HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Schaalia cardiffensis (GCA_905373095.1)

Select a Genome:
BAKTA Annotations for GCA_905373095.1
Genome Selected: Schaalia cardiffensis
ContigsBases CDSrRNA tmRNAtRNA
86 2,144,927 1825 0 1 39
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3744 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:7]    |    Number of Records Found: 3744 [8 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
3001 CAJPRS010000043.1 GCA905373095_01502 CDS open 8637-10241 _na     534_aa DASS family divalent anion:sodium (Na+) symporter
3002 CAJPRS010000043.1 GCA905373095_01503 CDS open 10649-11404 _na     251_aa ABC transporter permease
3003 CAJPRS010000043.1 GCA905373095_01504 CDS open 11410-12258 _na     282_aa mutG MutG family lantibiotic protection ABC superfamily ATP binding cassette transporter permease
3004 CAJPRS010000043.1 GCA905373095_01505 CDS open 12255-13205 _na     316_aa ABC superfamily ATP binding cassette transporter%2C ABC protein
3005 CAJPRS010000043.1 GCA905373095_01506 CDS open 13359-13544 _na     61_aa hypothetical protein
3006 CAJPRS010000043.1 GCA905373095_01507 CDS open 13529-16726 _na     1065_aa D-lactate dehydrogenase
3007 CAJPRS010000043.1 GCA905373095_01508 CDS open 16847-18073 _na     408_aa Cell division topological specificity factor
3008 CAJPRS010000043.1 GCA905373095_01509 CDS open 18336-19460 _na     374_aa Hydrolase
3009 CAJPRS010000043.1 GCA905373095_01494 gene open 29-1240
3010 CAJPRS010000043.1 GCA905373095_01495 gene open 1282-1908
3011 CAJPRS010000043.1 GCA905373095_01496 gene open 2195-3445
3012 CAJPRS010000043.1 GCA905373095_01497 gene open 3492-4763
3013 CAJPRS010000043.1 GCA905373095_01498 gene open 4781-6001
3014 CAJPRS010000043.1 GCA905373095_01499 gene open 6012-6755
3015 CAJPRS010000043.1 GCA905373095_01500 gene open 6752-7294
3016 CAJPRS010000043.1 GCA905373095_01501 gene open 7294-8529
3017 CAJPRS010000043.1 GCA905373095_01502 gene open 8637-10241
3018 CAJPRS010000043.1 GCA905373095_01503 gene open 10649-11404
3019 CAJPRS010000043.1 GCA905373095_01504 gene open 11410-12258 mutG
3020 CAJPRS010000043.1 GCA905373095_01505 gene open 12255-13205
3021 CAJPRS010000043.1 GCA905373095_01506 gene open 13359-13544
3022 CAJPRS010000043.1 GCA905373095_01507 gene open 13529-16726
3023 CAJPRS010000043.1 GCA905373095_01508 gene open 16847-18073
3024 CAJPRS010000043.1 GCA905373095_01509 gene open 18336-19460
3025 CAJPRS010000044.1 GCA905373095_01510 CDS open 138-1133 _na     331_aa hypothetical protein
3026 CAJPRS010000044.1 GCA905373095_01511 CDS open 1127-2830 _na     567_aa Signal transduction histidine kinase subgroup 3 dimerisation and phosphoacceptor domain-containing protein
3027 CAJPRS010000044.1 GCA905373095_01512 CDS open 3039-4238 _na     399_aa DUF4428 domain-containing protein
3028 CAJPRS010000044.1 GCA905373095_01513 CDS open 4332-5186 _na     284_aa TPM domain-containing protein
3029 CAJPRS010000044.1 GCA905373095_01514 CDS open 5200-6393 _na     397_aa TFIIB-type zinc ribbon-containing protein
3030 CAJPRS010000044.1 GCA905373095_01515 CDS open 6593-8242 _na     549_aa SPFH domain-containing protein
3031 CAJPRS010000044.1 GCA905373095_01516 CDS open 8723-11431 _na     902_aa ppdK pyruvate%2C phosphate dikinase
3032 CAJPRS010000044.1 GCA905373095_01517 CDS open 12162-13820 _na     552_aa L-lactate permease
3033 CAJPRS010000044.1 GCA905373095_01518 CDS open 14095-14601 _na     168_aa DUF4418 domain-containing protein
3034 CAJPRS010000044.1 GCA905373095_01519 CDS open 14730-15500 _na     256_aa DUF6273 domain-containing protein
3035 CAJPRS010000044.1 GCA905373095_01520 CDS open 15497-16690 _na     397_aa ABC3 transporter permease C-terminal domain-containing protein
3036 CAJPRS010000044.1 GCA905373095_01521 CDS open 16740-17936 _na     398_aa ABC superfamily ATP binding cassette transporter%2C membrane protein
3037 CAJPRS010000044.1 GCA905373095_01522 CDS open 17938-18630 _na     230_aa Lipoprotein releasing ABC superfamily ATP binding cassette transporter%2C ABC protein
3038 CAJPRS010000044.1 GCA905373095_01523 CDS open 19150-19485 _na     111_aa hypothetical protein
3039 CAJPRS010000044.1 GCA905373095_01510 gene open 138-1133
3040 CAJPRS010000044.1 GCA905373095_01511 gene open 1127-2830
3041 CAJPRS010000044.1 GCA905373095_01512 gene open 3039-4238
3042 CAJPRS010000044.1 GCA905373095_01513 gene open 4332-5186
3043 CAJPRS010000044.1 GCA905373095_01514 gene open 5200-6393
3044 CAJPRS010000044.1 GCA905373095_01515 gene open 6593-8242
3045 CAJPRS010000044.1 GCA905373095_01516 gene open 8723-11431 ppdK
3046 CAJPRS010000044.1 GCA905373095_01517 gene open 12162-13820
3047 CAJPRS010000044.1 GCA905373095_01518 gene open 14095-14601
3048 CAJPRS010000044.1 GCA905373095_01519 gene open 14730-15500
3049 CAJPRS010000044.1 GCA905373095_01520 gene open 15497-16690
3050 CAJPRS010000044.1 GCA905373095_01521 gene open 16740-17936
3051 CAJPRS010000044.1 GCA905373095_01522 gene open 17938-18630
3052 CAJPRS010000044.1 GCA905373095_01523 gene open 19150-19485
3053 CAJPRS010000045.1 GCA905373095_01524 CDS open 571-1632 _na     353_aa efflux RND transporter periplasmic adaptor subunit
3054 CAJPRS010000045.1 GCA905373095_01525 CDS open 1634-2356 _na     240_aa ABC superfamily ATP binding cassette transporter%2C ABC protein
3055 CAJPRS010000045.1 GCA905373095_01526 CDS open 2353-3771 _na     472_aa ABC superfamily ATP binding cassette transporter%2C membrane protein
3056 CAJPRS010000045.1 GCA905373095_01527 CDS open 4409-5269 _na     286_aa Adenine DNA glycosylase
3057 CAJPRS010000045.1 GCA905373095_01528 CDS open 5894-6475 _na     193_aa dcd dCTP deaminase
