HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Capnocytophaga sputigena (GCA_905373265.1)

Select a Genome:
BAKTA Annotations for GCA_905373265.1
Genome Selected: Capnocytophaga sputigena
ContigsBases CDSrRNA tmRNAtRNA
89 2955558 2698 2 1 30
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 5478 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:11]    |    Number of Records Found: 5478 [11 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  11  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
5001 CAJPRX010000058.1 GCA905373265_02492 gene open 7394-7699
5002 CAJPRX010000058.1 GCA905373265_02493 gene open 7707-8594
5003 CAJPRX010000058.1 GCA905373265_02494 gene open 8572-8721
5004 CAJPRX010000058.1 GCA905373265_02495 gene open 8744-9247
5005 CAJPRX010000058.1 GCA905373265_02496 gene open 9260-9772
5006 CAJPRX010000058.1 GCA905373265_02497 gene open 9777-10316
5007 CAJPRX010000058.1 GCA905373265_02498 gene open 10321-10695
5008 CAJPRX010000058.1 GCA905373265_02499 gene open 10710-11687
5009 CAJPRX010000058.1 GCA905373265_02500 gene open 11689-11991 lydA
5010 CAJPRX010000058.1 GCA905373265_02501 gene open 12004-12498
5011 CAJPRX010000058.1 GCA905373265_02502 gene open 12505-13086
5012 CAJPRX010000058.1 GCA905373265_02503 gene open 13145-13612
5013 CAJPRX010000059.1 GCA905373265_02504 CDS open 68-721 _na     217_aa master DNA invertase Mpi family serine-type recombinase
5014 CAJPRX010000059.1 GCA905373265_02505 CDS open 732-2360 _na     542_aa Acetyl-CoA carboxylase carboxyltransferase subunit alpha
5015 CAJPRX010000059.1 GCA905373265_02506 CDS open 2453-5209 _na     918_aa uvrA excinuclease ABC subunit UvrA
5016 CAJPRX010000059.1 GCA905373265_02507 CDS open 5340-6806 _na     488_aa susD SusD family
5017 CAJPRX010000059.1 GCA905373265_02508 CDS open 6820-9945 _na     1041_aa TonB-dependent receptor plug domain protein
5018 CAJPRX010000059.1 GCA905373265_02509 CDS open 10267-11160 _na     297_aa WYL domain-containing protein
5019 CAJPRX010000059.1 GCA905373265_02510 CDS open 11430-11771 _na     113_aa hypothetical protein
5020 CAJPRX010000059.1 GCA905373265_02511 CDS open 11880-12050 _na     56_aa hypothetical protein
5021 CAJPRX010000059.1 GCA905373265_02504 gene open 68-721
5022 CAJPRX010000059.1 GCA905373265_02505 gene open 732-2360
5023 CAJPRX010000059.1 GCA905373265_02506 gene open 2453-5209 uvrA
5024 CAJPRX010000059.1 GCA905373265_02507 gene open 5340-6806 susD
5025 CAJPRX010000059.1 GCA905373265_02508 gene open 6820-9945
5026 CAJPRX010000059.1 GCA905373265_02509 gene open 10267-11160
5027 CAJPRX010000059.1 GCA905373265_02510 gene open 11430-11771
5028 CAJPRX010000059.1 GCA905373265_02511 gene open 11880-12050
5029 CAJPRX010000060.1 GCA905373265_02512 CDS open 101-715 _na     204_aa DUF4468 domain-containing protein
5030 CAJPRX010000060.1 GCA905373265_02513 CDS open 722-2032 _na     436_aa Phenylacetate-coenzyme A ligase
5031 CAJPRX010000060.1 GCA905373265_02514 CDS open 2160-4163 _na     667_aa DUF3857 domain-containing protein
5032 CAJPRX010000060.1 GCA905373265_02515 CDS open 4244-5497 _na     417_aa FAD-binding domain-containing protein
5033 CAJPRX010000060.1 GCA905373265_02516 CDS open 5543-7216 _na     557_aa VWFA domain-containing protein
5034 CAJPRX010000060.1 GCA905373265_02517 CDS open 7269-7625 _na     118_aa yfhL YfhL family 4Fe-4S dicluster ferredoxin
5035 CAJPRX010000060.1 GCA905373265_02518 CDS open 7705-8355 _na     216_aa DUF218 domain-containing protein
5036 CAJPRX010000060.1 GCA905373265_02519 CDS open 8388-9590 _na     400_aa Sigma-54 interaction domain protein
5037 CAJPRX010000060.1 GCA905373265_02520 CDS open 9689-10240 _na     183_aa Thioredoxin family protein
5038 CAJPRX010000060.1 GCA905373265_02521 CDS open 10271-11281 _na     336_aa lpxK tetraacyldisaccharide 4'-kinase
5039 CAJPRX010000060.1 GCA905373265_02522 CDS open 11322-11882 _na     186_aa DUF4328 domain-containing protein
5040 CAJPRX010000060.1 GCA905373265_02512 gene open 101-715
5041 CAJPRX010000060.1 GCA905373265_02513 gene open 722-2032
5042 CAJPRX010000060.1 GCA905373265_02514 gene open 2160-4163
5043 CAJPRX010000060.1 GCA905373265_02515 gene open 4244-5497
5044 CAJPRX010000060.1 GCA905373265_02516 gene open 5543-7216
5045 CAJPRX010000060.1 GCA905373265_02517 gene open 7269-7625 yfhL
5046 CAJPRX010000060.1 GCA905373265_02518 gene open 7705-8355
5047 CAJPRX010000060.1 GCA905373265_02519 gene open 8388-9590
5048 CAJPRX010000060.1 GCA905373265_02520 gene open 9689-10240
5049 CAJPRX010000060.1 GCA905373265_02521 gene open 10271-11281 lpxK
5050 CAJPRX010000060.1 GCA905373265_02522 gene open 11322-11882
5051 CAJPRX010000061.1 GCA905373265_02523 CDS open 116-634 _na     172_aa hypothetical protein
5052 CAJPRX010000061.1 GCA905373265_02524 CDS open 692-2266 _na     524_aa SPFH/Band 7/PHB domain protein
5053 CAJPRX010000061.1 GCA905373265_02525 CDS open 2267-3868 _na     533_aa DUF4139 domain-containing protein
5054 CAJPRX010000061.1 GCA905373265_02526 CDS open 3966-4874 _na     302_aa cysK cysteine synthase A
5055 CAJPRX010000061.1 GCA905373265_02527 CDS open 4923-5279 _na     118_aa Four helix bundle protein
