BAKTAGenome Explorer: Dialister invisus (GCA_905373435.1)
Select a Genome:
|
BAKTA Annotations for GCA_905373435.1
|
Search & Sort all 3782 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 3501 | CAJPSS010000050.1 | GCA905373435_01741 | CDS | open | 2224-2682 | _na 152_aa | mscL | large conductance mechanosensitive channel protein MscL |
| 3502 | CAJPSS010000050.1 | GCA905373435_01743 | CDS | open | 2988-3686 | _na 232_aa | tonB | TonB C-terminal domain-containing protein |
| 3503 | CAJPSS010000050.1 | GCA905373435_01744 | CDS | open | 3817-4023 | _na 68_aa | hypothetical protein | |
| 3504 | CAJPSS010000050.1 | GCA905373435_01745 | CDS | open | 4024-5292 | _na 422_aa | ADP-ribosylglycohydrolase | |
| 3505 | CAJPSS010000050.1 | GCA905373435_01746 | CDS | open | 5468-6730 | _na 420_aa | SGNH hydrolase-type esterase domain-containing protein | |
| 3506 | CAJPSS010000050.1 | GCA905373435_01739 | gene | open | 474-1172 | |||
| 3507 | CAJPSS010000050.1 | GCA905373435_01740 | gene | open | 1449-1721 | |||
| 3508 | CAJPSS010000050.1 | GCA905373435_01741 | gene | open | 2224-2682 | mscL | ||
| 3509 | CAJPSS010000050.1 | GCA905373435_01743 | gene | open | 2988-3686 | tonB | ||
| 3510 | CAJPSS010000050.1 | GCA905373435_01744 | gene | open | 3817-4023 | |||
| 3511 | CAJPSS010000050.1 | GCA905373435_01745 | gene | open | 4024-5292 | |||
| 3512 | CAJPSS010000050.1 | GCA905373435_01746 | gene | open | 5468-6730 | |||
| 3513 | CAJPSS010000050.1 | GCA905373435_01742 | gene | open | 2779-2862 | trnL | ||
| 3514 | CAJPSS010000050.1 | GCA905373435_01742 | tRNA | open | 2779-2862 | trnL | tRNA-Leu(tag) | |
| 3515 | CAJPSS010000051.1 | regulatory_region | open | 2859-3058 | T-box leader | |||
| 3516 | CAJPSS010000051.1 | GCA905373435_01747 | CDS | open | 269-1774 | _na 501_aa | IMP dehydrogenase | |
| 3517 | CAJPSS010000051.1 | GCA905373435_01748 | CDS | open | 1811-2341 | _na 176_aa | hypothetical protein | |
| 3518 | CAJPSS010000051.1 | GCA905373435_01749 | CDS | open | 3275-4156 | _na 293_aa | livH | Branched-chain amino acid ABC transporter permease |
| 3519 | CAJPSS010000051.1 | GCA905373435_01750 | CDS | open | 4156-5118 | _na 320_aa | Branched-chain amino acid ABC transporter%2C permease protein | |
| 3520 | CAJPSS010000051.1 | GCA905373435_01751 | CDS | open | 5118-5882 | _na 254_aa | ABC transporter%2C ATP-binding protein | |
| 3521 | CAJPSS010000051.1 | GCA905373435_01752 | CDS | open | 5882-6598 | _na 238_aa | ABC transporter%2C ATP-binding protein | |
| 3522 | CAJPSS010000051.1 | GCA905373435_01747 | gene | open | 269-1774 | |||
| 3523 | CAJPSS010000051.1 | GCA905373435_01748 | gene | open | 1811-2341 | |||
| 3524 | CAJPSS010000051.1 | GCA905373435_01749 | gene | open | 3275-4156 | livH | ||
| 3525 | CAJPSS010000051.1 | GCA905373435_01750 | gene | open | 4156-5118 | |||
| 3526 | CAJPSS010000051.1 | GCA905373435_01751 | gene | open | 5118-5882 | |||
| 3527 | CAJPSS010000051.1 | GCA905373435_01752 | gene | open | 5882-6598 | |||
| 3528 | CAJPSS010000052.1 | GCA905373435_01753 | CDS | open | 48-278 | _na 76_aa | hypothetical protein | |
| 3529 | CAJPSS010000052.1 | GCA905373435_01754 | CDS | open | 956-1810 | _na 284_aa | Prephenate dehydrogenase | |
| 3530 | CAJPSS010000052.1 | GCA905373435_01755 | CDS | open | 1985-3058 | _na 357_aa | 3-dehydroquinate synthase | |
| 3531 | CAJPSS010000052.1 | GCA905373435_01757 | CDS | open | 4232-5134 | _na 300_aa | Phosphatidylglycerol lysyltransferase C-terminal domain-containing protein | |
| 3532 | CAJPSS010000052.1 | GCA905373435_01758 | CDS | open | 5142-6395 | _na 417_aa | GNAT family N-acetyltransferase | |