3058 CAJPRS010000045.1 GCA905373095_01529 CDS open 6540-7997 _na     485_aa PRTRC system protein E
3059 CAJPRS010000045.1 GCA905373095_01530 CDS open 8111-8386 _na     91_aa hypothetical protein
3060 CAJPRS010000045.1 GCA905373095_01531 CDS open 8568-9563 _na     331_aa Brp/Blh family beta-carotene 15%2C15'-monooxygenase
3061 CAJPRS010000045.1 GCA905373095_01532 CDS open 9799-12471 _na     890_aa Peptidoglycan recognition protein family domain-containing protein
3062 CAJPRS010000045.1 GCA905373095_01533 CDS open 12687-15404 _na     905_aa Putative iron-sulfur-binding reductase
3063 CAJPRS010000045.1 GCA905373095_01534 CDS open 15853-17445 _na     530_aa Amidophosphoribosyltransferase
3064 CAJPRS010000045.1 GCA905373095_01535 CDS open 17758-18903 _na     381_aa Phosphoribosylformylglycinamidine cyclo-ligase
3065 CAJPRS010000045.1 GCA905373095_01524 gene open 571-1632
3066 CAJPRS010000045.1 GCA905373095_01525 gene open 1634-2356
3067 CAJPRS010000045.1 GCA905373095_01526 gene open 2353-3771
3068 CAJPRS010000045.1 GCA905373095_01527 gene open 4409-5269
3069 CAJPRS010000045.1 GCA905373095_01528 gene open 5894-6475 dcd
3070 CAJPRS010000045.1 GCA905373095_01529 gene open 6540-7997
3071 CAJPRS010000045.1 GCA905373095_01530 gene open 8111-8386
3072 CAJPRS010000045.1 GCA905373095_01531 gene open 8568-9563
3073 CAJPRS010000045.1 GCA905373095_01532 gene open 9799-12471
3074 CAJPRS010000045.1 GCA905373095_01533 gene open 12687-15404
3075 CAJPRS010000045.1 GCA905373095_01534 gene open 15853-17445
3076 CAJPRS010000045.1 GCA905373095_01535 gene open 17758-18903
3077 CAJPRS010000046.1 GCA905373095_01536 CDS open 10-1617 _na     535_aa rho transcription termination factor Rho
3078 CAJPRS010000046.1 GCA905373095_01537 CDS open 1865-2818 _na     317_aa thrB homoserine kinase
3079 CAJPRS010000046.1 GCA905373095_01538 CDS open 2820-4127 _na     435_aa Homoserine dehydrogenase
3080 CAJPRS010000046.1 GCA905373095_01539 CDS open 4603-6720 _na     705_aa pflB formate C-acetyltransferase
3081 CAJPRS010000046.1 GCA905373095_01540 CDS open 6795-7046 _na     83_aa grcA2 autonomous glycyl radical cofactor GrcA2
3082 CAJPRS010000046.1 GCA905373095_01541 CDS open 7146-8084 _na     312_aa pflA pyruvate formate-lyase-activating protein
3083 CAJPRS010000046.1 GCA905373095_01542 CDS open 8280-8705 _na     141_aa DUF4168 domain-containing protein
3084 CAJPRS010000046.1 GCA905373095_01543 CDS open 8880-9506 _na     208_aa sugar O-acetyltransferase
3085 CAJPRS010000046.1 GCA905373095_01544 CDS open 9654-10589 _na     311_aa pflA pyruvate formate-lyase-activating protein
3086 CAJPRS010000046.1 GCA905373095_01545 CDS open 10785-11210 _na     141_aa DUF4168 domain-containing protein
3087 CAJPRS010000046.1 GCA905373095_01546 CDS open 11330-12094 _na     254_aa hypothetical protein
3088 CAJPRS010000046.1 GCA905373095_01547 CDS open 12107-13420 _na     437_aa Lipoprotein
3089 CAJPRS010000046.1 GCA905373095_01548 CDS open 13815-15275 _na     486_aa Sulfide-quinone reductase
3090 CAJPRS010000046.1 GCA905373095_01549 CDS open 15301-15483 _na     60_aa hypothetical protein
3091 CAJPRS010000046.1 GCA905373095_01550 CDS open 15620-16957 _na     445_aa Aminopeptidase
3092 CAJPRS010000046.1 GCA905373095_01551 CDS open 17098-17997 _na     299_aa aldose-1-epimerase
3093 CAJPRS010000046.1 GCA905373095_01536 gene open 10-1617 rho
3094 CAJPRS010000046.1 GCA905373095_01537 gene open 1865-2818 thrB
3095 CAJPRS010000046.1 GCA905373095_01538 gene open 2820-4127
3096 CAJPRS010000046.1 GCA905373095_01539 gene open 4603-6720 pflB
3097 CAJPRS010000046.1 GCA905373095_01540 gene open 6795-7046 grcA2
3098 CAJPRS010000046.1 GCA905373095_01541 gene open 7146-8084 pflA
3099 CAJPRS010000046.1 GCA905373095_01542 gene open 8280-8705
3100 CAJPRS010000046.1 GCA905373095_01543 gene open 8880-9506
3101 CAJPRS010000046.1 GCA905373095_01544 gene open 9654-10589 pflA
3102 CAJPRS010000046.1 GCA905373095_01545 gene open 10785-11210
3103 CAJPRS010000046.1 GCA905373095_01546 gene open 11330-12094
3104 CAJPRS010000046.1 GCA905373095_01547 gene open 12107-13420
3105 CAJPRS010000046.1 GCA905373095_01548 gene open 13815-15275
3106 CAJPRS010000046.1 GCA905373095_01549 gene open 15301-15483
3107 CAJPRS010000046.1 GCA905373095_01550 gene open 15620-16957
3108 CAJPRS010000046.1 GCA905373095_01551 gene open 17098-17997
3109 CAJPRS010000047.1 GCA905373095_01552 CDS open 417-2291 _na     624_aa Endonuclease/exonuclease/phosphatase family protein
3110 CAJPRS010000047.1 GCA905373095_01553 CDS open 2354-4609 _na     751_aa 5'-Nucleotidase C-terminal domain-containing protein
3111 CAJPRS010000047.1 GCA905373095_01554 CDS open 4927-5538 _na     203_aa Inner membrane protein
3112 CAJPRS010000047.1 GCA905373095_01555 CDS open 5696-6784 _na     362_aa ABC superfamily ATP binding cassette transporter%2C binding protein
3113 CAJPRS010000047.1 GCA905373095_01556 CDS open 6878-8422 _na     514_aa Ribose ABC superfamily ATP binding cassette transporter%2C ABC protein
3114 CAJPRS010000047.1 GCA905373095_01557 CDS open 8419-9681 _na     420_aa ABC superfamily ATP binding cassette transporter%2C membrane protein
3115 CAJPRS010000047.1 GCA905373095_01558 CDS open 9678-10961 _na     427_aa Carbohydrate uptake ABC superfamily ATP binding cassette transporter%2C membrane protein
3116 CAJPRS010000047.1 GCA905373095_01559 CDS open 10961-11401 _na     146_aa cytidine deaminase
3117 CAJPRS010000047.1 GCA905373095_01560 CDS open 11451-12734 _na     427_aa thymidine phosphorylase
3118 CAJPRS010000047.1 GCA905373095_01561 CDS open 12989-13939 _na     316_aa deoR DeoR family transcriptional regulator
