HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Veillonella parvula (GCA_905373225.1)

Select a Genome:
BAKTA Annotations for GCA_905373225.1
Genome Selected: Veillonella parvula
ContigsBases CDSrRNA tmRNAtRNA
25 1972424 1803 0 1 36
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3712 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:2]    |    Number of Records Found: 3712 [8 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
501 CAJPRU010000001.1 GCA905373225_00250 gene open 252127-253371 sAM1
502 CAJPRU010000001.1 GCA905373225_00251 gene open 253547-254611 mtnA
503 CAJPRU010000001.1 GCA905373225_00252 gene open 254654-255448 mtnP
504 CAJPRU010000001.1 GCA905373225_00253 gene open 255558-256436 hslO
505 CAJPRU010000001.1 GCA905373225_00254 gene open 256634-257095 ribE
506 CAJPRU010000001.1 GCA905373225_00255 gene open 257165-258367 ribA
507 CAJPRU010000001.1 GCA905373225_00256 gene open 258383-259039 ribE
508 CAJPRU010000001.1 GCA905373225_00257 gene open 259020-260234 ribD
509 CAJPRU010000001.1 GCA905373225_00122 gene open 131180-131255 trnD
510 CAJPRU010000001.1 GCA905373225_00123 gene open 131261-131336 trnF
511 CAJPRU010000001.1 GCA905373225_00124 gene open 131344-131418 trnG
512 CAJPRU010000001.1 GCA905373225_00125 gene open 131428-131502 trnC
513 CAJPRU010000001.1 GCA905373225_00126 gene open 131517-131605 trnL
514 CAJPRU010000001.1 GCA905373225_00122 tRNA open 131180-131255 trnD tRNA-Asp(gtc)
515 CAJPRU010000001.1 GCA905373225_00123 tRNA open 131261-131336 trnF tRNA-Phe(gaa)
516 CAJPRU010000001.1 GCA905373225_00124 tRNA open 131344-131418 trnG tRNA-Gly(gcc)
517 CAJPRU010000001.1 GCA905373225_00125 tRNA open 131428-131502 trnC tRNA-Cys(gca)
518 CAJPRU010000001.1 GCA905373225_00126 tRNA open 131517-131605 trnL tRNA-Leu(taa)
519 CAJPRU010000002.1 GCA905373225_00325 gene open 67846-68196 RNaseP_bact_a
520 CAJPRU010000002.1 GCA905373225_00344 gene open 89457-89628 6S
521 CAJPRU010000002.1 GCA905373225_00325 ncRNA open 67846-68196 Bacterial RNase P class A
522 CAJPRU010000002.1 GCA905373225_00344 ncRNA open 89457-89628 6S / SsrS RNA
523 CAJPRU010000002.1 regulatory_region open 25131-25218 ZMP/ZTP riboswitch aptamer (pfl RNA motif)
524 CAJPRU010000002.1 regulatory_region open 50572-50804 T-box leader
525 CAJPRU010000002.1 GCA905373225_00258 CDS open 4-123 _na     39_aa hypothetical protein
526 CAJPRU010000002.1 GCA905373225_00259 CDS open 426-1415 _na     329_aa cbiK Sirohydrochlorin cobaltochelatase
527 CAJPRU010000002.1 GCA905373225_00260 CDS open 1467-2408 _na     313_aa fepB Fe/B12 periplasmic-binding domain-containing protein
528 CAJPRU010000002.1 GCA905373225_00261 CDS open 2477-3259 _na     260_aa ABC transporter domain-containing protein
529 CAJPRU010000002.1 GCA905373225_00262 CDS open 3259-4254 _na     331_aa fepD Hemin transport system permease protein HmuU
530 CAJPRU010000002.1 GCA905373225_00263 CDS open 4327-4992 _na     221_aa cobH Cobalamin biosynthesis precorrin-8X methylmutase CobH/CbiC domain-containing protein
531 CAJPRU010000002.1 GCA905373225_00264 CDS open 4979-5767 _na     262_aa cobK precorrin-6A reductase
532 CAJPRU010000002.1 GCA905373225_00265 CDS open 5764-6453 _na     229_aa cobJ Tetrapyrrole methylase domain-containing protein
533 CAJPRU010000002.1 GCA905373225_00266 CDS open 6483-7631 _na     382_aa cbiG Cobalt-precorrin 5A hydrolase
534 CAJPRU010000002.1 GCA905373225_00267 CDS open 7633-8394 _na     253_aa cobM precorrin-4 C(11)-methyltransferase
535 CAJPRU010000002.1 GCA905373225_00268 CDS open 8396-8983 _na     195_aa cbiT Precorrin-6Y C5%2C15-methyltransferase (Decarboxylating)%2C CbiT subunit
536 CAJPRU010000002.1 GCA905373225_00269 CDS open 8980-9606 _na     208_aa cbiE Precorrin-6y C5%2C15-methyltransferase (Decarboxylating)%2C CbiE subunit
537 CAJPRU010000002.1 GCA905373225_00270 CDS open 9582-10700 _na     372_aa cbiD cobalt-precorrin-5B (C(1))-methyltransferase CbiD
538 CAJPRU010000002.1 GCA905373225_00271 CDS open 10771-11265 _na     164_aa yajQ YajQ family cyclic di-GMP-binding protein
539 CAJPRU010000002.1 GCA905373225_00272 CDS open 11679-13274 _na     531_aa WG repeat-containing protein
540 CAJPRU010000002.1 GCA905373225_00273 CDS open 13501-14475 _na     324_aa rluA Ribosomal large subunit pseudouridine synthase D
541 CAJPRU010000002.1 GCA905373225_00274 CDS open 14724-15653 _na     309_aa fba class II fructose-1%2C6-bisphosphate aldolase
542 CAJPRU010000002.1 GCA905373225_00275 CDS open 15657-17213 _na     518_aa spoVB putative cell division protein ytgP
543 CAJPRU010000002.1 GCA905373225_00276 CDS open 17310-18353 _na     347_aa yfdV Auxin efflux carrier
544 CAJPRU010000002.1 GCA905373225_00277 CDS open 18575-19315 _na     246_aa puuD Putative glutamine amidotransferase Rv2859c
545 CAJPRU010000002.1 GCA905373225_00278 CDS open 19331-19579 _na     82_aa amino acid permease
546 CAJPRU010000002.1 GCA905373225_00279 CDS open 19634-20638 _na     334_aa Amino acid permease/ SLC12A domain-containing protein
547 CAJPRU010000002.1 GCA905373225_00280 CDS open 20789-21628 _na     279_aa SnoaL-like domain-containing protein
548 CAJPRU010000002.1 GCA905373225_00281 CDS open 21630-22973 _na     447_aa hypothetical protein
549 CAJPRU010000002.1 GCA905373225_00282 CDS open 23098-23757 _na     219_aa gph Phosphoglycolate phosphatase
550 CAJPRU010000002.1 GCA905373225_00283 CDS open 23958-24554 _na     198_aa hypothetical protein
551 CAJPRU010000002.1 GCA905373225_00284 CDS open 24734-24853 _na     39_aa hypothetical protein
552 CAJPRU010000002.1 GCA905373225_00286 CDS open 25308-26519 _na     403_aa yhjX Putative MFS-type transporter YhjX
553 CAJPRU010000002.1 GCA905373225_00287 CDS open 26476-26613 _na     45_aa hypothetical protein
554 CAJPRU010000002.1 GCA905373225_00288 CDS open 26787-30125 _na     1112_aa ATP-dependent RecD-like DNA helicase
