HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Hallella sp. HMT-376 (GCA_905373545.1)

Select a Genome:
BAKTA Annotations for GCA_905373545.1
Genome Selected: Hallella sp. HMT-376
ContigsBases CDSrRNA tmRNAtRNA
108 2528667 2140 0 0 42
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4374 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:7]    |    Number of Records Found: 4374 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
3001 CAJPTH010000047.1 GCA905373545_01497 gene open 15046-17187
3002 CAJPTH010000047.1 GCA905373545_01498 gene open 17297-18571
3003 CAJPTH010000047.1 GCA905373545_01499 gene open 18573-19223 lptC
3004 CAJPTH010000047.1 GCA905373545_01500 gene open 19247-20389
3005 CAJPTH010000047.1 GCA905373545_01501 gene open 20630-21850
3006 CAJPTH010000047.1 GCA905373545_01502 gene open 21843-23246
3007 CAJPTH010000048.1 GCA905373545_01503 CDS open 767-1723 _na     318_aa Phosphate transport system substrate-binding protein
3008 CAJPTH010000048.1 GCA905373545_01504 CDS open 1731-2573 _na     280_aa tonB Protein TonB
3009 CAJPTH010000048.1 GCA905373545_01505 CDS open 2605-3261 _na     218_aa Biopolymer transport protein ExbD/TolR
3010 CAJPTH010000048.1 GCA905373545_01506 CDS open 3263-3904 _na     213_aa Biopolymer transport protein ExbD/TolR
3011 CAJPTH010000048.1 GCA905373545_01507 CDS open 3935-4771 _na     278_aa exbB Outer membrane transport energization protein ExbB
3012 CAJPTH010000048.1 GCA905373545_01508 CDS open 4964-6157 _na     397_aa Aminotransferase
3013 CAJPTH010000048.1 GCA905373545_01509 CDS open 6263-7474 _na     403_aa bifunctional 3%2C4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II
3014 CAJPTH010000048.1 GCA905373545_01510 CDS open 7514-9424 _na     636_aa YjgP/YjgQ family permease
3015 CAJPTH010000048.1 GCA905373545_01512 CDS open 10048-10824 _na     258_aa amidohydrolase
3016 CAJPTH010000048.1 GCA905373545_01513 CDS open 10838-11383 _na     181_aa Oxidoreductase
3017 CAJPTH010000048.1 GCA905373545_01514 CDS open 11380-11670 _na     96_aa hypothetical protein
3018 CAJPTH010000048.1 GCA905373545_01515 CDS open 11598-12932 _na     444_aa NADP-specific glutamate dehydrogenase
3019 CAJPTH010000048.1 GCA905373545_01516 CDS open 13843-14196 _na     117_aa putative DNA-binding protein%2C MmcQ/YjbR family
3020 CAJPTH010000048.1 GCA905373545_01517 CDS open 14262-15647 _na     461_aa Aldo/keto reductase
3021 CAJPTH010000048.1 GCA905373545_01518 CDS open 15766-16293 _na     175_aa Gamma carbonic anhydrase family protein
3022 CAJPTH010000048.1 GCA905373545_01519 CDS open 16338-16898 _na     186_aa nicotinamidase
3023 CAJPTH010000048.1 GCA905373545_01520 CDS open 17107-18408 _na     433_aa nhaA Na+/H+ antiporter NhaA
3024 CAJPTH010000048.1 GCA905373545_01521 CDS open 18456-18656 _na     66_aa hypothetical protein
3025 CAJPTH010000048.1 GCA905373545_01522 CDS open 18604-18807 _na     67_aa hypothetical protein
3026 CAJPTH010000048.1 GCA905373545_01523 CDS open 18746-19039 _na     97_aa hypothetical protein
3027 CAJPTH010000048.1 GCA905373545_01524 CDS open 19251-19361 _na     36_aa hypothetical protein
3028 CAJPTH010000048.1 GCA905373545_01525 CDS open 19434-19808 _na     124_aa Reactive intermediate/imine deaminase
3029 CAJPTH010000048.1 GCA905373545_01526 CDS open 20043-21350 _na     435_aa eno phosphopyruvate hydratase
3030 CAJPTH010000048.1 GCA905373545_01527 CDS open 21467-21790 _na     107_aa Cupin domain protein
3031 CAJPTH010000048.1 GCA905373545_01528 CDS open 22000-23067 _na     355_aa Alpha/beta hydrolase
3032 CAJPTH010000048.1 GCA905373545_01503 gene open 767-1723
3033 CAJPTH010000048.1 GCA905373545_01504 gene open 1731-2573 tonB
3034 CAJPTH010000048.1 GCA905373545_01505 gene open 2605-3261
3035 CAJPTH010000048.1 GCA905373545_01506 gene open 3263-3904
3036 CAJPTH010000048.1 GCA905373545_01507 gene open 3935-4771 exbB
3037 CAJPTH010000048.1 GCA905373545_01508 gene open 4964-6157
3038 CAJPTH010000048.1 GCA905373545_01509 gene open 6263-7474
3039 CAJPTH010000048.1 GCA905373545_01510 gene open 7514-9424
3040 CAJPTH010000048.1 GCA905373545_01512 gene open 10048-10824
3041 CAJPTH010000048.1 GCA905373545_01513 gene open 10838-11383
3042 CAJPTH010000048.1 GCA905373545_01514 gene open 11380-11670
3043 CAJPTH010000048.1 GCA905373545_01515 gene open 11598-12932
3044 CAJPTH010000048.1 GCA905373545_01516 gene open 13843-14196
3045 CAJPTH010000048.1 GCA905373545_01517 gene open 14262-15647
3046 CAJPTH010000048.1 GCA905373545_01518 gene open 15766-16293
3047 CAJPTH010000048.1 GCA905373545_01519 gene open 16338-16898
3048 CAJPTH010000048.1 GCA905373545_01520 gene open 17107-18408 nhaA
3049 CAJPTH010000048.1 GCA905373545_01521 gene open 18456-18656
3050 CAJPTH010000048.1 GCA905373545_01522 gene open 18604-18807
3051 CAJPTH010000048.1 GCA905373545_01523 gene open 18746-19039
3052 CAJPTH010000048.1 GCA905373545_01524 gene open 19251-19361
3053 CAJPTH010000048.1 GCA905373545_01525 gene open 19434-19808
3054 CAJPTH010000048.1 GCA905373545_01526 gene open 20043-21350 eno
3055 CAJPTH010000048.1 GCA905373545_01527 gene open 21467-21790
3056 CAJPTH010000048.1 GCA905373545_01528 gene open 22000-23067
3057 CAJPTH010000048.1 GCA905373545_01511 gene open 9647-9720 trnM
3058 CAJPTH010000048.1 GCA905373545_01511 tRNA open 9647-9720 trnM tRNA-Met(cat)
3059 CAJPTH010000049.1 GCA905373545_01529 CDS open 366-2399 _na     677_aa Putative endopeptidase
3060 CAJPTH010000049.1 GCA905373545_01530 CDS open 2439-4382 _na     647_aa abc-f ribosomal protection-like ABC-F family protein