| 3533 | CAJPSS010000052.1 | GCA905373435_01753 | gene | open | 48-278 | |||
| 3534 | CAJPSS010000052.1 | GCA905373435_01754 | gene | open | 956-1810 | |||
| 3535 | CAJPSS010000052.1 | GCA905373435_01755 | gene | open | 1985-3058 | |||
| 3536 | CAJPSS010000052.1 | GCA905373435_01757 | gene | open | 4232-5134 | |||
| 3537 | CAJPSS010000052.1 | GCA905373435_01758 | gene | open | 5142-6395 | |||
| 3538 | CAJPSS010000052.1 | GCA905373435_01756 | gene | open | 3234-3310 | trnR | ||
| 3539 | CAJPSS010000052.1 | GCA905373435_01756 | tRNA | open | 3234-3310 | trnR | tRNA-Arg(cct) | |
| 3540 | CAJPSS010000053.1 | GCA905373435_01759 | CDS | open | 150-2321 | _na 723_aa | TonB-dependent receptor | |
| 3541 | CAJPSS010000053.1 | GCA905373435_01761 | CDS | open | 2980-3333 | _na 117_aa | CGGC domain-containing protein | |
| 3542 | CAJPSS010000053.1 | GCA905373435_01762 | CDS | open | 3436-3840 | _na 134_aa | hypothetical protein | |
| 3543 | CAJPSS010000053.1 | GCA905373435_01763 | CDS | open | 3862-6210 | _na 782_aa | TonB-dependent receptor | |
| 3544 | CAJPSS010000053.1 | GCA905373435_01759 | gene | open | 150-2321 | |||
| 3545 | CAJPSS010000053.1 | GCA905373435_01761 | gene | open | 2980-3333 | |||
| 3546 | CAJPSS010000053.1 | GCA905373435_01762 | gene | open | 3436-3840 | |||
| 3547 | CAJPSS010000053.1 | GCA905373435_01763 | gene | open | 3862-6210 | |||
| 3548 | CAJPSS010000053.1 | GCA905373435_01760 | gene | open | 2654-2729 | trnA | ||
| 3549 | CAJPSS010000053.1 | GCA905373435_01760 | tRNA | open | 2654-2729 | trnA | tRNA-Ala(ggc) | |
| 3550 | CAJPSS010000054.1 | GCA905373435_01764 | CDS | open | 152-523 | _na 123_aa | hypothetical protein | |
| 3551 | CAJPSS010000054.1 | GCA905373435_01765 | CDS | open | 993-1142 | _na 49_aa | hypothetical protein | |
| 3552 | CAJPSS010000054.1 | GCA905373435_01766 | CDS | open | 1191-1619 | _na 142_aa | hypothetical protein | |
| 3553 | CAJPSS010000054.1 | GCA905373435_01767 | CDS | open | 1634-1912 | _na 92_aa | hypothetical protein | |
| 3554 | CAJPSS010000054.1 | GCA905373435_01768 | CDS | open | 1924-2448 | _na 174_aa | hypothetical protein | |
| 3555 | CAJPSS010000054.1 | GCA905373435_01769 | CDS | open | 2742-3002 | _na 86_aa | hypothetical protein | |
| 3556 | CAJPSS010000054.1 | GCA905373435_01770 | CDS | open | 3123-3461 | _na 112_aa | hypothetical protein | |
| 3557 | CAJPSS010000054.1 | GCA905373435_01771 | CDS | open | 3626-3805 | _na 59_aa | hypothetical protein | |
| 3558 | CAJPSS010000054.1 | GCA905373435_01772 | CDS | open | 3842-4027 | _na 61_aa | hypothetical protein | |
| 3559 | CAJPSS010000054.1 | GCA905373435_01773 | CDS | open | 4067-4231 | _na 54_aa | hypothetical protein | |
| 3560 | CAJPSS010000054.1 | GCA905373435_01774 | CDS | open | 4228-4698 | _na 156_aa | hypothetical protein | |
| 3561 | CAJPSS010000054.1 | GCA905373435_01775 | CDS | open | 4811-5287 | _na 158_aa | Lipoprotein | |
| 3562 | CAJPSS010000054.1 | GCA905373435_01776 | CDS | open | 5305-5796 | _na 163_aa | hypothetical protein | |
| 3563 | CAJPSS010000054.1 | GCA905373435_01764 | gene | open | 152-523 | |||
| 3564 | CAJPSS010000054.1 | GCA905373435_01765 | gene | open | 993-1142 | |||
| 3565 | CAJPSS010000054.1 | GCA905373435_01766 | gene | open | 1191-1619 | |||
| 3566 | CAJPSS010000054.1 | GCA905373435_01767 | gene | open | 1634-1912 | |||
| 3567 | CAJPSS010000054.1 | GCA905373435_01768 | gene | open | 1924-2448 | |||
| 3568 | CAJPSS010000054.1 | GCA905373435_01769 | gene | open | 2742-3002 | |||