5056 CAJPRX010000061.1 GCA905373265_02528 CDS open 5315-6157 _na     280_aa Serine acetyltransferase
5057 CAJPRX010000061.1 GCA905373265_02529 CDS open 6404-7906 _na     500_aa gltX glutamate--tRNA ligase
5058 CAJPRX010000061.1 GCA905373265_02530 CDS open 7913-8575 _na     220_aa Aspartate kinase
5059 CAJPRX010000061.1 GCA905373265_02531 CDS open 8664-9023 _na     119_aa UPF0102 protein CBG49_10970
5060 CAJPRX010000061.1 GCA905373265_02532 CDS open 9195-10019 _na     274_aa NADAR domain-containing protein
5061 CAJPRX010000061.1 GCA905373265_02533 CDS open 10025-10432 _na     135_aa Immunity protein 45 domain-containing protein
5062 CAJPRX010000061.1 GCA905373265_02534 CDS open 10608-10925 _na     105_aa DUF4298 domain-containing protein
5063 CAJPRX010000061.1 GCA905373265_02535 CDS open 10947-11594 _na     215_aa hypothetical protein
5064 CAJPRX010000061.1 GCA905373265_02536 CDS open 11561-12034 _na     157_aa 5-formyltetrahydrofolate cyclo-ligase
5065 CAJPRX010000061.1 GCA905373265_02523 gene open 116-634
5066 CAJPRX010000061.1 GCA905373265_02524 gene open 692-2266
5067 CAJPRX010000061.1 GCA905373265_02525 gene open 2267-3868
5068 CAJPRX010000061.1 GCA905373265_02526 gene open 3966-4874 cysK
5069 CAJPRX010000061.1 GCA905373265_02527 gene open 4923-5279
5070 CAJPRX010000061.1 GCA905373265_02528 gene open 5315-6157
5071 CAJPRX010000061.1 GCA905373265_02529 gene open 6404-7906 gltX
5072 CAJPRX010000061.1 GCA905373265_02530 gene open 7913-8575
5073 CAJPRX010000061.1 GCA905373265_02531 gene open 8664-9023
5074 CAJPRX010000061.1 GCA905373265_02532 gene open 9195-10019
5075 CAJPRX010000061.1 GCA905373265_02533 gene open 10025-10432
5076 CAJPRX010000061.1 GCA905373265_02534 gene open 10608-10925
5077 CAJPRX010000061.1 GCA905373265_02535 gene open 10947-11594
5078 CAJPRX010000061.1 GCA905373265_02536 gene open 11561-12034
5079 CAJPRX010000062.1 GCA905373265_02537 CDS open 208-639 _na     143_aa DUF2262 domain-containing protein
5080 CAJPRX010000062.1 GCA905373265_02538 CDS open 647-1129 _na     160_aa SMI1/KNR4 family protein
5081 CAJPRX010000062.1 GCA905373265_02539 CDS open 1136-1465 _na     109_aa hypothetical protein
5082 CAJPRX010000062.1 GCA905373265_02540 CDS open 1472-1843 _na     123_aa Transposase
5083 CAJPRX010000062.1 GCA905373265_02541 CDS open 1944-2312 _na     122_aa Toxin-antitoxin system%2C toxin component domain protein
5084 CAJPRX010000062.1 GCA905373265_02542 CDS open 2390-3451 _na     353_aa Lipoprotein
5085 CAJPRX010000062.1 GCA905373265_02543 CDS open 3484-3981 _na     165_aa YdeI/OmpD-associated family protein
5086 CAJPRX010000062.1 GCA905373265_02544 CDS open 3965-4675 _na     236_aa hypothetical protein
5087 CAJPRX010000062.1 GCA905373265_02545 CDS open 4684-5301 _na     205_aa DUF4304 domain-containing protein
5088 CAJPRX010000062.1 GCA905373265_02546 CDS open 5558-5734 _na     58_aa hypothetical protein
5089 CAJPRX010000062.1 GCA905373265_02547 CDS open 5776-7503 _na     575_aa ytpA Phospholipase ytpA
5090 CAJPRX010000062.1 GCA905373265_02548 CDS open 7546-8292 _na     248_aa 3-oxoacyl-ACP reductase
5091 CAJPRX010000062.1 GCA905373265_02549 CDS open 8289-9329 _na     346_aa Phospholipase
5092 CAJPRX010000062.1 GCA905373265_02550 CDS open 9317-10093 _na     258_aa Phosphatidate cytidylyltransferase
5093 CAJPRX010000062.1 GCA905373265_02551 CDS open 10083-10685 _na     200_aa CDP-alcohol phosphatidyltransferase
5094 CAJPRX010000062.1 GCA905373265_02552 CDS open 10707-11054 _na     115_aa Phosphoribosyl-ATP pyrophosphohydrolase
5095 CAJPRX010000062.1 GCA905373265_02553 CDS open 11783-11881 _na     32_aa hypothetical protein
5096 CAJPRX010000062.1 GCA905373265_02537 gene open 208-639
5097 CAJPRX010000062.1 GCA905373265_02538 gene open 647-1129
5098 CAJPRX010000062.1 GCA905373265_02539 gene open 1136-1465
5099 CAJPRX010000062.1 GCA905373265_02540 gene open 1472-1843
5100 CAJPRX010000062.1 GCA905373265_02541 gene open 1944-2312
5101 CAJPRX010000062.1 GCA905373265_02542 gene open 2390-3451
5102 CAJPRX010000062.1 GCA905373265_02543 gene open 3484-3981
5103 CAJPRX010000062.1 GCA905373265_02544 gene open 3965-4675
5104 CAJPRX010000062.1 GCA905373265_02545 gene open 4684-5301
5105 CAJPRX010000062.1 GCA905373265_02546 gene open 5558-5734
5106 CAJPRX010000062.1 GCA905373265_02547 gene open 5776-7503 ytpA
5107 CAJPRX010000062.1 GCA905373265_02548 gene open 7546-8292
5108 CAJPRX010000062.1 GCA905373265_02549 gene open 8289-9329
5109 CAJPRX010000062.1 GCA905373265_02550 gene open 9317-10093
5110 CAJPRX010000062.1 GCA905373265_02551 gene open 10083-10685
5111 CAJPRX010000062.1 GCA905373265_02552 gene open 10707-11054
5112 CAJPRX010000062.1 GCA905373265_02553 gene open 11783-11881
5113 CAJPRX010000063.1 GCA905373265_02554 CDS open 75-929 _na     284_aa YD repeat protein
5114 CAJPRX010000063.1 GCA905373265_02555 CDS open 922-3210 _na     762_aa DUF5682 domain-containing protein
5115 CAJPRX010000063.1 GCA905373265_02556 CDS open 3215-3691 _na     158_aa DinB-like domain-containing protein
5116 CAJPRX010000063.1 GCA905373265_02557 CDS open 3801-5177 _na     458_aa hisS histidine--tRNA ligase
5117 CAJPRX010000063.1 GCA905373265_02558 CDS open 5280-6047 _na     255_aa mazG nucleoside triphosphate pyrophosphohydrolase