3061 CAJPTH010000049.1 GCA905373545_01531 CDS open 4484-6637 _na     717_aa S1 motif domain-containing protein
3062 CAJPTH010000049.1 GCA905373545_01532 CDS open 6682-7032 _na     116_aa VOC domain-containing protein
3063 CAJPTH010000049.1 GCA905373545_01533 CDS open 7143-7487 _na     114_aa rplT 50S ribosomal protein L20
3064 CAJPTH010000049.1 GCA905373545_01534 CDS open 7526-7723 _na     65_aa rpmI 50S ribosomal protein L35
3065 CAJPTH010000049.1 GCA905373545_01535 CDS open 7799-8485 _na     228_aa infC translation initiation factor IF-3
3066 CAJPTH010000049.1 GCA905373545_01536 CDS open 8583-9056 _na     157_aa Outer membrane protein beta-barrel domain-containing protein
3067 CAJPTH010000049.1 GCA905373545_01537 CDS open 9281-9742 _na     153_aa DUF6078 domain-containing protein
3068 CAJPTH010000049.1 GCA905373545_01538 CDS open 9894-11846 _na     650_aa thrS threonine--tRNA ligase
3069 CAJPTH010000049.1 GCA905373545_01539 CDS open 12006-12380 _na     124_aa Outer membrane protein beta-barrel domain-containing protein
3070 CAJPTH010000049.1 GCA905373545_01540 CDS open 12377-14350 _na     657_aa Tetratricopeptide repeat protein
3071 CAJPTH010000049.1 GCA905373545_01541 CDS open 14361-14918 _na     185_aa def peptide deformylase
3072 CAJPTH010000049.1 GCA905373545_01542 CDS open 14973-15386 _na     137_aa ruvX Holliday junction resolvase RuvX
3073 CAJPTH010000049.1 GCA905373545_01543 CDS open 15390-15884 _na     164_aa Sporulation related domain-containing protein
3074 CAJPTH010000049.1 GCA905373545_01544 CDS open 16128-16346 _na     72_aa ytxH YtxH domain-containing protein
3075 CAJPTH010000049.1 GCA905373545_01545 CDS open 16356-16706 _na     116_aa Phage holin family protein
3076 CAJPTH010000049.1 GCA905373545_01546 CDS open 16711-16992 _na     93_aa hypothetical protein
3077 CAJPTH010000049.1 GCA905373545_01547 CDS open 17349-18110 _na     253_aa Lipoate--protein ligase
3078 CAJPTH010000049.1 GCA905373545_01548 CDS open 18107-19132 _na     341_aa murB UDP-N-acetylmuramate dehydrogenase
3079 CAJPTH010000049.1 GCA905373545_01549 CDS open 19133-19963 _na     276_aa DUF4348 domain-containing protein
3080 CAJPTH010000049.1 GCA905373545_01550 CDS open 20116-21153 _na     345_aa pheS phenylalanine--tRNA ligase subunit alpha
3081 CAJPTH010000049.1 GCA905373545_01551 CDS open 21155-21673 _na     172_aa GNAT family acetyltransferase
3082 CAJPTH010000049.1 GCA905373545_01552 CDS open 21726-21854 _na     42_aa hypothetical protein
3083 CAJPTH010000049.1 GCA905373545_01529 gene open 366-2399
3084 CAJPTH010000049.1 GCA905373545_01530 gene open 2439-4382 abc-f
3085 CAJPTH010000049.1 GCA905373545_01531 gene open 4484-6637
3086 CAJPTH010000049.1 GCA905373545_01532 gene open 6682-7032
3087 CAJPTH010000049.1 GCA905373545_01533 gene open 7143-7487 rplT
3088 CAJPTH010000049.1 GCA905373545_01534 gene open 7526-7723 rpmI
3089 CAJPTH010000049.1 GCA905373545_01535 gene open 7799-8485 infC
3090 CAJPTH010000049.1 GCA905373545_01536 gene open 8583-9056
3091 CAJPTH010000049.1 GCA905373545_01537 gene open 9281-9742
3092 CAJPTH010000049.1 GCA905373545_01538 gene open 9894-11846 thrS
3093 CAJPTH010000049.1 GCA905373545_01539 gene open 12006-12380
3094 CAJPTH010000049.1 GCA905373545_01540 gene open 12377-14350
3095 CAJPTH010000049.1 GCA905373545_01541 gene open 14361-14918 def
3096 CAJPTH010000049.1 GCA905373545_01542 gene open 14973-15386 ruvX
3097 CAJPTH010000049.1 GCA905373545_01543 gene open 15390-15884
3098 CAJPTH010000049.1 GCA905373545_01544 gene open 16128-16346 ytxH
3099 CAJPTH010000049.1 GCA905373545_01545 gene open 16356-16706
3100 CAJPTH010000049.1 GCA905373545_01546 gene open 16711-16992
3101 CAJPTH010000049.1 GCA905373545_01547 gene open 17349-18110
3102 CAJPTH010000049.1 GCA905373545_01548 gene open 18107-19132 murB
3103 CAJPTH010000049.1 GCA905373545_01549 gene open 19133-19963
3104 CAJPTH010000049.1 GCA905373545_01550 gene open 20116-21153 pheS
3105 CAJPTH010000049.1 GCA905373545_01551 gene open 21155-21673
3106 CAJPTH010000049.1 GCA905373545_01552 gene open 21726-21854
3107 CAJPTH010000050.1 GCA905373545_01553 CDS open 69-1904 _na     611_aa Gylcosyl hydrolase 115 C-terminal domain-containing protein
3108 CAJPTH010000050.1 GCA905373545_01554 CDS open 1923-2693 _na     256_aa trmB tRNA (guanosine(46)-N7)-methyltransferase TrmB
3109 CAJPTH010000050.1 GCA905373545_01555 CDS open 2700-3716 _na     338_aa branched-chain amino acid aminotransferase
3110 CAJPTH010000050.1 GCA905373545_01556 CDS open 3797-3988 _na     63_aa xseB exodeoxyribonuclease VII small subunit
3111 CAJPTH010000050.1 GCA905373545_01557 CDS open 3994-5289 _na     431_aa xseA exodeoxyribonuclease VII large subunit
3112 CAJPTH010000050.1 GCA905373545_01558 CDS open 5296-6669 _na     457_aa Serine protease
3113 CAJPTH010000050.1 GCA905373545_01559 CDS open 6794-8179 _na     461_aa mepA Multidrug export protein MepA
3114 CAJPTH010000050.1 GCA905373545_01560 CDS open 8154-8777 _na     207_aa Cytidylate kinase
3115 CAJPTH010000050.1 GCA905373545_01561 CDS open 8925-9437 _na     170_aa Phosphoesterase
3116 CAJPTH010000050.1 GCA905373545_01562 CDS open 9530-10678 _na     382_aa rfbB dTDP-glucose 4%2C6-dehydratase
3117 CAJPTH010000050.1 GCA905373545_01563 CDS open 10706-11875 _na     389_aa purT formate-dependent phosphoribosylglycinamide formyltransferase
3118 CAJPTH010000050.1 GCA905373545_01564 CDS open 11872-12279 _na     135_aa qdtA Sugar 3%2C4-ketoisomerase QdtA cupin domain-containing protein