3119 CAJPRS010000047.1 GCA905373095_01562 CDS open 14157-14873 _na     238_aa deoD purine-nucleoside phosphorylase
3120 CAJPRS010000047.1 GCA905373095_01563 CDS open 14916-15569 _na     217_aa deoC deoxyribose-phosphate aldolase
3121 CAJPRS010000047.1 GCA905373095_01564 CDS open 15575-17257 _na     560_aa Phosphomannomutase
3122 CAJPRS010000047.1 GCA905373095_01552 gene open 417-2291
3123 CAJPRS010000047.1 GCA905373095_01553 gene open 2354-4609
3124 CAJPRS010000047.1 GCA905373095_01554 gene open 4927-5538
3125 CAJPRS010000047.1 GCA905373095_01555 gene open 5696-6784
3126 CAJPRS010000047.1 GCA905373095_01556 gene open 6878-8422
3127 CAJPRS010000047.1 GCA905373095_01557 gene open 8419-9681
3128 CAJPRS010000047.1 GCA905373095_01558 gene open 9678-10961
3129 CAJPRS010000047.1 GCA905373095_01559 gene open 10961-11401
3130 CAJPRS010000047.1 GCA905373095_01560 gene open 11451-12734
3131 CAJPRS010000047.1 GCA905373095_01561 gene open 12989-13939 deoR
3132 CAJPRS010000047.1 GCA905373095_01562 gene open 14157-14873 deoD
3133 CAJPRS010000047.1 GCA905373095_01563 gene open 14916-15569 deoC
3134 CAJPRS010000047.1 GCA905373095_01564 gene open 15575-17257
3135 CAJPRS010000048.1 regulatory_region open 6127-6252 FMN riboswitch aptamer (RFN element)
3136 CAJPRS010000048.1 GCA905373095_01565 CDS open 28-252 _na     74_aa Methionine adenosyltransferase
3137 CAJPRS010000048.1 GCA905373095_01566 CDS open 249-881 _na     210_aa Vitamin K epoxide reductase domain-containing protein
3138 CAJPRS010000048.1 GCA905373095_01567 CDS open 969-2912 _na     647_aa priA Primosome assembly protein PriA
3139 CAJPRS010000048.1 GCA905373095_01568 CDS open 2944-3885 _na     313_aa fmt methionyl-tRNA formyltransferase
3140 CAJPRS010000048.1 GCA905373095_01569 CDS open 3885-5360 _na     491_aa Ribosomal RNA small subunit methyltransferase B
3141 CAJPRS010000048.1 GCA905373095_01570 CDS open 5397-6059 _na     220_aa rpe ribulose-phosphate 3-epimerase
3142 CAJPRS010000048.1 GCA905373095_01571 CDS open 6237-7082 _na     281_aa ABC transmembrane type-1 domain-containing protein
3143 CAJPRS010000048.1 GCA905373095_01572 CDS open 7093-8118 _na     341_aa Solute-binding protein family 3/N-terminal domain-containing protein
3144 CAJPRS010000048.1 GCA905373095_01573 CDS open 8231-8494 _na     87_aa phosphoribosyl-ATP diphosphatase
3145 CAJPRS010000048.1 GCA905373095_01574 CDS open 8651-9496 _na     281_aa hisG ATP phosphoribosyltransferase
3146 CAJPRS010000048.1 GCA905373095_01575 CDS open 9536-10459 _na     307_aa WYL domain-containing protein
3147 CAJPRS010000048.1 GCA905373095_01576 CDS open 10452-11441 _na     329_aa WYL domain-containing protein
3148 CAJPRS010000048.1 GCA905373095_01577 CDS open 11438-14203 _na     921_aa DEAD/DEAH box family ATP-dependent RNA helicase
3149 CAJPRS010000048.1 GCA905373095_01578 CDS open 14200-15804 _na     534_aa lnt apolipoprotein N-acyltransferase
3150 CAJPRS010000048.1 GCA905373095_01565 gene open 28-252
3151 CAJPRS010000048.1 GCA905373095_01566 gene open 249-881
3152 CAJPRS010000048.1 GCA905373095_01567 gene open 969-2912 priA
3153 CAJPRS010000048.1 GCA905373095_01568 gene open 2944-3885 fmt
3154 CAJPRS010000048.1 GCA905373095_01569 gene open 3885-5360
3155 CAJPRS010000048.1 GCA905373095_01570 gene open 5397-6059 rpe
3156 CAJPRS010000048.1 GCA905373095_01571 gene open 6237-7082
3157 CAJPRS010000048.1 GCA905373095_01572 gene open 7093-8118
3158 CAJPRS010000048.1 GCA905373095_01573 gene open 8231-8494
3159 CAJPRS010000048.1 GCA905373095_01574 gene open 8651-9496 hisG
3160 CAJPRS010000048.1 GCA905373095_01575 gene open 9536-10459
3161 CAJPRS010000048.1 GCA905373095_01576 gene open 10452-11441
3162 CAJPRS010000048.1 GCA905373095_01577 gene open 11438-14203
3163 CAJPRS010000048.1 GCA905373095_01578 gene open 14200-15804 lnt
3164 CAJPRS010000049.1 GCA905373095_01579 CDS open 177-2138 _na     653_aa DNA primase
3165 CAJPRS010000049.1 GCA905373095_01580 CDS open 2298-2540 _na     80_aa hypothetical protein
3166 CAJPRS010000049.1 GCA905373095_01581 CDS open 2617-3105 _na     162_aa S-ribosylhomocysteine lyase
3167 CAJPRS010000049.1 GCA905373095_01582 CDS open 3269-3754 _na     161_aa hypothetical protein
3168 CAJPRS010000049.1 GCA905373095_01583 CDS open 3805-4770 _na     321_aa hypothetical protein
3169 CAJPRS010000049.1 GCA905373095_01584 CDS open 5047-5517 _na     156_aa rimP Ribosome maturation factor RimP
3170 CAJPRS010000049.1 GCA905373095_01585 CDS open 5523-6569 _na     348_aa nusA Transcription termination/antitermination protein NusA
3171 CAJPRS010000049.1 GCA905373095_01586 CDS open 6594-6917 _na     107_aa ylxR YlxR family protein
3172 CAJPRS010000049.1 GCA905373095_01587 CDS open 7025-9970 _na     981_aa infB translation initiation factor IF-2
3173 CAJPRS010000049.1 GCA905373095_01588 CDS open 10600-11631 _na     343_aa DUF559 domain-containing protein
3174 CAJPRS010000049.1 GCA905373095_01589 CDS open 12010-12504 _na     164_aa hypothetical protein
3175 CAJPRS010000049.1 GCA905373095_01590 CDS open 12655-13092 _na     145_aa rbfA 30S ribosome-binding factor RbfA
3176 CAJPRS010000049.1 GCA905373095_01591 CDS open 13095-14588 _na     497_aa truB tRNA pseudouridine(55) synthase TruB
3177 CAJPRS010000049.1 GCA905373095_01592 CDS open 14585-15574 _na     329_aa bifunctional riboflavin kinase/FAD synthetase
3178 CAJPRS010000049.1 GCA905373095_01579 gene open 177-2138
3179 CAJPRS010000049.1 GCA905373095_01580 gene open 2298-2540
3180 CAJPRS010000049.1 GCA905373095_01581 gene open 2617-3105
3181 CAJPRS010000049.1 GCA905373095_01582 gene open 3269-3754