555 CAJPRU010000002.1 GCA905373225_00289 CDS open 30232-31284 _na     350_aa hypothetical protein
556 CAJPRU010000002.1 GCA905373225_00290 CDS open 31612-31929 _na     105_aa Restriction endonuclease subunit S
557 CAJPRU010000002.1 GCA905373225_00291 CDS open 31953-32912 _na     319_aa Transposase from transposon Tn916
558 CAJPRU010000002.1 GCA905373225_00292 CDS open 32873-33445 _na     190_aa restriction endonuclease subunit S
559 CAJPRU010000002.1 GCA905373225_00293 CDS open 33490-35091 _na     533_aa type I restriction-modification system subunit M
560 CAJPRU010000002.1 GCA905373225_00294 CDS open 35108-36334 _na     408_aa restriction endonuclease subunit S
561 CAJPRU010000002.1 GCA905373225_00295 CDS open 36367-39594 _na     1075_aa Type I restriction enzyme endonuclease subunit
562 CAJPRU010000002.1 GCA905373225_00296 CDS open 39596-40165 _na     189_aa Restriction endonuclease subunit S
563 CAJPRU010000002.1 GCA905373225_00297 CDS open 40302-41189 _na     295_aa GIY-YIG nuclease family protein
564 CAJPRU010000002.1 GCA905373225_00298 CDS open 41265-41450 _na     61_aa MmcQ/YjbR family DNA-binding protein
565 CAJPRU010000002.1 GCA905373225_00299 CDS open 41471-42679 _na     402_aa DUF3857 domain-containing protein
566 CAJPRU010000002.1 GCA905373225_00300 CDS open 42869-43051 _na     60_aa hypothetical protein
567 CAJPRU010000002.1 GCA905373225_00301 CDS open 43139-43702 _na     187_aa hypothetical protein
568 CAJPRU010000002.1 GCA905373225_00302 CDS open 43855-44205 _na     116_aa rplT 50S ribosomal protein L20
569 CAJPRU010000002.1 GCA905373225_00303 CDS open 44252-44449 _na     65_aa rpmI 50S ribosomal protein L35
570 CAJPRU010000002.1 GCA905373225_00304 CDS open 44470-45018 _na     182_aa infC translation initiation factor IF-3
571 CAJPRU010000002.1 GCA905373225_00305 CDS open 45389-46990 _na     533_aa sdcS Sodium-dependent dicarboxylate transporter SdcS
572 CAJPRU010000002.1 GCA905373225_00306 CDS open 47155-48360 _na     401_aa araJ Sialic acid transporter
573 CAJPRU010000002.1 GCA905373225_00307 CDS open 48520-50430 _na     636_aa thrS threonine--tRNA ligase
574 CAJPRU010000002.1 GCA905373225_00308 CDS open 51046-52035 _na     329_aa Tat pathway signal sequence domain protein
575 CAJPRU010000002.1 GCA905373225_00309 CDS open 52137-52412 _na     91_aa DUF4911 domain-containing protein
576 CAJPRU010000002.1 GCA905373225_00310 CDS open 52416-53660 _na     414_aa rlhA Peptidase family U32 C-terminal domain-containing protein
577 CAJPRU010000002.1 GCA905373225_00311 CDS open 53660-54268 _na     202_aa trmR tRNA 5-hydroxyuridine methyltransferase
578 CAJPRU010000002.1 GCA905373225_00312 CDS open 54292-55725 _na     477_aa mltG Endolytic murein transglycosylase
579 CAJPRU010000002.1 GCA905373225_00313 CDS open 55969-56265 _na     98_aa DUF1292 domain-containing protein
580 CAJPRU010000002.1 GCA905373225_00314 CDS open 56292-56711 _na     139_aa ruvX Holliday junction resolvase RuvX
581 CAJPRU010000002.1 GCA905373225_00315 CDS open 56711-56971 _na     86_aa ireB IreB family regulatory phosphoprotein
582 CAJPRU010000002.1 GCA905373225_00316 CDS open 57126-59741 _na     871_aa alaS alanine--tRNA ligase
583 CAJPRU010000002.1 GCA905373225_00317 CDS open 60020-60832 _na     270_aa pGRP C40 family peptidase
584 CAJPRU010000002.1 GCA905373225_00318 CDS open 60917-61927 _na     336_aa wcaA Bactoprenol glucosyl transferase-like protein from prophage CPS-53
585 CAJPRU010000002.1 GCA905373225_00319 CDS open 62304-62681 _na     125_aa hupH HupH hydrogenase expression protein C-terminal domain-containing protein
586 CAJPRU010000002.1 GCA905373225_00320 CDS open 62750-63358 _na     202_aa Hydrogenase 2 maturation protease
587 CAJPRU010000002.1 GCA905373225_00321 CDS open 63321-64130 _na     269_aa cybH Ni/Fe-hydrogenase%2C b-type cytochrome subunit
588 CAJPRU010000002.1 GCA905373225_00322 CDS open 64145-66046 _na     633_aa hyaB Hydrogenase-1 large chain
589 CAJPRU010000002.1 GCA905373225_00323 CDS open 66046-67185 _na     379_aa hyaA Uptake hydrogenase small subunit
590 CAJPRU010000002.1 GCA905373225_00324 CDS open 67459-67788 _na     109_aa trxA Thioredoxin
591 CAJPRU010000002.1 GCA905373225_00326 CDS open 68246-69349 _na     367_aa yqfO Nif3-like dinuclear metal center hexameric protein
592 CAJPRU010000002.1 GCA905373225_00327 CDS open 69365-70096 _na     243_aa trmK tRNA (Adenine(22)-N(1))-methyltransferase
593 CAJPRU010000002.1 GCA905373225_00329 CDS open 70471-71028 _na     185_aa folE GTP cyclohydrolase I FolE
594 CAJPRU010000002.1 GCA905373225_00330 CDS open 71110-71856 _na     248_aa 7-carboxy-7-deazaguanine synthase
595 CAJPRU010000002.1 GCA905373225_00331 CDS open 71843-72181 _na     112_aa queD 6-carboxytetrahydropterin synthase QueD
596 CAJPRU010000002.1 GCA905373225_00332 CDS open 72387-73547 _na     386_aa rpoD RNA polymerase sigma factor SigA
597 CAJPRU010000002.1 GCA905373225_00333 CDS open 73576-75348 _na     590_aa dnaG DNA primase
598 CAJPRU010000002.1 GCA905373225_00334 CDS open 75605-77233 _na     542_aa rny ribonuclease Y
599 CAJPRU010000002.1 GCA905373225_00335 CDS open 77325-77753 _na     142_aa recX regulatory protein RecX
600 CAJPRU010000002.1 GCA905373225_00336 CDS open 77771-78811 _na     346_aa recA recombinase RecA
601 CAJPRU010000002.1 GCA905373225_00337 CDS open 78816-80063 _na     415_aa pncC competence/damage-inducible protein A
602 CAJPRU010000002.1 GCA905373225_00338 CDS open 80101-81447 _na     448_aa rimO 30S ribosomal protein S12 methylthiotransferase RimO
603 CAJPRU010000002.1 GCA905373225_00339 CDS open 81503-82540 _na     345_aa afuA Iron uptake protein A2
604 CAJPRU010000002.1 GCA905373225_00340 CDS open 82597-84543 _na     648_aa ygiQ YgiQ family radical SAM protein
605 CAJPRU010000002.1 GCA905373225_00341 CDS open 84583-85035 _na     150_aa rodZ Transcriptional regulator