| 3569 | CAJPSS010000054.1 | GCA905373435_01770 | gene | open | 3123-3461 | |||
| 3570 | CAJPSS010000054.1 | GCA905373435_01771 | gene | open | 3626-3805 | |||
| 3571 | CAJPSS010000054.1 | GCA905373435_01772 | gene | open | 3842-4027 | |||
| 3572 | CAJPSS010000054.1 | GCA905373435_01773 | gene | open | 4067-4231 | |||
| 3573 | CAJPSS010000054.1 | GCA905373435_01774 | gene | open | 4228-4698 | |||
| 3574 | CAJPSS010000054.1 | GCA905373435_01775 | gene | open | 4811-5287 | |||
| 3575 | CAJPSS010000054.1 | GCA905373435_01776 | gene | open | 5305-5796 | |||
| 3576 | CAJPSS010000055.1 | GCA905373435_01777 | CDS | open | 915-2018 | _na 367_aa | potA | Spermidine/putrescine import ATP-binding protein PotA |
| 3577 | CAJPSS010000055.1 | GCA905373435_01778 | CDS | open | 2015-2872 | _na 285_aa | ABC transporter%2C permease protein | |
| 3578 | CAJPSS010000055.1 | GCA905373435_01779 | CDS | open | 2853-3671 | _na 272_aa | ABC transporter%2C permease protein | |
| 3579 | CAJPSS010000055.1 | GCA905373435_01780 | CDS | open | 3739-4323 | _na 194_aa | DJ-1/PfpI family protein | |
| 3580 | CAJPSS010000055.1 | GCA905373435_01781 | CDS | open | 4399-5460 | _na 353_aa | ABC transporter%2C solute-binding protein | |
| 3581 | CAJPSS010000055.1 | GCA905373435_01777 | gene | open | 915-2018 | potA | ||
| 3582 | CAJPSS010000055.1 | GCA905373435_01778 | gene | open | 2015-2872 | |||
| 3583 | CAJPSS010000055.1 | GCA905373435_01779 | gene | open | 2853-3671 | |||
| 3584 | CAJPSS010000055.1 | GCA905373435_01780 | gene | open | 3739-4323 | |||
| 3585 | CAJPSS010000055.1 | GCA905373435_01781 | gene | open | 4399-5460 | |||
| 3586 | CAJPSS010000056.1 | GCA905373435_01782 | CDS | open | 457-1386 | _na 309_aa | Serine aminopeptidase S33 domain-containing protein | |
| 3587 | CAJPSS010000056.1 | GCA905373435_01783 | CDS | open | 1875-2879 | _na 334_aa | Tripartite tricarboxylate transporter family receptor | |
| 3588 | CAJPSS010000056.1 | GCA905373435_01784 | CDS | open | 3034-3492 | _na 152_aa | DUF1468 domain-containing protein | |
| 3589 | CAJPSS010000056.1 | GCA905373435_01785 | CDS | open | 3507-5018 | _na 503_aa | Membrane protein | |
| 3590 | CAJPSS010000056.1 | GCA905373435_01782 | gene | open | 457-1386 | |||
| 3591 | CAJPSS010000056.1 | GCA905373435_01783 | gene | open | 1875-2879 | |||
| 3592 | CAJPSS010000056.1 | GCA905373435_01784 | gene | open | 3034-3492 | |||
| 3593 | CAJPSS010000056.1 | GCA905373435_01785 | gene | open | 3507-5018 | |||
| 3594 | CAJPSS010000057.1 | GCA905373435_01786 | CDS | open | 1094-1921 | _na 275_aa | dapF | diaminopimelate epimerase |
| 3595 | CAJPSS010000057.1 | GCA905373435_01787 | CDS | open | 1946-2836 | _na 296_aa | TIGR00255 family protein | |
| 3596 | CAJPSS010000057.1 | GCA905373435_01788 | CDS | open | 2847-3122 | _na 91_aa | remA | extracellular matrix/biofilm regulator RemA |
| 3597 | CAJPSS010000057.1 | GCA905373435_01789 | CDS | open | 3129-3770 | _na 213_aa | gmk | guanylate kinase |
| 3598 | CAJPSS010000057.1 | GCA905373435_01790 | CDS | open | 3767-3967 | _na 66_aa | rpoZ | DNA-directed RNA polymerase subunit omega |
| 3599 | CAJPSS010000057.1 | GCA905373435_01791 | CDS | open | 4018-5217 | _na 399_aa | coaBC | bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC |
| 3600 | CAJPSS010000057.1 | GCA905373435_01786 | gene | open | 1094-1921 | dapF | ||
| 3601 | CAJPSS010000057.1 | GCA905373435_01787 | gene | open | 1946-2836 | |||
| 3602 | CAJPSS010000057.1 | GCA905373435_01788 | gene | open | 2847-3122 | remA | ||
| 3603 | CAJPSS010000057.1 | GCA905373435_01789 | gene | open | 3129-3770 | gmk | ||