3182 CAJPRS010000049.1 GCA905373095_01583 gene open 3805-4770
3183 CAJPRS010000049.1 GCA905373095_01584 gene open 5047-5517 rimP
3184 CAJPRS010000049.1 GCA905373095_01585 gene open 5523-6569 nusA
3185 CAJPRS010000049.1 GCA905373095_01586 gene open 6594-6917 ylxR
3186 CAJPRS010000049.1 GCA905373095_01587 gene open 7025-9970 infB
3187 CAJPRS010000049.1 GCA905373095_01588 gene open 10600-11631
3188 CAJPRS010000049.1 GCA905373095_01589 gene open 12010-12504
3189 CAJPRS010000049.1 GCA905373095_01590 gene open 12655-13092 rbfA
3190 CAJPRS010000049.1 GCA905373095_01591 gene open 13095-14588 truB
3191 CAJPRS010000049.1 GCA905373095_01592 gene open 14585-15574
3192 CAJPRS010000050.1 GCA905373095_01593 CDS open 131-1072 _na     313_aa Zinc/manganese ABC superfamily ATP binding cassette transporter permease
3193 CAJPRS010000050.1 GCA905373095_01594 CDS open 1069-1512 _na     147_aa Ferric uptake regulation protein
3194 CAJPRS010000050.1 GCA905373095_01595 CDS open 1509-2027 _na     172_aa dedA Membrane protein DedA with SNARE-associated domain
3195 CAJPRS010000050.1 GCA905373095_01596 CDS open 2244-2570 _na     108_aa DUF4176 domain-containing protein
3196 CAJPRS010000050.1 GCA905373095_01597 CDS open 2595-3197 _na     200_aa Photosystem I reaction center subunit X
3197 CAJPRS010000050.1 GCA905373095_01598 CDS open 3206-4192 _na     328_aa WXG100 family type VII secretion target
3198 CAJPRS010000050.1 GCA905373095_01599 CDS open 4189-4503 _na     104_aa Methyl accepting chemotaxis protein
3199 CAJPRS010000050.1 GCA905373095_01600 CDS open 4744-5565 _na     273_aa isoprenyl transferase
3200 CAJPRS010000050.1 GCA905373095_01601 CDS open 5565-6299 _na     244_aa recO DNA repair protein RecO
3201 CAJPRS010000050.1 GCA905373095_01602 CDS open 6554-8308 _na     584_aa leuA 2-isopropylmalate synthase
3202 CAJPRS010000050.1 GCA905373095_01603 CDS open 8846-10135 _na     429_aa era GTPase Era
3203 CAJPRS010000050.1 GCA905373095_01604 CDS open 10140-11429 _na     429_aa CBS domain protein
3204 CAJPRS010000050.1 GCA905373095_01605 CDS open 11456-11905 _na     149_aa ybeY rRNA maturation RNase YbeY
3205 CAJPRS010000050.1 GCA905373095_01606 CDS open 11902-12951 _na     349_aa PhoH-like protein
3206 CAJPRS010000050.1 GCA905373095_01607 CDS open 12985-13077 _na     30_aa hypothetical protein
3207 CAJPRS010000050.1 GCA905373095_01608 CDS open 13414-14007 _na     197_aa tetR TetR family transcriptional regulator
3208 CAJPRS010000050.1 GCA905373095_01609 CDS open 14004-14759 _na     251_aa Transport permease protein
3209 CAJPRS010000050.1 GCA905373095_01610 CDS open 14756-15565 _na     269_aa ABC superfamily ATP binding cassette transporter ABC protein
3210 CAJPRS010000050.1 GCA905373095_01593 gene open 131-1072
3211 CAJPRS010000050.1 GCA905373095_01594 gene open 1069-1512
3212 CAJPRS010000050.1 GCA905373095_01595 gene open 1509-2027 dedA
3213 CAJPRS010000050.1 GCA905373095_01596 gene open 2244-2570
3214 CAJPRS010000050.1 GCA905373095_01597 gene open 2595-3197
3215 CAJPRS010000050.1 GCA905373095_01598 gene open 3206-4192
3216 CAJPRS010000050.1 GCA905373095_01599 gene open 4189-4503
3217 CAJPRS010000050.1 GCA905373095_01600 gene open 4744-5565
3218 CAJPRS010000050.1 GCA905373095_01601 gene open 5565-6299 recO
3219 CAJPRS010000050.1 GCA905373095_01602 gene open 6554-8308 leuA
3220 CAJPRS010000050.1 GCA905373095_01603 gene open 8846-10135 era
3221 CAJPRS010000050.1 GCA905373095_01604 gene open 10140-11429
3222 CAJPRS010000050.1 GCA905373095_01605 gene open 11456-11905 ybeY
3223 CAJPRS010000050.1 GCA905373095_01606 gene open 11902-12951
3224 CAJPRS010000050.1 GCA905373095_01607 gene open 12985-13077
3225 CAJPRS010000050.1 GCA905373095_01608 gene open 13414-14007 tetR
3226 CAJPRS010000050.1 GCA905373095_01609 gene open 14004-14759
3227 CAJPRS010000050.1 GCA905373095_01610 gene open 14756-15565
3228 CAJPRS010000051.1 GCA905373095_01611 CDS open 126-2138 _na     670_aa glmS glutamine--fructose-6-phosphate transaminase (isomerizing)
3229 CAJPRS010000051.1 GCA905373095_01612 CDS open 2218-2715 _na     165_aa LytR/CpsA/Psr regulator C-terminal domain-containing protein
3230 CAJPRS010000051.1 GCA905373095_01613 CDS open 2751-4931 _na     726_aa GDSL-type esterase/lipase family protein
3231 CAJPRS010000051.1 GCA905373095_01614 CDS open 4942-5919 _na     325_aa coaA type I pantothenate kinase
3232 CAJPRS010000051.1 GCA905373095_01615 CDS open 6311-7672 _na     453_aa glmM phosphoglucosamine mutase
3233 CAJPRS010000051.1 GCA905373095_01616 CDS open 7846-8337 _na     163_aa rpsI 30S ribosomal protein S9
3234 CAJPRS010000051.1 GCA905373095_01617 CDS open 8382-8825 _na     147_aa rplM 50S ribosomal protein L13
3235 CAJPRS010000051.1 GCA905373095_01618 CDS open 8979-9188 _na     69_aa hypothetical protein
3236 CAJPRS010000051.1 GCA905373095_01619 CDS open 9131-10063 _na     310_aa truA tRNA pseudouridine(38-40) synthase TruA
3237 CAJPRS010000051.1 GCA905373095_01620 CDS open 10051-10800 _na     249_aa ROK family protein
3238 CAJPRS010000051.1 GCA905373095_01621 CDS open 10962-11504 _na     180_aa GNAT family N-acetyltransferase
3239 CAJPRS010000051.1 GCA905373095_01622 CDS open 11494-12063 _na     189_aa Panacea domain-containing protein
3240 CAJPRS010000051.1 GCA905373095_01623 CDS open 12315-12821 _na     168_aa rplQ 50S ribosomal protein L17
3241 CAJPRS010000051.1 GCA905373095_01624 CDS open 12868-13866 _na     332_aa rpoA DNA-directed RNA polymerase subunit alpha
3242 CAJPRS010000051.1 GCA905373095_01625 CDS open 14018-14428 _na     136_aa rpsK 30S ribosomal protein S11
3243 CAJPRS010000051.1 GCA905373095_01626 CDS open 14497-14871 _na     124_aa rpsM 30S ribosomal protein S13
