 _na     359_aa hemH ferrochelatase
2217 CAJPRS010000024.1 GCA905373095_01114 CDS open 18011-19672 _na     553_aa alpha/beta hydrolase
2218 CAJPRS010000024.1 GCA905373095_01115 CDS open 19774-20982 _na     402_aa DNA polymerase III subunit delta'
2219 CAJPRS010000024.1 GCA905373095_01116 CDS open 20979-21986 _na     335_aa tmk dTMP kinase
2220 CAJPRS010000024.1 GCA905373095_01117 CDS open 22330-25050 _na     906_aa topA type I DNA topoisomerase
2221 CAJPRS010000024.1 GCA905373095_01118 CDS open 25853-27628 _na     591_aa methyltransferase
2222 CAJPRS010000024.1 GCA905373095_01119 CDS open 27874-28845 _na     323_aa DUF808 domain-containing protein
2223 CAJPRS010000024.1 GCA905373095_01120 CDS open 29335-29958 _na     207_aa Superoxide dismutase
2224 CAJPRS010000024.1 GCA905373095_01121 CDS open 30577-32262 _na     561_aa Phosphoenolpyruvate-protein phosphotransferase
2225 CAJPRS010000024.1 GCA905373095_01101 gene open 42-2729
2226 CAJPRS010000024.1 GCA905373095_01102 gene open 2726-4741
2227 CAJPRS010000024.1 GCA905373095_01103 gene open 5235-6818 thrC
2228 CAJPRS010000024.1 GCA905373095_01104 gene open 7366-8010
2229 CAJPRS010000024.1 GCA905373095_01105 gene open 8399-9124
2230 CAJPRS010000024.1 GCA905373095_01106 gene open 9335-10699
2231 CAJPRS010000024.1 GCA905373095_01107 gene open 11225-12169
2232 CAJPRS010000024.1 GCA905373095_01108 gene open 12166-12678 carD
2233 CAJPRS010000024.1 GCA905373095_01109 gene open 12906-13640
2234 CAJPRS010000024.1 GCA905373095_01110 gene open 13708-14040
2235 CAJPRS010000024.1 GCA905373095_01111 gene open 15537-15971
2236 CAJPRS010000024.1 GCA905373095_01112 gene open 16265-17344 hemH
2237 CAJPRS010000024.1 GCA905373095_01114 gene open 18011-19672
2238 CAJPRS010000024.1 GCA905373095_01115 gene open 19774-20982
2239 CAJPRS010000024.1 GCA905373095_01116 gene open 20979-21986 tmk
2240 CAJPRS010000024.1 GCA905373095_01117 gene open 22330-25050 topA
2241 CAJPRS010000024.1 GCA905373095_01118 gene open 25853-27628
2242 CAJPRS010000024.1 GCA905373095_01119 gene open 27874-28845
2243 CAJPRS010000024.1 GCA905373095_01120 gene open 29335-29958
2244 CAJPRS010000024.1 GCA905373095_01121 gene open 30577-32262
2245 CAJPRS010000024.1 GCA905373095_01113 gene open 17545-17620 trnT
2246 CAJPRS010000024.1 GCA905373095_01113 tRNA open 17545-17620 trnT tRNA-Thr(cgt)
2247 CAJPRS010000025.1 GCA905373095_01122 CDS open 166-1131 _na     321_aa Putative inner membrane transport protein
2248 CAJPRS010000025.1 GCA905373095_01123 CDS open 1154-1990 _na     278_aa YwiC-like protein
2249 CAJPRS010000025.1 GCA905373095_01124 CDS open 2090-3073 _na     327_aa BASS family bile acid:sodium (Na+) symporter
2250 CAJPRS010000025.1 GCA905373095_01125 CDS open 3291-5249 _na     652_aa Xanthine/uracil permease
2251 CAJPRS010000025.1 GCA905373095_01126 CDS open 5487-5771 _na     94_aa DNA-binding protein HB1
2252 CAJPRS010000025.1 GCA905373095_01127 CDS open 5846-6229 _na     127_aa PF11238 family protein
2253 CAJPRS010000025.1 GCA905373095_01128 CDS open 6226-8028 _na     600_aa Type III restriction protein res subunit
2254 CAJPRS010000025.1 GCA905373095_01129 CDS open 8035-9339 _na     434_aa nicotinate phosphoribosyltransferase