| 3604 | CAJPSS010000057.1 | GCA905373435_01790 | gene | open | 3767-3967 | rpoZ | ||
| 3605 | CAJPSS010000057.1 | GCA905373435_01791 | gene | open | 4018-5217 | coaBC | ||
| 3606 | CAJPSS010000058.1 | GCA905373435_01792 | CDS | open | 486-1610 | _na 374_aa | oadB | Glutaconyl-CoA decarboxylase subunit beta |
| 3607 | CAJPSS010000058.1 | GCA905373435_01793 | CDS | open | 2490-3779 | _na 429_aa | Transporter%2C DASS family | |
| 3608 | CAJPSS010000058.1 | GCA905373435_01794 | CDS | open | 3877-4002 | _na 41_aa | Glutaconyl-CoA decarboxylase subunit delta | |
| 3609 | CAJPSS010000058.1 | GCA905373435_01795 | CDS | open | 4049-5173 | _na 374_aa | oadB | Glutaconyl-CoA decarboxylase subunit beta |
| 3610 | CAJPSS010000058.1 | GCA905373435_01792 | gene | open | 486-1610 | oadB | ||
| 3611 | CAJPSS010000058.1 | GCA905373435_01793 | gene | open | 2490-3779 | |||
| 3612 | CAJPSS010000058.1 | GCA905373435_01794 | gene | open | 3877-4002 | |||
| 3613 | CAJPSS010000058.1 | GCA905373435_01795 | gene | open | 4049-5173 | oadB | ||
| 3614 | CAJPSS010000059.1 | GCA905373435_01796 | CDS | open | 113-502 | _na 129_aa | DUF3899 domain-containing protein | |
| 3615 | CAJPSS010000059.1 | GCA905373435_01797 | CDS | open | 646-1032 | _na 128_aa | hypothetical protein | |
| 3616 | CAJPSS010000059.1 | GCA905373435_01798 | CDS | open | 1040-1423 | _na 127_aa | hypothetical protein | |
| 3617 | CAJPSS010000059.1 | GCA905373435_01799 | CDS | open | 1547-1936 | _na 129_aa | hypothetical protein | |
| 3618 | CAJPSS010000059.1 | GCA905373435_01800 | CDS | open | 1936-2058 | _na 40_aa | hypothetical protein | |
| 3619 | CAJPSS010000059.1 | GCA905373435_01801 | CDS | open | 2156-2539 | _na 127_aa | hypothetical protein | |
| 3620 | CAJPSS010000059.1 | GCA905373435_01802 | CDS | open | 2724-3089 | _na 121_aa | hypothetical protein | |
| 3621 | CAJPSS010000059.1 | GCA905373435_01803 | CDS | open | 3093-3563 | _na 156_aa | hypothetical protein | |
| 3622 | CAJPSS010000059.1 | GCA905373435_01804 | CDS | open | 3576-3776 | _na 66_aa | hypothetical protein | |
| 3623 | CAJPSS010000059.1 | GCA905373435_01805 | CDS | open | 4263-4652 | _na 129_aa | hypothetical protein | |
| 3624 | CAJPSS010000059.1 | GCA905373435_01796 | gene | open | 113-502 | |||
| 3625 | CAJPSS010000059.1 | GCA905373435_01797 | gene | open | 646-1032 | |||
| 3626 | CAJPSS010000059.1 | GCA905373435_01798 | gene | open | 1040-1423 | |||
| 3627 | CAJPSS010000059.1 | GCA905373435_01799 | gene | open | 1547-1936 | |||
| 3628 | CAJPSS010000059.1 | GCA905373435_01800 | gene | open | 1936-2058 | |||
| 3629 | CAJPSS010000059.1 | GCA905373435_01801 | gene | open | 2156-2539 | |||
| 3630 | CAJPSS010000059.1 | GCA905373435_01802 | gene | open | 2724-3089 | |||
| 3631 | CAJPSS010000059.1 | GCA905373435_01803 | gene | open | 3093-3563 | |||
| 3632 | CAJPSS010000059.1 | GCA905373435_01804 | gene | open | 3576-3776 | |||
| 3633 | CAJPSS010000059.1 | GCA905373435_01805 | gene | open | 4263-4652 | |||
| 3634 | CAJPSS010000060.1 | repeat_region | open | 895-1614 | CRISPR array with 12 repeats of length 28%2C consensus sequence GTTATCTGCCGTATAGGCAGCTTAGAAA and spacer length 32 | |||
| 3635 | CAJPSS010000060.1 | GCA905373435_01806 | CDS | open | 1806-2426 | _na 206_aa | RelA/SpoT domain protein | |
| 3636 | CAJPSS010000060.1 | GCA905373435_01807 | CDS | open | 2423-3097 | _na 224_aa | Response regulator receiver domain protein | |
| 3637 | CAJPSS010000060.1 | GCA905373435_01808 | CDS | open | 3126-4388 | _na 420_aa | histidine kinase | |
| 3638 | CAJPSS010000060.1 | GCA905373435_01809 | CDS | open | 4574-5011 | _na 145_aa | abiV | AbiV family abortive infection protein |