3244 CAJPRS010000051.1 GCA905373095_01611 gene open 126-2138 glmS
3245 CAJPRS010000051.1 GCA905373095_01612 gene open 2218-2715
3246 CAJPRS010000051.1 GCA905373095_01613 gene open 2751-4931
3247 CAJPRS010000051.1 GCA905373095_01614 gene open 4942-5919 coaA
3248 CAJPRS010000051.1 GCA905373095_01615 gene open 6311-7672 glmM
3249 CAJPRS010000051.1 GCA905373095_01616 gene open 7846-8337 rpsI
3250 CAJPRS010000051.1 GCA905373095_01617 gene open 8382-8825 rplM
3251 CAJPRS010000051.1 GCA905373095_01618 gene open 8979-9188
3252 CAJPRS010000051.1 GCA905373095_01619 gene open 9131-10063 truA
3253 CAJPRS010000051.1 GCA905373095_01620 gene open 10051-10800
3254 CAJPRS010000051.1 GCA905373095_01621 gene open 10962-11504
3255 CAJPRS010000051.1 GCA905373095_01622 gene open 11494-12063
3256 CAJPRS010000051.1 GCA905373095_01623 gene open 12315-12821 rplQ
3257 CAJPRS010000051.1 GCA905373095_01624 gene open 12868-13866 rpoA
3258 CAJPRS010000051.1 GCA905373095_01625 gene open 14018-14428 rpsK
3259 CAJPRS010000051.1 GCA905373095_01626 gene open 14497-14871 rpsM
3260 CAJPRS010000052.1 GCA905373095_01627 CDS open 382-1401 _na     339_aa Gram-positive cocci surface proteins LPxTG domain-containing protein
3261 CAJPRS010000052.1 GCA905373095_01628 CDS open 1643-1864 _na     73_aa hypothetical protein
3262 CAJPRS010000052.1 GCA905373095_01629 CDS open 2077-2610 _na     177_aa hypothetical protein
3263 CAJPRS010000052.1 GCA905373095_01630 CDS open 2767-5199 _na     810_aa peptidoglycan glycosyltransferase
3264 CAJPRS010000052.1 GCA905373095_01631 CDS open 5528-7243 _na     571_aa gndA NADP-dependent phosphogluconate dehydrogenase
3265 CAJPRS010000052.1 GCA905373095_01632 CDS open 7481-9085 _na     534_aa CCA tRNA nucleotidyltransferase
3266 CAJPRS010000052.1 GCA905373095_01633 CDS open 9513-10049 _na     178_aa MutT/NUDIX family protein
3267 CAJPRS010000052.1 GCA905373095_01634 CDS open 10050-12422 _na     790_aa Membrane protein
3268 CAJPRS010000052.1 GCA905373095_01635 CDS open 12422-14173 _na     583_aa mviN Integral membrane protein MviN
3269 CAJPRS010000052.1 GCA905373095_01627 gene open 382-1401
3270 CAJPRS010000052.1 GCA905373095_01628 gene open 1643-1864
3271 CAJPRS010000052.1 GCA905373095_01629 gene open 2077-2610
3272 CAJPRS010000052.1 GCA905373095_01630 gene open 2767-5199
3273 CAJPRS010000052.1 GCA905373095_01631 gene open 5528-7243 gndA
3274 CAJPRS010000052.1 GCA905373095_01632 gene open 7481-9085
3275 CAJPRS010000052.1 GCA905373095_01633 gene open 9513-10049
3276 CAJPRS010000052.1 GCA905373095_01634 gene open 10050-12422
3277 CAJPRS010000052.1 GCA905373095_01635 gene open 12422-14173 mviN
3278 CAJPRS010000053.1 repeat_region open 27-248 CRISPR array with 4 repeats of length 29%2C consensus sequence CGGCTCATCCCCGCTCACGCGGGGAGCAC and spacer length 32
3279 CAJPRS010000053.1 GCA905373095_01636 CDS open 257-661 _na     134_aa cas2e type I-E CRISPR-associated endoribonuclease Cas2e
3280 CAJPRS010000053.1 GCA905373095_01637 CDS open 668-1621 _na     317_aa cas1e type I-E CRISPR-associated endonuclease Cas1e
3281 CAJPRS010000053.1 GCA905373095_01638 CDS open 1618-2376 _na     252_aa cas6e type I-E CRISPR-associated protein Cas6/Cse3/CasE
3282 CAJPRS010000053.1 GCA905373095_01639 CDS open 2376-3065 _na     229_aa cas5e type I-E CRISPR-associated protein Cas5/CasD
3283 CAJPRS010000053.1 GCA905373095_01640 CDS open 3098-4222 _na     374_aa cas7e type I-E CRISPR-associated protein Cas7/Cse4/CasC
3284 CAJPRS010000053.1 GCA905373095_01641 CDS open 4237-4926 _na     229_aa casB type I-E CRISPR-associated protein Cse2/CasB
3285 CAJPRS010000053.1 GCA905373095_01642 CDS open 4923-6587 _na     554_aa casA type I-E CRISPR-associated protein Cse1/CasA
3286 CAJPRS010000053.1 GCA905373095_01643 CDS open 6587-9577 _na     996_aa CRISPR-associated helicase cas3
3287 CAJPRS010000053.1 GCA905373095_01644 CDS open 10058-11035 _na     325_aa rlmB 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB
3288 CAJPRS010000053.1 GCA905373095_01645 CDS open 11227-12390 _na     387_aa hypothetical protein
3289 CAJPRS010000053.1 GCA905373095_01646 CDS open 12474-13952 _na     492_aa cysS cysteine--tRNA ligase
3290 CAJPRS010000053.1 GCA905373095_01636 gene open 257-661 cas2e
3291 CAJPRS010000053.1 GCA905373095_01637 gene open 668-1621 cas1e
3292 CAJPRS010000053.1 GCA905373095_01638 gene open 1618-2376 cas6e
3293 CAJPRS010000053.1 GCA905373095_01639 gene open 2376-3065 cas5e
3294 CAJPRS010000053.1 GCA905373095_01640 gene open 3098-4222 cas7e
3295 CAJPRS010000053.1 GCA905373095_01641 gene open 4237-4926 casB
3296 CAJPRS010000053.1 GCA905373095_01642 gene open 4923-6587 casA
3297 CAJPRS010000053.1 GCA905373095_01643 gene open 6587-9577
3298 CAJPRS010000053.1 GCA905373095_01644 gene open 10058-11035 rlmB
3299 CAJPRS010000053.1 GCA905373095_01645 gene open 11227-12390
3300 CAJPRS010000053.1 GCA905373095_01646 gene open 12474-13952 cysS
3301 CAJPRS010000054.1 GCA905373095_01647 CDS open 346-1341 _na     331_aa ABC superfamily ATP binding cassette transporter
3302 CAJPRS010000054.1 GCA905373095_01648 CDS open 1548-3017 _na     489_aa aspartate kinase
3303 CAJPRS010000054.1 GCA905373095_01649 CDS open 3215-4264 _na     349_aa aspartate-semialdehyde dehydrogenase
3304 CAJPRS010000054.1 GCA905373095_01650 CDS open 4671-5936 _na     421_aa Iron (Fe3+) ABC superfamily ATP binding cassette transporter%2C ABC protein
3305 CAJPRS010000054.1 GCA905373095_01651 CDS open 5929-7107 _na     392_aa hypothetical protein
3306 CAJPRS010000054.1 GCA905373095_01652 CDS open 7116-7922 _na     268_aa extracellular solute-binding protein