3119 CAJPTH010000050.1 GCA905373545_01565 CDS open 12267-13205 _na     312_aa GNAT family N-acetyltransferase
3120 CAJPTH010000050.1 GCA905373545_01566 CDS open 13202-14302 _na     366_aa Aminotransferase
3121 CAJPTH010000050.1 GCA905373545_01567 CDS open 14305-14934 _na     209_aa Deoxyadenosine/deoxycytidine kinase
3122 CAJPTH010000050.1 GCA905373545_01568 CDS open 14950-15579 _na     209_aa Deoxyadenosine/deoxycytidine kinase
3123 CAJPTH010000050.1 GCA905373545_01569 CDS open 15934-17922 _na     662_aa DNA topoisomerase
3124 CAJPTH010000050.1 GCA905373545_01570 CDS open 17923-20082 _na     719_aa OmpA-like domain-containing protein
3125 CAJPTH010000050.1 GCA905373545_01571 CDS open 20122-20463 _na     113_aa DUF5056 domain-containing protein
3126 CAJPTH010000050.1 GCA905373545_01572 CDS open 20450-20992 _na     180_aa RNA polymerase sigma factor
3127 CAJPTH010000050.1 GCA905373545_01573 CDS open 21002-21661 _na     219_aa DUF6249 domain-containing protein
3128 CAJPTH010000050.1 GCA905373545_01553 gene open 69-1904
3129 CAJPTH010000050.1 GCA905373545_01554 gene open 1923-2693 trmB
3130 CAJPTH010000050.1 GCA905373545_01555 gene open 2700-3716
3131 CAJPTH010000050.1 GCA905373545_01556 gene open 3797-3988 xseB
3132 CAJPTH010000050.1 GCA905373545_01557 gene open 3994-5289 xseA
3133 CAJPTH010000050.1 GCA905373545_01558 gene open 5296-6669
3134 CAJPTH010000050.1 GCA905373545_01559 gene open 6794-8179 mepA
3135 CAJPTH010000050.1 GCA905373545_01560 gene open 8154-8777
3136 CAJPTH010000050.1 GCA905373545_01561 gene open 8925-9437
3137 CAJPTH010000050.1 GCA905373545_01562 gene open 9530-10678 rfbB
3138 CAJPTH010000050.1 GCA905373545_01563 gene open 10706-11875 purT
3139 CAJPTH010000050.1 GCA905373545_01564 gene open 11872-12279 qdtA
3140 CAJPTH010000050.1 GCA905373545_01565 gene open 12267-13205
3141 CAJPTH010000050.1 GCA905373545_01566 gene open 13202-14302
3142 CAJPTH010000050.1 GCA905373545_01567 gene open 14305-14934
3143 CAJPTH010000050.1 GCA905373545_01568 gene open 14950-15579
3144 CAJPTH010000050.1 GCA905373545_01569 gene open 15934-17922
3145 CAJPTH010000050.1 GCA905373545_01570 gene open 17923-20082
3146 CAJPTH010000050.1 GCA905373545_01571 gene open 20122-20463
3147 CAJPTH010000050.1 GCA905373545_01572 gene open 20450-20992
3148 CAJPTH010000050.1 GCA905373545_01573 gene open 21002-21661
3149 CAJPTH010000051.1 GCA905373545_01574 CDS open 286-1149 _na     287_aa folP dihydropteroate synthase
3150 CAJPTH010000051.1 GCA905373545_01575 CDS open 1183-1959 _na     258_aa cdaA diadenylate cyclase CdaA
3151 CAJPTH010000051.1 GCA905373545_01576 CDS open 2088-3137 _na     349_aa pta phosphate acetyltransferase
3152 CAJPTH010000051.1 GCA905373545_01577 CDS open 3184-4389 _na     401_aa Acetate kinase
3153 CAJPTH010000051.1 GCA905373545_01578 CDS open 4563-5873 _na     436_aa fucP L-fucose:H+ symporter permease
3154 CAJPTH010000051.1 GCA905373545_01579 CDS open 5981-7753 _na     590_aa fucI L-fucose isomerase
3155 CAJPTH010000051.1 GCA905373545_01580 CDS open 7848-8543 _na     231_aa Acylneuraminate cytidylyltransferase
3156 CAJPTH010000051.1 GCA905373545_01581 CDS open 8577-9398 _na     273_aa UDP-2%2C3-diacylglucosamine hydrolase
3157 CAJPTH010000051.1 GCA905373545_01582 CDS open 9489-9809 _na     106_aa FeS assembly SUF system protein
3158 CAJPTH010000051.1 GCA905373545_01583 CDS open 10177-12363 _na     728_aa Glycosyl hydrolase
3159 CAJPTH010000051.1 GCA905373545_01584 CDS open 12380-13063 _na     227_aa radC DNA repair protein RadC
3160 CAJPTH010000051.1 GCA905373545_01585 CDS open 13106-14194 _na     362_aa Glycosyltransferase
3161 CAJPTH010000051.1 GCA905373545_01586 CDS open 14335-14901 _na     188_aa efp elongation factor P
3162 CAJPTH010000051.1 GCA905373545_01587 CDS open 15386-16090 _na     234_aa PASTA domain-containing protein
3163 CAJPTH010000051.1 GCA905373545_01588 CDS open 16099-17166 _na     355_aa Pseudouridine synthase
3164 CAJPTH010000051.1 GCA905373545_01589 CDS open 17166-18170 _na     334_aa D-alanine--D-alanine ligase
3165 CAJPTH010000051.1 GCA905373545_01590 CDS open 18179-19327 _na     382_aa Acyltransferase
3166 CAJPTH010000051.1 GCA905373545_01591 CDS open 19324-19983 _na     219_aa NigD-like C-terminal beta sandwich domain-containing protein
3167 CAJPTH010000051.1 GCA905373545_01592 CDS open 20100-21053 _na     317_aa Nucleoside-diphosphate-sugar epimerase
3168 CAJPTH010000051.1 GCA905373545_01593 CDS open 21239-21658 _na     139_aa hypothetical protein
3169 CAJPTH010000051.1 GCA905373545_01574 gene open 286-1149 folP
3170 CAJPTH010000051.1 GCA905373545_01575 gene open 1183-1959 cdaA
3171 CAJPTH010000051.1 GCA905373545_01576 gene open 2088-3137 pta
3172 CAJPTH010000051.1 GCA905373545_01577 gene open 3184-4389
3173 CAJPTH010000051.1 GCA905373545_01578 gene open 4563-5873 fucP
3174 CAJPTH010000051.1 GCA905373545_01579 gene open 5981-7753 fucI
3175 CAJPTH010000051.1 GCA905373545_01580 gene open 7848-8543
3176 CAJPTH010000051.1 GCA905373545_01581 gene open 8577-9398
3177 CAJPTH010000051.1 GCA905373545_01582 gene open 9489-9809
3178 CAJPTH010000051.1 GCA905373545_01583 gene open 10177-12363
3179 CAJPTH010000051.1 GCA905373545_01584 gene open 12380-13063 radC
3180 CAJPTH010000051.1 GCA905373545_01585 gene open 13106-14194
3181 CAJPTH010000051.1 GCA905373545_01586 gene open 14335-14901 efp
3182 CAJPTH010000051.1 GCA905373545_01587 gene open 15386-16090