5118 CAJPRX010000063.1 GCA905373265_02559 CDS open 6044-7258 _na     404_aa ROK family protein
5119 CAJPRX010000063.1 GCA905373265_02560 CDS open 7387-8625 _na     412_aa Flavoprotein family protein
5120 CAJPRX010000063.1 GCA905373265_02561 CDS open 8648-9082 _na     144_aa Putative beta-lactamase-inhibitor-like PepSY-like domain-containing protein
5121 CAJPRX010000063.1 GCA905373265_02562 CDS open 9084-9533 _na     149_aa Putative beta-lactamase-inhibitor-like PepSY-like domain-containing protein
5122 CAJPRX010000063.1 GCA905373265_02563 CDS open 9711-11048 _na     445_aa DUF5723 domain-containing protein
5123 CAJPRX010000063.1 GCA905373265_02554 gene open 75-929
5124 CAJPRX010000063.1 GCA905373265_02555 gene open 922-3210
5125 CAJPRX010000063.1 GCA905373265_02556 gene open 3215-3691
5126 CAJPRX010000063.1 GCA905373265_02557 gene open 3801-5177 hisS
5127 CAJPRX010000063.1 GCA905373265_02558 gene open 5280-6047 mazG
5128 CAJPRX010000063.1 GCA905373265_02559 gene open 6044-7258
5129 CAJPRX010000063.1 GCA905373265_02560 gene open 7387-8625
5130 CAJPRX010000063.1 GCA905373265_02561 gene open 8648-9082
5131 CAJPRX010000063.1 GCA905373265_02562 gene open 9084-9533
5132 CAJPRX010000063.1 GCA905373265_02563 gene open 9711-11048
5133 CAJPRX010000064.1 repeat_region open 4716-5303 CRISPR array with 8 repeats of length 46%2C consensus sequence GTTGTGAATTGCTTTCAAATTTTGTAGTTTTGTGATTGATAACAAC and spacer length 30
5134 CAJPRX010000064.1 GCA905373265_02564 CDS open 406-1044 _na     212_aa aat leucyl/phenylalanyl-tRNA--protein transferase
5135 CAJPRX010000064.1 GCA905373265_02565 CDS open 1047-1598 _na     183_aa DUF3127 domain-containing protein
5136 CAJPRX010000064.1 GCA905373265_02566 CDS open 1975-2301 _na     108_aa ytxH YtxH domain-containing protein
5137 CAJPRX010000064.1 GCA905373265_02567 CDS open 2306-2683 _na     125_aa Phage holin family protein
5138 CAJPRX010000064.1 GCA905373265_02568 CDS open 2673-2921 _na     82_aa DUF3618 domain-containing protein
5139 CAJPRX010000064.1 GCA905373265_02569 CDS open 3042-3419 _na     125_aa Lipocalin-like domain-containing protein
5140 CAJPRX010000064.1 GCA905373265_02570 CDS open 3492-3743 _na     83_aa Transglycosylase-associated protein
5141 CAJPRX010000064.1 GCA905373265_02571 CDS open 4157-4594 _na     145_aa Polymerase
5142 CAJPRX010000064.1 GCA905373265_02572 CDS open 5636-5977 _na     113_aa cas2 CRISPR-associated endonuclease Cas2
5143 CAJPRX010000064.1 GCA905373265_02573 CDS open 6175-10455 _na     1426_aa cas9 type II CRISPR RNA-guided endonuclease Cas9
5144 CAJPRX010000064.1 GCA905373265_02564 gene open 406-1044 aat
5145 CAJPRX010000064.1 GCA905373265_02565 gene open 1047-1598
5146 CAJPRX010000064.1 GCA905373265_02566 gene open 1975-2301 ytxH
5147 CAJPRX010000064.1 GCA905373265_02567 gene open 2306-2683
5148 CAJPRX010000064.1 GCA905373265_02568 gene open 2673-2921
5149 CAJPRX010000064.1 GCA905373265_02569 gene open 3042-3419
5150 CAJPRX010000064.1 GCA905373265_02570 gene open 3492-3743
5151 CAJPRX010000064.1 GCA905373265_02571 gene open 4157-4594
5152 CAJPRX010000064.1 GCA905373265_02572 gene open 5636-5977 cas2
5153 CAJPRX010000064.1 GCA905373265_02573 gene open 6175-10455 cas9
5154 CAJPRX010000065.1 GCA905373265_02574 CDS open 40-249 _na     69_aa hypothetical protein
5155 CAJPRX010000065.1 GCA905373265_02575 CDS open 381-575 _na     64_aa tatA Sec-independent protein translocase protein TatA
5156 CAJPRX010000065.1 GCA905373265_02576 CDS open 621-938 _na     105_aa UPF0145 protein C4H12_11850
5157 CAJPRX010000065.1 GCA905373265_02577 CDS open 1016-2011 _na     331_aa mutY A/G-specific adenine glycosylase
5158 CAJPRX010000065.1 GCA905373265_02578 CDS open 2116-2577 _na     153_aa MORN repeat protein
5159 CAJPRX010000065.1 GCA905373265_02579 CDS open 2673-3095 _na     140_aa Single-stranded DNA-binding protein
5160 CAJPRX010000065.1 GCA905373265_02580 CDS open 3119-4444 _na     441_aa Magnesium/cobalt efflux protein
5161 CAJPRX010000065.1 GCA905373265_02581 CDS open 4437-4775 _na     112_aa Transcriptional regulator
5162 CAJPRX010000065.1 GCA905373265_02582 CDS open 4827-5078 _na     83_aa toxin-antitoxin system%2C antitoxin component%2C PHD family protein
5163 CAJPRX010000065.1 GCA905373265_02583 CDS open 5069-5365 _na     98_aa type II toxin-antitoxin system RelE/ParE family toxin
5164 CAJPRX010000065.1 GCA905373265_02584 CDS open 5438-6829 _na     463_aa Bacterial group 2 Ig-like protein
5165 CAJPRX010000065.1 GCA905373265_02585 CDS open 6888-7796 _na     302_aa Bacterial group 2 Ig-like protein
5166 CAJPRX010000065.1 GCA905373265_02586 CDS open 7793-8908 _na     371_aa DUF4856 domain-containing protein
5167 CAJPRX010000065.1 GCA905373265_02587 CDS open 8913-9455 _na     180_aa Lipoprotein
5168 CAJPRX010000065.1 GCA905373265_02588 CDS open 9460-10440 _na     326_aa DUF4302 domain-containing protein
5169 CAJPRX010000065.1 GCA905373265_02574 gene open 40-249
5170 CAJPRX010000065.1 GCA905373265_02575 gene open 381-575 tatA
5171 CAJPRX010000065.1 GCA905373265_02576 gene open 621-938
5172 CAJPRX010000065.1 GCA905373265_02577 gene open 1016-2011 mutY