3307 CAJPRS010000054.1 GCA905373095_01653 CDS open 8079-8483 _na     134_aa hypothetical protein
3308 CAJPRS010000054.1 GCA905373095_01654 CDS open 8584-9981 _na     465_aa MFS transporter
3309 CAJPRS010000054.1 GCA905373095_01655 CDS open 10121-10351 _na     76_aa hypothetical protein
3310 CAJPRS010000054.1 GCA905373095_01656 CDS open 10348-10782 _na     144_aa kdpD sensor histidine kinase KdpD
3311 CAJPRS010000054.1 GCA905373095_01657 CDS open 10873-11133 _na     86_aa hypothetical protein
3312 CAJPRS010000054.1 GCA905373095_01658 CDS open 11291-11653 _na     120_aa trxA thioredoxin
3313 CAJPRS010000054.1 GCA905373095_01659 CDS open 12050-12742 _na     230_aa tetR TetR family transcriptional regulator
3314 CAJPRS010000054.1 GCA905373095_01660 CDS open 12921-13358 _na     145_aa 8-oxo-dGTP diphosphatase
3315 CAJPRS010000054.1 GCA905373095_01647 gene open 346-1341
3316 CAJPRS010000054.1 GCA905373095_01648 gene open 1548-3017
3317 CAJPRS010000054.1 GCA905373095_01649 gene open 3215-4264
3318 CAJPRS010000054.1 GCA905373095_01650 gene open 4671-5936
3319 CAJPRS010000054.1 GCA905373095_01651 gene open 5929-7107
3320 CAJPRS010000054.1 GCA905373095_01652 gene open 7116-7922
3321 CAJPRS010000054.1 GCA905373095_01653 gene open 8079-8483
3322 CAJPRS010000054.1 GCA905373095_01654 gene open 8584-9981
3323 CAJPRS010000054.1 GCA905373095_01655 gene open 10121-10351
3324 CAJPRS010000054.1 GCA905373095_01656 gene open 10348-10782 kdpD
3325 CAJPRS010000054.1 GCA905373095_01657 gene open 10873-11133
3326 CAJPRS010000054.1 GCA905373095_01658 gene open 11291-11653 trxA
3327 CAJPRS010000054.1 GCA905373095_01659 gene open 12050-12742 tetR
3328 CAJPRS010000054.1 GCA905373095_01660 gene open 12921-13358
3329 CAJPRS010000055.1 GCA905373095_01661 CDS open 41-1051 _na     336_aa pta phosphate acetyltransferase
3330 CAJPRS010000055.1 GCA905373095_01662 CDS open 1230-2426 _na     398_aa Acetate kinase
3331 CAJPRS010000055.1 GCA905373095_01663 CDS open 3779-4666 _na     295_aa Inorganic polyphosphate/ATP-NAD kinase
3332 CAJPRS010000055.1 GCA905373095_01664 CDS open 4668-5669 _na     333_aa Band 7 domain-containing protein
3333 CAJPRS010000055.1 GCA905373095_01665 CDS open 5760-6512 _na     250_aa MutT/nudix family DNA hydrolase
3334 CAJPRS010000055.1 GCA905373095_01666 CDS open 6671-7669 _na     332_aa restriction endonuclease
3335 CAJPRS010000055.1 GCA905373095_01667 CDS open 8014-10296 _na     760_aa NAD(+) synthase
3336 CAJPRS010000055.1 GCA905373095_01668 CDS open 10293-10664 _na     123_aa Sugar transporter
3337 CAJPRS010000055.1 GCA905373095_01669 CDS open 11981-13375 _na     464_aa DUF418 domain-containing protein
3338 CAJPRS010000055.1 GCA905373095_01661 gene open 41-1051 pta
3339 CAJPRS010000055.1 GCA905373095_01662 gene open 1230-2426
3340 CAJPRS010000055.1 GCA905373095_01663 gene open 3779-4666
3341 CAJPRS010000055.1 GCA905373095_01664 gene open 4668-5669
3342 CAJPRS010000055.1 GCA905373095_01665 gene open 5760-6512
3343 CAJPRS010000055.1 GCA905373095_01666 gene open 6671-7669
3344 CAJPRS010000055.1 GCA905373095_01667 gene open 8014-10296
3345 CAJPRS010000055.1 GCA905373095_01668 gene open 10293-10664
3346 CAJPRS010000055.1 GCA905373095_01669 gene open 11981-13375
3347 CAJPRS010000056.1 repeat_region open 12494-12757 CRISPR array with 4 repeats of length 40%2C consensus sequence CCAGTCTTAATGCACCTTATGGCGCGAGGTGCTTTCTGAC and spacer length 31
3348 CAJPRS010000056.1 GCA905373095_01670 CDS open 102-884 _na     260_aa Hsp70 family protein
3349 CAJPRS010000056.1 GCA905373095_01671 CDS open 1190-1570 _na     126_aa hicB HicB family toxin-antitoxin system
3350 CAJPRS010000056.1 GCA905373095_01672 CDS open 2150-2704 _na     184_aa merR MerR family transcriptional regulator
3351 CAJPRS010000056.1 GCA905373095_01673 CDS open 2828-3601 _na     257_aa merR MerR family transcriptional regulator
3352 CAJPRS010000056.1 GCA905373095_01674 CDS open 3598-4029 _na     143_aa FHA-domain-containing protein
3353 CAJPRS010000056.1 GCA905373095_01675 CDS open 4092-4865 _na     257_aa DUF881 domain-containing protein
3354 CAJPRS010000056.1 GCA905373095_01676 CDS open 4867-5199 _na     110_aa Small basic protein
3355 CAJPRS010000056.1 GCA905373095_01677 CDS open 5201-6058 _na     285_aa Membrane associated protein
3356 CAJPRS010000056.1 GCA905373095_01678 CDS open 6060-8615 _na     851_aa pepN aminopeptidase N
3357 CAJPRS010000056.1 GCA905373095_01679 CDS open 8698-10281 _na     527_aa UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2%2C6-diaminopimelate ligase
3358 CAJPRS010000056.1 GCA905373095_01680 CDS open 10355-11833 _na     492_aa der ribosome biogenesis GTPase Der
3359 CAJPRS010000056.1 GCA905373095_01681 CDS open 11843-12358 _na     171_aa Methylated-DNA--protein-cysteine methyltransferase
3360 CAJPRS010000056.1 GCA905373095_01670 gene open 102-884
3361 CAJPRS010000056.1 GCA905373095_01671 gene open 1190-1570 hicB
3362 CAJPRS010000056.1 GCA905373095_01672 gene open 2150-2704 merR
3363 CAJPRS010000056.1 GCA905373095_01673 gene open 2828-3601 merR
3364 CAJPRS010000056.1 GCA905373095_01674 gene open 3598-4029
3365 CAJPRS010000056.1 GCA905373095_01675 gene open 4092-4865
3366 CAJPRS010000056.1 GCA905373095_01676 gene open 4867-5199
3367 CAJPRS010000056.1 GCA905373095_01677 gene open 5201-6058
3368 CAJPRS010000056.1 GCA905373095_01678 gene open 6060-8615 pepN
3369 CAJPRS010000056.1 GCA905373095_01679 gene open 8698-10281
3370 CAJPRS010000056.1 GCA905373095_01680 gene open 10355-11833 der
3371 CAJPRS010000056.1 GCA905373095_01681 gene open 11843-12358
3372 CAJPRS010000057.1 GCA905373095_01682 CDS open 538-1818 _na     426_aa Fic family protein
