BAKTAGenome Explorer: Dialister invisus (GCA_905373435.1)
Select a Genome:
|
BAKTA Annotations for GCA_905373435.1
|
Search & Sort all 3782 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 2501 | CAJPSS010000021.1 | GCA905373435_01263 | CDS | open | 27187-28227 | _na 346_aa | ATP-binding protein | |
| 2502 | CAJPSS010000021.1 | GCA905373435_01264 | CDS | open | 28230-29198 | _na 322_aa | DUF1351 domain-containing protein | |
| 2503 | CAJPSS010000021.1 | GCA905373435_01265 | CDS | open | 29201-29395 | _na 64_aa | hypothetical protein | |
| 2504 | CAJPSS010000021.1 | GCA905373435_01266 | CDS | open | 29413-29613 | _na 66_aa | hypothetical protein | |
| 2505 | CAJPSS010000021.1 | GCA905373435_01225 | gene | open | 197-676 | |||
| 2506 | CAJPSS010000021.1 | GCA905373435_01226 | gene | open | 677-1210 | |||
| 2507 | CAJPSS010000021.1 | GCA905373435_01227 | gene | open | 1191-1526 | |||
| 2508 | CAJPSS010000021.1 | GCA905373435_01228 | gene | open | 1527-1760 | |||
| 2509 | CAJPSS010000021.1 | GCA905373435_01229 | gene | open | 1760-1885 | |||
| 2510 | CAJPSS010000021.1 | GCA905373435_01230 | gene | open | 1886-2332 | |||
| 2511 | CAJPSS010000021.1 | GCA905373435_01231 | gene | open | 2372-3301 | |||
| 2512 | CAJPSS010000021.1 | GCA905373435_01232 | gene | open | 3305-3952 | |||
| 2513 | CAJPSS010000021.1 | GCA905373435_01233 | gene | open | 3945-5042 | |||
| 2514 | CAJPSS010000021.1 | GCA905373435_01234 | gene | open | 5035-5457 | |||
| 2515 | CAJPSS010000021.1 | GCA905373435_01235 | gene | open | 5462-5869 | |||
| 2516 | CAJPSS010000021.1 | GCA905373435_01236 | gene | open | 5859-6857 | |||
| 2517 | CAJPSS010000021.1 | GCA905373435_01237 | gene | open | 6850-7590 | |||
| 2518 | CAJPSS010000021.1 | GCA905373435_01238 | gene | open | 7587-9605 | |||
| 2519 | CAJPSS010000021.1 | GCA905373435_01239 | gene | open | 9620-9766 | |||
| 2520 | CAJPSS010000021.1 | GCA905373435_01240 | gene | open | 9790-10224 | |||
| 2521 | CAJPSS010000021.1 | GCA905373435_01241 | gene | open | 10272-10763 | |||
| 2522 | CAJPSS010000021.1 | GCA905373435_01242 | gene | open | 10779-12134 | |||
| 2523 | CAJPSS010000021.1 | GCA905373435_01243 | gene | open | 12146-12343 | |||
| 2524 | CAJPSS010000021.1 | GCA905373435_01244 | gene | open | 12333-12779 | |||
| 2525 | CAJPSS010000021.1 | GCA905373435_01245 | gene | open | 12776-13255 | |||
| 2526 | CAJPSS010000021.1 | GCA905373435_01246 | gene | open | 13248-13622 | |||
| 2527 | CAJPSS010000021.1 | GCA905373435_01247 | gene | open | 13598-13960 | |||
| 2528 | CAJPSS010000021.1 | GCA905373435_01248 | gene | open | 13966-14208 | |||
| 2529 | CAJPSS010000021.1 | GCA905373435_01249 | gene | open | 14220-15140 | |||
| 2530 | CAJPSS010000021.1 | GCA905373435_01250 | gene | open | 15162-15725 | |||
| 2531 | CAJPSS010000021.1 | GCA905373435_01251 | gene | open | 15865-16065 | |||
| 2532 | CAJPSS010000021.1 | GCA905373435_01252 | gene | open | 16067-17389 | |||
| 2533 | CAJPSS010000021.1 | GCA905373435_01253 | gene | open | 17386-18825 | |||
| 2534 | CAJPSS010000021.1 | GCA905373435_01254 | gene | open | 18836-20089 | |||
| 2535 | CAJPSS010000021.1 | GCA905373435_01255 | gene | open | 20082-20513 | |||
| 2536 | CAJPSS010000021.1 | GCA905373435_01256 | gene | open | 20658-21083 | |||
| 2537 | CAJPSS010000021.1 | GCA905373435_01257 | gene | open | 21073-21171 | |||
| 2538 | CAJPSS010000021.1 | GCA905373435_01258 | gene | open | 21194-21607 | |||
| 2539 | CAJPSS010000021.1 | GCA905373435_01259 | gene | open | 21961-24873 | |||
| 2540 | CAJPSS010000021.1 | GCA905373435_01260 | gene | open | 24870-25262 | |||
| 2541 | CAJPSS010000021.1 | GCA905373435_01261 | gene | open | 25287-26669 | |||
| 2542 | CAJPSS010000021.1 | GCA905373435_01262 | gene | open | 26674-27171 | |||
| 2543 | CAJPSS010000021.1 | GCA905373435_01263 | gene | open | 27187-28227 | |||
| 2544 | CAJPSS010000021.1 | GCA905373435_01264 | gene | open | 28230-29198 | |||
| 2545 | CAJPSS010000021.1 | GCA905373435_01265 | gene | open | 29201-29395 | |||
| 2546 | CAJPSS010000021.1 | GCA905373435_01266 | gene | open | 29413-29613 | |||
| 2547 | CAJPSS010000022.1 | GCA905373435_01269 | CDS | open | 261-695 | _na 144_aa | ruvX | Holliday junction resolvase RuvX |
| 2548 | CAJPSS010000022.1 | GCA905373435_01270 | CDS | open | 692-1885 | _na 397_aa | DUF3084 domain-containing protein | |
| 2549 | CAJPSS010000022.1 | GCA905373435_01271 | CDS | open | 1949-3034 | _na 361_aa | Permease%2C YjgP/YjgQ family | |
| 2550 | CAJPSS010000022.1 | GCA905373435_01272 | CDS | open | 3063-3785 | _na 240_aa | lptB | LPS export ABC transporter ATP-binding protein |
| 2551 | CAJPSS010000022.1 | GCA905373435_01273 | CDS | open | 3782-4630 | _na 282_aa | OstA-like protein | |
| 2552 | CAJPSS010000022.1 | GCA905373435_01274 | CDS | open | 4627-5172 | _na 181_aa | lptC | LPS export ABC transporter periplasmic protein LptC |
| 2553 | CAJPSS010000022.1 | GCA905373435_01275 | CDS | open | 5169-6152 | _na 327_aa | Lipid A biosynthesis (KDO)2-(Lauroyl)-lipid IVA acyltransferase | |
| 2554 | CAJPSS010000022.1 | GCA905373435_01276 | CDS | open | 6193-6732 | _na 179_aa | kdsC | 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase KdsC |
| 2555 | CAJPSS010000022.1 | GCA905373435_01277 | CDS | open | 6732-7703 | _na 323_aa | Sugar isomerase%2C KpsF/GutQ family | |
| 2556 | CAJPSS010000022.1 | GCA905373435_01278 | CDS | open | 7844-8665 | _na 273_aa | kdsA | 3-deoxy-8-phosphooctulonate synthase |
| 2557 | CAJPSS010000022.1 | GCA905373435_01279 | CDS | open | 8662-9393 | _na 243_aa | kdsB | 3-deoxy-manno-octulosonate cytidylyltransferase |
| 2558 | CAJPSS010000022.1 | GCA905373435_01280 | CDS | open | 9390-10502 | _na 370_aa | lpxK | tetraacyldisaccharide 4'-kinase |
| 2559 | CAJPSS010000022.1 | GCA905373435_01281 | CDS | open | 10492-11823 | _na 443_aa | 3-deoxy-D-manno-octulosonic acid transferase | |
| 2560 | CAJPSS010000022.1 | GCA905373435_01282 | CDS | open | 11825-13582 | _na 585_aa | msbA | Putative lipid A export permease/ATP-binding protein MsbA |
| 2561 | CAJPSS010000022.1 | GCA905373435_01283 | CDS | open | 13582-14718 | _na 378_aa | lpxB | lipid-A-disaccharide synthase |
| 2562 | CAJPSS010000022.1 | GCA905373435_01284 | CDS | open | 14715-15554 | _na 279_aa | lpxI | UDP-2%2C3-diacylglucosamine diphosphatase LpxI |
| 2563 | CAJPSS010000022.1 | GCA905373435_01285 | CDS | open | 15741-16994 | _na 417_aa | sstT | serine/threonine transporter SstT |
| 2564 | CAJPSS010000022.1 | GCA905373435_01286 | CDS | open | 17086-17739 | _na 217_aa | recO | DNA repair protein RecO |