3183 CAJPTH010000051.1 GCA905373545_01588 gene open 16099-17166
3184 CAJPTH010000051.1 GCA905373545_01589 gene open 17166-18170
3185 CAJPTH010000051.1 GCA905373545_01590 gene open 18179-19327
3186 CAJPTH010000051.1 GCA905373545_01591 gene open 19324-19983
3187 CAJPTH010000051.1 GCA905373545_01592 gene open 20100-21053
3188 CAJPTH010000051.1 GCA905373545_01593 gene open 21239-21658
3189 CAJPTH010000052.1 GCA905373545_01594 CDS open 619-1620 _na     333_aa luxR Transcriptional regulator%2C LuxR family
3190 CAJPTH010000052.1 GCA905373545_01595 CDS open 1700-4153 _na     817_aa DUF5117 domain-containing protein
3191 CAJPTH010000052.1 GCA905373545_01596 CDS open 4170-6698 _na     842_aa Zinc-dependent metalloprotease
3192 CAJPTH010000052.1 GCA905373545_01597 CDS open 6824-8464 _na     546_aa PKD domain protein
3193 CAJPTH010000052.1 GCA905373545_01598 CDS open 8494-9354 _na     286_aa DUF4843 domain-containing protein
3194 CAJPTH010000052.1 GCA905373545_01599 CDS open 9367-10878 _na     503_aa RagB/SusD family nutrient uptake outer membrane protein
3195 CAJPTH010000052.1 GCA905373545_01600 CDS open 10907-14242 _na     1111_aa SusC/RagA family TonB-linked outer membrane protein
3196 CAJPTH010000052.1 GCA905373545_01601 CDS open 14540-15619 _na     359_aa fecR FecR protein
3197 CAJPTH010000052.1 GCA905373545_01602 CDS open 15677-16174 _na     165_aa RNA polymerase factor sigma-70
3198 CAJPTH010000052.1 GCA905373545_01603 CDS open 16597-17154 _na     185_aa BIG2 domain-containing protein
3199 CAJPTH010000052.1 GCA905373545_01604 CDS open 17279-17953 _na     224_aa NigD-like protein
3200 CAJPTH010000052.1 GCA905373545_01605 CDS open 17982-18533 _na     183_aa RNA polymerase subunit sigma
3201 CAJPTH010000052.1 GCA905373545_01606 CDS open 18544-19806 _na     420_aa RNA polymerase
3202 CAJPTH010000052.1 GCA905373545_01594 gene open 619-1620 luxR
3203 CAJPTH010000052.1 GCA905373545_01595 gene open 1700-4153
3204 CAJPTH010000052.1 GCA905373545_01596 gene open 4170-6698
3205 CAJPTH010000052.1 GCA905373545_01597 gene open 6824-8464
3206 CAJPTH010000052.1 GCA905373545_01598 gene open 8494-9354
3207 CAJPTH010000052.1 GCA905373545_01599 gene open 9367-10878
3208 CAJPTH010000052.1 GCA905373545_01600 gene open 10907-14242
3209 CAJPTH010000052.1 GCA905373545_01601 gene open 14540-15619 fecR
3210 CAJPTH010000052.1 GCA905373545_01602 gene open 15677-16174
3211 CAJPTH010000052.1 GCA905373545_01603 gene open 16597-17154
3212 CAJPTH010000052.1 GCA905373545_01604 gene open 17279-17953
3213 CAJPTH010000052.1 GCA905373545_01605 gene open 17982-18533
3214 CAJPTH010000052.1 GCA905373545_01606 gene open 18544-19806
3215 CAJPTH010000053.1 repeat_region open 8973-9957 CRISPR array with 15 repeats of length 36%2C consensus sequence GTTGCGGTTTGATGTAGAAAGAAGATATATAGCAAC and spacer length 29
3216 CAJPTH010000053.1 GCA905373545_01607 CDS open 59-658 _na     199_aa AAA+ ATPase domain-containing protein
3217 CAJPTH010000053.1 GCA905373545_01608 CDS open 655-1419 _na     254_aa ABC transporter permease
3218 CAJPTH010000053.1 GCA905373545_01609 CDS open 1416-1610 _na     64_aa hypothetical protein
3219 CAJPTH010000053.1 GCA905373545_01610 CDS open 1736-2524 _na     262_aa Nif3-like dinuclear metal center hexameric protein
3220 CAJPTH010000053.1 GCA905373545_01611 CDS open 2528-3373 _na     281_aa C4-type zinc ribbon domain-containing protein
3221 CAJPTH010000053.1 GCA905373545_01612 CDS open 3612-3782 _na     56_aa hypothetical protein
3222 CAJPTH010000053.1 GCA905373545_01613 CDS open 3997-7656 _na     1219_aa cas9 type II CRISPR RNA-guided endonuclease Cas9
3223 CAJPTH010000053.1 GCA905373545_01614 CDS open 7660-8547 _na     295_aa cas1 type II CRISPR-associated endonuclease Cas1
3224 CAJPTH010000053.1 GCA905373545_01615 CDS open 8544-8882 _na     112_aa cas2 CRISPR-associated endonuclease Cas2
3225 CAJPTH010000053.1 GCA905373545_01616 CDS open 10174-10509 _na     111_aa MmcQ/YjbR family DNA-binding protein
3226 CAJPTH010000053.1 GCA905373545_01617 CDS open 10537-11025 _na     162_aa hypothetical protein
3227 CAJPTH010000053.1 GCA905373545_01618 CDS open 11080-11199 _na     39_aa hypothetical protein
3228 CAJPTH010000053.1 GCA905373545_01619 CDS open 11207-11773 _na     188_aa NUDIX hydrolase
3229 CAJPTH010000053.1 GCA905373545_01620 CDS open 11853-12365 _na     170_aa Acyltransferase 3 domain-containing protein
3230 CAJPTH010000053.1 GCA905373545_01621 CDS open 12538-12864 _na     108_aa hypothetical protein
3231 CAJPTH010000053.1 GCA905373545_01622 CDS open 13390-14262 _na     290_aa sucD succinate--CoA ligase subunit alpha
3232 CAJPTH010000053.1 GCA905373545_01623 CDS open 14301-15440 _na     379_aa sucC ADP-forming succinate--CoA ligase subunit beta
3233 CAJPTH010000053.1 GCA905373545_01624 CDS open 15555-16031 _na     158_aa DUF4112 domain-containing protein
3234 CAJPTH010000053.1 GCA905373545_01625 CDS open 16093-16704 _na     203_aa Peptidoglycan/xylan/chitin deacetylase%2C PgdA/CDA1 family
3235 CAJPTH010000053.1 GCA905373545_01626 CDS open 16718-20080 _na     1120_aa DUF2723 domain-containing protein
3236 CAJPTH010000053.1 GCA905373545_01607 gene open 59-658
3237 CAJPTH010000053.1 GCA905373545_01608 gene open 655-1419
3238 CAJPTH010000053.1 GCA905373545_01609 gene open 1416-1610
3239 CAJPTH010000053.1 GCA905373545_01610 gene open 1736-2524
3240 CAJPTH010000053.1 GCA905373545_01611 gene open 2528-3373
3241 CAJPTH010000053.1 GCA905373545_01612 gene open 3612-3782