2255 CAJPRS010000025.1 GCA905373095_01130 CDS open 9472-9744 _na     90_aa clpS ATP-dependent Clp protease adapter ClpS
2256 CAJPRS010000025.1 GCA905373095_01131 CDS open 9761-10336 _na     191_aa DUF2017 domain-containing protein
2257 CAJPRS010000025.1 GCA905373095_01132 CDS open 10348-11181 _na     277_aa murI glutamate racemase
2258 CAJPRS010000025.1 GCA905373095_01133 CDS open 11181-11984 _na     267_aa Metallo-beta-lactamase domain-containing protein
2259 CAJPRS010000025.1 GCA905373095_01134 CDS open 12020-12940 _na     306_aa HTH lysR-type domain-containing protein
2260 CAJPRS010000025.1 GCA905373095_01135 CDS open 13098-13226 _na     42_aa qseC Sensor histidine kinase QseC
2261 CAJPRS010000025.1 GCA905373095_01136 CDS open 13272-13916 _na     214_aa rdgB RdgB/HAM1 family non-canonical purine NTP pyrophosphatase
2262 CAJPRS010000025.1 GCA905373095_01137 CDS open 13916-14683 _na     255_aa rph ribonuclease PH
2263 CAJPRS010000025.1 GCA905373095_01138 CDS open 14720-15736 _na     338_aa nudC NAD(+) diphosphatase
2264 CAJPRS010000025.1 GCA905373095_01139 CDS open 15780-17801 _na     673_aa DNA 3'-5' helicase
2265 CAJPRS010000025.1 GCA905373095_01140 CDS open 17798-18790 _na     330_aa hypothetical protein
2266 CAJPRS010000025.1 GCA905373095_01141 CDS open 19000-20544 _na     514_aa Hydrolase
2267 CAJPRS010000025.1 GCA905373095_01142 CDS open 20654-21856 _na     400_aa Secreted protein
2268 CAJPRS010000025.1 GCA905373095_01143 CDS open 21903-22541 _na     212_aa PPA1309 family protein
2269 CAJPRS010000025.1 GCA905373095_01144 CDS open 22623-25796 _na     1057_aa UPF0182 protein HMPREF9004_1819
2270 CAJPRS010000025.1 GCA905373095_01146 CDS open 26890-27033 _na     47_aa hypothetical protein
2271 CAJPRS010000025.1 GCA905373095_01147 CDS open 27399-27659 _na     86_aa hypothetical protein
2272 CAJPRS010000025.1 GCA905373095_01148 CDS open 27851-28201 _na     116_aa Holin
2273 CAJPRS010000025.1 GCA905373095_01149 CDS open 28240-28554 _na     104_aa HTH cro/C1-type domain-containing protein
2274 CAJPRS010000025.1 GCA905373095_01150 CDS open 29454-30371 _na     305_aa hypothetical protein
2275 CAJPRS010000025.1 GCA905373095_01151 CDS open 30396-30893 _na     165_aa hypothetical protein
2276 CAJPRS010000025.1 GCA905373095_01122 gene open 166-1131
2277 CAJPRS010000025.1 GCA905373095_01123 gene open 1154-1990
2278 CAJPRS010000025.1 GCA905373095_01124 gene open 2090-3073
2279 CAJPRS010000025.1 GCA905373095_01125 gene open 3291-5249
2280 CAJPRS010000025.1 GCA905373095_01126 gene open 5487-5771
2281 CAJPRS010000025.1 GCA905373095_01127 gene open 5846-6229
2282 CAJPRS010000025.1 GCA905373095_01128 gene open 6226-8028
2283 CAJPRS010000025.1 GCA905373095_01129 gene open 8035-9339
2284 CAJPRS010000025.1 GCA905373095_01130 gene open 9472-9744 clpS
2285 CAJPRS010000025.1 GCA905373095_01131 gene open 9761-10336
2286 CAJPRS010000025.1 GCA905373095_01132 gene open 10348-11181 murI
2287 CAJPRS010000025.1 GCA905373095_01133 gene open 11181-11984
2288 CAJPRS010000025.1 GCA905373095_01134 gene open 12020-12940
2289 CAJPRS010000025.1 GCA905373095_01135 gene open 13098-13226 qseC
2290 CAJPRS010000025.1 GCA905373095_01136 gene open 13272-13916 rdgB
2291 CAJPRS010000025.1 GCA905373095_01137 gene open 13916-14683 rph