606 CAJPRU010000002.1 GCA905373225_00342 CDS open 85087-87828 _na     913_aa ftsK DNA translocase SpoIIIE
607 CAJPRU010000002.1 GCA905373225_00343 CDS open 87911-89212 _na     433_aa rarA Replication-associated recombination protein A
608 CAJPRU010000002.1 GCA905373225_00345 CDS open 89709-91514 _na     601_aa aspS aspartate--tRNA ligase
609 CAJPRU010000002.1 GCA905373225_00346 CDS open 91523-92794 _na     423_aa hisS histidine--tRNA ligase
610 CAJPRU010000002.1 GCA905373225_00347 CDS open 92794-94221 _na     475_aa hemZ coproporphyrinogen dehydrogenase HemZ
611 CAJPRU010000002.1 GCA905373225_00348 CDS open 94214-94702 _na     162_aa fur Ferric uptake regulation protein
612 CAJPRU010000002.1 GCA905373225_00349 CDS open 94744-95379 _na     211_aa Metallo-beta-lactamase domain protein
613 CAJPRU010000002.1 GCA905373225_00350 CDS open 95379-97619 _na     746_aa spoT GTP diphosphokinase
614 CAJPRU010000002.1 GCA905373225_00351 CDS open 97631-99613 _na     660_aa recJ single-stranded-DNA-specific exonuclease RecJ
615 CAJPRU010000002.1 GCA905373225_00352 CDS open 99808-101226 _na     472_aa hydG [FeFe] hydrogenase H-cluster radical SAM maturase HydG
616 CAJPRU010000002.1 GCA905373225_00353 CDS open 101369-101665 _na     98_aa hypothetical protein
617 CAJPRU010000002.1 GCA905373225_00354 CDS open 101537-102625 _na     362_aa Oligopeptide ABC transporter%2C oligopeptide-binding protein
618 CAJPRU010000002.1 GCA905373225_00355 CDS open 102627-103436 _na     269_aa yusV Putative siderophore transport system ATP-binding protein YusV
619 CAJPRU010000002.1 GCA905373225_00356 CDS open 103451-104449 _na     332_aa Iron ABC transporter permease
620 CAJPRU010000002.1 GCA905373225_00357 CDS open 104451-105473 _na     340_aa fhuB Putative iron(3+)-hydroxamate import system permease protein FhuB
621 CAJPRU010000002.1 GCA905373225_00358 CDS open 105767-106531 _na     254_aa fetB Iron export ABC transporter permease subunit FetB
622 CAJPRU010000002.1 GCA905373225_00359 CDS open 106528-107184 _na     218_aa ybbL Putative ABC transporter%2C ATP-binding protein YbbL
623 CAJPRU010000002.1 GCA905373225_00360 CDS open 107329-107613 _na     94_aa rpmA 50S ribosomal protein L27
624 CAJPRU010000002.1 GCA905373225_00361 CDS open 107626-107940 _na     104_aa ysxB Ribosomal processing cysteine protease Prp
625 CAJPRU010000002.1 GCA905373225_00362 CDS open 107943-108254 _na     103_aa rplU 50S ribosomal protein L21
626 CAJPRU010000002.1 GCA905373225_00363 CDS open 108455-108706 _na     83_aa Manganese efflux pump
627 CAJPRU010000002.1 GCA905373225_00364 CDS open 108716-109030 _na     104_aa mntP Putative manganese efflux pump MntP
628 CAJPRU010000002.1 GCA905373225_00365 CDS open 109059-110486 _na     475_aa cafA Ribonuclease G
629 CAJPRU010000002.1 GCA905373225_00366 CDS open 110521-111216 _na     231_aa TIGR03936 family radical SAM-associated protein
630 CAJPRU010000002.1 GCA905373225_00367 CDS open 111188-113071 _na     627_aa ygiQ Radical SAM core domain-containing protein
631 CAJPRU010000002.1 GCA905373225_00368 CDS open 113127-114230 _na     367_aa rodA rod shape-determining protein RodA
632 CAJPRU010000002.1 GCA905373225_00369 CDS open 114239-115162 _na     307_aa minD AAA family ATPase
633 CAJPRU010000002.1 GCA905373225_00370 CDS open 115164-117086 _na     640_aa mrdA penicillin-binding protein 2
634 CAJPRU010000002.1 GCA905373225_00371 CDS open 117106-117600 _na     164_aa mreD rod shape-determining protein MreD
635 CAJPRU010000002.1 GCA905373225_00372 CDS open 117597-118514 _na     305_aa mreC rod shape-determining protein MreC
636 CAJPRU010000002.1 GCA905373225_00373 CDS open 118516-119553 _na     345_aa mreB Cell shape-determining protein MreB
637 CAJPRU010000002.1 GCA905373225_00374 CDS open 119833-120531 _na     232_aa radC DNA repair protein RadC
638 CAJPRU010000002.1 GCA905373225_00375 CDS open 120669-121235 _na     188_aa dTTP/UTP pyrophosphatase
639 CAJPRU010000002.1 GCA905373225_00376 CDS open 121322-121942 _na     206_aa DUF3137 domain-containing protein
640 CAJPRU010000002.1 GCA905373225_00377 CDS open 122095-123300 _na     401_aa ackA Acetate kinase
641 CAJPRU010000002.1 GCA905373225_00378 CDS open 123304-123867 _na     187_aa Lipoprotein
642 CAJPRU010000002.1 GCA905373225_00379 CDS open 124054-125397 _na     447_aa tmcAL tRNA(Met) cytidine acetate ligase
643 CAJPRU010000002.1 GCA905373225_00380 CDS open 125521-126042 _na     173_aa pyrR bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR
644 CAJPRU010000002.1 GCA905373225_00381 CDS open 126136-127059 _na     307_aa rluA Pseudouridine synthase
645 CAJPRU010000002.1 GCA905373225_00382 CDS open 127146-127586 _na     146_aa lspA signal peptidase II
646 CAJPRU010000002.1 GCA905373225_00383 CDS open 127695-127859 _na     54_aa rnfC Ferredoxin
647 CAJPRU010000002.1 GCA905373225_00384 CDS open 128351-128614 _na     87_aa Integral membrane protein
648 CAJPRU010000002.1 GCA905373225_00385 CDS open 128617-128754 _na     45_aa hypothetical protein
649 CAJPRU010000002.1 GCA905373225_00386 CDS open 128854-130155 _na     433_aa citT Sodium-dependent dicarboxylate transporter SdcS
650 CAJPRU010000002.1 GCA905373225_00387 CDS open 130194-130451 _na     85_aa DUF3899 domain-containing protein
651 CAJPRU010000002.1 GCA905373225_00388 CDS open 130646-131767 _na     373_aa mmdB Methylmalonyl-CoA decarboxylase subunit beta
652 CAJPRU010000002.1 GCA905373225_00389 CDS open 131838-132221 _na     127_aa mmdC Methylmalonyl-CoA decarboxylase subunit gamma
653 CAJPRU010000002.1 GCA905373225_00390 CDS open 132323-132490 _na     55_aa mmdE Methylmalonyl-CoA decarboxylase subunit epsilon
654 CAJPRU010000002.1 GCA905373225_00391 CDS open 132514-132858 _na     114_aa Sodium pump decarboxylase%2C gamma subunit
655 CAJPRU010000002.1 GCA905373225_00392 CDS open 132932-134461 _na     509_aa mmdA Methylmalonyl-CoA decarboxylase subunit alpha