5173 CAJPRX010000065.1 GCA905373265_02578 gene open 2116-2577
5174 CAJPRX010000065.1 GCA905373265_02579 gene open 2673-3095
5175 CAJPRX010000065.1 GCA905373265_02580 gene open 3119-4444
5176 CAJPRX010000065.1 GCA905373265_02581 gene open 4437-4775
5177 CAJPRX010000065.1 GCA905373265_02582 gene open 4827-5078
5178 CAJPRX010000065.1 GCA905373265_02583 gene open 5069-5365
5179 CAJPRX010000065.1 GCA905373265_02584 gene open 5438-6829
5180 CAJPRX010000065.1 GCA905373265_02585 gene open 6888-7796
5181 CAJPRX010000065.1 GCA905373265_02586 gene open 7793-8908
5182 CAJPRX010000065.1 GCA905373265_02587 gene open 8913-9455
5183 CAJPRX010000065.1 GCA905373265_02588 gene open 9460-10440
5184 CAJPRX010000066.1 GCA905373265_02589 CDS open 350-505 _na     51_aa hypothetical protein
5185 CAJPRX010000066.1 GCA905373265_02590 CDS open 708-1556 _na     282_aa Lipoprotein
5186 CAJPRX010000066.1 GCA905373265_02591 CDS open 1738-2544 _na     268_aa ywqK Toxin-antitoxin system YwqK family antitoxin
5187 CAJPRX010000066.1 GCA905373265_02592 CDS open 2598-5042 _na     814_aa Glycosyl hydrolase family 2%2C sugar binding domain protein
5188 CAJPRX010000066.1 GCA905373265_02593 CDS open 5152-5592 _na     146_aa Lipoprotein
5189 CAJPRX010000066.1 GCA905373265_02594 CDS open 5615-6640 _na     341_aa Peptidase
5190 CAJPRX010000066.1 GCA905373265_02595 CDS open 6749-7612 _na     287_aa Peptidase M48 domain-containing protein
5191 CAJPRX010000066.1 GCA905373265_02596 CDS open 7977-9941 _na     654_aa 1%2C4-alpha-glucan branching enzyme
5192 CAJPRX010000066.1 GCA905373265_02589 gene open 350-505
5193 CAJPRX010000066.1 GCA905373265_02590 gene open 708-1556
5194 CAJPRX010000066.1 GCA905373265_02591 gene open 1738-2544 ywqK
5195 CAJPRX010000066.1 GCA905373265_02592 gene open 2598-5042
5196 CAJPRX010000066.1 GCA905373265_02593 gene open 5152-5592
5197 CAJPRX010000066.1 GCA905373265_02594 gene open 5615-6640
5198 CAJPRX010000066.1 GCA905373265_02595 gene open 6749-7612
5199 CAJPRX010000066.1 GCA905373265_02596 gene open 7977-9941
5200 CAJPRX010000067.1 GCA905373265_02597 CDS open 251-1459 _na     402_aa DUF4876 domain-containing protein
5201 CAJPRX010000067.1 GCA905373265_02598 CDS open 1723-3225 _na     500_aa DUF6850 domain-containing protein
5202 CAJPRX010000067.1 GCA905373265_02599 CDS open 3250-4320 _na     356_aa dinB DNA polymerase IV
5203 CAJPRX010000067.1 GCA905373265_02600 CDS open 4350-5444 _na     364_aa dprA DNA-processing protein DprA
5204 CAJPRX010000067.1 GCA905373265_02601 CDS open 5566-6228 _na     220_aa TIGR02453 family protein
5205 CAJPRX010000067.1 GCA905373265_02602 CDS open 6231-6599 _na     122_aa DUF2809 domain-containing protein
5206 CAJPRX010000067.1 GCA905373265_02603 CDS open 6688-7452 _na     254_aa Lipocalin-like domain-containing protein
5207 CAJPRX010000067.1 GCA905373265_02604 CDS open 7476-8264 _na     262_aa tatD Hydrolase%2C TatD family
5208 CAJPRX010000067.1 GCA905373265_02605 CDS open 8371-9438 _na     355_aa 3-oxoacyl-[acyl-carrier-protein] synthase 2
5209 CAJPRX010000067.1 GCA905373265_02597 gene open 251-1459
5210 CAJPRX010000067.1 GCA905373265_02598 gene open 1723-3225
5211 CAJPRX010000067.1 GCA905373265_02599 gene open 3250-4320 dinB
5212 CAJPRX010000067.1 GCA905373265_02600 gene open 4350-5444 dprA
5213 CAJPRX010000067.1 GCA905373265_02601 gene open 5566-6228
5214 CAJPRX010000067.1 GCA905373265_02602 gene open 6231-6599
5215 CAJPRX010000067.1 GCA905373265_02603 gene open 6688-7452
5216 CAJPRX010000067.1 GCA905373265_02604 gene open 7476-8264 tatD
5217 CAJPRX010000067.1 GCA905373265_02605 gene open 8371-9438
5218 CAJPRX010000068.1 GCA905373265_02606 CDS open 123-779 _na     218_aa putative peptidase Lmo0363
5219 CAJPRX010000068.1 GCA905373265_02607 CDS open 816-1454 _na     212_aa S51 family peptidase
5220 CAJPRX010000068.1 GCA905373265_02608 CDS open 1464-2381 _na     305_aa blaCSP-1 extended-spectrum class A beta-lactamase CSP-1
5221 CAJPRX010000068.1 GCA905373265_02609 CDS open 2388-2723 _na     111_aa hopJ HopJ type III effector protein
5222 CAJPRX010000068.1 GCA905373265_02610 CDS open 2751-3281 _na     176_aa hypothetical protein
5223 CAJPRX010000068.1 GCA905373265_02611 CDS open 3358-4179 _na     273_aa DNA alkylation repair protein
5224 CAJPRX010000068.1 GCA905373265_02612 CDS open 4204-4434 _na     76_aa Colicin-E8 immunity domain protein
5225 CAJPRX010000068.1 GCA905373265_02613 CDS open 4444-5148 _na     234_aa GNAT family N-acetyltransferase
5226 CAJPRX010000068.1 GCA905373265_02614 CDS open 5225-5869 _na     214_aa DUF4304 domain-containing protein
5227 CAJPRX010000068.1 GCA905373265_02615 CDS open 6149-6463 _na     104_aa yafQ type II toxin-antitoxin system YafQ family toxin
5228 CAJPRX010000068.1 GCA905373265_02616 CDS open 6456-6704 _na     82_aa antitoxin
5229 CAJPRX010000068.1 GCA905373265_02617 CDS open 6823-7653 _na     276_aa menB 1%2C4-dihydroxy-2-naphthoyl-CoA synthase
5230 CAJPRX010000068.1 GCA905373265_02618 CDS open 7675-8094 _na     139_aa Phosphoheptose isomerase
5231 CAJPRX010000068.1 GCA905373265_02619 CDS open 8179-8952 _na     257_aa (Fe-S)-binding protein
5232 CAJPRX010000068.1 GCA905373265_02606 gene open 123-779