2292 CAJPRS010000025.1 GCA905373095_01138 gene open 14720-15736 nudC
2293 CAJPRS010000025.1 GCA905373095_01139 gene open 15780-17801
2294 CAJPRS010000025.1 GCA905373095_01140 gene open 17798-18790
2295 CAJPRS010000025.1 GCA905373095_01141 gene open 19000-20544
2296 CAJPRS010000025.1 GCA905373095_01142 gene open 20654-21856
2297 CAJPRS010000025.1 GCA905373095_01143 gene open 21903-22541
2298 CAJPRS010000025.1 GCA905373095_01144 gene open 22623-25796
2299 CAJPRS010000025.1 GCA905373095_01146 gene open 26890-27033
2300 CAJPRS010000025.1 GCA905373095_01147 gene open 27399-27659
2301 CAJPRS010000025.1 GCA905373095_01148 gene open 27851-28201
2302 CAJPRS010000025.1 GCA905373095_01149 gene open 28240-28554
2303 CAJPRS010000025.1 GCA905373095_01150 gene open 29454-30371
2304 CAJPRS010000025.1 GCA905373095_01151 gene open 30396-30893
2305 CAJPRS010000025.1 GCA905373095_01145 gene open 26061-26134 trnfM
2306 CAJPRS010000025.1 GCA905373095_01145 tRNA open 26061-26134 trnfM tRNA-fMet(cat)
2307 CAJPRS010000026.1 regulatory_region open 2106-2161 msiK RNA
2308 CAJPRS010000026.1 repeat_region open 29787-30940 CRISPR array with 16 repeats of length 37%2C consensus sequence GTCAGAAAGCACCTCGCGCCATAAGGTGCATTAAGAC and spacer length 35
2309 CAJPRS010000026.1 GCA905373095_01152 CDS open 124-684 _na     186_aa hypothetical protein
2310 CAJPRS010000026.1 GCA905373095_01153 CDS open 1243-2058 _na     271_aa hypothetical protein
2311 CAJPRS010000026.1 GCA905373095_01154 CDS open 2168-3295 _na     375_aa Sugar ABC superfamily ATP binding cassette transporter%2C ABC protein
2312 CAJPRS010000026.1 GCA905373095_01155 CDS open 3683-4945 _na     420_aa DUF4032 domain-containing protein
2313 CAJPRS010000026.1 GCA905373095_01156 CDS open 4981-5733 _na     250_aa Glycerophosphodiester phosphodiesterase
2314 CAJPRS010000026.1 GCA905373095_01157 CDS open 6272-8110 _na     612_aa phosphoenolpyruvate carboxykinase (GTP)
2315 CAJPRS010000026.1 GCA905373095_01158 CDS open 8441-9142 _na     233_aa Manganese transport regulator
2316 CAJPRS010000026.1 GCA905373095_01159 CDS open 9290-10315 _na     341_aa nrdF class 1b ribonucleoside-diphosphate reductase subunit beta
2317 CAJPRS010000026.1 GCA905373095_01160 CDS open 10390-10893 _na     167_aa nrdI class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI
2318 CAJPRS010000026.1 GCA905373095_01161 CDS open 11146-12327 _na     393_aa hypothetical protein
2319 CAJPRS010000026.1 GCA905373095_01162 CDS open 12558-13382 _na     274_aa Universal stress protein
2320 CAJPRS010000026.1 GCA905373095_01163 CDS open 13402-15039 _na     545_aa hypothetical protein
2321 CAJPRS010000026.1 GCA905373095_01164 CDS open 15095-15547 _na     150_aa hypothetical protein
2322 CAJPRS010000026.1 GCA905373095_01165 CDS open 15540-17927 _na     795_aa CRISPR-associated protein
2323 CAJPRS010000026.1 GCA905373095_01166 CDS open 18098-18454 _na     118_aa hypothetical protein
2324 CAJPRS010000026.1 GCA905373095_01167 CDS open 18631-20007 _na     458_aa Cas10/Cmr2 second palm domain-containing protein
2325 CAJPRS010000026.1 GCA905373095_01168 CDS open 20004-22175 _na     723_aa CRISPR-associated protein Cmr3