| 2565 | CAJPSS010000022.1 | GCA905373435_01287 | CDS | open | 17732-19042 | _na 436_aa | CBS domain protein | |
| 2566 | CAJPSS010000022.1 | GCA905373435_01288 | CDS | open | 19088-19990 | _na 300_aa | era | GTPase Era |
| 2567 | CAJPSS010000022.1 | GCA905373435_01289 | CDS | open | 19983-20399 | _na 138_aa | cytidine deaminase | |
| 2568 | CAJPSS010000022.1 | GCA905373435_01290 | CDS | open | 20386-20877 | _na 163_aa | ybeY | rRNA maturation RNase YbeY |
| 2569 | CAJPSS010000022.1 | GCA905373435_01291 | CDS | open | 20861-21820 | _na 319_aa | PhoH-like protein | |
| 2570 | CAJPSS010000022.1 | GCA905373435_01292 | CDS | open | 21899-22849 | _na 316_aa | TIGR01212 family radical SAM protein | |
| 2571 | CAJPSS010000022.1 | GCA905373435_01293 | CDS | open | 22955-24835 | _na 626_aa | Glutamine-dependent NAD(+) synthetase | |
| 2572 | CAJPSS010000022.1 | GCA905373435_01294 | CDS | open | 24885-26417 | _na 510_aa | DEAD/DEAH box helicase | |
| 2573 | CAJPSS010000022.1 | GCA905373435_01298 | CDS | open | 27292-27873 | _na 193_aa | Gram-positive signal peptide protein%2C YSIRK family | |
| 2574 | CAJPSS010000022.1 | GCA905373435_01299 | CDS | open | 27891-28463 | _na 190_aa | Carboxypeptidase regulatory-like domain-containing protein | |
| 2575 | CAJPSS010000022.1 | GCA905373435_01269 | gene | open | 261-695 | ruvX | ||
| 2576 | CAJPSS010000022.1 | GCA905373435_01270 | gene | open | 692-1885 | |||
| 2577 | CAJPSS010000022.1 | GCA905373435_01271 | gene | open | 1949-3034 | |||
| 2578 | CAJPSS010000022.1 | GCA905373435_01272 | gene | open | 3063-3785 | lptB | ||
| 2579 | CAJPSS010000022.1 | GCA905373435_01273 | gene | open | 3782-4630 | |||
| 2580 | CAJPSS010000022.1 | GCA905373435_01274 | gene | open | 4627-5172 | lptC | ||
| 2581 | CAJPSS010000022.1 | GCA905373435_01275 | gene | open | 5169-6152 | |||
| 2582 | CAJPSS010000022.1 | GCA905373435_01276 | gene | open | 6193-6732 | kdsC | ||
| 2583 | CAJPSS010000022.1 | GCA905373435_01277 | gene | open | 6732-7703 | |||
| 2584 | CAJPSS010000022.1 | GCA905373435_01278 | gene | open | 7844-8665 | kdsA | ||
| 2585 | CAJPSS010000022.1 | GCA905373435_01279 | gene | open | 8662-9393 | kdsB | ||
| 2586 | CAJPSS010000022.1 | GCA905373435_01280 | gene | open | 9390-10502 | lpxK | ||
| 2587 | CAJPSS010000022.1 | GCA905373435_01281 | gene | open | 10492-11823 | |||
| 2588 | CAJPSS010000022.1 | GCA905373435_01282 | gene | open | 11825-13582 | msbA | ||
| 2589 | CAJPSS010000022.1 | GCA905373435_01283 | gene | open | 13582-14718 | lpxB | ||
| 2590 | CAJPSS010000022.1 | GCA905373435_01284 | gene | open | 14715-15554 | lpxI | ||
| 2591 | CAJPSS010000022.1 | GCA905373435_01285 | gene | open | 15741-16994 | sstT | ||
| 2592 | CAJPSS010000022.1 | GCA905373435_01286 | gene | open | 17086-17739 | recO | ||
| 2593 | CAJPSS010000022.1 | GCA905373435_01287 | gene | open | 17732-19042 | |||
| 2594 | CAJPSS010000022.1 | GCA905373435_01288 | gene | open | 19088-19990 | era | ||
| 2595 | CAJPSS010000022.1 | GCA905373435_01289 | gene | open | 19983-20399 | |||
| 2596 | CAJPSS010000022.1 | GCA905373435_01290 | gene | open | 20386-20877 | ybeY | ||
| 2597 | CAJPSS010000022.1 | GCA905373435_01291 | gene | open | 20861-21820 | |||
| 2598 | CAJPSS010000022.1 | GCA905373435_01292 | gene | open | 21899-22849 | |||
| 2599 | CAJPSS010000022.1 | GCA905373435_01293 | gene | open | 22955-24835 | |||
| 2600 | CAJPSS010000022.1 | GCA905373435_01294 | gene | open | 24885-26417 | |||
| 2601 | CAJPSS010000022.1 | GCA905373435_01298 | gene | open | 27292-27873 | |||
| 2602 | CAJPSS010000022.1 | GCA905373435_01299 | gene | open | 27891-28463 | |||
| 2603 | CAJPSS010000022.1 | GCA905373435_01267 | gene | open | 48-124 | trnR | ||
| 2604 | CAJPSS010000022.1 | GCA905373435_01268 | gene | open | 129-204 | trnP | ||
| 2605 | CAJPSS010000022.1 | GCA905373435_01295 | gene | open | 26760-26835 | trnV | ||
| 2606 | CAJPSS010000022.1 | GCA905373435_01296 | gene | open | 26842-26916 | trnE | ||
| 2607 | CAJPSS010000022.1 | GCA905373435_01297 | gene | open | 26919-26994 | trnN | ||
| 2608 | CAJPSS010000022.1 | GCA905373435_01267 | tRNA | open | 48-124 | trnR | tRNA-Arg(tct) | |
| 2609 | CAJPSS010000022.1 | GCA905373435_01268 | tRNA | open | 129-204 | trnP | tRNA-Pro(tgg) | |
| 2610 | CAJPSS010000022.1 | GCA905373435_01295 | tRNA | open | 26760-26835 | trnV | tRNA-Val(tac) | |
| 2611 | CAJPSS010000022.1 | GCA905373435_01296 | tRNA | open | 26842-26916 | trnE | tRNA-Glu(ttc) | |
| 2612 | CAJPSS010000022.1 | GCA905373435_01297 | tRNA | open | 26919-26994 | trnN | tRNA-Asn(gtt) | |
| 2613 | CAJPSS010000023.1 | regulatory_region | open | 1393-1481 | Glycine riboswitch aptamer | |||
| 2614 | CAJPSS010000023.1 | regulatory_region | open | 3230-3330 | Glycine riboswitch aptamer | |||
| 2615 | CAJPSS010000023.1 | GCA905373435_01300 | CDS | open | 103-522 | _na 139_aa | hypothetical protein | |
| 2616 | CAJPSS010000023.1 | GCA905373435_01301 | CDS | open | 1322-1603 | _na 93_aa | hypothetical protein | |
| 2617 | CAJPSS010000023.1 | GCA905373435_01302 | CDS | open | 1578-2945 | _na 455_aa | Amino acid carrier protein | |
| 2618 | CAJPSS010000023.1 | GCA905373435_01303 | CDS | open | 2833-3360 | _na 175_aa | hypothetical protein | |
| 2619 | CAJPSS010000023.1 | GCA905373435_01304 | CDS | open | 3455-4906 | _na 483_aa | Amino acid carrier protein | |
| 2620 | CAJPSS010000023.1 | GCA905373435_01305 | CDS | open | 5058-5159 | _na 33_aa | hypothetical protein | |
| 2621 | CAJPSS010000023.1 | GCA905373435_01306 | CDS | open | 5156-5767 | _na 203_aa | pdaC | Deacetylase PdaC domain-containing protein |
| 2622 | CAJPSS010000023.1 | GCA905373435_01307 | CDS | open | 6293-7519 | _na 408_aa | Transporter%2C dicarboxylate/amino acid:cation Na+/H+ symporter family protein | |
| 2623 | CAJPSS010000023.1 | GCA905373435_01308 | CDS | open | 7611-8498 | _na 295_aa | araC | Transcriptional regulator%2C AraC family |
| 2624 | CAJPSS010000023.1 | GCA905373435_01309 | CDS | open | 8700-9128 | _na 142_aa | Metalloregulation DNA-binding stress protein | |
| 2625 | CAJPSS010000023.1 | GCA905373435_01310 | CDS | open | 9301-9795 | _na 164_aa | DUF2846 domain-containing protein | |
| 2626 | CAJPSS010000023.1 | GCA905373435_01311 | CDS | open | 10017-10319 | _na 100_aa | fliS | Flagellar protein FliS |
| 2627 | CAJPSS010000023.1 | GCA905373435_01312 | CDS | open | 10956-12680 | _na 574_aa | cstA | Carbon starvation protein CstA |
| 2628 | CAJPSS010000023.1 | GCA905373435_01313 | CDS | open | 12682-13278 | _na 198_aa | GNAT family acetyltransferase | |