3242 CAJPTH010000053.1 GCA905373545_01613 gene open 3997-7656 cas9
3243 CAJPTH010000053.1 GCA905373545_01614 gene open 7660-8547 cas1
3244 CAJPTH010000053.1 GCA905373545_01615 gene open 8544-8882 cas2
3245 CAJPTH010000053.1 GCA905373545_01616 gene open 10174-10509
3246 CAJPTH010000053.1 GCA905373545_01617 gene open 10537-11025
3247 CAJPTH010000053.1 GCA905373545_01618 gene open 11080-11199
3248 CAJPTH010000053.1 GCA905373545_01619 gene open 11207-11773
3249 CAJPTH010000053.1 GCA905373545_01620 gene open 11853-12365
3250 CAJPTH010000053.1 GCA905373545_01621 gene open 12538-12864
3251 CAJPTH010000053.1 GCA905373545_01622 gene open 13390-14262 sucD
3252 CAJPTH010000053.1 GCA905373545_01623 gene open 14301-15440 sucC
3253 CAJPTH010000053.1 GCA905373545_01624 gene open 15555-16031
3254 CAJPTH010000053.1 GCA905373545_01625 gene open 16093-16704
3255 CAJPTH010000053.1 GCA905373545_01626 gene open 16718-20080
3256 CAJPTH010000054.1 GCA905373545_01627 CDS open 155-577 _na     140_aa Beta-lactamase-inhibitor-like PepSY-like domain-containing protein
3257 CAJPTH010000054.1 GCA905373545_01628 CDS open 711-2369 _na     552_aa Glycosyltransferase involved in cell wall bisynthesis
3258 CAJPTH010000054.1 GCA905373545_01629 CDS open 2401-4962 _na     853_aa Starch phosphorylase
3259 CAJPTH010000054.1 GCA905373545_01630 CDS open 5230-6168 _na     312_aa prsA Ribose-phosphate pyrophosphokinase
3260 CAJPTH010000054.1 GCA905373545_01631 CDS open 6215-6823 _na     202_aa Thiamine phosphate pyrophosphorylase
3261 CAJPTH010000054.1 GCA905373545_01632 CDS open 6939-8114 _na     391_aa nspC carboxynorspermidine decarboxylase
3262 CAJPTH010000054.1 GCA905373545_01637 CDS open 8667-9215 _na     182_aa Phage protein
3263 CAJPTH010000054.1 GCA905373545_01638 CDS open 9226-9654 _na     142_aa Single-stranded DNA-binding protein
3264 CAJPTH010000054.1 GCA905373545_01639 CDS open 9669-11006 _na     445_aa gldE Gliding motility-associated protein GldE
3265 CAJPTH010000054.1 GCA905373545_01640 CDS open 11006-11620 _na     204_aa Siderophore biosynthesis protein
3266 CAJPTH010000054.1 GCA905373545_01641 CDS open 11791-12813 _na     340_aa Phytase esterase
3267 CAJPTH010000054.1 GCA905373545_01642 CDS open 12806-13609 _na     267_aa PPM-type phosphatase domain-containing protein
3268 CAJPTH010000054.1 GCA905373545_01643 CDS open 13611-14204 _na     197_aa hypothetical protein
3269 CAJPTH010000054.1 GCA905373545_01644 CDS open 14046-14375 _na     109_aa hypothetical protein
3270 CAJPTH010000054.1 GCA905373545_01645 CDS open 14392-17304 _na     970_aa Xanthan lyase
3271 CAJPTH010000054.1 GCA905373545_01646 CDS open 17307-17864 _na     185_aa Acyltransferase
3272 CAJPTH010000054.1 GCA905373545_01647 CDS open 17872-18255 _na     127_aa hypothetical protein
3273 CAJPTH010000054.1 GCA905373545_01648 CDS open 18344-19990 _na     548_aa diphosphate--fructose-6-phosphate 1-phosphotransferase
3274 CAJPTH010000054.1 GCA905373545_01627 gene open 155-577
3275 CAJPTH010000054.1 GCA905373545_01628 gene open 711-2369
3276 CAJPTH010000054.1 GCA905373545_01629 gene open 2401-4962
3277 CAJPTH010000054.1 GCA905373545_01630 gene open 5230-6168 prsA
3278 CAJPTH010000054.1 GCA905373545_01631 gene open 6215-6823
3279 CAJPTH010000054.1 GCA905373545_01632 gene open 6939-8114 nspC
3280 CAJPTH010000054.1 GCA905373545_01637 gene open 8667-9215
3281 CAJPTH010000054.1 GCA905373545_01638 gene open 9226-9654
3282 CAJPTH010000054.1 GCA905373545_01639 gene open 9669-11006 gldE
3283 CAJPTH010000054.1 GCA905373545_01640 gene open 11006-11620
3284 CAJPTH010000054.1 GCA905373545_01641 gene open 11791-12813
3285 CAJPTH010000054.1 GCA905373545_01642 gene open 12806-13609
3286 CAJPTH010000054.1 GCA905373545_01643 gene open 13611-14204
3287 CAJPTH010000054.1 GCA905373545_01644 gene open 14046-14375
3288 CAJPTH010000054.1 GCA905373545_01645 gene open 14392-17304
3289 CAJPTH010000054.1 GCA905373545_01646 gene open 17307-17864
3290 CAJPTH010000054.1 GCA905373545_01647 gene open 17872-18255
3291 CAJPTH010000054.1 GCA905373545_01648 gene open 18344-19990
3292 CAJPTH010000054.1 GCA905373545_01633 gene open 8233-8308 trnG
3293 CAJPTH010000054.1 GCA905373545_01634 gene open 8348-8429 trnL
3294 CAJPTH010000054.1 GCA905373545_01635 gene open 8459-8542 trnL
3295 CAJPTH010000054.1 GCA905373545_01636 gene open 8560-8632 trnG
3296 CAJPTH010000054.1 GCA905373545_01633 tRNA open 8233-8308 trnG tRNA-Gly(gcc)
3297 CAJPTH010000054.1 GCA905373545_01634 tRNA open 8348-8429 trnL tRNA-Leu(cag)
3298 CAJPTH010000054.1 GCA905373545_01635 tRNA open 8459-8542 trnL tRNA-Leu(gag)
3299 CAJPTH010000054.1 GCA905373545_01636 tRNA open 8560-8632 trnG tRNA-Gly(gcc)
3300 CAJPTH010000055.1 GCA905373545_01649 CDS open 10-795 _na     261_aa tRNA threonylcarbamoyladenosine dehydratase
3301 CAJPTH010000055.1 GCA905373545_01650 CDS open 792-2090 _na     432_aa rmuC DNA recombination protein RmuC
3302 CAJPTH010000055.1 GCA905373545_01651 CDS open 2177-3475 _na     432_aa MATE family efflux transporter
3303 CAJPTH010000055.1 GCA905373545_01652 CDS open 3465-4214 _na     249_aa Lipocalin-like domain-containing protein
3304 CAJPTH010000055.1 GCA905373545_01653 CDS open 4276-4833 _na     185_aa hypothetical protein
3305 CAJPTH010000055.1 GCA905373545_01654 CDS open 4839-8315 _na     1158_aa Ppx/GppA phosphatase family protein
3306 CAJPTH010000055.1 GCA905373545_01655 CDS open 8315-9814 _na     499_aa Tubulin/FtsZ family%2C GTPase domain
3307 CAJPTH010000055.1 GCA905373545_01656 CDS open 9872-10315 _na     147_aa DUF4386 domain-containing protein