5233 CAJPRX010000068.1 GCA905373265_02607 gene open 816-1454
5234 CAJPRX010000068.1 GCA905373265_02608 gene open 1464-2381 blaCSP-1
5235 CAJPRX010000068.1 GCA905373265_02609 gene open 2388-2723 hopJ
5236 CAJPRX010000068.1 GCA905373265_02610 gene open 2751-3281
5237 CAJPRX010000068.1 GCA905373265_02611 gene open 3358-4179
5238 CAJPRX010000068.1 GCA905373265_02612 gene open 4204-4434
5239 CAJPRX010000068.1 GCA905373265_02613 gene open 4444-5148
5240 CAJPRX010000068.1 GCA905373265_02614 gene open 5225-5869
5241 CAJPRX010000068.1 GCA905373265_02615 gene open 6149-6463 yafQ
5242 CAJPRX010000068.1 GCA905373265_02616 gene open 6456-6704
5243 CAJPRX010000068.1 GCA905373265_02617 gene open 6823-7653 menB
5244 CAJPRX010000068.1 GCA905373265_02618 gene open 7675-8094
5245 CAJPRX010000068.1 GCA905373265_02619 gene open 8179-8952
5246 CAJPRX010000069.1 GCA905373265_02620 CDS open 2394-2603 _na     69_aa hypothetical protein
5247 CAJPRX010000069.1 GCA905373265_02621 CDS open 4050-4232 _na     60_aa hypothetical protein
5248 CAJPRX010000069.1 GCA905373265_02622 CDS open 4518-5174 _na     218_aa hypothetical protein
5249 CAJPRX010000069.1 GCA905373265_02623 CDS open 5325-8444 _na     1039_aa Gliding motility-associated C-terminal domain-containing protein
5250 CAJPRX010000069.1 GCA905373265_02624 CDS open 8581-8877 _na     98_aa gliding motility-associated C-terminal domain-containing protein
5251 CAJPRX010000069.1 GCA905373265_02620 gene open 2394-2603
5252 CAJPRX010000069.1 GCA905373265_02621 gene open 4050-4232
5253 CAJPRX010000069.1 GCA905373265_02622 gene open 4518-5174
5254 CAJPRX010000069.1 GCA905373265_02623 gene open 5325-8444
5255 CAJPRX010000069.1 GCA905373265_02624 gene open 8581-8877
5256 CAJPRX010000070.1 GCA905373265_02625 CDS open 87-389 _na     100_aa hypothetical protein
5257 CAJPRX010000070.1 GCA905373265_02626 CDS open 427-831 _na     134_aa Endopeptidase IV
5258 CAJPRX010000070.1 GCA905373265_02627 CDS open 1001-1492 _na     163_aa Sel1 repeat family protein
5259 CAJPRX010000070.1 GCA905373265_02628 CDS open 1973-2365 _na     130_aa hypothetical protein
5260 CAJPRX010000070.1 GCA905373265_02629 CDS open 2405-2701 _na     98_aa hypothetical protein
5261 CAJPRX010000070.1 GCA905373265_02630 CDS open 2792-2959 _na     55_aa hypothetical protein
5262 CAJPRX010000070.1 GCA905373265_02631 CDS open 4087-4617 _na     176_aa hypothetical protein
5263 CAJPRX010000070.1 GCA905373265_02632 CDS open 4905-5321 _na     138_aa hypothetical protein
5264 CAJPRX010000070.1 GCA905373265_02633 CDS open 5756-6055 _na     99_aa hypothetical protein
5265 CAJPRX010000070.1 GCA905373265_02634 CDS open 6116-6382 _na     88_aa hypothetical protein
5266 CAJPRX010000070.1 GCA905373265_02635 CDS open 6437-6742 _na     101_aa hypothetical protein
5267 CAJPRX010000070.1 GCA905373265_02636 CDS open 6865-7500 _na     211_aa Immunity protein 43 domain-containing protein
5268 CAJPRX010000070.1 GCA905373265_02637 CDS open 7510-8028 _na     172_aa HNH nuclease domain-containing protein
5269 CAJPRX010000070.1 GCA905373265_02638 CDS open 8124-8546 _na     140_aa hypothetical protein
5270 CAJPRX010000070.1 GCA905373265_02625 gene open 87-389
5271 CAJPRX010000070.1 GCA905373265_02626 gene open 427-831
5272 CAJPRX010000070.1 GCA905373265_02627 gene open 1001-1492
5273 CAJPRX010000070.1 GCA905373265_02628 gene open 1973-2365
5274 CAJPRX010000070.1 GCA905373265_02629 gene open 2405-2701
5275 CAJPRX010000070.1 GCA905373265_02630 gene open 2792-2959
5276 CAJPRX010000070.1 GCA905373265_02631 gene open 4087-4617
5277 CAJPRX010000070.1 GCA905373265_02632 gene open 4905-5321
5278 CAJPRX010000070.1 GCA905373265_02633 gene open 5756-6055
5279 CAJPRX010000070.1 GCA905373265_02634 gene open 6116-6382
5280 CAJPRX010000070.1 GCA905373265_02635 gene open 6437-6742
5281 CAJPRX010000070.1 GCA905373265_02636 gene open 6865-7500
5282 CAJPRX010000070.1 GCA905373265_02637 gene open 7510-8028
5283 CAJPRX010000070.1 GCA905373265_02638 gene open 8124-8546
5284 CAJPRX010000071.1 GCA905373265_02639 CDS open 434-1594 _na     386_aa 5-(carboxyamino)imidazole ribonucleotide synthase
5285 CAJPRX010000071.1 GCA905373265_02640 CDS open 1604-2650 _na     348_aa Endonuclease/exonuclease/phosphatase domain-containing protein
5286 CAJPRX010000071.1 GCA905373265_02641 CDS open 2699-5371 _na     890_aa peptidoglycan glycosyltransferase
5287 CAJPRX010000071.1 GCA905373265_02642 CDS open 5554-5961 _na     135_aa DUF2845 domain-containing protein
5288 CAJPRX010000071.1 GCA905373265_02643 CDS open 5958-6491 _na     177_aa dnaJ Molecular chaperone DnaJ
5289 CAJPRX010000071.1 GCA905373265_02644 CDS open 6502-7467 _na     321_aa luxE Acyl-protein synthetase LuxE domain-containing protein
5290 CAJPRX010000071.1 GCA905373265_02645 CDS open 7741-8520 _na     259_aa lipocalin family protein
5291 CAJPRX010000071.1 GCA905373265_02639 gene open 434-1594
5292 CAJPRX010000071.1 GCA905373265_02640 gene open 1604-2650
5293 CAJPRX010000071.1 GCA905373265_02641 gene open 2699-5371
5294 CAJPRX010000071.1 GCA905373265_02642 gene open 5554-5961
5295 CAJPRX010000071.1 GCA905373265_02643 gene open 5958-6491 dnaJ
5296 CAJPRX010000071.1 GCA905373265_02644 gene open 6502-7467 luxE