| 2629 | CAJPSS010000023.1 | GCA905373435_01314 | CDS | open | 13239-13382 | _na 47_aa | hypothetical protein | |
| 2630 | CAJPSS010000023.1 | GCA905373435_01315 | CDS | open | 13636-14370 | _na 244_aa | B3/4 domain protein | |
| 2631 | CAJPSS010000023.1 | GCA905373435_01316 | CDS | open | 14395-15018 | _na 207_aa | DNA polymerase III%2C epsilon subunit | |
| 2632 | CAJPSS010000023.1 | GCA905373435_01317 | CDS | open | 15065-15877 | _na 270_aa | MBL fold hydrolase | |
| 2633 | CAJPSS010000023.1 | GCA905373435_01318 | CDS | open | 15989-16645 | _na 218_aa | tetR | Transcriptional regulator%2C TetR family |
| 2634 | CAJPSS010000023.1 | GCA905373435_01319 | CDS | open | 16642-21009 | _na 1455_aa | Putative CoA-substrate-specific enzyme activase | |
| 2635 | CAJPSS010000023.1 | GCA905373435_01320 | CDS | open | 21238-21363 | _na 41_aa | hypothetical protein | |
| 2636 | CAJPSS010000023.1 | GCA905373435_01321 | CDS | open | 21376-21927 | _na 183_aa | Cytokinin riboside 5'-monophosphate phosphoribohydrolase | |
| 2637 | CAJPSS010000023.1 | GCA905373435_01322 | CDS | open | 22338-22589 | _na 83_aa | Ribosomal protein L7Ae | |
| 2638 | CAJPSS010000023.1 | GCA905373435_01323 | CDS | open | 22696-23076 | _na 126_aa | rpsL | 30S ribosomal protein S12 |
| 2639 | CAJPSS010000023.1 | GCA905373435_01324 | CDS | open | 23127-23597 | _na 156_aa | rpsG | 30S ribosomal protein S7 |
| 2640 | CAJPSS010000023.1 | GCA905373435_01325 | CDS | open | 23662-25698 | _na 678_aa | fusA | elongation factor G |
| 2641 | CAJPSS010000023.1 | GCA905373435_01300 | gene | open | 103-522 | |||
| 2642 | CAJPSS010000023.1 | GCA905373435_01301 | gene | open | 1322-1603 | |||
| 2643 | CAJPSS010000023.1 | GCA905373435_01302 | gene | open | 1578-2945 | |||
| 2644 | CAJPSS010000023.1 | GCA905373435_01303 | gene | open | 2833-3360 | |||
| 2645 | CAJPSS010000023.1 | GCA905373435_01304 | gene | open | 3455-4906 | |||
| 2646 | CAJPSS010000023.1 | GCA905373435_01305 | gene | open | 5058-5159 | |||
| 2647 | CAJPSS010000023.1 | GCA905373435_01306 | gene | open | 5156-5767 | pdaC | ||
| 2648 | CAJPSS010000023.1 | GCA905373435_01307 | gene | open | 6293-7519 | |||
| 2649 | CAJPSS010000023.1 | GCA905373435_01308 | gene | open | 7611-8498 | araC | ||
| 2650 | CAJPSS010000023.1 | GCA905373435_01309 | gene | open | 8700-9128 | |||
| 2651 | CAJPSS010000023.1 | GCA905373435_01310 | gene | open | 9301-9795 | |||
| 2652 | CAJPSS010000023.1 | GCA905373435_01311 | gene | open | 10017-10319 | fliS | ||
| 2653 | CAJPSS010000023.1 | GCA905373435_01312 | gene | open | 10956-12680 | cstA | ||
| 2654 | CAJPSS010000023.1 | GCA905373435_01313 | gene | open | 12682-13278 | |||
| 2655 | CAJPSS010000023.1 | GCA905373435_01314 | gene | open | 13239-13382 | |||
| 2656 | CAJPSS010000023.1 | GCA905373435_01315 | gene | open | 13636-14370 | |||
| 2657 | CAJPSS010000023.1 | GCA905373435_01316 | gene | open | 14395-15018 | |||
| 2658 | CAJPSS010000023.1 | GCA905373435_01317 | gene | open | 15065-15877 | |||
| 2659 | CAJPSS010000023.1 | GCA905373435_01318 | gene | open | 15989-16645 | tetR | ||
| 2660 | CAJPSS010000023.1 | GCA905373435_01319 | gene | open | 16642-21009 | |||
| 2661 | CAJPSS010000023.1 | GCA905373435_01320 | gene | open | 21238-21363 | |||
| 2662 | CAJPSS010000023.1 | GCA905373435_01321 | gene | open | 21376-21927 | |||
| 2663 | CAJPSS010000023.1 | GCA905373435_01322 | gene | open | 22338-22589 | |||
| 2664 | CAJPSS010000023.1 | GCA905373435_01323 | gene | open | 22696-23076 | rpsL | ||
| 2665 | CAJPSS010000023.1 | GCA905373435_01324 | gene | open | 23127-23597 | rpsG | ||
| 2666 | CAJPSS010000023.1 | GCA905373435_01325 | gene | open | 23662-25698 | fusA | ||
| 2667 | CAJPSS010000024.1 | GCA905373435_01326 | CDS | open | 75-539 | _na 154_aa | hypothetical protein | |
| 2668 | CAJPSS010000024.1 | GCA905373435_01327 | CDS | open | 1474-2316 | _na 280_aa | hypothetical protein | |
| 2669 | CAJPSS010000024.1 | GCA905373435_01328 | CDS | open | 2347-3021 | _na 224_aa | TIGR02206 family protein | |
| 2670 | CAJPSS010000024.1 | GCA905373435_01329 | CDS | open | 3081-3335 | _na 84_aa | Integral membrane protein | |
| 2671 | CAJPSS010000024.1 | GCA905373435_01330 | CDS | open | 3712-5010 | _na 432_aa | Citrate transporter-like domain-containing protein | |
| 2672 | CAJPSS010000024.1 | GCA905373435_01331 | CDS | open | 5109-5696 | _na 195_aa | Nitroreductase family protein | |
| 2673 | CAJPSS010000024.1 | GCA905373435_01332 | CDS | open | 5784-6245 | _na 153_aa | eamA | EamA domain-containing protein |
| 2674 | CAJPSS010000024.1 | GCA905373435_01333 | CDS | open | 6223-6633 | _na 136_aa | VOC family protein | |
| 2675 | CAJPSS010000024.1 | GCA905373435_01334 | CDS | open | 6661-7407 | _na 248_aa | Type-4 uracil-DNA glycosylase | |
| 2676 | CAJPSS010000024.1 | GCA905373435_01335 | CDS | open | 7439-8866 | _na 475_aa | dnaB | replicative DNA helicase |
| 2677 | CAJPSS010000024.1 | GCA905373435_01336 | CDS | open | 8879-10795 | _na 638_aa | lonC | Lon family ATP-dependent protease |
| 2678 | CAJPSS010000024.1 | GCA905373435_01337 | CDS | open | 11335-11880 | _na 181_aa | hypothetical protein | |
| 2679 | CAJPSS010000024.1 | GCA905373435_01338 | CDS | open | 12222-12743 | _na 173_aa | bioX | Protein BioX |
| 2680 | CAJPSS010000024.1 | GCA905373435_01339 | CDS | open | 12740-13903 | _na 387_aa | bioF | 8-amino-7-oxononanoate synthase |
| 2681 | CAJPSS010000024.1 | GCA905373435_01340 | CDS | open | 13900-14670 | _na 256_aa | 6-carboxyhexanoate--CoA ligase | |
| 2682 | CAJPSS010000024.1 | GCA905373435_01341 | CDS | open | 14897-15343 | _na 148_aa | rplI | 50S ribosomal protein L9 |
| 2683 | CAJPSS010000024.1 | GCA905373435_01342 | CDS | open | 15340-17322 | _na 660_aa | Cyclic-di-AMP phosphodiesterase | |
| 2684 | CAJPSS010000024.1 | GCA905373435_01343 | CDS | open | 17422-18471 | _na 349_aa | DUF2232 domain-containing protein | |
| 2685 | CAJPSS010000024.1 | GCA905373435_01344 | CDS | open | 18507-20186 | _na 559_aa | Ribonuclease J | |
| 2686 | CAJPSS010000024.1 | GCA905373435_01345 | CDS | open | 20183-20779 | _na 198_aa | hypothetical protein | |
| 2687 | CAJPSS010000024.1 | GCA905373435_01346 | CDS | open | 21633-22430 | _na 265_aa | ABC transporter%2C ATP-binding protein | |
| 2688 | CAJPSS010000024.1 | GCA905373435_01347 | CDS | open | 22430-23455 | _na 341_aa | Iron chelate uptake ABC transporter%2C FeCT family%2C permease protein | |
| 2689 | CAJPSS010000024.1 | GCA905373435_01348 | CDS | open | 23486-24514 | _na 342_aa | Periplasmic binding protein | |
| 2690 | CAJPSS010000024.1 | GCA905373435_01349 | CDS | open | 24716-24853 | _na 45_aa | hypothetical protein | |