3373 CAJPRS010000057.1 GCA905373095_01683 CDS open 2077-2337 _na     86_aa DUF3073 domain-containing protein
3374 CAJPRS010000057.1 GCA905373095_01684 CDS open 2536-2838 _na     100_aa DUF3618 domain-containing protein
3375 CAJPRS010000057.1 GCA905373095_01685 CDS open 2835-3290 _na     151_aa Integral membrane protein
3376 CAJPRS010000057.1 GCA905373095_01686 CDS open 3938-5827 _na     629_aa ATP-binding cassette domain-containing protein
3377 CAJPRS010000057.1 GCA905373095_01690 CDS open 7072-8763 _na     563_aa mscS Small-conductance mechanosensitive ion channel MscS
3378 CAJPRS010000057.1 GCA905373095_01691 CDS open 9000-9506 _na     168_aa peptide-methionine (R)-S-oxide reductase
3379 CAJPRS010000057.1 GCA905373095_01693 CDS open 11099-11731 _na     210_aa Histone acetyltransferase
3380 CAJPRS010000057.1 GCA905373095_01682 gene open 538-1818
3381 CAJPRS010000057.1 GCA905373095_01683 gene open 2077-2337
3382 CAJPRS010000057.1 GCA905373095_01684 gene open 2536-2838
3383 CAJPRS010000057.1 GCA905373095_01685 gene open 2835-3290
3384 CAJPRS010000057.1 GCA905373095_01686 gene open 3938-5827
3385 CAJPRS010000057.1 GCA905373095_01690 gene open 7072-8763 mscS
3386 CAJPRS010000057.1 GCA905373095_01691 gene open 9000-9506
3387 CAJPRS010000057.1 GCA905373095_01693 gene open 11099-11731
3388 CAJPRS010000057.1 GCA905373095_01687 gene open 6466-6541 trnF
3389 CAJPRS010000057.1 GCA905373095_01688 gene open 6589-6662 trnD
3390 CAJPRS010000057.1 GCA905373095_01689 gene open 6723-6795 trnE
3391 CAJPRS010000057.1 GCA905373095_01692 gene open 10951-11025 trnK
3392 CAJPRS010000057.1 GCA905373095_01687 tRNA open 6466-6541 trnF tRNA-Phe(gaa)
3393 CAJPRS010000057.1 GCA905373095_01688 tRNA open 6589-6662 trnD tRNA-Asp(gtc)
3394 CAJPRS010000057.1 GCA905373095_01689 tRNA open 6723-6795 trnE tRNA-Glu(ttc)
3395 CAJPRS010000057.1 GCA905373095_01692 tRNA open 10951-11025 trnK tRNA-Lys(ttt)
3396 CAJPRS010000058.1 GCA905373095_01694 CDS open 117-1598 _na     493_aa choice-of-anchor M domain-containing protein
3397 CAJPRS010000058.1 GCA905373095_01695 CDS open 1729-2055 _na     108_aa DUF86 domain-containing protein
3398 CAJPRS010000058.1 GCA905373095_01696 CDS open 2052-2372 _na     106_aa Polymerase nucleotidyl transferase domain-containing protein
3399 CAJPRS010000058.1 GCA905373095_01697 CDS open 2600-4204 _na     534_aa Alcohol dehydrogenase-like N-terminal domain-containing protein
3400 CAJPRS010000058.1 GCA905373095_01698 CDS open 4365-5477 _na     370_aa Sorbitol-6-phosphate dehydrogenase
3401 CAJPRS010000058.1 GCA905373095_01699 CDS open 5431-6732 _na     433_aa PHP domain protein
3402 CAJPRS010000058.1 GCA905373095_01700 CDS open 6955-9405 _na     816_aa dihydrolipoyllysine-residue succinyltransferase
3403 CAJPRS010000058.1 GCA905373095_01701 CDS open 9440-10807 _na     455_aa lpdA dihydrolipoyl dehydrogenase
3404 CAJPRS010000058.1 GCA905373095_01702 CDS open 10835-11476 _na     213_aa 2-oxoacid dehydrogenase acyltransferase catalytic domain-containing protein
3405 CAJPRS010000058.1 GCA905373095_01694 gene open 117-1598
3406 CAJPRS010000058.1 GCA905373095_01695 gene open 1729-2055
3407 CAJPRS010000058.1 GCA905373095_01696 gene open 2052-2372
3408 CAJPRS010000058.1 GCA905373095_01697 gene open 2600-4204
3409 CAJPRS010000058.1 GCA905373095_01698 gene open 4365-5477
3410 CAJPRS010000058.1 GCA905373095_01699 gene open 5431-6732
3411 CAJPRS010000058.1 GCA905373095_01700 gene open 6955-9405
3412 CAJPRS010000058.1 GCA905373095_01701 gene open 9440-10807 lpdA
3413 CAJPRS010000058.1 GCA905373095_01702 gene open 10835-11476
3414 CAJPRS010000059.1 GCA905373095_01704 CDS open 201-614 _na     137_aa hypothetical protein
3415 CAJPRS010000059.1 GCA905373095_01705 CDS open 689-1381 _na     230_aa hypothetical protein
3416 CAJPRS010000059.1 GCA905373095_01706 CDS open 1746-2792 _na     348_aa hypothetical protein
3417 CAJPRS010000059.1 GCA905373095_01707 CDS open 2895-3761 _na     288_aa DUF1266 domain-containing protein
3418 CAJPRS010000059.1 GCA905373095_01708 CDS open 4285-4761 _na     158_aa thioredoxin-dependent peroxiredoxin
3419 CAJPRS010000059.1 GCA905373095_01709 CDS open 5019-5396 _na     125_aa SMI1/KNR4 family protein
3420 CAJPRS010000059.1 GCA905373095_01710 CDS open 5573-5902 _na     109_aa padR Transcription regulator PadR N-terminal domain-containing protein
3421 CAJPRS010000059.1 GCA905373095_01711 CDS open 5904-6350 _na     148_aa hypothetical protein
3422 CAJPRS010000059.1 GCA905373095_01712 CDS open 6437-7054 _na     205_aa hypothetical protein
3423 CAJPRS010000059.1 GCA905373095_01715 CDS open 7446-8189 _na     247_aa Manganese transport regulator
3424 CAJPRS010000059.1 GCA905373095_01716 CDS open 8656-9120 _na     154_aa HIT family protein
3425 CAJPRS010000059.1 GCA905373095_01717 CDS open 9179-9634 _na     151_aa hypothetical protein
3426 CAJPRS010000059.1 GCA905373095_01718 CDS open 9797-11371 _na     524_aa hypothetical protein
3427 CAJPRS010000059.1 GCA905373095_01704 gene open 201-614
3428 CAJPRS010000059.1 GCA905373095_01705 gene open 689-1381
3429 CAJPRS010000059.1 GCA905373095_01706 gene open 1746-2792
3430 CAJPRS010000059.1 GCA905373095_01707 gene open 2895-3761
3431 CAJPRS010000059.1 GCA905373095_01708 gene open 4285-4761
3432 CAJPRS010000059.1 GCA905373095_01709 gene open 5019-5396
3433 CAJPRS010000059.1 GCA905373095_01710 gene open 5573-5902 padR
3434 CAJPRS010000059.1 GCA905373095_01711 gene open 5904-6350
3435 CAJPRS010000059.1 GCA905373095_01712 gene open 6437-7054
3436 CAJPRS010000059.1 GCA905373095_01715 gene open 7446-8189