| 3639 | CAJPSS010000060.1 | GCA905373435_01806 | gene | open | 1806-2426 | |||
| 3640 | CAJPSS010000060.1 | GCA905373435_01807 | gene | open | 2423-3097 | |||
| 3641 | CAJPSS010000060.1 | GCA905373435_01808 | gene | open | 3126-4388 | |||
| 3642 | CAJPSS010000060.1 | GCA905373435_01809 | gene | open | 4574-5011 | abiV | ||
| 3643 | CAJPSS010000061.1 | GCA905373435_01810 | CDS | open | 137-544 | _na 135_aa | DUF5058 domain-containing protein | |
| 3644 | CAJPSS010000061.1 | GCA905373435_01811 | CDS | open | 541-798 | _na 85_aa | Holin | |
| 3645 | CAJPSS010000061.1 | GCA905373435_01812 | CDS | open | 873-1277 | _na 134_aa | hypothetical protein | |
| 3646 | CAJPSS010000061.1 | GCA905373435_01813 | CDS | open | 1340-1753 | _na 137_aa | hypothetical protein | |
| 3647 | CAJPSS010000061.1 | GCA905373435_01814 | CDS | open | 1753-2190 | _na 145_aa | hypothetical protein | |
| 3648 | CAJPSS010000061.1 | GCA905373435_01815 | CDS | open | 2133-2540 | _na 135_aa | hypothetical protein | |
| 3649 | CAJPSS010000061.1 | GCA905373435_01816 | CDS | open | 2537-2683 | _na 48_aa | hypothetical protein | |
| 3650 | CAJPSS010000061.1 | GCA905373435_01817 | CDS | open | 2821-3228 | _na 135_aa | DUF5058 domain-containing protein | |
| 3651 | CAJPSS010000061.1 | GCA905373435_01818 | CDS | open | 3335-3742 | _na 135_aa | DUF5058 domain-containing protein | |
| 3652 | CAJPSS010000061.1 | GCA905373435_01819 | CDS | open | 3918-4295 | _na 125_aa | hypothetical protein | |
| 3653 | CAJPSS010000061.1 | GCA905373435_01820 | CDS | open | 4296-4643 | _na 115_aa | hypothetical protein | |
| 3654 | CAJPSS010000061.1 | GCA905373435_01821 | CDS | open | 4589-4798 | _na 69_aa | hypothetical protein | |
| 3655 | CAJPSS010000061.1 | GCA905373435_01810 | gene | open | 137-544 | |||
| 3656 | CAJPSS010000061.1 | GCA905373435_01811 | gene | open | 541-798 | |||
| 3657 | CAJPSS010000061.1 | GCA905373435_01812 | gene | open | 873-1277 | |||
| 3658 | CAJPSS010000061.1 | GCA905373435_01813 | gene | open | 1340-1753 | |||
| 3659 | CAJPSS010000061.1 | GCA905373435_01814 | gene | open | 1753-2190 | |||
| 3660 | CAJPSS010000061.1 | GCA905373435_01815 | gene | open | 2133-2540 | |||
| 3661 | CAJPSS010000061.1 | GCA905373435_01816 | gene | open | 2537-2683 | |||
| 3662 | CAJPSS010000061.1 | GCA905373435_01817 | gene | open | 2821-3228 | |||
| 3663 | CAJPSS010000061.1 | GCA905373435_01818 | gene | open | 3335-3742 | |||
| 3664 | CAJPSS010000061.1 | GCA905373435_01819 | gene | open | 3918-4295 | |||
| 3665 | CAJPSS010000061.1 | GCA905373435_01820 | gene | open | 4296-4643 | |||
| 3666 | CAJPSS010000061.1 | GCA905373435_01821 | gene | open | 4589-4798 | |||
| 3667 | CAJPSS010000062.1 | GCA905373435_01822 | CDS | open | 483-1091 | _na 202_aa | hypothetical protein | |
| 3668 | CAJPSS010000062.1 | GCA905373435_01823 | CDS | open | 1211-1411 | _na 66_aa | hypothetical protein | |
| 3669 | CAJPSS010000062.1 | GCA905373435_01824 | CDS | open | 1436-2260 | _na 274_aa | hypothetical protein | |
| 3670 | CAJPSS010000062.1 | GCA905373435_01825 | CDS | open | 2297-2746 | _na 149_aa | hypothetical protein | |
| 3671 | CAJPSS010000062.1 | GCA905373435_01822 | gene | open | 483-1091 | |||
| 3672 | CAJPSS010000062.1 | GCA905373435_01823 | gene | open | 1211-1411 | |||
| 3673 | CAJPSS010000062.1 | GCA905373435_01824 | gene | open | 1436-2260 | |||
| 3674 | CAJPSS010000062.1 | GCA905373435_01825 | gene | open | 2297-2746 | |||
| 3675 | CAJPSS010000063.1 | GCA905373435_01826 | CDS | open | 58-456 | _na 132_aa | hypothetical protein | |