656 CAJPRU010000002.1 GCA905373225_00393 CDS open 134612-135034 _na     140_aa mce methylmalonyl-CoA epimerase
657 CAJPRU010000002.1 GCA905373225_00394 CDS open 135086-136024 _na     312_aa meaB methylmalonyl Co-A mutase-associated GTPase MeaB
658 CAJPRU010000002.1 GCA905373225_00395 CDS open 136104-136499 _na     131_aa sbm Methylmalonyl-CoA mutase
659 CAJPRU010000002.1 GCA905373225_00396 CDS open 136528-138174 _na     548_aa sbm Methylmalonyl-CoA mutase large subunit
660 CAJPRU010000002.1 GCA905373225_00397 CDS open 138203-139708 _na     501_aa aCH1 Propionyl-CoA:succinate CoA transferase
661 CAJPRU010000002.1 GCA905373225_00398 CDS open 140233-141471 _na     412_aa rfaL O-antigen ligase family protein
662 CAJPRU010000002.1 GCA905373225_00399 CDS open 141481-142788 _na     435_aa folC tetrahydrofolate synthase
663 CAJPRU010000002.1 GCA905373225_00400 CDS open 142801-145458 _na     885_aa valS valine--tRNA ligase
664 CAJPRU010000002.1 GCA905373225_00401 CDS open 145479-146369 _na     296_aa tatC twin-arginine translocase subunit TatC
665 CAJPRU010000002.1 GCA905373225_00402 CDS open 146371-147342 _na     323_aa ispA Octaprenyl-diphosphate synthase
666 CAJPRU010000002.1 GCA905373225_00403 CDS open 147339-148037 _na     232_aa yihA ribosome biogenesis GTP-binding protein YihA/YsxC
667 CAJPRU010000002.1 GCA905373225_00404 CDS open 148037-150346 _na     769_aa lon endopeptidase La
668 CAJPRU010000002.1 GCA905373225_00405 CDS open 150412-151665 _na     417_aa clpX ATP-dependent protease ATP-binding subunit ClpX
669 CAJPRU010000002.1 GCA905373225_00406 CDS open 151678-152271 _na     197_aa clpP ATP-dependent Clp endopeptidase proteolytic subunit ClpP
670 CAJPRU010000002.1 GCA905373225_00407 CDS open 152308-153612 _na     434_aa tig trigger factor
671 CAJPRU010000002.1 GCA905373225_00408 CDS open 153776-154231 _na     151_aa CBS domain-containing protein
672 CAJPRU010000002.1 GCA905373225_00409 CDS open 154343-154822 _na     159_aa rlmH 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH
673 CAJPRU010000002.1 GCA905373225_00410 CDS open 154819-155631 _na     270_aa phnP Metallo-hydrolase YycJ
674 CAJPRU010000002.1 GCA905373225_00411 CDS open 155737-156924 _na     395_aa rbcL 2%2C3-diketo-5-methylthiopentyl-1-phosphate enolase
675 CAJPRU010000002.1 GCA905373225_00412 CDS open 157126-158511 _na     461_aa uraA Xanthine permease
676 CAJPRU010000002.1 GCA905373225_00413 CDS open 158657-161206 _na     849_aa xdh selenium-dependent xanthine dehydrogenase
677 CAJPRU010000002.1 GCA905373225_00414 CDS open 161224-162573 _na     449_aa hydA dihydropyrimidinase
678 CAJPRU010000002.1 GCA905373225_00415 CDS open 162570-164261 _na     563_aa preA Putative selenate reductase%2C YgfK subunit
679 CAJPRU010000002.1 GCA905373225_00416 CDS open 164290-165618 _na     442_aa ssnA putative aminohydrolase SsnA
680 CAJPRU010000002.1 GCA905373225_00417 CDS open 165673-166608 _na     311_aa arcC carbamate kinase
681 CAJPRU010000002.1 GCA905373225_00418 CDS open 166677-167870 _na     397_aa ygeW knotted carbamoyltransferase YgeW
682 CAJPRU010000002.1 GCA905373225_00419 CDS open 168024-169334 _na     436_aa ygeY YgeY family selenium metabolism-linked hydrolase
683 CAJPRU010000002.1 GCA905373225_00420 CDS open 169347-170558 _na     403_aa dpaL diaminopropionate ammonia-lyase
684 CAJPRU010000002.1 GCA905373225_00421 CDS open 170568-171200 _na     210_aa PAC domain-containing protein
685 CAJPRU010000002.1 GCA905373225_00422 CDS open 171599-172018 _na     139_aa norV flavodoxin
686 CAJPRU010000002.1 GCA905373225_00423 CDS open 172029-172616 _na     195_aa DUF3793 domain-containing protein
687 CAJPRU010000002.1 GCA905373225_00424 CDS open 172721-173353 _na     210_aa Peptidase
688 CAJPRU010000002.1 GCA905373225_00425 CDS open 173391-175094 _na     567_aa glnS glutamine--tRNA ligase/YqeY domain fusion protein
689 CAJPRU010000002.1 GCA905373225_00426 CDS open 175162-176211 _na     349_aa ldhA 4-phosphoerythronate dehydrogenase
690 CAJPRU010000002.1 GCA905373225_00427 CDS open 176335-176802 _na     155_aa mscL large conductance mechanosensitive channel protein MscL
691 CAJPRU010000002.1 GCA905373225_00428 CDS open 177088-178755 _na     555_aa ybjD ATP-dependent endonuclease of the OLD family-like protein
692 CAJPRU010000002.1 GCA905373225_00429 CDS open 178928-179815 _na     295_aa rhaT DMT family transporter
693 CAJPRU010000002.1 GCA905373225_00430 CDS open 180028-181527 _na     499_aa thrC threonine synthase
694 CAJPRU010000002.1 GCA905373225_00431 CDS open 181711-182652 _na     313_aa efeB Putative deferrochelatase/peroxidase YfeX
695 CAJPRU010000002.1 GCA905373225_00433 CDS open 183094-183396 _na     100_aa hypothetical protein
696 CAJPRU010000002.1 GCA905373225_00434 CDS open 183398-184363 _na     321_aa moaA GTP 3'%2C8-cyclase MoaA
697 CAJPRU010000002.1 GCA905373225_00435 CDS open 184390-184830 _na     146_aa yiiM MOSC domain protein
698 CAJPRU010000002.1 GCA905373225_00436 CDS open 185045-186373 _na     442_aa uraA Xanthine permease
699 CAJPRU010000002.1 GCA905373225_00437 CDS open 186554-187171 _na     205_aa ftcD Methenyltetrahydrofolate cyclohydrolase
700 CAJPRU010000002.1 GCA905373225_00438 CDS open 187331-189001 _na     556_aa mIS1 formate--tetrahydrofolate ligase
701 CAJPRU010000002.1 GCA905373225_00439 CDS open 189398-190672 _na     424_aa citT Na(+)/dicarboxylate symporter
702 CAJPRU010000002.1 GCA905373225_00440 CDS open 190830-191441 _na     203_aa ttdB L(+)-tartrate dehydratase subunit beta
703 CAJPRU010000002.1 GCA905373225_00441 CDS open 191441-192343 _na     300_aa ttdA L(+)-tartrate dehydratase subunit alpha
704 CAJPRU010000002.1 GCA905373225_00442 CDS open 192728-193756 _na     342_aa araC Transcriptional regulator%2C AraC family
705 CAJPRU010000002.1 GCA905373225_00443 CDS open 193949-194215 _na     88_aa Integral membrane protein