5297 CAJPRX010000071.1 GCA905373265_02645 gene open 7741-8520
5298 CAJPRX010000072.1 GCA905373265_02646 CDS open 86-412 _na     108_aa hypothetical protein
5299 CAJPRX010000072.1 GCA905373265_02647 CDS open 2912-3193 _na     93_aa hypothetical protein
5300 CAJPRX010000072.1 GCA905373265_02648 CDS open 3253-3510 _na     85_aa XRE family transcriptional regulator
5301 CAJPRX010000072.1 GCA905373265_02649 CDS open 3722-4066 _na     114_aa helix-turn-helix domain-containing protein
5302 CAJPRX010000072.1 GCA905373265_02650 CDS open 4088-4528 _na     146_aa hypothetical protein
5303 CAJPRX010000072.1 GCA905373265_02651 CDS open 4945-5517 _na     190_aa DUF3109 domain-containing protein
5304 CAJPRX010000072.1 GCA905373265_02652 CDS open 5629-6153 _na     174_aa DUF2892 domain-containing protein
5305 CAJPRX010000072.1 GCA905373265_02653 CDS open 6215-6967 _na     250_aa truA tRNA pseudouridine(38-40) synthase TruA
5306 CAJPRX010000072.1 GCA905373265_02654 CDS open 7062-8318 _na     418_aa Tetratricopeptide repeat protein
5307 CAJPRX010000072.1 GCA905373265_02646 gene open 86-412
5308 CAJPRX010000072.1 GCA905373265_02647 gene open 2912-3193
5309 CAJPRX010000072.1 GCA905373265_02648 gene open 3253-3510
5310 CAJPRX010000072.1 GCA905373265_02649 gene open 3722-4066
5311 CAJPRX010000072.1 GCA905373265_02650 gene open 4088-4528
5312 CAJPRX010000072.1 GCA905373265_02651 gene open 4945-5517
5313 CAJPRX010000072.1 GCA905373265_02652 gene open 5629-6153
5314 CAJPRX010000072.1 GCA905373265_02653 gene open 6215-6967 truA
5315 CAJPRX010000072.1 GCA905373265_02654 gene open 7062-8318
5316 CAJPRX010000073.1 GCA905373265_02655 CDS open 255-728 _na     157_aa hypothetical protein
5317 CAJPRX010000073.1 GCA905373265_02656 CDS open 742-5358 _na     1538_aa DUF6531 domain-containing protein
5318 CAJPRX010000073.1 GCA905373265_02657 CDS open 5501-6340 _na     279_aa hypothetical protein
5319 CAJPRX010000073.1 GCA905373265_02655 gene open 255-728
5320 CAJPRX010000073.1 GCA905373265_02656 gene open 742-5358
5321 CAJPRX010000073.1 GCA905373265_02657 gene open 5501-6340
5322 CAJPRX010000074.1 GCA905373265_02658 CDS open 255-749 _na     164_aa hypothetical protein
5323 CAJPRX010000074.1 GCA905373265_02659 CDS open 902-1150 _na     82_aa AbrB/MazE/SpoVT family DNA-binding domain-containing protein
5324 CAJPRX010000074.1 GCA905373265_02660 CDS open 1186-1509 _na     107_aa type II toxin-antitoxin system PemK/MazF family toxin
5325 CAJPRX010000074.1 GCA905373265_02661 CDS open 1678-1965 _na     95_aa hypothetical protein
5326 CAJPRX010000074.1 GCA905373265_02662 CDS open 1939-2223 _na     94_aa yafQ type II toxin-antitoxin system YafQ family toxin
5327 CAJPRX010000074.1 GCA905373265_02663 CDS open 2210-2470 _na     86_aa toxin-antitoxin system protein
5328 CAJPRX010000074.1 GCA905373265_02664 CDS open 2740-3867 _na     375_aa relaxase/mobilization nuclease domain-containing protein
5329 CAJPRX010000074.1 GCA905373265_02665 CDS open 3882-5507 _na     541_aa hypothetical protein
5330 CAJPRX010000074.1 GCA905373265_02658 gene open 255-749
5331 CAJPRX010000074.1 GCA905373265_02659 gene open 902-1150
5332 CAJPRX010000074.1 GCA905373265_02660 gene open 1186-1509
5333 CAJPRX010000074.1 GCA905373265_02661 gene open 1678-1965
5334 CAJPRX010000074.1 GCA905373265_02662 gene open 1939-2223 yafQ
5335 CAJPRX010000074.1 GCA905373265_02663 gene open 2210-2470
5336 CAJPRX010000074.1 GCA905373265_02664 gene open 2740-3867
5337 CAJPRX010000074.1 GCA905373265_02665 gene open 3882-5507
5338 CAJPRX010000075.1 GCA905373265_02666 CDS open 296-877 _na     193_aa TIGR02185 family protein
5339 CAJPRX010000075.1 GCA905373265_02667 CDS open 905-2629 _na     574_aa Putative ABC transporter ATP-binding protein
5340 CAJPRX010000075.1 GCA905373265_02668 CDS open 2633-4390 _na     585_aa Putative multidrug export ATP-binding/permease protein
5341 CAJPRX010000075.1 GCA905373265_02669 CDS open 4618-5580 _na     320_aa araC AraC family transcriptional regulator
5342 CAJPRX010000075.1 GCA905373265_02666 gene open 296-877
5343 CAJPRX010000075.1 GCA905373265_02667 gene open 905-2629
5344 CAJPRX010000075.1 GCA905373265_02668 gene open 2633-4390
5345 CAJPRX010000075.1 GCA905373265_02669 gene open 4618-5580 araC
5346 CAJPRX010000076.1 GCA905373265_02671 gene open 818-1048 sRNA_1300
5347 CAJPRX010000076.1 GCA905373265_02671 ncRNA open 818-1048 Enterococcus sRNA 1300
5348 CAJPRX010000076.1 GCA905373265_02670 CDS open 553-723 _na     56_aa DNA recombinase
5349 CAJPRX010000076.1 GCA905373265_02672 CDS open 1109-2326 _na     405_aa mef(A) macrolide efflux MFS transporter Mef(A)
5350 CAJPRX010000076.1 GCA905373265_02673 CDS open 2446-3909 _na     487_aa msr(D) ABC-F type ribosomal protection protein Msr(D)
5351 CAJPRX010000076.1 GCA905373265_02674 CDS open 4027-4326 _na     99_aa ubiC UbiC transcription regulator-associated domain-containing protein
5352 CAJPRX010000076.1 GCA905373265_02675 CDS open 4313-4681 _na     122_aa YolD-like protein
5353 CAJPRX010000076.1 GCA905373265_02676 CDS open 4694-5029 _na     111_aa DNA polymerase Y-family little finger domain-containing protein