3308 CAJPTH010000055.1 GCA905373545_01657 CDS open 10317-11705 _na     462_aa Lipoprotein
3309 CAJPTH010000055.1 GCA905373545_01658 CDS open 12035-13282 _na     415_aa dacB D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase
3310 CAJPTH010000055.1 GCA905373545_01659 CDS open 13360-15876 _na     838_aa TonB-dependent receptor
3311 CAJPTH010000055.1 GCA905373545_01660 CDS open 15918-16928 _na     336_aa Beta-carotene 15%2C15'-monooxygenase
3312 CAJPTH010000055.1 GCA905373545_01661 CDS open 16915-18756 _na     613_aa Collagenase-like protease
3313 CAJPTH010000055.1 GCA905373545_01662 CDS open 18749-19186 _na     145_aa hypothetical protein
3314 CAJPTH010000055.1 GCA905373545_01649 gene open 10-795
3315 CAJPTH010000055.1 GCA905373545_01650 gene open 792-2090 rmuC
3316 CAJPTH010000055.1 GCA905373545_01651 gene open 2177-3475
3317 CAJPTH010000055.1 GCA905373545_01652 gene open 3465-4214
3318 CAJPTH010000055.1 GCA905373545_01653 gene open 4276-4833
3319 CAJPTH010000055.1 GCA905373545_01654 gene open 4839-8315
3320 CAJPTH010000055.1 GCA905373545_01655 gene open 8315-9814
3321 CAJPTH010000055.1 GCA905373545_01656 gene open 9872-10315
3322 CAJPTH010000055.1 GCA905373545_01657 gene open 10317-11705
3323 CAJPTH010000055.1 GCA905373545_01658 gene open 12035-13282 dacB
3324 CAJPTH010000055.1 GCA905373545_01659 gene open 13360-15876
3325 CAJPTH010000055.1 GCA905373545_01660 gene open 15918-16928
3326 CAJPTH010000055.1 GCA905373545_01661 gene open 16915-18756
3327 CAJPTH010000055.1 GCA905373545_01662 gene open 18749-19186
3328 CAJPTH010000056.1 GCA905373545_01663 CDS open 149-1480 _na     443_aa dihydroorotase
3329 CAJPTH010000056.1 GCA905373545_01664 CDS open 1493-2296 _na     267_aa DUF4369 domain-containing protein
3330 CAJPTH010000056.1 GCA905373545_01665 CDS open 2387-2815 _na     142_aa Lipoprotein
3331 CAJPTH010000056.1 GCA905373545_01666 CDS open 2812-3153 _na     113_aa Septum formation initiator
3332 CAJPTH010000056.1 GCA905373545_01667 CDS open 3232-4995 _na     587_aa DNA polymerase III subunit gamma/tau
3333 CAJPTH010000056.1 GCA905373545_01668 CDS open 5128-6165 _na     345_aa asnA aspartate--ammonia ligase
3334 CAJPTH010000056.1 GCA905373545_01670 CDS open 6504-7727 _na     407_aa pepT peptidase T
3335 CAJPTH010000056.1 GCA905373545_01671 CDS open 7861-10119 _na     752_aa Monovalent cation:H+ antiporter-2%2C CPA2 family
3336 CAJPTH010000056.1 GCA905373545_01672 CDS open 10375-13212 _na     945_aa lptD LPS-assembly protein LptD central domain-containing protein
3337 CAJPTH010000056.1 GCA905373545_01673 CDS open 13277-13813 _na     178_aa Phosphohydrolase
3338 CAJPTH010000056.1 GCA905373545_01674 CDS open 14158-15930 _na     590_aa Pyruvate carboxylase subunit B
3339 CAJPTH010000056.1 GCA905373545_01675 CDS open 16064-16915 _na     283_aa Lipoprotein
3340 CAJPTH010000056.1 GCA905373545_01676 CDS open 17150-17611 _na     153_aa queF preQ(1) synthase
3341 CAJPTH010000056.1 GCA905373545_01677 CDS open 17614-18303 _na     229_aa queuosine precursor transporter
3342 CAJPTH010000056.1 GCA905373545_01663 gene open 149-1480
3343 CAJPTH010000056.1 GCA905373545_01664 gene open 1493-2296
3344 CAJPTH010000056.1 GCA905373545_01665 gene open 2387-2815
3345 CAJPTH010000056.1 GCA905373545_01666 gene open 2812-3153
3346 CAJPTH010000056.1 GCA905373545_01667 gene open 3232-4995
3347 CAJPTH010000056.1 GCA905373545_01668 gene open 5128-6165 asnA
3348 CAJPTH010000056.1 GCA905373545_01670 gene open 6504-7727 pepT
3349 CAJPTH010000056.1 GCA905373545_01671 gene open 7861-10119
3350 CAJPTH010000056.1 GCA905373545_01672 gene open 10375-13212 lptD
3351 CAJPTH010000056.1 GCA905373545_01673 gene open 13277-13813
3352 CAJPTH010000056.1 GCA905373545_01674 gene open 14158-15930
3353 CAJPTH010000056.1 GCA905373545_01675 gene open 16064-16915
3354 CAJPTH010000056.1 GCA905373545_01676 gene open 17150-17611 queF
3355 CAJPTH010000056.1 GCA905373545_01677 gene open 17614-18303
3356 CAJPTH010000056.1 GCA905373545_01669 gene open 6408-6484 trnR
3357 CAJPTH010000056.1 GCA905373545_01669 tRNA open 6408-6484 trnR tRNA-Arg(ccg)
3358 CAJPTH010000057.1 GCA905373545_01678 CDS open 12-1208 _na     398_aa L-serine ammonia-lyase
3359 CAJPTH010000057.1 GCA905373545_01680 CDS open 1661-2329 _na     222_aa bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase
3360 CAJPTH010000057.1 GCA905373545_01681 CDS open 2367-3389 _na     340_aa 2-dehydro-3-deoxygluconokinase
3361 CAJPTH010000057.1 GCA905373545_01682 CDS open 3603-4850 _na     415_aa uxuA mannonate dehydratase
3362 CAJPTH010000057.1 GCA905373545_01683 CDS open 4862-5674 _na     270_aa D-mannonate oxidoreductase
3363 CAJPTH010000057.1 GCA905373545_01684 CDS open 6171-6449 _na     92_aa DNA-binding protein HU-beta
3364 CAJPTH010000057.1 GCA905373545_01686 CDS open 6687-8261 _na     524_aa Ribonuclease E/G
3365 CAJPTH010000057.1 GCA905373545_01687 CDS open 8377-10095 _na     572_aa hypothetical protein
3366 CAJPTH010000057.1 GCA905373545_01688 CDS open 10542-13769 _na     1075_aa Glycoside hydrolase
3367 CAJPTH010000057.1 GCA905373545_01689 CDS open 13826-14296 _na     156_aa Threonyl/alanyl tRNA synthetase SAD domain-containing protein
3368 CAJPTH010000057.1 GCA905373545_01690 CDS open 14293-15957 _na     554_aa Alpha-amylase
3369 CAJPTH010000057.1 GCA905373545_01691 CDS open 15998-16885 _na     295_aa fabD ACP S-malonyltransferase
3370 CAJPTH010000057.1 GCA905373545_01692 CDS open 17015-17563 _na     182_aa rplI 50S ribosomal protein L9