706 CAJPRU010000002.1 GCA905373225_00444 CDS open 194632-195654 _na     340_aa araC AraC family transcriptional regulator
707 CAJPRU010000002.1 GCA905373225_00445 CDS open 195669-195947 _na     92_aa UDP-N-acetylglucosamine kinase
708 CAJPRU010000002.1 GCA905373225_00446 CDS open 195997-196332 _na     111_aa qdoI Cupin domain protein
709 CAJPRU010000002.1 GCA905373225_00447 CDS open 196672-197907 _na     411_aa moeA Molybdopterin molybdenumtransferase
710 CAJPRU010000002.1 GCA905373225_00448 CDS open 197888-199012 _na     374_aa mobB molybdopterin-guanine dinucleotide biosynthesis protein B
711 CAJPRU010000002.1 GCA905373225_00449 CDS open 199005-199535 _na     176_aa thiT energy-coupled thiamine transporter ThiT
712 CAJPRU010000002.1 GCA905373225_00450 CDS open 199674-200705 _na     343_aa guaB GMP reductase
713 CAJPRU010000002.1 GCA905373225_00451 CDS open 200843-202126 _na     427_aa fucP Major facilitator superfamily (MFS) profile domain-containing protein
714 CAJPRU010000002.1 GCA905373225_00452 CDS open 202205-203383 _na     392_aa abgB Putative hydrolase YxeP
715 CAJPRU010000002.1 GCA905373225_00453 CDS open 203574-203756 _na     60_aa Lipoprotein
716 CAJPRU010000002.1 GCA905373225_00454 CDS open 203894-205081 _na     395_aa argD Acetylornithine aminotransferase
717 CAJPRU010000002.1 GCA905373225_00455 CDS open 205167-206024 _na     285_aa argB Acetylglutamate kinase
718 CAJPRU010000002.1 GCA905373225_00456 CDS open 206035-206985 _na     316_aa argC N-acetyl-gamma-glutamyl-phosphate reductase
719 CAJPRU010000002.1 GCA905373225_00457 CDS open 207096-208106 _na     336_aa argF ornithine carbamoyltransferase
720 CAJPRU010000002.1 GCA905373225_00458 CDS open 208138-209322 _na     394_aa abgB Amidohydrolase
721 CAJPRU010000002.1 GCA905373225_00459 CDS open 209550-210872 _na     440_aa cpdA Alkaline phosphatase
722 CAJPRU010000002.1 GCA905373225_00460 CDS open 210879-211469 _na     196_aa cynT Carbonic anhydrase
723 CAJPRU010000002.1 GCA905373225_00461 CDS open 211654-212166 _na     170_aa ilvN acetolactate synthase small subunit
724 CAJPRU010000002.1 GCA905373225_00462 CDS open 212175-213902 _na     575_aa ilvB biosynthetic-type acetolactate synthase large subunit
725 CAJPRU010000002.1 GCA905373225_00463 CDS open 214095-214373 _na     92_aa Glutaredoxin
726 CAJPRU010000002.1 GCA905373225_00464 CDS open 214451-214951 _na     166_aa Folate family ECF transporter S component
727 CAJPRU010000002.1 GCA905373225_00465 CDS open 214941-215288 _na     115_aa nitrous oxide-stimulated promoter family protein
728 CAJPRU010000002.1 GCA905373225_00466 CDS open 215298-216113 _na     271_aa ubiG Methyltransferase domain-containing protein
729 CAJPRU010000002.1 GCA905373225_00468 CDS open 216688-217146 _na     152_aa protein-tyrosine-phosphatase
730 CAJPRU010000002.1 GCA905373225_00469 CDS open 217245-219488 _na     747_aa Autotransporter outer membrane beta-barrel domain-containing protein
731 CAJPRU010000002.1 GCA905373225_00470 CDS open 219635-220354 _na     239_aa DUF4198 domain-containing protein
732 CAJPRU010000002.1 GCA905373225_00471 CDS open 220622-222433 _na     603_aa typA translational GTPase TypA
733 CAJPRU010000002.1 GCA905373225_00472 CDS open 222630-223577 _na     315_aa 4Fe-4S ferredoxin-type domain-containing protein
734 CAJPRU010000002.1 GCA905373225_00473 CDS open 223717-224646 _na     309_aa murB UDP-N-acetylmuramate dehydrogenase
735 CAJPRU010000002.1 GCA905373225_00474 CDS open 224621-224986 _na     121_aa ylbF YlbF family regulator
736 CAJPRU010000002.1 GCA905373225_00475 CDS open 225092-225577 _na     161_aa trmL tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL
737 CAJPRU010000002.1 GCA905373225_00476 CDS open 225606-226118 _na     170_aa moaC cyclic pyranopterin monophosphate synthase MoaC
738 CAJPRU010000002.1 GCA905373225_00477 CDS open 226137-226904 _na     255_aa ulaG metal-dependent hydrolase
739 CAJPRU010000002.1 GCA905373225_00478 CDS open 227010-228653 _na     547_aa VWA-like domain-containing protein
740 CAJPRU010000002.1 GCA905373225_00479 CDS open 228791-229891 _na     366_aa mMP0363 AAA+ ATPase domain-containing protein
741 CAJPRU010000002.1 GCA905373225_00480 CDS open 229904-230710 _na     268_aa DUF4116 domain-containing protein
742 CAJPRU010000002.1 GCA905373225_00481 CDS open 230823-231473 _na     216_aa trkA Ktr system potassium uptake protein A
743 CAJPRU010000002.1 GCA905373225_00482 CDS open 231509-232870 _na     453_aa trkG Cation transporter
744 CAJPRU010000002.1 GCA905373225_00483 CDS open 232877-233881 _na     334_aa rbsK Ribokinase
745 CAJPRU010000002.1 GCA905373225_00484 CDS open 234205-235845 _na     546_aa hutW heme anaerobic degradation radical SAM methyltransferase ChuW/HutW
746 CAJPRU010000002.1 GCA905373225_00485 CDS open 235867-236385 _na     172_aa fldA Flavodoxin-like domain-containing protein
747 CAJPRU010000002.1 GCA905373225_00486 CDS open 236414-237217 _na     267_aa tonB Energy transducer TonB
748 CAJPRU010000002.1 GCA905373225_00487 CDS open 237220-237627 _na     135_aa exbD Biopolymer transporter ExbD
749 CAJPRU010000002.1 GCA905373225_00488 CDS open 237630-238247 _na     205_aa tolQ MotA/TolQ/ExbB proton channel domain-containing protein
750 CAJPRU010000002.1 GCA905373225_00489 CDS open 238283-243361 _na     1692_aa fepA Colicin I receptor
751 CAJPRU010000002.1 GCA905373225_00490 CDS open 243547-248568 _na     1673_aa btuB TonB-dependent receptor
752 CAJPRU010000002.1 GCA905373225_00258 gene open 4-123
753 CAJPRU010000002.1 GCA905373225_00259 gene open 426-1415 cbiK
754 CAJPRU010000002.1 GCA905373225_00260 gene open 1467-2408 fepB
755 CAJPRU010000002.1 GCA905373225_00261 gene open 2477-3259
756 CAJPRU010000002.1 GCA905373225_00262 gene open 3259-4254 fepD
757 CAJPRU010000002.1 GCA905373225_00263 gene open 4327-4992 cobH