5354 CAJPRX010000076.1 GCA905373265_02677 CDS open 5026-5271 _na     81_aa DNA polymerase IV
5355 CAJPRX010000076.1 GCA905373265_02678 CDS open 5268-5456 _na     62_aa impB Type VI secretion protein ImpB
5356 CAJPRX010000076.1 GCA905373265_02670 gene open 553-723
5357 CAJPRX010000076.1 GCA905373265_02672 gene open 1109-2326 mef(A)
5358 CAJPRX010000076.1 GCA905373265_02673 gene open 2446-3909 msr(D)
5359 CAJPRX010000076.1 GCA905373265_02674 gene open 4027-4326 ubiC
5360 CAJPRX010000076.1 GCA905373265_02675 gene open 4313-4681
5361 CAJPRX010000076.1 GCA905373265_02676 gene open 4694-5029
5362 CAJPRX010000076.1 GCA905373265_02677 gene open 5026-5271
5363 CAJPRX010000076.1 GCA905373265_02678 gene open 5268-5456 impB
5364 CAJPRX010000077.1 GCA905373265_02679 CDS open 86-496 _na     136_aa DUF2846 domain-containing protein
5365 CAJPRX010000077.1 GCA905373265_02680 CDS open 594-1799 _na     401_aa Bcr/CflA family multidrug efflux MFS transporter
5366 CAJPRX010000077.1 GCA905373265_02681 CDS open 1799-4285 _na     828_aa Glutamyl- and glutaminyl-tRNA synthetases
5367 CAJPRX010000077.1 GCA905373265_02682 CDS open 4299-5021 _na     240_aa hypothetical protein
5368 CAJPRX010000077.1 GCA905373265_02679 gene open 86-496
5369 CAJPRX010000077.1 GCA905373265_02680 gene open 594-1799
5370 CAJPRX010000077.1 GCA905373265_02681 gene open 1799-4285
5371 CAJPRX010000077.1 GCA905373265_02682 gene open 4299-5021
5372 CAJPRX010000078.1 GCA905373265_02683 CDS open 39-197 _na     52_aa hypothetical protein
5373 CAJPRX010000078.1 GCA905373265_02684 CDS open 206-628 _na     140_aa hypothetical protein
5374 CAJPRX010000078.1 GCA905373265_02685 CDS open 579-758 _na     59_aa hypothetical protein
5375 CAJPRX010000078.1 GCA905373265_02686 CDS open 748-1026 _na     92_aa hypothetical protein
5376 CAJPRX010000078.1 GCA905373265_02687 CDS open 1092-1232 _na     46_aa hypothetical protein
5377 CAJPRX010000078.1 GCA905373265_02688 CDS open 1281-1538 _na     85_aa hypothetical protein
5378 CAJPRX010000078.1 GCA905373265_02689 CDS open 1652-2362 _na     236_aa replication initiation factor domain-containing protein
5379 CAJPRX010000078.1 GCA905373265_02690 CDS open 2478-3170 _na     230_aa zonular occludens toxin domain-containing protein
5380 CAJPRX010000078.1 GCA905373265_02691 CDS open 3300-3524 _na     74_aa hypothetical protein
5381 CAJPRX010000078.1 GCA905373265_02692 CDS open 3526-4893 _na     455_aa hypothetical protein
5382 CAJPRX010000078.1 GCA905373265_02683 gene open 39-197
5383 CAJPRX010000078.1 GCA905373265_02684 gene open 206-628
5384 CAJPRX010000078.1 GCA905373265_02685 gene open 579-758
5385 CAJPRX010000078.1 GCA905373265_02686 gene open 748-1026
5386 CAJPRX010000078.1 GCA905373265_02687 gene open 1092-1232
5387 CAJPRX010000078.1 GCA905373265_02688 gene open 1281-1538
5388 CAJPRX010000078.1 GCA905373265_02689 gene open 1652-2362
5389 CAJPRX010000078.1 GCA905373265_02690 gene open 2478-3170
5390 CAJPRX010000078.1 GCA905373265_02691 gene open 3300-3524
5391 CAJPRX010000078.1 GCA905373265_02692 gene open 3526-4893
5392 CAJPRX010000079.1 regulatory_region open 2371-2442 SAM-II riboswitch aptamer (SAM-II long loop)
5393 CAJPRX010000079.1 GCA905373265_02693 CDS open 356-2152 _na     598_aa lepA translation elongation factor 4
5394 CAJPRX010000079.1 GCA905373265_02694 CDS open 2480-3727 _na     415_aa metK methionine adenosyltransferase
5395 CAJPRX010000079.1 GCA905373265_02695 CDS open 3860-4438 _na     192_aa Flavoprotein oxygenase
5396 CAJPRX010000079.1 GCA905373265_02693 gene open 356-2152 lepA
5397 CAJPRX010000079.1 GCA905373265_02694 gene open 2480-3727 metK
5398 CAJPRX010000079.1 GCA905373265_02695 gene open 3860-4438
5399 CAJPRX010000080.1 GCA905373265_02696 CDS open 243-1295 _na     350_aa Peptidase M14 carboxypeptidase A domain-containing protein
5400 CAJPRX010000080.1 GCA905373265_02697 CDS open 1398-1880 _na     160_aa asnC Regulatory protein AsnC
5401 CAJPRX010000080.1 GCA905373265_02698 CDS open 1956-2651 _na     231_aa Glycine/sarcosine/dimethylglycine N-methyltransferase
5402 CAJPRX010000080.1 GCA905373265_02699 CDS open 2662-2895 _na     77_aa hypothetical protein
5403 CAJPRX010000080.1 GCA905373265_02700 CDS open 2791-3009 _na     72_aa hypothetical protein
5404 CAJPRX010000080.1 GCA905373265_02701 CDS open 3029-4648 _na     539_aa uup ABC transporter domain-containing protein
5405 CAJPRX010000080.1 GCA905373265_02696 gene open 243-1295
5406 CAJPRX010000080.1 GCA905373265_02697 gene open 1398-1880 asnC
5407 CAJPRX010000080.1 GCA905373265_02698 gene open 1956-2651
5408 CAJPRX010000080.1 GCA905373265_02699 gene open 2662-2895
5409 CAJPRX010000080.1 GCA905373265_02700 gene open 2791-3009
5410 CAJPRX010000080.1 GCA905373265_02701 gene open 3029-4648 uup
5411 CAJPRX010000081.1 GCA905373265_02702 CDS open 236-1816 _na     526_aa istA IS21 family transposase
5412 CAJPRX010000081.1 GCA905373265_02703 CDS open 1823-2611 _na     262_aa istB IS21-like element helper ATPase IstB
5413 CAJPRX010000081.1 GCA905373265_02704 CDS open 2950-4341 _na     463_aa C10 family peptidase
5414 CAJPRX010000081.1 GCA905373265_02702 gene open 236-1816 istA
5415 CAJPRX010000081.1 GCA905373265_02703 gene open 1823-2611 istB