3371 CAJPTH010000057.1 GCA905373545_01693 CDS open 17582-17854 _na     90_aa Small ribosomal subunit protein bS18
3372 CAJPTH010000057.1 GCA905373545_01694 CDS open 17858-18148 _na     96_aa rpsF 30S ribosomal protein S6
3373 CAJPTH010000057.1 GCA905373545_01678 gene open 12-1208
3374 CAJPTH010000057.1 GCA905373545_01680 gene open 1661-2329
3375 CAJPTH010000057.1 GCA905373545_01681 gene open 2367-3389
3376 CAJPTH010000057.1 GCA905373545_01682 gene open 3603-4850 uxuA
3377 CAJPTH010000057.1 GCA905373545_01683 gene open 4862-5674
3378 CAJPTH010000057.1 GCA905373545_01684 gene open 6171-6449
3379 CAJPTH010000057.1 GCA905373545_01686 gene open 6687-8261
3380 CAJPTH010000057.1 GCA905373545_01687 gene open 8377-10095
3381 CAJPTH010000057.1 GCA905373545_01688 gene open 10542-13769
3382 CAJPTH010000057.1 GCA905373545_01689 gene open 13826-14296
3383 CAJPTH010000057.1 GCA905373545_01690 gene open 14293-15957
3384 CAJPTH010000057.1 GCA905373545_01691 gene open 15998-16885 fabD
3385 CAJPTH010000057.1 GCA905373545_01692 gene open 17015-17563 rplI
3386 CAJPTH010000057.1 GCA905373545_01693 gene open 17582-17854
3387 CAJPTH010000057.1 GCA905373545_01694 gene open 17858-18148 rpsF
3388 CAJPTH010000057.1 GCA905373545_01679 gene open 1440-1510 trnC
3389 CAJPTH010000057.1 GCA905373545_01679 tRNA open 1440-1510 trnC tRNA-Cys(gca)
3390 CAJPTH010000058.1 GCA905373545_01695 CDS open 34-873 _na     279_aa glycine--tRNA ligase
3391 CAJPTH010000058.1 GCA905373545_01696 CDS open 874-1509 _na     211_aa Peptidyl-prolyl cis-trans isomerase
3392 CAJPTH010000058.1 GCA905373545_01697 CDS open 1877-3247 _na     456_aa Multidrug-efflux transporter
3393 CAJPTH010000058.1 GCA905373545_01698 CDS open 3291-4139 _na     282_aa TraB/GumN family protein
3394 CAJPTH010000058.1 GCA905373545_01699 CDS open 4158-5063 _na     301_aa TraB/GumN family protein
3395 CAJPTH010000058.1 GCA905373545_01700 CDS open 5241-7661 _na     806_aa N terminal of Calcineurin-like phosphoesterase
3396 CAJPTH010000058.1 GCA905373545_01701 CDS open 7690-9561 _na     623_aa BACON domain-containing protein
3397 CAJPTH010000058.1 GCA905373545_01702 CDS open 9552-9761 _na     69_aa hypothetical protein
3398 CAJPTH010000058.1 GCA905373545_01703 CDS open 9796-11679 _na     627_aa IgA Peptidase M64
3399 CAJPTH010000058.1 GCA905373545_01704 CDS open 11878-13752 _na     624_aa DUF4906 domain-containing protein
3400 CAJPTH010000058.1 GCA905373545_01705 CDS open 13774-13998 _na     74_aa hypothetical protein
3401 CAJPTH010000058.1 GCA905373545_01706 CDS open 14693-16387 _na     564_aa Helicase
3402 CAJPTH010000058.1 GCA905373545_01707 CDS open 16391-16984 _na     197_aa PspA/IM30 family protein
3403 CAJPTH010000058.1 GCA905373545_01708 CDS open 17126-17470 _na     114_aa Fic family protein
3404 CAJPTH010000058.1 GCA905373545_01695 gene open 34-873
3405 CAJPTH010000058.1 GCA905373545_01696 gene open 874-1509
3406 CAJPTH010000058.1 GCA905373545_01697 gene open 1877-3247
3407 CAJPTH010000058.1 GCA905373545_01698 gene open 3291-4139
3408 CAJPTH010000058.1 GCA905373545_01699 gene open 4158-5063
3409 CAJPTH010000058.1 GCA905373545_01700 gene open 5241-7661
3410 CAJPTH010000058.1 GCA905373545_01701 gene open 7690-9561
3411 CAJPTH010000058.1 GCA905373545_01702 gene open 9552-9761
3412 CAJPTH010000058.1 GCA905373545_01703 gene open 9796-11679
3413 CAJPTH010000058.1 GCA905373545_01704 gene open 11878-13752
3414 CAJPTH010000058.1 GCA905373545_01705 gene open 13774-13998
3415 CAJPTH010000058.1 GCA905373545_01706 gene open 14693-16387
3416 CAJPTH010000058.1 GCA905373545_01707 gene open 16391-16984
3417 CAJPTH010000058.1 GCA905373545_01708 gene open 17126-17470
3418 CAJPTH010000059.1 GCA905373545_01709 CDS open 88-1170 _na     360_aa ahpC Antioxidant AhpC
3419 CAJPTH010000059.1 GCA905373545_01710 CDS open 1296-1913 _na     205_aa luxR Regulatory protein%2C luxR family
3420 CAJPTH010000059.1 GCA905373545_01711 CDS open 2008-2445 _na     145_aa Transcriptional repressor
3421 CAJPTH010000059.1 GCA905373545_01712 CDS open 2451-3278 _na     275_aa xynC XynC protein
3422 CAJPTH010000059.1 GCA905373545_01713 CDS open 3454-4263 _na     269_aa rhaD rhamnulose-1-phosphate aldolase
3423 CAJPTH010000059.1 GCA905373545_01714 CDS open 4443-5105 _na     220_aa DUF1648 domain-containing protein
3424 CAJPTH010000059.1 GCA905373545_01715 CDS open 5133-6386 _na     417_aa L-rhamnose isomerase
3425 CAJPTH010000059.1 GCA905373545_01716 CDS open 6395-7822 _na     475_aa Rhamnulokinase
3426 CAJPTH010000059.1 GCA905373545_01717 CDS open 8181-9179 _na     332_aa Glycosidase
3427 CAJPTH010000059.1 GCA905373545_01718 CDS open 9203-10480 _na     425_aa ampG MFS transporter%2C PAT family%2C beta-lactamase induction signal transducer AmpG
3428 CAJPTH010000059.1 GCA905373545_01719 CDS open 10516-12000 _na     494_aa Meiotically up-regulated gene 157 (Mug157) protein
3429 CAJPTH010000059.1 GCA905373545_01720 CDS open 12044-14206 _na     720_aa Alpha-1%2C2-mannosidase%2C putative
3430 CAJPTH010000059.1 GCA905373545_01721 CDS open 15342-16391 _na     349_aa DNA polymerase-3 subunit delta
3431 CAJPTH010000059.1 GCA905373545_01722 CDS open 16380-16970 _na     196_aa hypothetical protein
3432 CAJPTH010000059.1 GCA905373545_01709 gene open 88-1170 ahpC
3433 CAJPTH010000059.1 GCA905373545_01710 gene open 1296-1913 luxR
3434 CAJPTH010000059.1 GCA905373545_01711 gene open 2008-2445
3435 CAJPTH010000059.1 GCA905373545_01712 gene open 2451-3278 xynC