758 CAJPRU010000002.1 GCA905373225_00264 gene open 4979-5767 cobK
759 CAJPRU010000002.1 GCA905373225_00265 gene open 5764-6453 cobJ
760 CAJPRU010000002.1 GCA905373225_00266 gene open 6483-7631 cbiG
761 CAJPRU010000002.1 GCA905373225_00267 gene open 7633-8394 cobM
762 CAJPRU010000002.1 GCA905373225_00268 gene open 8396-8983 cbiT
763 CAJPRU010000002.1 GCA905373225_00269 gene open 8980-9606 cbiE
764 CAJPRU010000002.1 GCA905373225_00270 gene open 9582-10700 cbiD
765 CAJPRU010000002.1 GCA905373225_00271 gene open 10771-11265 yajQ
766 CAJPRU010000002.1 GCA905373225_00272 gene open 11679-13274
767 CAJPRU010000002.1 GCA905373225_00273 gene open 13501-14475 rluA
768 CAJPRU010000002.1 GCA905373225_00274 gene open 14724-15653 fba
769 CAJPRU010000002.1 GCA905373225_00275 gene open 15657-17213 spoVB
770 CAJPRU010000002.1 GCA905373225_00276 gene open 17310-18353 yfdV
771 CAJPRU010000002.1 GCA905373225_00277 gene open 18575-19315 puuD
772 CAJPRU010000002.1 GCA905373225_00278 gene open 19331-19579
773 CAJPRU010000002.1 GCA905373225_00279 gene open 19634-20638
774 CAJPRU010000002.1 GCA905373225_00280 gene open 20789-21628
775 CAJPRU010000002.1 GCA905373225_00281 gene open 21630-22973
776 CAJPRU010000002.1 GCA905373225_00282 gene open 23098-23757 gph
777 CAJPRU010000002.1 GCA905373225_00283 gene open 23958-24554
778 CAJPRU010000002.1 GCA905373225_00284 gene open 24734-24853
779 CAJPRU010000002.1 GCA905373225_00286 gene open 25308-26519 yhjX
780 CAJPRU010000002.1 GCA905373225_00287 gene open 26476-26613
781 CAJPRU010000002.1 GCA905373225_00288 gene open 26787-30125
782 CAJPRU010000002.1 GCA905373225_00289 gene open 30232-31284
783 CAJPRU010000002.1 GCA905373225_00290 gene open 31612-31929
784 CAJPRU010000002.1 GCA905373225_00291 gene open 31953-32912
785 CAJPRU010000002.1 GCA905373225_00292 gene open 32873-33445
786 CAJPRU010000002.1 GCA905373225_00293 gene open 33490-35091
787 CAJPRU010000002.1 GCA905373225_00294 gene open 35108-36334
788 CAJPRU010000002.1 GCA905373225_00295 gene open 36367-39594
789 CAJPRU010000002.1 GCA905373225_00296 gene open 39596-40165
790 CAJPRU010000002.1 GCA905373225_00297 gene open 40302-41189
791 CAJPRU010000002.1 GCA905373225_00298 gene open 41265-41450
792 CAJPRU010000002.1 GCA905373225_00299 gene open 41471-42679
793 CAJPRU010000002.1 GCA905373225_00300 gene open 42869-43051
794 CAJPRU010000002.1 GCA905373225_00301 gene open 43139-43702
795 CAJPRU010000002.1 GCA905373225_00302 gene open 43855-44205 rplT
796 CAJPRU010000002.1 GCA905373225_00303 gene open 44252-44449 rpmI
797 CAJPRU010000002.1 GCA905373225_00304 gene open 44470-45018 infC
798 CAJPRU010000002.1 GCA905373225_00305 gene open 45389-46990 sdcS
799 CAJPRU010000002.1 GCA905373225_00306 gene open 47155-48360 araJ
800 CAJPRU010000002.1 GCA905373225_00307 gene open 48520-50430 thrS
801 CAJPRU010000002.1 GCA905373225_00308 gene open 51046-52035
802 CAJPRU010000002.1 GCA905373225_00309 gene open 52137-52412
803 CAJPRU010000002.1 GCA905373225_00310 gene open 52416-53660 rlhA
804 CAJPRU010000002.1 GCA905373225_00311 gene open 53660-54268 trmR
805 CAJPRU010000002.1 GCA905373225_00312 gene open 54292-55725 mltG
806 CAJPRU010000002.1 GCA905373225_00313 gene open 55969-56265
807 CAJPRU010000002.1 GCA905373225_00314 gene open 56292-56711 ruvX
808 CAJPRU010000002.1 GCA905373225_00315 gene open 56711-56971 ireB
809 CAJPRU010000002.1 GCA905373225_00316 gene open 57126-59741 alaS
810 CAJPRU010000002.1 GCA905373225_00317 gene open 60020-60832 pGRP
811 CAJPRU010000002.1 GCA905373225_00318 gene open 60917-61927 wcaA
812 CAJPRU010000002.1 GCA905373225_00319 gene open 62304-62681 hupH
813 CAJPRU010000002.1 GCA905373225_00320 gene open 62750-63358
814 CAJPRU010000002.1 GCA905373225_00321 gene open 63321-64130 cybH
815 CAJPRU010000002.1 GCA905373225_00322 gene open 64145-66046 hyaB
816 CAJPRU010000002.1 GCA905373225_00323 gene open 66046-67185 hyaA
817 CAJPRU010000002.1 GCA905373225_00324 gene open 67459-67788 trxA
818 CAJPRU010000002.1 GCA905373225_00326 gene open 68246-69349 yqfO
819 CAJPRU010000002.1 GCA905373225_00327 gene open 69365-70096 trmK
820 CAJPRU010000002.1 GCA905373225_00329 gene open 70471-71028 folE
821 CAJPRU010000002.1 GCA905373225_00330 gene open 71110-71856
822 CAJPRU010000002.1 GCA905373225_00331 gene open 71843-72181 queD
823 CAJPRU010000002.1 GCA905373225_00332 gene open 72387-73547 rpoD
824 CAJPRU010000002.1 GCA905373225_00333 gene open 73576-75348 dnaG
825 CAJPRU010000002.1 GCA905373225_00334 gene open 75605-77233 rny
826 CAJPRU010000002.1 GCA905373225_00335 gene open 77325-77753 recX
827 CAJPRU010000002.1 GCA905373225_00336 gene open 77771-78811 recA
828 CAJPRU010000002.1 GCA905373225_00337 gene open 78816-80063 pncC
829 CAJPRU010000002.1 GCA905373225_00338 gene open 80101-81447 rimO
830 CAJPRU010000002.1 GCA905373225_00339 gene open 81503-82540 afuA
831 CAJPRU010000002.1 GCA905373225_00340 gene open 82597-84543 ygiQ
832 CAJPRU010000002.1 GCA905373225_00341 gene open 84583-85035 rodZ
833 CAJPRU010000002.1 GCA905373225_00342 gene open 85087-87828 ftsK
834 CAJPRU010000002.1 GCA905373225_00343 gene open 87911-89212 rarA
835 CAJPRU010000002.1 GCA905373225_00345 gene open 89709-91514 aspS
836 CAJPRU010000002.1 GCA905373225_00346 gene open 91523-92794 hisS
837 CAJPRU010000002.1 GCA905373225_00347 gene open 92794-94221 hemZ
838 CAJPRU010000002.1 GCA905373225_00348 gene open 94214-94702 fur
839 CAJPRU010000002.1 GCA905373225_00349 gene open 94744-95379
840 CAJPRU010000002.1 GCA905373225_00350 gene open 95379-97619 spoT
841 CAJPRU010000002.1 GCA905373225_00351 gene open 97631-99613 recJ
842 CAJPRU010000002.1 GCA905373225_00352 gene open 99808-101226 hydG
843 CAJPRU010000002.1 GCA905373225_00353 gene open 101369-101665
844 CAJPRU010000002.1 GCA905373225_00354 gene open 101537-102625
845 CAJPRU010000002.1 GCA905373225_00355 gene open 102627-103436 yusV