2326 CAJPRS010000026.1 GCA905373095_01169 CDS open 22172-24073 _na     633_aa RAMP superfamily CRISPR-associated protein
2327 CAJPRS010000026.1 GCA905373095_01170 CDS open 24070-24672 _na     200_aa hypothetical protein
2328 CAJPRS010000026.1 GCA905373095_01171 CDS open 24669-26915 _na     748_aa TIGR03986 family CRISPR-associated RAMP protein
2329 CAJPRS010000026.1 GCA905373095_01172 CDS open 27201-27488 _na     95_aa cas2 CRISPR-associated endonuclease Cas2
2330 CAJPRS010000026.1 GCA905373095_01173 CDS open 27479-29494 _na     671_aa cas1 CRISPR-associated endonuclease Cas1
2331 CAJPRS010000026.1 GCA905373095_01152 gene open 124-684
2332 CAJPRS010000026.1 GCA905373095_01153 gene open 1243-2058
2333 CAJPRS010000026.1 GCA905373095_01154 gene open 2168-3295
2334 CAJPRS010000026.1 GCA905373095_01155 gene open 3683-4945
2335 CAJPRS010000026.1 GCA905373095_01156 gene open 4981-5733
2336 CAJPRS010000026.1 GCA905373095_01157 gene open 6272-8110
2337 CAJPRS010000026.1 GCA905373095_01158 gene open 8441-9142
2338 CAJPRS010000026.1 GCA905373095_01159 gene open 9290-10315 nrdF
2339 CAJPRS010000026.1 GCA905373095_01160 gene open 10390-10893 nrdI
2340 CAJPRS010000026.1 GCA905373095_01161 gene open 11146-12327
2341 CAJPRS010000026.1 GCA905373095_01162 gene open 12558-13382
2342 CAJPRS010000026.1 GCA905373095_01163 gene open 13402-15039
2343 CAJPRS010000026.1 GCA905373095_01164 gene open 15095-15547
2344 CAJPRS010000026.1 GCA905373095_01165 gene open 15540-17927
2345 CAJPRS010000026.1 GCA905373095_01166 gene open 18098-18454
2346 CAJPRS010000026.1 GCA905373095_01167 gene open 18631-20007
2347 CAJPRS010000026.1 GCA905373095_01168 gene open 20004-22175
2348 CAJPRS010000026.1 GCA905373095_01169 gene open 22172-24073
2349 CAJPRS010000026.1 GCA905373095_01170 gene open 24070-24672
2350 CAJPRS010000026.1 GCA905373095_01171 gene open 24669-26915
2351 CAJPRS010000026.1 GCA905373095_01172 gene open 27201-27488 cas2
2352 CAJPRS010000026.1 GCA905373095_01173 gene open 27479-29494 cas1
2353 CAJPRS010000027.1 GCA905373095_01174 CDS open 275-685 _na     136_aa hypothetical protein
2354 CAJPRS010000027.1 GCA905373095_01175 CDS open 704-940 _na     78_aa Monofunctional biosynthetic peptidoglycan transglycosylase
2355 CAJPRS010000027.1 GCA905373095_01176 CDS open 1064-2380 _na     438_aa pitrilysin family protein
2356 CAJPRS010000027.1 GCA905373095_01177 CDS open 2621-3391 _na     256_aa NYN domain-containing protein
2357 CAJPRS010000027.1 GCA905373095_01178 CDS open 3614-4357 _na     247_aa dapB 4-hydroxy-tetrahydrodipicolinate reductase
2358 CAJPRS010000027.1 GCA905373095_01179 CDS open 4365-5075 _na     236_aa N-acetyltransferase domain-containing protein
2359 CAJPRS010000027.1 GCA905373095_01180 CDS open 5151-6047 _na     298_aa dapA 4-hydroxy-tetrahydrodipicolinate synthase
2360 CAJPRS010000027.1 GCA905373095_01181 CDS open 7183-8508 _na     441_aa MFS transporter
2361 CAJPRS010000027.1 GCA905373095_01182 CDS open 8559-9485 _na     308_aa Acetyl esterase
2362 CAJPRS010000027.1 GCA905373095_01183 CDS open 9519-10652 _na     377_aa caiA crotonobetainyl-CoA dehydrogenase
2363 CAJPRS010000027.1 GCA905373095_01184 CDS open 10678-11898 _na     406_aa caiB L-carnitine CoA-transferase