| 2691 | CAJPSS010000024.1 | GCA905373435_01326 | gene | open | 75-539 | |||
| 2692 | CAJPSS010000024.1 | GCA905373435_01327 | gene | open | 1474-2316 | |||
| 2693 | CAJPSS010000024.1 | GCA905373435_01328 | gene | open | 2347-3021 | |||
| 2694 | CAJPSS010000024.1 | GCA905373435_01329 | gene | open | 3081-3335 | |||
| 2695 | CAJPSS010000024.1 | GCA905373435_01330 | gene | open | 3712-5010 | |||
| 2696 | CAJPSS010000024.1 | GCA905373435_01331 | gene | open | 5109-5696 | |||
| 2697 | CAJPSS010000024.1 | GCA905373435_01332 | gene | open | 5784-6245 | eamA | ||
| 2698 | CAJPSS010000024.1 | GCA905373435_01333 | gene | open | 6223-6633 | |||
| 2699 | CAJPSS010000024.1 | GCA905373435_01334 | gene | open | 6661-7407 | |||
| 2700 | CAJPSS010000024.1 | GCA905373435_01335 | gene | open | 7439-8866 | dnaB | ||
| 2701 | CAJPSS010000024.1 | GCA905373435_01336 | gene | open | 8879-10795 | lonC | ||
| 2702 | CAJPSS010000024.1 | GCA905373435_01337 | gene | open | 11335-11880 | |||
| 2703 | CAJPSS010000024.1 | GCA905373435_01338 | gene | open | 12222-12743 | bioX | ||
| 2704 | CAJPSS010000024.1 | GCA905373435_01339 | gene | open | 12740-13903 | bioF | ||
| 2705 | CAJPSS010000024.1 | GCA905373435_01340 | gene | open | 13900-14670 | |||
| 2706 | CAJPSS010000024.1 | GCA905373435_01341 | gene | open | 14897-15343 | rplI | ||
| 2707 | CAJPSS010000024.1 | GCA905373435_01342 | gene | open | 15340-17322 | |||
| 2708 | CAJPSS010000024.1 | GCA905373435_01343 | gene | open | 17422-18471 | |||
| 2709 | CAJPSS010000024.1 | GCA905373435_01344 | gene | open | 18507-20186 | |||
| 2710 | CAJPSS010000024.1 | GCA905373435_01345 | gene | open | 20183-20779 | |||
| 2711 | CAJPSS010000024.1 | GCA905373435_01346 | gene | open | 21633-22430 | |||
| 2712 | CAJPSS010000024.1 | GCA905373435_01347 | gene | open | 22430-23455 | |||
| 2713 | CAJPSS010000024.1 | GCA905373435_01348 | gene | open | 23486-24514 | |||
| 2714 | CAJPSS010000024.1 | GCA905373435_01349 | gene | open | 24716-24853 | |||
| 2715 | CAJPSS010000025.1 | GCA905373435_01350 | CDS | open | 88-363 | _na 91_aa | Prevent-host-death protein | |
| 2716 | CAJPSS010000025.1 | GCA905373435_01351 | CDS | open | 394-993 | _na 199_aa | G5 domain-containing protein | |
| 2717 | CAJPSS010000025.1 | GCA905373435_01352 | CDS | open | 1006-1557 | _na 183_aa | N-acetylmuramoyl-L-alanine amidase | |
| 2718 | CAJPSS010000025.1 | GCA905373435_01353 | CDS | open | 1554-1736 | _na 60_aa | Holin | |
| 2719 | CAJPSS010000025.1 | GCA905373435_01354 | CDS | open | 1749-2084 | _na 111_aa | Serine/threonine protein kinase | |
| 2720 | CAJPSS010000025.1 | GCA905373435_01355 | CDS | open | 2084-2278 | _na 64_aa | hypothetical protein | |
| 2721 | CAJPSS010000025.1 | GCA905373435_01356 | CDS | open | 2293-2745 | _na 150_aa | Phage tail protein | |
| 2722 | CAJPSS010000025.1 | GCA905373435_01357 | CDS | open | 2796-3821 | _na 341_aa | tyrosine-type recombinase/integrase | |
| 2723 | CAJPSS010000025.1 | GCA905373435_01358 | CDS | open | 4738-5694 | _na 318_aa | phage tail protein | |
| 2724 | CAJPSS010000025.1 | GCA905373435_01359 | CDS | open | 5687-6343 | _na 218_aa | DUF2313 domain-containing protein | |
| 2725 | CAJPSS010000025.1 | GCA905373435_01360 | CDS | open | 6340-7428 | _na 362_aa | Baseplate J/gp47 family protein | |
| 2726 | CAJPSS010000025.1 | GCA905373435_01361 | CDS | open | 7433-7861 | _na 142_aa | DUF2634 domain-containing protein | |
| 2727 | CAJPSS010000025.1 | GCA905373435_01362 | CDS | open | 7863-8270 | _na 135_aa | DUF2577 domain-containing protein | |
| 2728 | CAJPSS010000025.1 | GCA905373435_01363 | CDS | open | 8278-9810 | _na 510_aa | NlpC/P60 domain-containing protein | |
| 2729 | CAJPSS010000025.1 | GCA905373435_01364 | CDS | open | 9827-10582 | _na 251_aa | Dit-like phage tail protein N-terminal domain-containing protein | |
| 2730 | CAJPSS010000025.1 | GCA905373435_01365 | CDS | open | 10582-12885 | _na 767_aa | Phage tail tape measure protein | |
| 2731 | CAJPSS010000025.1 | GCA905373435_01366 | CDS | open | 13071-13487 | _na 138_aa | Phage XkdN-like protein | |
| 2732 | CAJPSS010000025.1 | GCA905373435_01367 | CDS | open | 13499-13933 | _na 144_aa | Phage tail tube protein | |
| 2733 | CAJPSS010000025.1 | GCA905373435_01368 | CDS | open | 13950-15119 | _na 389_aa | Phage tail sheath subtilisin-like domain-containing protein | |
| 2734 | CAJPSS010000025.1 | GCA905373435_01369 | CDS | open | 15134-15640 | _na 168_aa | DUF3168 domain-containing protein | |
| 2735 | CAJPSS010000025.1 | GCA905373435_01370 | CDS | open | 15633-16049 | _na 138_aa | HK97 gp10 family phage protein | |
| 2736 | CAJPSS010000025.1 | GCA905373435_01371 | CDS | open | 16039-16392 | _na 117_aa | phage head closure protein | |
| 2737 | CAJPSS010000025.1 | GCA905373435_01372 | CDS | open | 16397-16699 | _na 100_aa | head-tail connector protein | |
| 2738 | CAJPSS010000025.1 | GCA905373435_01373 | CDS | open | 16711-17865 | _na 384_aa | phage major capsid protein | |
| 2739 | CAJPSS010000025.1 | GCA905373435_01374 | CDS | open | 17880-18485 | _na 201_aa | HK97 family phage prohead protease | |
| 2740 | CAJPSS010000025.1 | GCA905373435_01375 | CDS | open | 18469-19719 | _na 416_aa | phage portal protein | |
| 2741 | CAJPSS010000025.1 | GCA905373435_01376 | CDS | open | 19734-21398 | _na 554_aa | Terminase large subunit | |
| 2742 | CAJPSS010000025.1 | GCA905373435_01377 | CDS | open | 21395-21751 | _na 118_aa | Terminase | |
| 2743 | CAJPSS010000025.1 | GCA905373435_01378 | CDS | open | 21906-22292 | _na 128_aa | HNH endonuclease | |
| 2744 | CAJPSS010000025.1 | GCA905373435_01379 | CDS | open | 22484-22996 | _na 170_aa | Sigma-70 family RNA polymerase sigma factor | |
| 2745 | CAJPSS010000025.1 | GCA905373435_01380 | CDS | open | 23065-23478 | _na 137_aa | rusA | RusA family crossover junction endodeoxyribonuclease |
| 2746 | CAJPSS010000025.1 | GCA905373435_01381 | CDS | open | 23488-24012 | _na 174_aa | SAM-dependent methyltransferase | |
| 2747 | CAJPSS010000025.1 | GCA905373435_01382 | CDS | open | 24054-24281 | _na 75_aa | hypothetical protein | |
| 2748 | CAJPSS010000025.1 | GCA905373435_01350 | gene | open | 88-363 | |||
| 2749 | CAJPSS010000025.1 | GCA905373435_01351 | gene | open | 394-993 | |||
| 2750 | CAJPSS010000025.1 | GCA905373435_01352 | gene | open | 1006-1557 | |||
| 2751 | CAJPSS010000025.1 | GCA905373435_01353 | gene | open | 1554-1736 | |||
| 2752 | CAJPSS010000025.1 | GCA905373435_01354 | gene | open | 1749-2084 | |||
| 2753 | CAJPSS010000025.1 | GCA905373435_01355 | gene | open | 2084-2278 | |||