3437 CAJPRS010000059.1 GCA905373095_01716 gene open 8656-9120
3438 CAJPRS010000059.1 GCA905373095_01717 gene open 9179-9634
3439 CAJPRS010000059.1 GCA905373095_01718 gene open 9797-11371
3440 CAJPRS010000059.1 GCA905373095_01703 gene open 13-96 trnL
3441 CAJPRS010000059.1 GCA905373095_01713 gene open 7168-7243 trnK
3442 CAJPRS010000059.1 GCA905373095_01714 gene open 7274-7346 trnK
3443 CAJPRS010000059.1 GCA905373095_01703 tRNA open 13-96 trnL tRNA-Leu(tag)
3444 CAJPRS010000059.1 GCA905373095_01713 tRNA open 7168-7243 trnK tRNA-Lys(ctt)
3445 CAJPRS010000059.1 GCA905373095_01714 tRNA open 7274-7346 trnK tRNA-Lys(ctt)
3446 CAJPRS010000060.1 GCA905373095_01719 CDS open 593-2113 _na     506_aa Ribose ABC superfamily ATP binding cassette transporter%2C ABC protein
3447 CAJPRS010000060.1 GCA905373095_01720 CDS open 2110-3126 _na     338_aa rbsC Ribose transport system permease rbsC
3448 CAJPRS010000060.1 GCA905373095_01721 CDS open 3236-4273 _na     345_aa Ribose ABC superfamily ATP binding cassette transporter%2C binding protein
3449 CAJPRS010000060.1 GCA905373095_01722 CDS open 4385-6145 _na     586_aa L-fucose isomerase
3450 CAJPRS010000060.1 GCA905373095_01723 CDS open 6376-7785 _na     469_aa Rhamnulokinase
3451 CAJPRS010000060.1 GCA905373095_01724 CDS open 7760-8755 _na     331_aa lacI LacI family transcriptional regulator
3452 CAJPRS010000060.1 GCA905373095_01725 CDS open 8805-9236 _na     143_aa L-fucose mutarotase
3453 CAJPRS010000060.1 GCA905373095_01726 CDS open 9382-9498 _na     38_aa hypothetical protein
3454 CAJPRS010000060.1 GCA905373095_01727 CDS open 9530-10276 _na     248_aa deoR DeoR family transcriptional regulator
3455 CAJPRS010000060.1 GCA905373095_01719 gene open 593-2113
3456 CAJPRS010000060.1 GCA905373095_01720 gene open 2110-3126 rbsC
3457 CAJPRS010000060.1 GCA905373095_01721 gene open 3236-4273
3458 CAJPRS010000060.1 GCA905373095_01722 gene open 4385-6145
3459 CAJPRS010000060.1 GCA905373095_01723 gene open 6376-7785
3460 CAJPRS010000060.1 GCA905373095_01724 gene open 7760-8755 lacI
3461 CAJPRS010000060.1 GCA905373095_01725 gene open 8805-9236
3462 CAJPRS010000060.1 GCA905373095_01726 gene open 9382-9498
3463 CAJPRS010000060.1 GCA905373095_01727 gene open 9530-10276 deoR
3464 CAJPRS010000061.1 GCA905373095_01728 CDS open 110-727 _na     205_aa hypothetical protein
3465 CAJPRS010000061.1 GCA905373095_01729 CDS open 682-2865 _na     727_aa hypothetical protein
3466 CAJPRS010000061.1 GCA905373095_01730 CDS open 2969-3883 _na     304_aa DUF3097 domain-containing protein
3467 CAJPRS010000061.1 GCA905373095_01731 CDS open 3997-5964 _na     655_aa OPT family oligopeptide transporter
3468 CAJPRS010000061.1 GCA905373095_01732 CDS open 6164-7417 _na     417_aa hemW radical SAM family heme chaperone HemW
3469 CAJPRS010000061.1 GCA905373095_01733 CDS open 7414-8241 _na     275_aa trmB tRNA (guanosine(46)-N7)-methyltransferase TrmB
3470 CAJPRS010000061.1 GCA905373095_01734 CDS open 8238-10106 _na     622_aa lepA translation elongation factor 4
3471 CAJPRS010000061.1 GCA905373095_01728 gene open 110-727
3472 CAJPRS010000061.1 GCA905373095_01729 gene open 682-2865
3473 CAJPRS010000061.1 GCA905373095_01730 gene open 2969-3883
3474 CAJPRS010000061.1 GCA905373095_01731 gene open 3997-5964
3475 CAJPRS010000061.1 GCA905373095_01732 gene open 6164-7417 hemW
3476 CAJPRS010000061.1 GCA905373095_01733 gene open 7414-8241 trmB
3477 CAJPRS010000061.1 GCA905373095_01734 gene open 8238-10106 lepA
3478 CAJPRS010000062.1 GCA905373095_01735 CDS open 77-811 _na     244_aa HTH iclR-type domain-containing protein
3479 CAJPRS010000062.1 GCA905373095_01736 CDS open 989-2389 _na     466_aa 3-isopropylmalate dehydratase large subunit
3480 CAJPRS010000062.1 GCA905373095_01737 CDS open 2414-3112 _na     232_aa 3-isopropylmalate dehydratase small subunit
3481 CAJPRS010000062.1 GCA905373095_01738 CDS open 3241-4566 _na     441_aa murA UDP-N-acetylglucosamine 1-carboxyvinyltransferase
3482 CAJPRS010000062.1 GCA905373095_01739 CDS open 4563-5540 _na     325_aa DAGKc domain-containing protein
3483 CAJPRS010000062.1 GCA905373095_01740 CDS open 5568-6347 _na     259_aa 1-acylglycerol-3-phosphate O-acyltransferase
3484 CAJPRS010000062.1 GCA905373095_01741 CDS open 6448-7095 _na     215_aa AMIN domain-containing protein
3485 CAJPRS010000062.1 GCA905373095_01742 CDS open 7147-8178 _na     343_aa Glycerol-3-phosphate dehydrogenase [NAD(P)+]
3486 CAJPRS010000062.1 GCA905373095_01743 CDS open 8328-9119 _na     263_aa D-alanine--D-alanine ligase family protein
3487 CAJPRS010000062.1 GCA905373095_01744 CDS open 9112-9465 _na     117_aa ATP-grasp domain-containing protein
3488 CAJPRS010000062.1 GCA905373095_01735 gene open 77-811
3489 CAJPRS010000062.1 GCA905373095_01736 gene open 989-2389
3490 CAJPRS010000062.1 GCA905373095_01737 gene open 2414-3112
3491 CAJPRS010000062.1 GCA905373095_01738 gene open 3241-4566 murA
3492 CAJPRS010000062.1 GCA905373095_01739 gene open 4563-5540
3493 CAJPRS010000062.1 GCA905373095_01740 gene open 5568-6347
3494 CAJPRS010000062.1 GCA905373095_01741 gene open 6448-7095
3495 CAJPRS010000062.1 GCA905373095_01742 gene open 7147-8178
3496 CAJPRS010000062.1 GCA905373095_01743 gene open 8328-9119
3497 CAJPRS010000062.1 GCA905373095_01744 gene open 9112-9465
3498 CAJPRS010000063.1 GCA905373095_01745 CDS open 475-1266 _na     263_aa Two component system response regulator
3499 CAJPRS010000063.1 GCA905373095_01746 CDS open 1373-3844 _na     823_aa clpC ATP-dependent Clp protease ATP-binding subunit ClpC
3500 CAJPRS010000063.1 GCA905373095_01747 CDS open 4085-4909 _na     274_aa DUF4037 domain-containing protein