2364 CAJPRS010000027.1 GCA905373095_01185 CDS open 11905-13479 _na     524_aa Crotonobetaine/carnitine-CoA ligase
2365 CAJPRS010000027.1 GCA905373095_01186 CDS open 13508-14383 _na     291_aa maoC 3-alpha%2C7-alpha%2C 12-alpha-trihydroxy-5-beta-cholest-24-enoyl-CoA hydratase
2366 CAJPRS010000027.1 GCA905373095_01187 CDS open 14502-15836 _na     444_aa General substrate transporter
2367 CAJPRS010000027.1 GCA905373095_01188 CDS open 15839-16510 _na     223_aa Metallo-beta-lactamase
2368 CAJPRS010000027.1 GCA905373095_01189 CDS open 16474-17049 _na     191_aa acrR TetR family transcriptional regulator
2369 CAJPRS010000027.1 GCA905373095_01190 CDS open 17227-17991 _na     254_aa Electron transfer flavoprotein small subunit
2370 CAJPRS010000027.1 GCA905373095_01191 CDS open 18009-18881 _na     290_aa fixB Electron transfer flavoprotein subunit alpha/FixB family protein
2371 CAJPRS010000027.1 GCA905373095_01192 CDS open 18897-20195 _na     432_aa fixC Electron transfer flavoprotein FixC
2372 CAJPRS010000027.1 GCA905373095_01193 CDS open 20224-20520 _na     98_aa Ferredoxin-like protein
2373 CAJPRS010000027.1 GCA905373095_01194 CDS open 20696-22387 _na     563_aa Ribonuclease J
2374 CAJPRS010000027.1 GCA905373095_01195 CDS open 22425-23381 _na     318_aa pfkB PfkB family kinase
2375 CAJPRS010000027.1 GCA905373095_01196 CDS open 23616-26333 _na     905_aa Cell division protein FtsK/SpoIIIE
2376 CAJPRS010000027.1 GCA905373095_01197 CDS open 26354-26983 _na     209_aa pgsA CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase
2377 CAJPRS010000027.1 GCA905373095_01198 CDS open 27150-27464 _na     104_aa XRE family transcriptional regulator
2378 CAJPRS010000027.1 GCA905373095_01199 CDS open 27467-27700 _na     77_aa DUF3046 domain-containing protein
2379 CAJPRS010000027.1 GCA905373095_01200 CDS open 27923-29092 _na     389_aa recA recombinase RecA
2380 CAJPRS010000027.1 GCA905373095_01201 CDS open 29099-29692 _na     197_aa recX Regulatory protein RecX
2381 CAJPRS010000027.1 GCA905373095_01202 CDS open 30034-30528 _na     164_aa cinA Competence/damage-inducible protein CinA
2382 CAJPRS010000027.1 GCA905373095_01203 CDS open 30635-31021 _na     128_aa hypothetical protein
2383 CAJPRS010000027.1 GCA905373095_01174 gene open 275-685
2384 CAJPRS010000027.1 GCA905373095_01175 gene open 704-940
2385 CAJPRS010000027.1 GCA905373095_01176 gene open 1064-2380
2386 CAJPRS010000027.1 GCA905373095_01177 gene open 2621-3391
2387 CAJPRS010000027.1 GCA905373095_01178 gene open 3614-4357 dapB
2388 CAJPRS010000027.1 GCA905373095_01179 gene open 4365-5075
2389 CAJPRS010000027.1 GCA905373095_01180 gene open 5151-6047 dapA
2390 CAJPRS010000027.1 GCA905373095_01181 gene open 7183-8508
2391 CAJPRS010000027.1 GCA905373095_01182 gene open 8559-9485
2392 CAJPRS010000027.1 GCA905373095_01183 gene open 9519-10652 caiA
2393 CAJPRS010000027.1 GCA905373095_01184 gene open 10678-11898 caiB
2394 CAJPRS010000027.1 GCA905373095_01185 gene open 11905-13479
2395 CAJPRS010000027.1 GCA905373095_01186 gene open 13508-14383 maoC
2396 CAJPRS010000027.1 GCA905373095_01187 gene open 14502-15836
2397 CAJPRS010000027.1 GCA905373095_01188 gene open 15839-16510
2398 CAJPRS010000027.1 GCA905373095_01189 gene open 16474-17049 acrR