| 2754 | CAJPSS010000025.1 | GCA905373435_01356 | gene | open | 2293-2745 | |||
| 2755 | CAJPSS010000025.1 | GCA905373435_01357 | gene | open | 2796-3821 | |||
| 2756 | CAJPSS010000025.1 | GCA905373435_01358 | gene | open | 4738-5694 | |||
| 2757 | CAJPSS010000025.1 | GCA905373435_01359 | gene | open | 5687-6343 | |||
| 2758 | CAJPSS010000025.1 | GCA905373435_01360 | gene | open | 6340-7428 | |||
| 2759 | CAJPSS010000025.1 | GCA905373435_01361 | gene | open | 7433-7861 | |||
| 2760 | CAJPSS010000025.1 | GCA905373435_01362 | gene | open | 7863-8270 | |||
| 2761 | CAJPSS010000025.1 | GCA905373435_01363 | gene | open | 8278-9810 | |||
| 2762 | CAJPSS010000025.1 | GCA905373435_01364 | gene | open | 9827-10582 | |||
| 2763 | CAJPSS010000025.1 | GCA905373435_01365 | gene | open | 10582-12885 | |||
| 2764 | CAJPSS010000025.1 | GCA905373435_01366 | gene | open | 13071-13487 | |||
| 2765 | CAJPSS010000025.1 | GCA905373435_01367 | gene | open | 13499-13933 | |||
| 2766 | CAJPSS010000025.1 | GCA905373435_01368 | gene | open | 13950-15119 | |||
| 2767 | CAJPSS010000025.1 | GCA905373435_01369 | gene | open | 15134-15640 | |||
| 2768 | CAJPSS010000025.1 | GCA905373435_01370 | gene | open | 15633-16049 | |||
| 2769 | CAJPSS010000025.1 | GCA905373435_01371 | gene | open | 16039-16392 | |||
| 2770 | CAJPSS010000025.1 | GCA905373435_01372 | gene | open | 16397-16699 | |||
| 2771 | CAJPSS010000025.1 | GCA905373435_01373 | gene | open | 16711-17865 | |||
| 2772 | CAJPSS010000025.1 | GCA905373435_01374 | gene | open | 17880-18485 | |||
| 2773 | CAJPSS010000025.1 | GCA905373435_01375 | gene | open | 18469-19719 | |||
| 2774 | CAJPSS010000025.1 | GCA905373435_01376 | gene | open | 19734-21398 | |||
| 2775 | CAJPSS010000025.1 | GCA905373435_01377 | gene | open | 21395-21751 | |||
| 2776 | CAJPSS010000025.1 | GCA905373435_01378 | gene | open | 21906-22292 | |||
| 2777 | CAJPSS010000025.1 | GCA905373435_01379 | gene | open | 22484-22996 | |||
| 2778 | CAJPSS010000025.1 | GCA905373435_01380 | gene | open | 23065-23478 | rusA | ||
| 2779 | CAJPSS010000025.1 | GCA905373435_01381 | gene | open | 23488-24012 | |||
| 2780 | CAJPSS010000025.1 | GCA905373435_01382 | gene | open | 24054-24281 | |||
| 2781 | CAJPSS010000026.1 | repeat_region | open | 9686-10683 | CRISPR array with 17 repeats of length 28%2C consensus sequence GTTAACTGCCGCATAGGTAGTTTAGAAA and spacer length 32 | |||
| 2782 | CAJPSS010000026.1 | GCA905373435_01383 | CDS | open | 859-1281 | _na 140_aa | rhuM | RhuM family protein |
| 2783 | CAJPSS010000026.1 | GCA905373435_01384 | CDS | open | 1492-2031 | _na 179_aa | cas1f | type I-F CRISPR-associated endonuclease Cas1f |
| 2784 | CAJPSS010000026.1 | GCA905373435_01385 | CDS | open | 2028-2456 | _na 142_aa | cas1f | type I-F CRISPR-associated endonuclease Cas1f |
| 2785 | CAJPSS010000026.1 | GCA905373435_01386 | CDS | open | 2453-5893 | _na 1146_aa | cas3f | type I-F CRISPR-associated helicase Cas3f |
| 2786 | CAJPSS010000026.1 | GCA905373435_01387 | CDS | open | 5896-7059 | _na 387_aa | Type I-F CRISPR-associated protein Csy1 | |
| 2787 | CAJPSS010000026.1 | GCA905373435_01388 | CDS | open | 7056-7943 | _na 295_aa | csy2 | type I-F CRISPR-associated protein Csy2 |
| 2788 | CAJPSS010000026.1 | GCA905373435_01389 | CDS | open | 7960-8979 | _na 339_aa | csy3 | type I-F CRISPR-associated protein Csy3 |
| 2789 | CAJPSS010000026.1 | GCA905373435_01390 | CDS | open | 8983-9555 | _na 190_aa | cas6f | type I-F CRISPR-associated endoribonuclease Cas6/Csy4 |
| 2790 | CAJPSS010000026.1 | GCA905373435_01391 | CDS | open | 11415-11768 | _na 117_aa | yraN | YraN family protein |
| 2791 | CAJPSS010000026.1 | GCA905373435_01392 | CDS | open | 11783-13300 | _na 505_aa | ATP-dependent protease | |
| 2792 | CAJPSS010000026.1 | GCA905373435_01393 | CDS | open | 13300-14388 | _na 362_aa | dprA | DNA-processing protein DprA |
| 2793 | CAJPSS010000026.1 | GCA905373435_01394 | CDS | open | 14436-16835 | _na 799_aa | topA | type I DNA topoisomerase |
| 2794 | CAJPSS010000026.1 | GCA905373435_01395 | CDS | open | 16835-18133 | _na 432_aa | trmFO | methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO |
| 2795 | CAJPSS010000026.1 | GCA905373435_01396 | CDS | open | 18218-18751 | _na 177_aa | hslV | ATP-dependent protease subunit HslV |
| 2796 | CAJPSS010000026.1 | GCA905373435_01397 | CDS | open | 18748-20109 | _na 453_aa | hslU | ATP-dependent protease ATPase subunit HslU |
| 2797 | CAJPSS010000026.1 | GCA905373435_01398 | CDS | open | 20235-21224 | _na 329_aa | birA | Bifunctional ligase/repressor BirA |
| 2798 | CAJPSS010000026.1 | GCA905373435_01399 | CDS | open | 21250-21813 | _na 187_aa | Biotin transporter | |
| 2799 | CAJPSS010000026.1 | GCA905373435_01400 | CDS | open | 21966-22754 | _na 262_aa | type III pantothenate kinase | |
| 2800 | CAJPSS010000026.1 | GCA905373435_01383 | gene | open | 859-1281 | rhuM | ||
| 2801 | CAJPSS010000026.1 | GCA905373435_01384 | gene | open | 1492-2031 | cas1f | ||
| 2802 | CAJPSS010000026.1 | GCA905373435_01385 | gene | open | 2028-2456 | cas1f | ||
| 2803 | CAJPSS010000026.1 | GCA905373435_01386 | gene | open | 2453-5893 | cas3f | ||
| 2804 | CAJPSS010000026.1 | GCA905373435_01387 | gene | open | 5896-7059 | |||
| 2805 | CAJPSS010000026.1 | GCA905373435_01388 | gene | open | 7056-7943 | csy2 | ||
| 2806 | CAJPSS010000026.1 | GCA905373435_01389 | gene | open | 7960-8979 | csy3 | ||
| 2807 | CAJPSS010000026.1 | GCA905373435_01390 | gene | open | 8983-9555 | cas6f | ||
| 2808 | CAJPSS010000026.1 | GCA905373435_01391 | gene | open | 11415-11768 | yraN | ||
| 2809 | CAJPSS010000026.1 | GCA905373435_01392 | gene | open | 11783-13300 | |||
| 2810 | CAJPSS010000026.1 | GCA905373435_01393 | gene | open | 13300-14388 | dprA | ||
| 2811 | CAJPSS010000026.1 | GCA905373435_01394 | gene | open | 14436-16835 | topA | ||
| 2812 | CAJPSS010000026.1 | GCA905373435_01395 | gene | open | 16835-18133 | trmFO | ||
| 2813 | CAJPSS010000026.1 | GCA905373435_01396 | gene | open | 18218-18751 | hslV | ||
| 2814 | CAJPSS010000026.1 | GCA905373435_01397 | gene | open | 18748-20109 | hslU | ||
| 2815 | CAJPSS010000026.1 | GCA905373435_01398 | gene | open | 20235-21224 | birA | ||
| 2816 | CAJPSS010000026.1 | GCA905373435_01399 | gene | open | 21250-21813 | |||
| 2817 | CAJPSS010000026.1 | GCA905373435_01400 | gene | open | 21966-22754 | |||
| 2818 | CAJPSS010000026.1 | GCA905373435_01401 | gene | open | 22802-22877 | trnE | ||
| 2819 | CAJPSS010000026.1 | GCA905373435_01401 | tRNA | open | 22802-22877 | trnE | tRNA-Glu(ctc) | |