| 3676 | CAJPSS010000063.1 | GCA905373435_01827 | CDS | open | 533-1654 | _na 373_aa | DUF637 domain-containing protein | |
| 3677 | CAJPSS010000063.1 | GCA905373435_01828 | CDS | open | 1891-2208 | _na 105_aa | DUF420 domain-containing protein | |
| 3678 | CAJPSS010000063.1 | GCA905373435_01829 | CDS | open | 2292-4553 | _na 753_aa | Hemagglutinin repeat-containing protein | |
| 3679 | CAJPSS010000063.1 | GCA905373435_01826 | gene | open | 58-456 | |||
| 3680 | CAJPSS010000063.1 | GCA905373435_01827 | gene | open | 533-1654 | |||
| 3681 | CAJPSS010000063.1 | GCA905373435_01828 | gene | open | 1891-2208 | |||
| 3682 | CAJPSS010000063.1 | GCA905373435_01829 | gene | open | 2292-4553 | |||
| 3683 | CAJPSS010000064.1 | GCA905373435_01830 | CDS | open | 244-609 | _na 121_aa | hypothetical protein | |
| 3684 | CAJPSS010000064.1 | GCA905373435_01831 | CDS | open | 683-1051 | _na 122_aa | winged helix-turn-helix transcriptional regulator | |
| 3685 | CAJPSS010000064.1 | GCA905373435_01832 | CDS | open | 1100-1861 | _na 253_aa | Hydrolase%2C alpha/beta domain protein | |
| 3686 | CAJPSS010000064.1 | GCA905373435_01833 | CDS | open | 2286-3323 | _na 345_aa | Acyltransferase | |
| 3687 | CAJPSS010000064.1 | GCA905373435_01834 | CDS | open | 3896-4135 | _na 79_aa | rhuM | Virulence protein RhuM family |
| 3688 | CAJPSS010000064.1 | GCA905373435_01830 | gene | open | 244-609 | |||
| 3689 | CAJPSS010000064.1 | GCA905373435_01831 | gene | open | 683-1051 | |||
| 3690 | CAJPSS010000064.1 | GCA905373435_01832 | gene | open | 1100-1861 | |||
| 3691 | CAJPSS010000064.1 | GCA905373435_01833 | gene | open | 2286-3323 | |||
| 3692 | CAJPSS010000064.1 | GCA905373435_01834 | gene | open | 3896-4135 | rhuM | ||
| 3693 | CAJPSS010000065.1 | GCA905373435_01835 | CDS | open | 1174-1548 | _na 124_aa | helix-turn-helix transcriptional regulator | |
| 3694 | CAJPSS010000065.1 | GCA905373435_01836 | CDS | open | 1686-1889 | _na 67_aa | hypothetical protein | |
| 3695 | CAJPSS010000065.1 | GCA905373435_01837 | CDS | open | 2864-3907 | _na 347_aa | hypothetical protein | |
| 3696 | CAJPSS010000065.1 | GCA905373435_01835 | gene | open | 1174-1548 | |||
| 3697 | CAJPSS010000065.1 | GCA905373435_01836 | gene | open | 1686-1889 | |||
| 3698 | CAJPSS010000065.1 | GCA905373435_01837 | gene | open | 2864-3907 | |||
| 3699 | CAJPSS010000066.1 | GCA905373435_01838 | CDS | open | 569-970 | _na 133_aa | hypothetical protein | |
| 3700 | CAJPSS010000066.1 | GCA905373435_01839 | CDS | open | 1010-1564 | _na 184_aa | hypothetical protein | |
| 3701 | CAJPSS010000066.1 | GCA905373435_01840 | CDS | open | 1616-1933 | _na 105_aa | hypothetical protein | |
| 3702 | CAJPSS010000066.1 | GCA905373435_01841 | CDS | open | 2139-2273 | _na 44_aa | hypothetical protein | |
| 3703 | CAJPSS010000066.1 | GCA905373435_01842 | CDS | open | 3190-4401 | _na 403_aa | SLH domain-containing protein | |
| 3704 | CAJPSS010000066.1 | GCA905373435_01838 | gene | open | 569-970 | |||
| 3705 | CAJPSS010000066.1 | GCA905373435_01839 | gene | open | 1010-1564 | |||
| 3706 | CAJPSS010000066.1 | GCA905373435_01840 | gene | open | 1616-1933 | |||
| 3707 | CAJPSS010000066.1 | GCA905373435_01841 | gene | open | 2139-2273 | |||
| 3708 | CAJPSS010000066.1 | GCA905373435_01842 | gene | open | 3190-4401 | |||
| 3709 | CAJPSS010000067.1 | GCA905373435_01843 | CDS | open | 56-871 | _na 271_aa | DNA-(apurinic or apyrimidinic site) lyase | |
| 3710 | CAJPSS010000067.1 | GCA905373435_01844 | CDS | open | 997-2991 | _na 664_aa | histidine kinase | |