846 CAJPRU010000002.1 GCA905373225_00356 gene open 103451-104449
847 CAJPRU010000002.1 GCA905373225_00357 gene open 104451-105473 fhuB
848 CAJPRU010000002.1 GCA905373225_00358 gene open 105767-106531 fetB
849 CAJPRU010000002.1 GCA905373225_00359 gene open 106528-107184 ybbL
850 CAJPRU010000002.1 GCA905373225_00360 gene open 107329-107613 rpmA
851 CAJPRU010000002.1 GCA905373225_00361 gene open 107626-107940 ysxB
852 CAJPRU010000002.1 GCA905373225_00362 gene open 107943-108254 rplU
853 CAJPRU010000002.1 GCA905373225_00363 gene open 108455-108706
854 CAJPRU010000002.1 GCA905373225_00364 gene open 108716-109030 mntP
855 CAJPRU010000002.1 GCA905373225_00365 gene open 109059-110486 cafA
856 CAJPRU010000002.1 GCA905373225_00366 gene open 110521-111216
857 CAJPRU010000002.1 GCA905373225_00367 gene open 111188-113071 ygiQ
858 CAJPRU010000002.1 GCA905373225_00368 gene open 113127-114230 rodA
859 CAJPRU010000002.1 GCA905373225_00369 gene open 114239-115162 minD
860 CAJPRU010000002.1 GCA905373225_00370 gene open 115164-117086 mrdA
861 CAJPRU010000002.1 GCA905373225_00371 gene open 117106-117600 mreD
862 CAJPRU010000002.1 GCA905373225_00372 gene open 117597-118514 mreC
863 CAJPRU010000002.1 GCA905373225_00373 gene open 118516-119553 mreB
864 CAJPRU010000002.1 GCA905373225_00374 gene open 119833-120531 radC
865 CAJPRU010000002.1 GCA905373225_00375 gene open 120669-121235
866 CAJPRU010000002.1 GCA905373225_00376 gene open 121322-121942
867 CAJPRU010000002.1 GCA905373225_00377 gene open 122095-123300 ackA
868 CAJPRU010000002.1 GCA905373225_00378 gene open 123304-123867
869 CAJPRU010000002.1 GCA905373225_00379 gene open 124054-125397 tmcAL
870 CAJPRU010000002.1 GCA905373225_00380 gene open 125521-126042 pyrR
871 CAJPRU010000002.1 GCA905373225_00381 gene open 126136-127059 rluA
872 CAJPRU010000002.1 GCA905373225_00382 gene open 127146-127586 lspA
873 CAJPRU010000002.1 GCA905373225_00383 gene open 127695-127859 rnfC
874 CAJPRU010000002.1 GCA905373225_00384 gene open 128351-128614
875 CAJPRU010000002.1 GCA905373225_00385 gene open 128617-128754
876 CAJPRU010000002.1 GCA905373225_00386 gene open 128854-130155 citT
877 CAJPRU010000002.1 GCA905373225_00387 gene open 130194-130451
878 CAJPRU010000002.1 GCA905373225_00388 gene open 130646-131767 mmdB
879 CAJPRU010000002.1 GCA905373225_00389 gene open 131838-132221 mmdC
880 CAJPRU010000002.1 GCA905373225_00390 gene open 132323-132490 mmdE
881 CAJPRU010000002.1 GCA905373225_00391 gene open 132514-132858
882 CAJPRU010000002.1 GCA905373225_00392 gene open 132932-134461 mmdA
883 CAJPRU010000002.1 GCA905373225_00393 gene open 134612-135034 mce
884 CAJPRU010000002.1 GCA905373225_00394 gene open 135086-136024 meaB
885 CAJPRU010000002.1 GCA905373225_00395 gene open 136104-136499 sbm
886 CAJPRU010000002.1 GCA905373225_00396 gene open 136528-138174 sbm
887 CAJPRU010000002.1 GCA905373225_00397 gene open 138203-139708 aCH1
888 CAJPRU010000002.1 GCA905373225_00398 gene open 140233-141471 rfaL
889 CAJPRU010000002.1 GCA905373225_00399 gene open 141481-142788 folC
890 CAJPRU010000002.1 GCA905373225_00400 gene open 142801-145458 valS
891 CAJPRU010000002.1 GCA905373225_00401 gene open 145479-146369 tatC
892 CAJPRU010000002.1 GCA905373225_00402 gene open 146371-147342 ispA
893 CAJPRU010000002.1 GCA905373225_00403 gene open 147339-148037 yihA
894 CAJPRU010000002.1 GCA905373225_00404 gene open 148037-150346 lon
895 CAJPRU010000002.1 GCA905373225_00405 gene open 150412-151665 clpX
896 CAJPRU010000002.1 GCA905373225_00406 gene open 151678-152271 clpP
897 CAJPRU010000002.1 GCA905373225_00407 gene open 152308-153612 tig
898 CAJPRU010000002.1 GCA905373225_00408 gene open 153776-154231
899 CAJPRU010000002.1 GCA905373225_00409 gene open 154343-154822 rlmH
900 CAJPRU010000002.1 GCA905373225_00410 gene open 154819-155631 phnP
901 CAJPRU010000002.1 GCA905373225_00411 gene open 155737-156924 rbcL
902 CAJPRU010000002.1 GCA905373225_00412 gene open 157126-158511 uraA
903 CAJPRU010000002.1 GCA905373225_00413 gene open 158657-161206 xdh
904 CAJPRU010000002.1 GCA905373225_00414 gene open 161224-162573 hydA
905 CAJPRU010000002.1 GCA905373225_00415 gene open 162570-164261 preA
906 CAJPRU010000002.1 GCA905373225_00416 gene open 164290-165618 ssnA
907 CAJPRU010000002.1 GCA905373225_00417 gene open 165673-166608 arcC
908 CAJPRU010000002.1 GCA905373225_00418 gene open 166677-167870 ygeW
909 CAJPRU010000002.1 GCA905373225_00419 gene open 168024-169334 ygeY
910 CAJPRU010000002.1 GCA905373225_00420 gene open 169347-170558 dpaL
911 CAJPRU010000002.1 GCA905373225_00421 gene open 170568-171200
912 CAJPRU010000002.1 GCA905373225_00422 gene open 171599-172018 norV
913 CAJPRU010000002.1 GCA905373225_00423 gene open 172029-172616
914 CAJPRU010000002.1 GCA905373225_00424 gene open 172721-173353
915 CAJPRU010000002.1 GCA905373225_00425 gene open 173391-175094 glnS
916 CAJPRU010000002.1 GCA905373225_00426 gene open 175162-176211 ldhA
917 CAJPRU010000002.1 GCA905373225_00427 gene open 176335-176802 mscL
918 CAJPRU010000002.1 GCA905373225_00428 gene open 177088-178755 ybjD
919 CAJPRU010000002.1 GCA905373225_00429 gene open 178928-179815 rhaT
920 CAJPRU010000002.1 GCA905373225_00430 gene open 180028-181527 thrC
921 CAJPRU010000002.1 GCA905373225_00431 gene open 181711-182652 efeB
922 CAJPRU010000002.1 GCA905373225_00433 gene open 183094-183396
923 CAJPRU010000002.1 GCA905373225_00434 gene open 183398-184363 moaA
924 CAJPRU010000002.1 GCA905373225_00435 gene open 184390-184830 yiiM
925 CAJPRU010000002.1 GCA905373225_00436 gene open 185045-186373 uraA
926 CAJPRU010000002.1 GCA905373225_00437 gene open 186554-187171 ftcD
927 CAJPRU010000002.1 GCA905373225_00438 gene open 187331-189001 mIS1
928 CAJPRU010000002.1 GCA905373225_00439 gene open 189398-190672 citT
929 CAJPRU010000002.1 GCA905373225_00440 gene open 190830-191441 ttdB