| 2820 | CAJPSS010000027.1 | GCA905373435_01402 | CDS | open | 454-1767 | _na 437_aa | Sel1 repeat family protein | |
| 2821 | CAJPSS010000027.1 | GCA905373435_01403 | CDS | open | 1974-2753 | _na 259_aa | Metal cation transporter%2C ZIP family | |
| 2822 | CAJPSS010000027.1 | GCA905373435_01404 | CDS | open | 2902-3339 | _na 145_aa | DUF1934 domain-containing protein | |
| 2823 | CAJPSS010000027.1 | GCA905373435_01405 | CDS | open | 3318-4982 | _na 554_aa | argS | arginine--tRNA ligase |
| 2824 | CAJPSS010000027.1 | GCA905373435_01406 | CDS | open | 4993-6609 | _na 538_aa | CTP synthase | |
| 2825 | CAJPSS010000027.1 | GCA905373435_01407 | CDS | open | 6830-7549 | _na 239_aa | nikM | Nickel transport complex%2C NikM subunit%2C transmembrane |
| 2826 | CAJPSS010000027.1 | GCA905373435_01408 | CDS | open | 7727-8140 | _na 137_aa | Surface-adhesin protein E-like domain-containing protein | |
| 2827 | CAJPSS010000027.1 | GCA905373435_01409 | CDS | open | 8143-9063 | _na 306_aa | Radical SAM core domain-containing protein | |
| 2828 | CAJPSS010000027.1 | GCA905373435_01410 | CDS | open | 9242-10102 | _na 286_aa | 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase | |
| 2829 | CAJPSS010000027.1 | GCA905373435_01411 | CDS | open | 10709-11941 | _na 410_aa | S-layer-like y domain-containing protein | |
| 2830 | CAJPSS010000027.1 | GCA905373435_01412 | CDS | open | 12113-13933 | _na 606_aa | Outer membrane protein alpha | |
| 2831 | CAJPSS010000027.1 | GCA905373435_01413 | CDS | open | 14178-14690 | _na 170_aa | thiW | energy coupling factor transporter S component ThiW |
| 2832 | CAJPSS010000027.1 | GCA905373435_01414 | CDS | open | 14811-15284 | _na 157_aa | Pyridoxamine 5'-phosphate oxidase family protein | |
| 2833 | CAJPSS010000027.1 | GCA905373435_01415 | CDS | open | 15367-16800 | _na 477_aa | Putative permease | |
| 2834 | CAJPSS010000027.1 | GCA905373435_01416 | CDS | open | 16904-17827 | _na 307_aa | Radical SAM domain protein | |
| 2835 | CAJPSS010000027.1 | GCA905373435_01417 | CDS | open | 17898-18278 | _na 126_aa | Dihydrolipoamide acyltransferase | |
| 2836 | CAJPSS010000027.1 | GCA905373435_01418 | CDS | open | 18427-19452 | _na 341_aa | Endolytic murein transglycosylase | |
| 2837 | CAJPSS010000027.1 | GCA905373435_01419 | CDS | open | 19436-20047 | _na 203_aa | O-methyltransferase | |
| 2838 | CAJPSS010000027.1 | GCA905373435_01420 | CDS | open | 20075-21295 | _na 406_aa | Peptidase%2C U32 family | |
| 2839 | CAJPSS010000027.1 | GCA905373435_01421 | CDS | open | 21288-21521 | _na 77_aa | DUF4911 domain-containing protein | |
| 2840 | CAJPSS010000027.1 | GCA905373435_01422 | CDS | open | 21580-21981 | _na 133_aa | Pyridoxamine 5'-phosphate oxidase family protein | |
| 2841 | CAJPSS010000027.1 | GCA905373435_01402 | gene | open | 454-1767 | |||
| 2842 | CAJPSS010000027.1 | GCA905373435_01403 | gene | open | 1974-2753 | |||
| 2843 | CAJPSS010000027.1 | GCA905373435_01404 | gene | open | 2902-3339 | |||
| 2844 | CAJPSS010000027.1 | GCA905373435_01405 | gene | open | 3318-4982 | argS | ||
| 2845 | CAJPSS010000027.1 | GCA905373435_01406 | gene | open | 4993-6609 | |||
| 2846 | CAJPSS010000027.1 | GCA905373435_01407 | gene | open | 6830-7549 | nikM | ||
| 2847 | CAJPSS010000027.1 | GCA905373435_01408 | gene | open | 7727-8140 | |||
| 2848 | CAJPSS010000027.1 | GCA905373435_01409 | gene | open | 8143-9063 | |||
| 2849 | CAJPSS010000027.1 | GCA905373435_01410 | gene | open | 9242-10102 | |||
| 2850 | CAJPSS010000027.1 | GCA905373435_01411 | gene | open | 10709-11941 | |||
| 2851 | CAJPSS010000027.1 | GCA905373435_01412 | gene | open | 12113-13933 | |||
| 2852 | CAJPSS010000027.1 | GCA905373435_01413 | gene | open | 14178-14690 | thiW | ||
| 2853 | CAJPSS010000027.1 | GCA905373435_01414 | gene | open | 14811-15284 | |||
| 2854 | CAJPSS010000027.1 | GCA905373435_01415 | gene | open | 15367-16800 | |||
| 2855 | CAJPSS010000027.1 | GCA905373435_01416 | gene | open | 16904-17827 | |||
| 2856 | CAJPSS010000027.1 | GCA905373435_01417 | gene | open | 17898-18278 | |||
| 2857 | CAJPSS010000027.1 | GCA905373435_01418 | gene | open | 18427-19452 | |||
| 2858 | CAJPSS010000027.1 | GCA905373435_01419 | gene | open | 19436-20047 | |||
| 2859 | CAJPSS010000027.1 | GCA905373435_01420 | gene | open | 20075-21295 | |||
| 2860 | CAJPSS010000027.1 | GCA905373435_01421 | gene | open | 21288-21521 | |||
| 2861 | CAJPSS010000027.1 | GCA905373435_01422 | gene | open | 21580-21981 | |||
| 2862 | CAJPSS010000028.1 | GCA905373435_01423 | CDS | open | 66-548 | _na 160_aa | fabZ | 3-hydroxyacyl-ACP dehydratase FabZ |
| 2863 | CAJPSS010000028.1 | GCA905373435_01424 | CDS | open | 559-1302 | _na 247_aa | lpxC | UDP-3-O-acyl-N-acetylglucosamine deacetylase |
| 2864 | CAJPSS010000028.1 | GCA905373435_01425 | CDS | open | 1564-2370 | _na 268_aa | larE | ATP-dependent sacrificial sulfur transferase LarE |
| 2865 | CAJPSS010000028.1 | GCA905373435_01426 | CDS | open | 2372-3142 | _na 256_aa | larB | nickel pincer cofactor biosynthesis protein LarB |
| 2866 | CAJPSS010000028.1 | GCA905373435_01427 | CDS | open | 3090-4481 | _na 463_aa | larC | nickel pincer cofactor biosynthesis protein LarC |
| 2867 | CAJPSS010000028.1 | GCA905373435_01428 | CDS | open | 4584-5498 | _na 304_aa | rarD | EamA family transporter RarD |
| 2868 | CAJPSS010000028.1 | GCA905373435_01429 | CDS | open | 5512-6261 | _na 249_aa | Uridine phosphorylase | |
| 2869 | CAJPSS010000028.1 | GCA905373435_01430 | CDS | open | 6272-6541 | _na 89_aa | DUF1294 domain-containing protein | |
| 2870 | CAJPSS010000028.1 | GCA905373435_01431 | CDS | open | 6830-9685 | _na 951_aa | ileS | isoleucine--tRNA ligase |
| 2871 | CAJPSS010000028.1 | GCA905373435_01432 | CDS | open | 9867-10601 | _na 244_aa | Cytosolic protein | |
| 2872 | CAJPSS010000028.1 | GCA905373435_01433 | CDS | open | 10814-11239 | _na 141_aa | Hsp20/alpha crystallin family protein | |
| 2873 | CAJPSS010000028.1 | GCA905373435_01434 | CDS | open | 11283-12008 | _na 241_aa | grpB | GrpB family protein |
| 2874 | CAJPSS010000028.1 | GCA905373435_01435 | CDS | open | 12191-13189 | _na 332_aa | bioB | biotin synthase BioB |
| 2875 | CAJPSS010000028.1 | GCA905373435_01436 | CDS | open | 13622-15796 | _na 724_aa | TonB-dependent siderophore receptor | |
| 2876 | CAJPSS010000028.1 | GCA905373435_01437 | CDS | open | 15878-17443 | _na 521_aa | ABC transporter substrate-binding protein | |
| 2877 | CAJPSS010000028.1 | GCA905373435_01438 | CDS | open | 17440-18390 | _na 316_aa | ABC transporter%2C permease protein | |