2399 CAJPRS010000027.1 GCA905373095_01190 gene open 17227-17991
2400 CAJPRS010000027.1 GCA905373095_01191 gene open 18009-18881 fixB
2401 CAJPRS010000027.1 GCA905373095_01192 gene open 18897-20195 fixC
2402 CAJPRS010000027.1 GCA905373095_01193 gene open 20224-20520
2403 CAJPRS010000027.1 GCA905373095_01194 gene open 20696-22387
2404 CAJPRS010000027.1 GCA905373095_01195 gene open 22425-23381 pfkB
2405 CAJPRS010000027.1 GCA905373095_01196 gene open 23616-26333
2406 CAJPRS010000027.1 GCA905373095_01197 gene open 26354-26983 pgsA
2407 CAJPRS010000027.1 GCA905373095_01198 gene open 27150-27464
2408 CAJPRS010000027.1 GCA905373095_01199 gene open 27467-27700
2409 CAJPRS010000027.1 GCA905373095_01200 gene open 27923-29092 recA
2410 CAJPRS010000027.1 GCA905373095_01201 gene open 29099-29692 recX
2411 CAJPRS010000027.1 GCA905373095_01202 gene open 30034-30528 cinA
2412 CAJPRS010000027.1 GCA905373095_01203 gene open 30635-31021
2413 CAJPRS010000028.1 GCA905373095_01204 CDS open 101-1840 _na     579_aa ABC superfamily ATP binding cassette transporter%2C ABC/membrane protein
2414 CAJPRS010000028.1 GCA905373095_01205 CDS open 1891-3999 _na     702_aa Sugar ABC superfamily ATP binding cassette transporter%2C ABC protein
2415 CAJPRS010000028.1 GCA905373095_01206 CDS open 4295-5140 _na     281_aa 2%2C5-diketo-D-gluconate reductase A
2416 CAJPRS010000028.1 GCA905373095_01207 CDS open 5260-5670 _na     136_aa DUF2241 domain-containing protein
2417 CAJPRS010000028.1 GCA905373095_01208 CDS open 5769-7088 _na     439_aa UTP-hexose-1-phosphate uridylyltransferase
2418 CAJPRS010000028.1 GCA905373095_01209 CDS open 7123-8247 _na     374_aa hypothetical protein
2419 CAJPRS010000028.1 GCA905373095_01210 CDS open 8410-8673 _na     87_aa DUF4235 domain-containing protein
2420 CAJPRS010000028.1 GCA905373095_01211 CDS open 9234-9500 _na     88_aa hypothetical protein
2421 CAJPRS010000028.1 GCA905373095_01212 CDS open 9530-10483 _na     317_aa hypothetical protein
2422 CAJPRS010000028.1 GCA905373095_01213 CDS open 10727-11503 _na     258_aa Phosphatidylcholine synthase
2423 CAJPRS010000028.1 GCA905373095_01214 CDS open 11955-14321 _na     788_aa purL phosphoribosylformylglycinamidine synthase subunit PurL
2424 CAJPRS010000028.1 GCA905373095_01215 CDS open 14405-15115 _na     236_aa purQ phosphoribosylformylglycinamidine synthase subunit PurQ
2425 CAJPRS010000028.1 GCA905373095_01216 CDS open 15112-15375 _na     87_aa purS phosphoribosylformylglycinamidine synthase subunit PurS
2426 CAJPRS010000028.1 GCA905373095_01217 CDS open 15428-16483 _na     351_aa phosphoribosylaminoimidazolesuccinocarboxamide synthase
2427 CAJPRS010000028.1 GCA905373095_01218 CDS open 16510-17859 _na     449_aa Phosphoribosylamine--glycine ligase
2428 CAJPRS010000028.1 GCA905373095_01219 CDS open 17969-18961 _na     330_aa Sortase
2429 CAJPRS010000028.1 GCA905373095_01220 CDS open 18984-21806 _na     940_aa Surface-anchored fimbrial subunit
2430 CAJPRS010000028.1 GCA905373095_01221 CDS open 22028-23611 _na     527_aa Type 2 fimbrial subunit
2431 CAJPRS010000028.1 GCA905373095_01222 CDS open 24130-25965 _na     611_aa phosphoenolpyruvate carboxykinase (GTP)