5416 CAJPRX010000081.1 GCA905373265_02704 gene open 2950-4341
5417 CAJPRX010000082.1 GCA905373265_02705 CDS open 1084-2037 _na     317_aa Replication protein
5418 CAJPRX010000082.1 GCA905373265_02706 CDS open 2902-4047 _na     381_aa Low temperature requirement protein A
5419 CAJPRX010000082.1 GCA905373265_02705 gene open 1084-2037
5420 CAJPRX010000082.1 GCA905373265_02706 gene open 2902-4047
5421 CAJPRX010000083.1 GCA905373265_02707 CDS open 124-603 _na     159_aa HTH cro/C1-type domain-containing protein
5422 CAJPRX010000083.1 GCA905373265_02709 CDS open 833-1942 _na     369_aa alr alanine racemase
5423 CAJPRX010000083.1 GCA905373265_02710 CDS open 1939-2706 _na     255_aa Enoyl-CoA hydratase/isomerase family protein
5424 CAJPRX010000083.1 GCA905373265_02711 CDS open 2991-4226 _na     411_aa xerD Tyr recombinase domain-containing protein
5425 CAJPRX010000083.1 GCA905373265_02707 gene open 124-603
5426 CAJPRX010000083.1 GCA905373265_02709 gene open 833-1942 alr
5427 CAJPRX010000083.1 GCA905373265_02710 gene open 1939-2706
5428 CAJPRX010000083.1 GCA905373265_02711 gene open 2991-4226 xerD
5429 CAJPRX010000083.1 GCA905373265_02708 gene open 691-763 trnfM
5430 CAJPRX010000083.1 GCA905373265_02708 tRNA open 691-763 trnfM tRNA-fMet(cat)
5431 CAJPRX010000084.1 GCA905373265_02712 CDS open 11-1027 _na     338_aa repB Initiator replication protein RepB
5432 CAJPRX010000084.1 GCA905373265_02713 CDS open 1040-1234 _na     64_aa hypothetical protein
5433 CAJPRX010000084.1 GCA905373265_02714 CDS open 1642-1923 _na     93_aa Addiction module toxin%2C RelE/StbE family
5434 CAJPRX010000084.1 GCA905373265_02715 CDS open 1928-2173 _na     81_aa Arc-like DNA binding domain-containing protein
5435 CAJPRX010000084.1 GCA905373265_02716 CDS open 2249-3559 _na     436_aa Mobilization protein
5436 CAJPRX010000084.1 GCA905373265_02712 gene open 11-1027 repB
5437 CAJPRX010000084.1 GCA905373265_02713 gene open 1040-1234
5438 CAJPRX010000084.1 GCA905373265_02714 gene open 1642-1923
5439 CAJPRX010000084.1 GCA905373265_02715 gene open 1928-2173
5440 CAJPRX010000084.1 GCA905373265_02716 gene open 2249-3559
5441 CAJPRX010000085.1 GCA905373265_02717 CDS open 215-370 _na     51_aa hypothetical protein
5442 CAJPRX010000085.1 GCA905373265_02718 CDS open 877-2082 _na     401_aa DNA cytosine methyltransferase
5443 CAJPRX010000085.1 GCA905373265_02719 CDS open 2208-3194 _na     328_aa hypothetical protein
5444 CAJPRX010000085.1 GCA905373265_02717 gene open 215-370
5445 CAJPRX010000085.1 GCA905373265_02718 gene open 877-2082
5446 CAJPRX010000085.1 GCA905373265_02719 gene open 2208-3194
5447 CAJPRX010000086.1 GCA905373265_02720 CDS open 11-646 _na     211_aa Lipoprotein
5448 CAJPRX010000086.1 GCA905373265_02721 CDS open 612-1157 _na     181_aa Lipoprotein
5449 CAJPRX010000086.1 GCA905373265_02722 CDS open 1167-1946 _na     259_aa hypothetical protein
5450 CAJPRX010000086.1 GCA905373265_02723 CDS open 2038-2577 _na     179_aa hypothetical protein
5451 CAJPRX010000086.1 GCA905373265_02724 CDS open 2593-2790 _na     65_aa hypothetical protein
5452 CAJPRX010000086.1 GCA905373265_02725 CDS open 3357-3638 _na     93_aa hypothetical protein
5453 CAJPRX010000086.1 GCA905373265_02720 gene open 11-646
5454 CAJPRX010000086.1 GCA905373265_02721 gene open 612-1157
5455 CAJPRX010000086.1 GCA905373265_02722 gene open 1167-1946
5456 CAJPRX010000086.1 GCA905373265_02723 gene open 2038-2577
5457 CAJPRX010000086.1 GCA905373265_02724 gene open 2593-2790
5458 CAJPRX010000086.1 GCA905373265_02725 gene open 3357-3638
5459 CAJPRX010000087.1 GCA905373265_02726 CDS open 76-363 _na     95_aa hypothetical protein
5460 CAJPRX010000087.1 GCA905373265_02727 CDS open 400-1734 _na     444_aa hypothetical protein
5461 CAJPRX010000087.1 GCA905373265_02728 CDS open 1738-2202 _na     154_aa Lipoprotein
5462 CAJPRX010000087.1 GCA905373265_02729 CDS open 2258-3514 _na     418_aa AAA+ ATPase domain-containing protein
5463 CAJPRX010000087.1 GCA905373265_02726 gene open 76-363
5464 CAJPRX010000087.1 GCA905373265_02727 gene open 400-1734
5465 CAJPRX010000087.1 GCA905373265_02728 gene open 1738-2202
5466 CAJPRX010000087.1 GCA905373265_02729 gene open 2258-3514
5467 CAJPRX010000088.1 GCA905373265_02730 CDS open 932-1186 _na     84_aa hypothetical protein
5468 CAJPRX010000088.1 GCA905373265_02730 gene open 932-1186
5469 CAJPRX010000089.1 GCA905373265_02731 CDS open 114-458 _na     114_aa SMI1/KNR4 family protein
5470 CAJPRX010000089.1 GCA905373265_02732 CDS open 467-682 _na     71_aa hypothetical protein
5471 CAJPRX010000089.1 GCA905373265_02733 CDS open 868-1218 _na     116_aa DUF6794 domain-containing protein
5472 CAJPRX010000089.1 GCA905373265_02734 CDS open 1226-1750 _na     174_aa O-acetyl-ADP-ribose deacetylase
5473 CAJPRX010000089.1 GCA905373265_02735 CDS open 1781-2401 _na     206_aa WG repeat-containing protein
5474 CAJPRX010000089.1 GCA905373265_02731 gene open 114-458
5475 CAJPRX010000089.1 GCA905373265_02732 gene open 467-682
5476 CAJPRX010000089.1 GCA905373265_02733 gene open 868-1218
5477 CAJPRX010000089.1 GCA905373265_02734 gene open 1226-1750
5478 CAJPRX010000089.1 GCA905373265_02735 gene open 1781-2401