| 2878 | CAJPSS010000028.1 | GCA905373435_01439 | CDS | open | 18387-19226 | _na 279_aa | ABC transporter%2C permease protein | |
| 2879 | CAJPSS010000028.1 | GCA905373435_01440 | CDS | open | 19229-20167 | _na 312_aa | nikD | Nickel import system ATP-binding protein NikD |
| 2880 | CAJPSS010000028.1 | GCA905373435_01423 | gene | open | 66-548 | fabZ | ||
| 2881 | CAJPSS010000028.1 | GCA905373435_01424 | gene | open | 559-1302 | lpxC | ||
| 2882 | CAJPSS010000028.1 | GCA905373435_01425 | gene | open | 1564-2370 | larE | ||
| 2883 | CAJPSS010000028.1 | GCA905373435_01426 | gene | open | 2372-3142 | larB | ||
| 2884 | CAJPSS010000028.1 | GCA905373435_01427 | gene | open | 3090-4481 | larC | ||
| 2885 | CAJPSS010000028.1 | GCA905373435_01428 | gene | open | 4584-5498 | rarD | ||
| 2886 | CAJPSS010000028.1 | GCA905373435_01429 | gene | open | 5512-6261 | |||
| 2887 | CAJPSS010000028.1 | GCA905373435_01430 | gene | open | 6272-6541 | |||
| 2888 | CAJPSS010000028.1 | GCA905373435_01431 | gene | open | 6830-9685 | ileS | ||
| 2889 | CAJPSS010000028.1 | GCA905373435_01432 | gene | open | 9867-10601 | |||
| 2890 | CAJPSS010000028.1 | GCA905373435_01433 | gene | open | 10814-11239 | |||
| 2891 | CAJPSS010000028.1 | GCA905373435_01434 | gene | open | 11283-12008 | grpB | ||
| 2892 | CAJPSS010000028.1 | GCA905373435_01435 | gene | open | 12191-13189 | bioB | ||
| 2893 | CAJPSS010000028.1 | GCA905373435_01436 | gene | open | 13622-15796 | |||
| 2894 | CAJPSS010000028.1 | GCA905373435_01437 | gene | open | 15878-17443 | |||
| 2895 | CAJPSS010000028.1 | GCA905373435_01438 | gene | open | 17440-18390 | |||
| 2896 | CAJPSS010000028.1 | GCA905373435_01439 | gene | open | 18387-19226 | |||
| 2897 | CAJPSS010000028.1 | GCA905373435_01440 | gene | open | 19229-20167 | nikD | ||
| 2898 | CAJPSS010000029.1 | regulatory_region | open | 12755-12922 | Cobalamin riboswitch aptamer | |||
| 2899 | CAJPSS010000029.1 | regulatory_region | open | 19611-19785 | Cobalamin riboswitch aptamer | |||
| 2900 | CAJPSS010000029.1 | regulatory_region | open | 19880-20054 | Cobalamin riboswitch aptamer | |||
| 2901 | CAJPSS010000029.1 | GCA905373435_01441 | CDS | open | 84-461 | _na 125_aa | HicB-like antitoxin of toxin-antitoxin system domain-containing protein | |
| 2902 | CAJPSS010000029.1 | GCA905373435_01442 | CDS | open | 683-1324 | _na 213_aa | Peptidase%2C M50 family | |
| 2903 | CAJPSS010000029.1 | GCA905373435_01443 | CDS | open | 1340-2002 | _na 220_aa | Glycine transporter domain-containing protein | |
| 2904 | CAJPSS010000029.1 | GCA905373435_01444 | CDS | open | 2090-3316 | _na 408_aa | O-antigen ligase family protein | |
| 2905 | CAJPSS010000029.1 | GCA905373435_01445 | CDS | open | 3616-5172 | _na 518_aa | Succinate CoA transferase | |
| 2906 | CAJPSS010000029.1 | GCA905373435_01446 | CDS | open | 5454-7100 | _na 548_aa | Methylmalonyl-CoA mutase domain protein | |
| 2907 | CAJPSS010000029.1 | GCA905373435_01447 | CDS | open | 7131-7523 | _na 130_aa | sbm | Methylmalonyl-CoA mutase domain-containing protein |
| 2908 | CAJPSS010000029.1 | GCA905373435_01448 | CDS | open | 7626-8564 | _na 312_aa | meaB | methylmalonyl Co-A mutase-associated GTPase MeaB |
| 2909 | CAJPSS010000029.1 | GCA905373435_01449 | CDS | open | 8583-9020 | _na 145_aa | Methylmalonyl-CoA epimerase | |
| 2910 | CAJPSS010000029.1 | GCA905373435_01450 | CDS | open | 9094-10623 | _na 509_aa | mmdA | Methylmalonyl-CoA decarboxylase alpha subunit |
| 2911 | CAJPSS010000029.1 | GCA905373435_01451 | CDS | open | 10666-10968 | _na 100_aa | Sodium pump decarboxylase%2C gamma subunit | |
| 2912 | CAJPSS010000029.1 | GCA905373435_01452 | CDS | open | 11005-11415 | _na 136_aa | accB | Glutaconyl-CoA decarboxylase subunit gamma |
| 2913 | CAJPSS010000029.1 | GCA905373435_01453 | CDS | open | 11858-11980 | _na 40_aa | hypothetical protein | |
| 2914 | CAJPSS010000029.1 | GCA905373435_01454 | CDS | open | 12043-12543 | _na 166_aa | Methylmalonyl-CoA mutase | |
| 2915 | CAJPSS010000029.1 | GCA905373435_01455 | CDS | open | 13169-15445 | _na 758_aa | methylmalonyl-CoA mutase | |
| 2916 | CAJPSS010000029.1 | GCA905373435_01456 | CDS | open | 15447-17642 | _na 731_aa | scpA | methylmalonyl-CoA mutase |
| 2917 | CAJPSS010000029.1 | GCA905373435_01457 | CDS | open | 17653-18831 | _na 392_aa | meaB | methylmalonyl Co-A mutase-associated GTPase MeaB |
| 2918 | CAJPSS010000029.1 | GCA905373435_01458 | CDS | open | 18950-19522 | _na 190_aa | peptide-methionine (S)-S-oxide reductase | |
| 2919 | CAJPSS010000029.1 | GCA905373435_01441 | gene | open | 84-461 | |||
| 2920 | CAJPSS010000029.1 | GCA905373435_01442 | gene | open | 683-1324 | |||
| 2921 | CAJPSS010000029.1 | GCA905373435_01443 | gene | open | 1340-2002 | |||
| 2922 | CAJPSS010000029.1 | GCA905373435_01444 | gene | open | 2090-3316 | |||
| 2923 | CAJPSS010000029.1 | GCA905373435_01445 | gene | open | 3616-5172 | |||
| 2924 | CAJPSS010000029.1 | GCA905373435_01446 | gene | open | 5454-7100 | |||
| 2925 | CAJPSS010000029.1 | GCA905373435_01447 | gene | open | 7131-7523 | sbm | ||
| 2926 | CAJPSS010000029.1 | GCA905373435_01448 | gene | open | 7626-8564 | meaB | ||
| 2927 | CAJPSS010000029.1 | GCA905373435_01449 | gene | open | 8583-9020 | |||
| 2928 | CAJPSS010000029.1 | GCA905373435_01450 | gene | open | 9094-10623 | mmdA | ||
| 2929 | CAJPSS010000029.1 | GCA905373435_01451 | gene | open | 10666-10968 | |||
| 2930 | CAJPSS010000029.1 | GCA905373435_01452 | gene | open | 11005-11415 | accB | ||
| 2931 | CAJPSS010000029.1 | GCA905373435_01453 | gene | open | 11858-11980 | |||
| 2932 | CAJPSS010000029.1 | GCA905373435_01454 | gene | open | 12043-12543 | |||
| 2933 | CAJPSS010000029.1 | GCA905373435_01455 | gene | open | 13169-15445 | |||
| 2934 | CAJPSS010000029.1 | GCA905373435_01456 | gene | open | 15447-17642 | scpA | ||
| 2935 | CAJPSS010000029.1 | GCA905373435_01457 | gene | open | 17653-18831 | meaB | ||
| 2936 | CAJPSS010000029.1 | GCA905373435_01458 | gene | open | 18950-19522 | |||
| 2937 | CAJPSS010000030.1 | GCA905373435_01459 | CDS | open | 807-2210 | _na 467_aa | potE | putrescine-ornithine antiporter |
| 2938 | CAJPSS010000030.1 | GCA905373435_01460 | CDS | open | 2291-2908 | _na 205_aa | hypothetical protein | |
| 2939 | CAJPSS010000030.1 | GCA905373435_01461 | CDS | open | 2930-3571 | _na 213_aa | upp | uracil phosphoribosyltransferase |
| 2940 | CAJPSS010000030.1 | GCA905373435_01462 | CDS | open | 3659-4510 | _na 283_aa | yihY | YihY family protein |
| 2941 | CAJPSS010000030.1 | GCA905373435_01463 | CDS | open | 4639-6465 | _na 608_aa | typA | translational GTPase TypA |