| 3711 | CAJPSS010000067.1 | GCA905373435_01845 | CDS | open | 3048-3620 | _na 190_aa | hypothetical protein | |
| 3712 | CAJPSS010000067.1 | GCA905373435_01843 | gene | open | 56-871 | |||
| 3713 | CAJPSS010000067.1 | GCA905373435_01844 | gene | open | 997-2991 | |||
| 3714 | CAJPSS010000067.1 | GCA905373435_01845 | gene | open | 3048-3620 | |||
| 3715 | CAJPSS010000068.1 | GCA905373435_01846 | CDS | open | 373-1296 | _na 307_aa | lysR | Transcriptional regulator%2C LysR family |
| 3716 | CAJPSS010000068.1 | GCA905373435_01847 | CDS | open | 1597-1782 | _na 61_aa | Toxin-antitoxin system%2C antitoxin component%2C Xre domain protein | |
| 3717 | CAJPSS010000068.1 | GCA905373435_01848 | CDS | open | 2606-2770 | _na 54_aa | hypothetical protein | |
| 3718 | CAJPSS010000068.1 | GCA905373435_01849 | CDS | open | 2858-3502 | _na 214_aa | hypothetical protein | |
| 3719 | CAJPSS010000068.1 | GCA905373435_01846 | gene | open | 373-1296 | lysR | ||
| 3720 | CAJPSS010000068.1 | GCA905373435_01847 | gene | open | 1597-1782 | |||
| 3721 | CAJPSS010000068.1 | GCA905373435_01848 | gene | open | 2606-2770 | |||
| 3722 | CAJPSS010000068.1 | GCA905373435_01849 | gene | open | 2858-3502 | |||
| 3723 | CAJPSS010000069.1 | GCA905373435_01850 | CDS | open | 712-1077 | _na 121_aa | arsR | Transcriptional regulator%2C ArsR family |
| 3724 | CAJPSS010000069.1 | GCA905373435_01851 | CDS | open | 1240-1461 | _na 73_aa | Heavy metal-associated domain protein | |
| 3725 | CAJPSS010000069.1 | GCA905373435_01852 | CDS | open | 1540-3408 | _na 622_aa | Cd(2+)-exporting ATPase | |
| 3726 | CAJPSS010000069.1 | GCA905373435_01850 | gene | open | 712-1077 | arsR | ||
| 3727 | CAJPSS010000069.1 | GCA905373435_01851 | gene | open | 1240-1461 | |||
| 3728 | CAJPSS010000069.1 | GCA905373435_01852 | gene | open | 1540-3408 | |||
| 3729 | CAJPSS010000070.1 | GCA905373435_01853 | CDS | open | 175-657 | _na 160_aa | greA | transcription elongation factor GreA |
| 3730 | CAJPSS010000070.1 | GCA905373435_01854 | CDS | open | 699-2594 | _na 631_aa | lysS | lysine--tRNA ligase |
| 3731 | CAJPSS010000070.1 | GCA905373435_01855 | CDS | open | 2677-3159 | _na 160_aa | Acetyltransferase%2C GNAT family | |
| 3732 | CAJPSS010000070.1 | GCA905373435_01853 | gene | open | 175-657 | greA | ||
| 3733 | CAJPSS010000070.1 | GCA905373435_01854 | gene | open | 699-2594 | lysS | ||
| 3734 | CAJPSS010000070.1 | GCA905373435_01855 | gene | open | 2677-3159 | |||
| 3735 | CAJPSS010000071.1 | GCA905373435_01856 | CDS | open | 113-508 | _na 131_aa | hypothetical protein | |
| 3736 | CAJPSS010000071.1 | GCA905373435_01857 | CDS | open | 581-1090 | _na 169_aa | hypothetical protein | |
| 3737 | CAJPSS010000071.1 | GCA905373435_01858 | CDS | open | 1110-1511 | _na 133_aa | hypothetical protein | |
| 3738 | CAJPSS010000071.1 | GCA905373435_01859 | CDS | open | 1531-2505 | _na 324_aa | hypothetical protein | |
| 3739 | CAJPSS010000071.1 | GCA905373435_01860 | CDS | open | 2694-3110 | _na 138_aa | DUF1453 domain-containing protein | |
| 3740 | CAJPSS010000071.1 | GCA905373435_01856 | gene | open | 113-508 | |||
| 3741 | CAJPSS010000071.1 | GCA905373435_01857 | gene | open | 581-1090 | |||
| 3742 | CAJPSS010000071.1 | GCA905373435_01858 | gene | open | 1110-1511 | |||
| 3743 | CAJPSS010000071.1 | GCA905373435_01859 | gene | open | 1531-2505 | |||
| 3744 | CAJPSS010000071.1 | GCA905373435_01860 | gene | open | 2694-3110 | |||
| 3745 | CAJPSS010000072.1 | GCA905373435_01861 | CDS | open | 77-364 | _na 95_aa | hypothetical protein | |