3436 CAJPTH010000059.1 GCA905373545_01713 gene open 3454-4263 rhaD
3437 CAJPTH010000059.1 GCA905373545_01714 gene open 4443-5105
3438 CAJPTH010000059.1 GCA905373545_01715 gene open 5133-6386
3439 CAJPTH010000059.1 GCA905373545_01716 gene open 6395-7822
3440 CAJPTH010000059.1 GCA905373545_01717 gene open 8181-9179
3441 CAJPTH010000059.1 GCA905373545_01718 gene open 9203-10480 ampG
3442 CAJPTH010000059.1 GCA905373545_01719 gene open 10516-12000
3443 CAJPTH010000059.1 GCA905373545_01720 gene open 12044-14206
3444 CAJPTH010000059.1 GCA905373545_01721 gene open 15342-16391
3445 CAJPTH010000059.1 GCA905373545_01722 gene open 16380-16970
3446 CAJPTH010000060.1 GCA905373545_01723 CDS open 16-1392 _na     458_aa putative transporter
3447 CAJPTH010000060.1 GCA905373545_01724 CDS open 1409-2881 _na     490_aa RNA pseudouridine synthase
3448 CAJPTH010000060.1 GCA905373545_01725 CDS open 3041-4153 _na     370_aa Carboxymuconolactone decarboxylase
3449 CAJPTH010000060.1 GCA905373545_01726 CDS open 4501-4701 _na     66_aa hypothetical protein
3450 CAJPTH010000060.1 GCA905373545_01727 CDS open 4701-5006 _na     101_aa Type II toxin-antitoxin system mRNA interferase toxin%2C RelE/StbE family
3451 CAJPTH010000060.1 GCA905373545_01728 CDS open 5488-6597 _na     369_aa Aminoglycoside phosphotransferase
3452 CAJPTH010000060.1 GCA905373545_01729 CDS open 6648-7247 _na     199_aa Carbohydrate-binding domain-containing protein
3453 CAJPTH010000060.1 GCA905373545_01730 CDS open 7630-10839 _na     1069_aa TonB-dependent receptor
3454 CAJPTH010000060.1 GCA905373545_01731 CDS open 10987-12765 _na     592_aa RagB/SusD domain-containing protein
3455 CAJPTH010000060.1 GCA905373545_01732 CDS open 12832-15060 _na     742_aa Alpha-N-acetylglucosaminidase
3456 CAJPTH010000060.1 GCA905373545_01733 CDS open 15164-16402 _na     412_aa GTPase%2C G3E family
3457 CAJPTH010000060.1 GCA905373545_01734 CDS open 16826-17005 _na     59_aa Toxin PIN
3458 CAJPTH010000060.1 GCA905373545_01723 gene open 16-1392
3459 CAJPTH010000060.1 GCA905373545_01724 gene open 1409-2881
3460 CAJPTH010000060.1 GCA905373545_01725 gene open 3041-4153
3461 CAJPTH010000060.1 GCA905373545_01726 gene open 4501-4701
3462 CAJPTH010000060.1 GCA905373545_01727 gene open 4701-5006
3463 CAJPTH010000060.1 GCA905373545_01728 gene open 5488-6597
3464 CAJPTH010000060.1 GCA905373545_01729 gene open 6648-7247
3465 CAJPTH010000060.1 GCA905373545_01730 gene open 7630-10839
3466 CAJPTH010000060.1 GCA905373545_01731 gene open 10987-12765
3467 CAJPTH010000060.1 GCA905373545_01732 gene open 12832-15060
3468 CAJPTH010000060.1 GCA905373545_01733 gene open 15164-16402
3469 CAJPTH010000060.1 GCA905373545_01734 gene open 16826-17005
3470 CAJPTH010000061.1 GCA905373545_01735 CDS open 11-730 _na     239_aa hypothetical protein
3471 CAJPTH010000061.1 GCA905373545_01736 CDS open 723-1151 _na     142_aa folK 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase
3472 CAJPTH010000061.1 GCA905373545_01737 CDS open 1322-2665 _na     447_aa Leucine-rich repeat domain-containing protein
3473 CAJPTH010000061.1 GCA905373545_01738 CDS open 3002-3271 _na     89_aa rpsO 30S ribosomal protein S15
3474 CAJPTH010000061.1 GCA905373545_01739 CDS open 3465-5267 _na     600_aa typA translational GTPase TypA
3475 CAJPTH010000061.1 GCA905373545_01740 CDS open 5294-5992 _na     232_aa Outer membrane protein beta-barrel domain-containing protein
3476 CAJPTH010000061.1 GCA905373545_01741 CDS open 6080-7177 _na     365_aa ROK family protein
3477 CAJPTH010000061.1 GCA905373545_01742 CDS open 7305-7784 _na     159_aa S-ribosylhomocysteine lyase
3478 CAJPTH010000061.1 GCA905373545_01743 CDS open 7819-8505 _na     228_aa 5'-methylthioadenosine/adenosylhomocysteine nucleosidase
3479 CAJPTH010000061.1 GCA905373545_01744 CDS open 8846-9316 _na     156_aa DUF3828 domain-containing protein
3480 CAJPTH010000061.1 GCA905373545_01745 CDS open 9399-11894 _na     831_aa yfhO YfhO family protein
3481 CAJPTH010000061.1 GCA905373545_01746 CDS open 11891-14731 _na     946_aa bifunctional fucokinase/fucose-1-phosphate guanylyltransferase
3482 CAJPTH010000061.1 GCA905373545_01747 CDS open 14737-15174 _na     145_aa NUDIX hydrolase
3483 CAJPTH010000061.1 GCA905373545_01748 CDS open 15153-15977 _na     274_aa GSCFA family protein
3484 CAJPTH010000061.1 GCA905373545_01749 CDS open 15927-16583 _na     218_aa hypothetical protein
3485 CAJPTH010000061.1 GCA905373545_01750 CDS open 16872-16988 _na     38_aa hypothetical protein
3486 CAJPTH010000061.1 GCA905373545_01735 gene open 11-730
3487 CAJPTH010000061.1 GCA905373545_01736 gene open 723-1151 folK
3488 CAJPTH010000061.1 GCA905373545_01737 gene open 1322-2665
3489 CAJPTH010000061.1 GCA905373545_01738 gene open 3002-3271 rpsO
3490 CAJPTH010000061.1 GCA905373545_01739 gene open 3465-5267 typA
3491 CAJPTH010000061.1 GCA905373545_01740 gene open 5294-5992
3492 CAJPTH010000061.1 GCA905373545_01741 gene open 6080-7177
3493 CAJPTH010000061.1 GCA905373545_01742 gene open 7305-7784
3494 CAJPTH010000061.1 GCA905373545_01743 gene open 7819-8505
3495 CAJPTH010000061.1 GCA905373545_01744 gene open 8846-9316
3496 CAJPTH010000061.1 GCA905373545_01745 gene open 9399-11894 yfhO
3497 CAJPTH010000061.1 GCA905373545_01746 gene open 11891-14731
3498 CAJPTH010000061.1 GCA905373545_01747 gene open 14737-15174
3499 CAJPTH010000061.1 GCA905373545_01748 gene open 15153-15977
3500 CAJPTH010000061.1 GCA905373545_01749 gene open 15927-16583