| 2942 | CAJPSS010000030.1 | GCA905373435_01464 | CDS | open | 6708-7160 | _na 150_aa | Universal stress family protein | |
| 2943 | CAJPSS010000030.1 | GCA905373435_01465 | CDS | open | 7195-7635 | _na 146_aa | Universal stress family protein | |
| 2944 | CAJPSS010000030.1 | GCA905373435_01466 | CDS | open | 7775-8164 | _na 129_aa | Universal stress family protein | |
| 2945 | CAJPSS010000030.1 | GCA905373435_01467 | CDS | open | 8245-11295 | _na 1016_aa | RND transporter%2C HAE1/HME family%2C permease protein | |
| 2946 | CAJPSS010000030.1 | GCA905373435_01468 | CDS | open | 11292-12356 | _na 354_aa | Efflux transporter%2C RND family%2C MFP subunit | |
| 2947 | CAJPSS010000030.1 | GCA905373435_01469 | CDS | open | 12497-13093 | _na 198_aa | HTH tetR-type domain-containing protein | |
| 2948 | CAJPSS010000030.1 | GCA905373435_01470 | CDS | open | 13090-13887 | _na 265_aa | truA | tRNA pseudouridine(38-40) synthase TruA |
| 2949 | CAJPSS010000030.1 | GCA905373435_01471 | CDS | open | 13953-14759 | _na 268_aa | ecfT | Energy-coupling factor transporter transmembrane protein EcfT |
| 2950 | CAJPSS010000030.1 | GCA905373435_01472 | CDS | open | 14759-15619 | _na 286_aa | energy-coupling factor transporter ATPase | |
| 2951 | CAJPSS010000030.1 | GCA905373435_01473 | CDS | open | 15595-16458 | _na 287_aa | energy-coupling factor transporter ATPase | |
| 2952 | CAJPSS010000030.1 | GCA905373435_01474 | CDS | open | 16535-16702 | _na 55_aa | hypothetical protein | |
| 2953 | CAJPSS010000030.1 | GCA905373435_01475 | CDS | open | 16742-17503 | _na 253_aa | HAD hydrolase%2C family IIB | |
| 2954 | CAJPSS010000030.1 | GCA905373435_01476 | CDS | open | 17678-19477 | _na 599_aa | Sulfatase N-terminal domain-containing protein | |
| 2955 | CAJPSS010000030.1 | GCA905373435_01477 | CDS | open | 19711-20181 | _na 156_aa | lysR | Transcriptional regulator%2C LysR family |
| 2956 | CAJPSS010000030.1 | GCA905373435_01459 | gene | open | 807-2210 | potE | ||
| 2957 | CAJPSS010000030.1 | GCA905373435_01460 | gene | open | 2291-2908 | |||
| 2958 | CAJPSS010000030.1 | GCA905373435_01461 | gene | open | 2930-3571 | upp | ||
| 2959 | CAJPSS010000030.1 | GCA905373435_01462 | gene | open | 3659-4510 | yihY | ||
| 2960 | CAJPSS010000030.1 | GCA905373435_01463 | gene | open | 4639-6465 | typA | ||
| 2961 | CAJPSS010000030.1 | GCA905373435_01464 | gene | open | 6708-7160 | |||
| 2962 | CAJPSS010000030.1 | GCA905373435_01465 | gene | open | 7195-7635 | |||
| 2963 | CAJPSS010000030.1 | GCA905373435_01466 | gene | open | 7775-8164 | |||
| 2964 | CAJPSS010000030.1 | GCA905373435_01467 | gene | open | 8245-11295 | |||
| 2965 | CAJPSS010000030.1 | GCA905373435_01468 | gene | open | 11292-12356 | |||
| 2966 | CAJPSS010000030.1 | GCA905373435_01469 | gene | open | 12497-13093 | |||
| 2967 | CAJPSS010000030.1 | GCA905373435_01470 | gene | open | 13090-13887 | truA | ||
| 2968 | CAJPSS010000030.1 | GCA905373435_01471 | gene | open | 13953-14759 | ecfT | ||
| 2969 | CAJPSS010000030.1 | GCA905373435_01472 | gene | open | 14759-15619 | |||
| 2970 | CAJPSS010000030.1 | GCA905373435_01473 | gene | open | 15595-16458 | |||
| 2971 | CAJPSS010000030.1 | GCA905373435_01474 | gene | open | 16535-16702 | |||
| 2972 | CAJPSS010000030.1 | GCA905373435_01475 | gene | open | 16742-17503 | |||
| 2973 | CAJPSS010000030.1 | GCA905373435_01476 | gene | open | 17678-19477 | |||
| 2974 | CAJPSS010000030.1 | GCA905373435_01477 | gene | open | 19711-20181 | lysR | ||
| 2975 | CAJPSS010000031.1 | GCA905373435_01478 | CDS | open | 424-552 | _na 42_aa | hypothetical protein | |
| 2976 | CAJPSS010000031.1 | GCA905373435_01479 | CDS | open | 602-1684 | _na 360_aa | Fic family protein | |
| 2977 | CAJPSS010000031.1 | GCA905373435_01480 | CDS | open | 2050-3039 | _na 329_aa | RND efflux pump membrane fusion protein barrel-sandwich domain-containing protein | |
| 2978 | CAJPSS010000031.1 | GCA905373435_01481 | CDS | open | 3079-4833 | _na 584_aa | lptB | LPS export ABC transporter ATP-binding protein |
| 2979 | CAJPSS010000031.1 | GCA905373435_01482 | CDS | open | 4830-5954 | _na 374_aa | ABC transmembrane type-2 domain-containing protein | |
| 2980 | CAJPSS010000031.1 | GCA905373435_01483 | CDS | open | 5954-7069 | _na 371_aa | Transport permease protein | |
| 2981 | CAJPSS010000031.1 | GCA905373435_01484 | CDS | open | 7080-7724 | _na 214_aa | tetR | Transcriptional regulator%2C TetR family |
| 2982 | CAJPSS010000031.1 | GCA905373435_01485 | CDS | open | 7727-8107 | _na 126_aa | PABS domain-containing protein | |
| 2983 | CAJPSS010000031.1 | GCA905373435_01486 | CDS | open | 8315-8614 | _na 99_aa | hypothetical protein | |
| 2984 | CAJPSS010000031.1 | GCA905373435_01487 | CDS | open | 8984-9760 | _na 258_aa | tatD | Hydrolase%2C TatD family |
| 2985 | CAJPSS010000031.1 | GCA905373435_01488 | CDS | open | 9849-10430 | _na 193_aa | alpha/beta hydrolase | |
| 2986 | CAJPSS010000031.1 | GCA905373435_01489 | CDS | open | 10455-11102 | _na 215_aa | Peptidase family S51 | |
| 2987 | CAJPSS010000031.1 | GCA905373435_01490 | CDS | open | 11452-12933 | _na 493_aa | Aldehyde dehydrogenase (NAD) family protein | |
| 2988 | CAJPSS010000031.1 | GCA905373435_01491 | CDS | open | 13014-13526 | _na 170_aa | Flavin reductase like domain-containing protein | |
| 2989 | CAJPSS010000031.1 | GCA905373435_01492 | CDS | open | 13710-14924 | _na 404_aa | Transporter%2C major facilitator family protein | |
| 2990 | CAJPSS010000031.1 | GCA905373435_01493 | CDS | open | 14925-15878 | _na 317_aa | AB hydrolase-1 domain-containing protein | |
| 2991 | CAJPSS010000031.1 | GCA905373435_01494 | CDS | open | 15923-16915 | _na 330_aa | deoxyguanosinetriphosphate triphosphohydrolase | |
| 2992 | CAJPSS010000031.1 | GCA905373435_01495 | CDS | open | 17111-17341 | _na 76_aa | hypothetical protein | |
| 2993 | CAJPSS010000031.1 | GCA905373435_01496 | CDS | open | 17508-17888 | _na 126_aa | hypothetical protein | |
| 2994 | CAJPSS010000031.1 | GCA905373435_01497 | CDS | open | 18095-19612 | _na 505_aa | Dolichyl-phosphate-mannose-protein mannosyltransferase | |
| 2995 | CAJPSS010000031.1 | GCA905373435_01478 | gene | open | 424-552 | |||
| 2996 | CAJPSS010000031.1 | GCA905373435_01479 | gene | open | 602-1684 | |||
| 2997 | CAJPSS010000031.1 | GCA905373435_01480 | gene | open | 2050-3039 | |||
| 2998 | CAJPSS010000031.1 | GCA905373435_01481 | gene | open | 3079-4833 | lptB | ||
| 2999 | CAJPSS010000031.1 | GCA905373435_01482 | gene | open | 4830-5954 | |||
| 3000 | CAJPSS010000031.1 | GCA905373435_01483 | gene | open | 5954-7069 |