| 3746 | CAJPSS010000072.1 | GCA905373435_01862 | CDS | open | 514-990 | _na 158_aa | hypothetical protein | |
| 3747 | CAJPSS010000072.1 | GCA905373435_01863 | CDS | open | 1085-1561 | _na 158_aa | Lipoprotein | |
| 3748 | CAJPSS010000072.1 | GCA905373435_01864 | CDS | open | 1558-2625 | _na 355_aa | hypothetical protein | |
| 3749 | CAJPSS010000072.1 | GCA905373435_01865 | CDS | open | 2622-3041 | _na 139_aa | DUF2269 domain-containing protein | |
| 3750 | CAJPSS010000072.1 | GCA905373435_01866 | CDS | open | 3058-3255 | _na 65_aa | hypothetical protein | |
| 3751 | CAJPSS010000072.1 | GCA905373435_01861 | gene | open | 77-364 | |||
| 3752 | CAJPSS010000072.1 | GCA905373435_01862 | gene | open | 514-990 | |||
| 3753 | CAJPSS010000072.1 | GCA905373435_01863 | gene | open | 1085-1561 | |||
| 3754 | CAJPSS010000072.1 | GCA905373435_01864 | gene | open | 1558-2625 | |||
| 3755 | CAJPSS010000072.1 | GCA905373435_01865 | gene | open | 2622-3041 | |||
| 3756 | CAJPSS010000072.1 | GCA905373435_01866 | gene | open | 3058-3255 | |||
| 3757 | CAJPSS010000073.1 | GCA905373435_01867 | CDS | open | 12-230 | _na 72_aa | hypothetical protein | |
| 3758 | CAJPSS010000073.1 | GCA905373435_01868 | CDS | open | 324-2387 | _na 687_aa | S-layer-like y domain-containing protein | |
| 3759 | CAJPSS010000073.1 | GCA905373435_01867 | gene | open | 12-230 | |||
| 3760 | CAJPSS010000073.1 | GCA905373435_01868 | gene | open | 324-2387 | |||
| 3761 | CAJPSS010000074.1 | GCA905373435_01869 | CDS | open | 1155-1769 | _na 204_aa | Resolvase%2C N-terminal domain protein | |
| 3762 | CAJPSS010000074.1 | GCA905373435_01870 | CDS | open | 2149-2655 | _na 168_aa | Integral membrane protein | |
| 3763 | CAJPSS010000074.1 | GCA905373435_01871 | CDS | open | 2670-2879 | _na 69_aa | yozG | HTH cro/C1-type domain-containing protein |
| 3764 | CAJPSS010000074.1 | GCA905373435_01869 | gene | open | 1155-1769 | |||
| 3765 | CAJPSS010000074.1 | GCA905373435_01870 | gene | open | 2149-2655 | |||
| 3766 | CAJPSS010000074.1 | GCA905373435_01871 | gene | open | 2670-2879 | yozG | ||
| 3767 | CAJPSS010000075.1 | GCA905373435_01872 | CDS | open | 317-628 | _na 103_aa | hypothetical protein | |
| 3768 | CAJPSS010000075.1 | GCA905373435_01873 | CDS | open | 708-875 | _na 55_aa | hypothetical protein | |
| 3769 | CAJPSS010000075.1 | GCA905373435_01874 | CDS | open | 1011-1559 | _na 182_aa | hypothetical protein | |
| 3770 | CAJPSS010000075.1 | GCA905373435_01875 | CDS | open | 1556-2038 | _na 160_aa | hypothetical protein | |
| 3771 | CAJPSS010000075.1 | GCA905373435_01876 | CDS | open | 2117-2344 | _na 75_aa | hypothetical protein | |
| 3772 | CAJPSS010000075.1 | GCA905373435_01872 | gene | open | 317-628 | |||
| 3773 | CAJPSS010000075.1 | GCA905373435_01873 | gene | open | 708-875 | |||
| 3774 | CAJPSS010000075.1 | GCA905373435_01874 | gene | open | 1011-1559 | |||
| 3775 | CAJPSS010000075.1 | GCA905373435_01875 | gene | open | 1556-2038 | |||
| 3776 | CAJPSS010000075.1 | GCA905373435_01876 | gene | open | 2117-2344 | |||
| 3777 | CAJPSS010000076.1 | GCA905373435_01877 | CDS | open | 130-396 | _na 88_aa | MtN3/saliva family protein | |
| 3778 | CAJPSS010000076.1 | GCA905373435_01878 | CDS | open | 684-1787 | _na 367_aa | Peptidase%2C M48 family | |
| 3779 | CAJPSS010000076.1 | GCA905373435_01879 | CDS | open | 1910-2668 | _na 252_aa | ABC transporter%2C ATP-binding protein | |
| 3780 | CAJPSS010000076.1 | GCA905373435_01877 | gene | open | 130-396 | |||
| 3781 | CAJPSS010000076.1 | GCA905373435_01878 | gene | open | 684-1787 | |||
| 3782 | CAJPSS010000076.1 | GCA905373435_01879 | gene | open | 1910-2668 |