2432 CAJPRS010000028.1 GCA905373095_01223 CDS open 26204-26836 _na     210_aa Putative phosphate transport regulator
2433 CAJPRS010000028.1 GCA905373095_01224 CDS open 26841-27905 _na     354_aa PiT family inorganic phosphate transporter
2434 CAJPRS010000028.1 GCA905373095_01225 CDS open 27902-28366 _na     154_aa septum formation family protein
2435 CAJPRS010000028.1 GCA905373095_01226 CDS open 28585-29499 _na     304_aa Nudix hydrolase domain-containing protein
2436 CAJPRS010000028.1 GCA905373095_01204 gene open 101-1840
2437 CAJPRS010000028.1 GCA905373095_01205 gene open 1891-3999
2438 CAJPRS010000028.1 GCA905373095_01206 gene open 4295-5140
2439 CAJPRS010000028.1 GCA905373095_01207 gene open 5260-5670
2440 CAJPRS010000028.1 GCA905373095_01208 gene open 5769-7088
2441 CAJPRS010000028.1 GCA905373095_01209 gene open 7123-8247
2442 CAJPRS010000028.1 GCA905373095_01210 gene open 8410-8673
2443 CAJPRS010000028.1 GCA905373095_01211 gene open 9234-9500
2444 CAJPRS010000028.1 GCA905373095_01212 gene open 9530-10483
2445 CAJPRS010000028.1 GCA905373095_01213 gene open 10727-11503
2446 CAJPRS010000028.1 GCA905373095_01214 gene open 11955-14321 purL
2447 CAJPRS010000028.1 GCA905373095_01215 gene open 14405-15115 purQ
2448 CAJPRS010000028.1 GCA905373095_01216 gene open 15112-15375 purS
2449 CAJPRS010000028.1 GCA905373095_01217 gene open 15428-16483
2450 CAJPRS010000028.1 GCA905373095_01218 gene open 16510-17859
2451 CAJPRS010000028.1 GCA905373095_01219 gene open 17969-18961
2452 CAJPRS010000028.1 GCA905373095_01220 gene open 18984-21806
2453 CAJPRS010000028.1 GCA905373095_01221 gene open 22028-23611
2454 CAJPRS010000028.1 GCA905373095_01222 gene open 24130-25965
2455 CAJPRS010000028.1 GCA905373095_01223 gene open 26204-26836
2456 CAJPRS010000028.1 GCA905373095_01224 gene open 26841-27905
2457 CAJPRS010000028.1 GCA905373095_01225 gene open 27902-28366
2458 CAJPRS010000028.1 GCA905373095_01226 gene open 28585-29499
2459 CAJPRS010000029.1 GCA905373095_01227 CDS open 132-614 _na     160_aa thioredoxin domain-containing protein
2460 CAJPRS010000029.1 GCA905373095_01228 CDS open 611-1459 _na     282_aa Cytochrome c biogenesis protein
2461 CAJPRS010000029.1 GCA905373095_01229 CDS open 1684-1980 _na     98_aa groES co-chaperone GroES
2462 CAJPRS010000029.1 GCA905373095_01230 CDS open 2114-3499 _na     461_aa THUMP-like domain-containing protein
2463 CAJPRS010000029.1 GCA905373095_01231 CDS open 3886-4938 _na     350_aa tsaD tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD
2464 CAJPRS010000029.1 GCA905373095_01232 CDS open 4967-5245 _na     92_aa macB Macrolide export ATP-binding/permease MacB
2465 CAJPRS010000029.1 GCA905373095_01233 CDS open 5534-6277 _na     247_aa sdhB succinate dehydrogenase
2466 CAJPRS010000029.1 GCA905373095_01234 CDS open 6274-8253 _na     659_aa Succinate dehydrogenase / fumarate reductase flavoprotein subunit
2467 CAJPRS010000029.1 GCA905373095_01235 CDS open 8270-9091 _na     273_aa Succinate dehydrogenase/Fumarate reductase transmembrane subunit
2468 CAJPRS010000029.1 GCA905373095_01236 CDS open 9208-9732 _na     174_aa rimI ribosomal protein S18-alanine N-acetyltransferase
2469 CAJPRS010000029.1 GCA905373095_01237 CDS open 9729-10424 _na     231_aa tsaB tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB
2470 CAJPRS010000029.1 GCA905373095_01238 CDS open 10435-11058 _na     207_aa tsaE tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE
2471 CAJPRS010000029.1 GCA905373095_01239 CDS open 11173-12168 _na     331_aa Xylulokinase
2472 CAJPRS010000029.1 GCA905373095_01240 CDS open 12196-12579 _na     127_aa hypothetical protein
2473 CAJPRS010000029.1 GCA905373095_01241 CDS open 12585-13088 _na     167_aa Secondary thiamine-phosphate synthase enzyme
2474 CAJPRS010000029.1 GCA905373095_01242 CDS open 13122-13826 _na     234_aa Triose-phosphate isomerase
2475 CAJPRS010000029.1 GCA905373095_01243 CDS open 13823-14440 _na     205_aa SIS domain protein
2476 CAJPRS010000029.1 GCA905373095_01244 CDS open 14433-15596 _na     387_aa N-acetylglucosamine-6-phosphate deacetylase
2477 CAJPRS010000029.1 GCA905373095_01245 CDS open 15600-16556 _na     318_aa Glucosamine-6-phosphate deaminase
2478 CAJPRS010000029.1 GCA905373095_01246 CDS open 16519-17889 _na     456_aa Neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein
2479 CAJPRS010000029.1 GCA905373095_01247 CDS open 17889-18707 _na     272_aa Dipeptide ABC superfamily ATP binding cassette transporter%2C ABC protein
2480 CAJPRS010000029.1 GCA905373095_01248 CDS open 18704-19702 _na     332_aa Oligopeptide ABC superfamily ATP binding cassette transporter%2C ABC protein
2481 CAJPRS010000029.1 GCA905373095_01249 CDS open 19699-20601 _na     300_aa Oligopeptide ABC superfamily ATP binding cassette transporter permease
2482 CAJPRS010000029.1 GCA905373095_01250 CDS open 20598-21551 _na     317_aa Oligopeptide ABC superfamily ATP binding cassette transporter%2C membrane protein
2483 CAJPRS010000029.1 GCA905373095_01251 CDS open 21556-23112 _na     518_aa ABC superfamily ATP binding cassette transporter%2C binding protein
2484 CAJPRS010000029.1 GCA905373095_01252 CDS open 23446-24225 _na     259_aa Glucitol operon repressor
2485 CAJPRS010000029.1 GCA905373095_01253 CDS open 24231-24788 _na     185_aa hypothetical protein
2486 CAJPRS010000029.1 GCA905373095_01254 CDS open 24772-25293 _na     173_aa 4-vinyl reductase 4VR domain-containing protein
2487 CAJPRS010000029.1 GCA905373095_01255 CDS open 25546-26781 _na     411_aa alr alanine racemase
2488 CAJPRS010000029.1 GCA905373095_01256 CDS open 26790-28388 _na     532_aa ADP-dependent (S)-NAD(P)H-hydrate dehydratase
2489 CAJPRS010000029.1 GCA905373095_01257 CDS open 28492-29385 _na     297_aa DMT superfamily glucose uptake transporter
2490 CAJPRS010000029.1 GCA905373095_01227 gene open 132-614
2491 CAJPRS010000029.1 GCA905373095_01228 gene open 611-1459
2492 CAJPRS010000029.1 GCA905373095_01229 gene open 1684-1980 groES
2493 CAJPRS010000029.1 GCA905373095_01230 gene open 2114-3499
2494 CAJPRS010000029.1 GCA905373095_01231 gene open 3886-4938 tsaD
2495 CAJPRS010000029.1 GCA905373095_01232 gene open 4967-5245 macB
2496 CAJPRS010000029.1 GCA905373095_01233 gene open 5534-6277 sdhB
2497 CAJPRS010000029.1 GCA905373095_01234 gene open 6274-8253
2498 CAJPRS010000029.1 GCA905373095_01235 gene open 8270-9091
2499 CAJPRS010000029.1 GCA905373095_01236 gene open 9208-9732 rimI
2500 CAJPRS010000029.1 GCA905373095_01237 gene open 9729-10424 tsaB