930 CAJPRU010000002.1 GCA905373225_00441 gene open 191441-192343 ttdA
931 CAJPRU010000002.1 GCA905373225_00442 gene open 192728-193756 araC
932 CAJPRU010000002.1 GCA905373225_00443 gene open 193949-194215
933 CAJPRU010000002.1 GCA905373225_00444 gene open 194632-195654 araC
934 CAJPRU010000002.1 GCA905373225_00445 gene open 195669-195947
935 CAJPRU010000002.1 GCA905373225_00446 gene open 195997-196332 qdoI
936 CAJPRU010000002.1 GCA905373225_00447 gene open 196672-197907 moeA
937 CAJPRU010000002.1 GCA905373225_00448 gene open 197888-199012 mobB
938 CAJPRU010000002.1 GCA905373225_00449 gene open 199005-199535 thiT
939 CAJPRU010000002.1 GCA905373225_00450 gene open 199674-200705 guaB
940 CAJPRU010000002.1 GCA905373225_00451 gene open 200843-202126 fucP
941 CAJPRU010000002.1 GCA905373225_00452 gene open 202205-203383 abgB
942 CAJPRU010000002.1 GCA905373225_00453 gene open 203574-203756
943 CAJPRU010000002.1 GCA905373225_00454 gene open 203894-205081 argD
944 CAJPRU010000002.1 GCA905373225_00455 gene open 205167-206024 argB
945 CAJPRU010000002.1 GCA905373225_00456 gene open 206035-206985 argC
946 CAJPRU010000002.1 GCA905373225_00457 gene open 207096-208106 argF
947 CAJPRU010000002.1 GCA905373225_00458 gene open 208138-209322 abgB
948 CAJPRU010000002.1 GCA905373225_00459 gene open 209550-210872 cpdA
949 CAJPRU010000002.1 GCA905373225_00460 gene open 210879-211469 cynT
950 CAJPRU010000002.1 GCA905373225_00461 gene open 211654-212166 ilvN
951 CAJPRU010000002.1 GCA905373225_00462 gene open 212175-213902 ilvB
952 CAJPRU010000002.1 GCA905373225_00463 gene open 214095-214373
953 CAJPRU010000002.1 GCA905373225_00464 gene open 214451-214951
954 CAJPRU010000002.1 GCA905373225_00465 gene open 214941-215288
955 CAJPRU010000002.1 GCA905373225_00466 gene open 215298-216113 ubiG
956 CAJPRU010000002.1 GCA905373225_00468 gene open 216688-217146
957 CAJPRU010000002.1 GCA905373225_00469 gene open 217245-219488
958 CAJPRU010000002.1 GCA905373225_00470 gene open 219635-220354
959 CAJPRU010000002.1 GCA905373225_00471 gene open 220622-222433 typA
960 CAJPRU010000002.1 GCA905373225_00472 gene open 222630-223577
961 CAJPRU010000002.1 GCA905373225_00473 gene open 223717-224646 murB
962 CAJPRU010000002.1 GCA905373225_00474 gene open 224621-224986 ylbF
963 CAJPRU010000002.1 GCA905373225_00475 gene open 225092-225577 trmL
964 CAJPRU010000002.1 GCA905373225_00476 gene open 225606-226118 moaC
965 CAJPRU010000002.1 GCA905373225_00477 gene open 226137-226904 ulaG
966 CAJPRU010000002.1 GCA905373225_00478 gene open 227010-228653
967 CAJPRU010000002.1 GCA905373225_00479 gene open 228791-229891 mMP0363
968 CAJPRU010000002.1 GCA905373225_00480 gene open 229904-230710
969 CAJPRU010000002.1 GCA905373225_00481 gene open 230823-231473 trkA
970 CAJPRU010000002.1 GCA905373225_00482 gene open 231509-232870 trkG
971 CAJPRU010000002.1 GCA905373225_00483 gene open 232877-233881 rbsK
972 CAJPRU010000002.1 GCA905373225_00484 gene open 234205-235845 hutW
973 CAJPRU010000002.1 GCA905373225_00485 gene open 235867-236385 fldA
974 CAJPRU010000002.1 GCA905373225_00486 gene open 236414-237217 tonB
975 CAJPRU010000002.1 GCA905373225_00487 gene open 237220-237627 exbD
976 CAJPRU010000002.1 GCA905373225_00488 gene open 237630-238247 tolQ
977 CAJPRU010000002.1 GCA905373225_00489 gene open 238283-243361 fepA
978 CAJPRU010000002.1 GCA905373225_00490 gene open 243547-248568 btuB
979 CAJPRU010000002.1 GCA905373225_00328 gene open 70325-70399 trnI
980 CAJPRU010000002.1 GCA905373225_00432 gene open 182935-183010 trnK
981 CAJPRU010000002.1 GCA905373225_00467 gene open 216485-216559 trnR
982 CAJPRU010000002.1 GCA905373225_00328 tRNA open 70325-70399 trnI tRNA-Ile2(cat)
983 CAJPRU010000002.1 GCA905373225_00432 tRNA open 182935-183010 trnK tRNA-Lys(ctt)
984 CAJPRU010000002.1 GCA905373225_00467 tRNA open 216485-216559 trnR tRNA-Arg(ccg)
985 CAJPRU010000003.1 rep_origin open 40835-41160
986 CAJPRU010000003.1 rep_origin open 42586-43410
987 CAJPRU010000003.1 regulatory_region open 145159-145334 Cobalamin riboswitch aptamer
988 CAJPRU010000003.1 repeat_region open 86114-86396 CRISPR array with 4 repeats of length 35%2C consensus sequence TTAATTTAAATAATCCCCATTAGGGGACGGAAACT and spacer length 43
989 CAJPRU010000003.1 repeat_region open 86814-87168 CRISPR array with 5 repeats of length 32%2C consensus sequence GTTAAATTAAATAATCCCCTGATGGGGACGGA and spacer length 46
990 CAJPRU010000003.1 repeat_region open 97208-98255 CRISPR array with 14 repeats of length 35%2C consensus sequence GTTAAATTAAATAATCCCCTGATGGGGACGGAAAC and spacer length 42
991 CAJPRU010000003.1 repeat_region open 113593-114034 CRISPR array with 7 repeats of length 36%2C consensus sequence GTTTGAGAGTAGTGTAATTCTGTAAACCTCTAAAAC and spacer length 30
992 CAJPRU010000003.1 repeat_region open 114317-114562 CRISPR array with 4 repeats of length 39%2C consensus sequence GCAGTTTGAGAGTAGTGTAATTCTGTAAACCTCTAAAAC and spacer length 27
993 CAJPRU010000003.1 repeat_region open 114649-116364 CRISPR array with 26 repeats of length 35%2C consensus sequence GTTTGAGAGTAGTGTAATTCTGTAAACCTCTAAAA and spacer length 31
994 CAJPRU010000003.1 GCA905373225_00491 CDS open 181-1590 _na     469_aa Hemagglutinin family protein
995 CAJPRU010000003.1 GCA905373225_00492 CDS open 2247-2573 _na     108_aa Tat pathway signal protein
996 CAJPRU010000003.1 GCA905373225_00493 CDS open 2640-3716 _na     358_aa wecH Acyltransferase 3 domain-containing protein
997 CAJPRU010000003.1 GCA905373225_00494 CDS open 4193-5743 _na     516_aa O-antigen ligase family protein
998 CAJPRU010000003.1 GCA905373225_00495 CDS open 5787-7028 _na     413_aa Polysaccharide biosynthesis protein
999 CAJPRU010000003.1 GCA905373225_00496 CDS open 7189-8142 _na     317_aa glycosyltransferase
1000 CAJPRU010000003.1 GCA905373225_00497 CDS open 8146-8967 _na     273_aa LicD/FKTN/FKRP nucleotidyltransferase domain-containing protein