HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Parvimonas micra (GCA_905373815.1)

Select a Genome:
BAKTA Annotations for GCA_905373815.1
Genome Selected: Parvimonas micra
ContigsBases CDSrRNA tmRNAtRNA
176 1,561,631 1506 1 1 36
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3147 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:3]    |    Number of Records Found: 3147 [7 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1001 CAJPUJ010000020.1 GCA905373815_00492 gene open 1879-2763 galU
1002 CAJPUJ010000020.1 GCA905373815_00493 gene open 2766-3956 wecE
1003 CAJPUJ010000020.1 GCA905373815_00494 gene open 3969-4262
1004 CAJPUJ010000020.1 GCA905373815_00495 gene open 4272-5753 lysS
1005 CAJPUJ010000020.1 GCA905373815_00496 gene open 5765-6247 greA
1006 CAJPUJ010000020.1 GCA905373815_00497 gene open 6484-6900
1007 CAJPUJ010000020.1 GCA905373815_00498 gene open 7753-7965
1008 CAJPUJ010000020.1 GCA905373815_00499 gene open 8171-8602
1009 CAJPUJ010000020.1 GCA905373815_00500 gene open 8847-9761 dppC
1010 CAJPUJ010000020.1 GCA905373815_00501 gene open 9778-10734 opp4B
1011 CAJPUJ010000020.1 GCA905373815_00502 gene open 10736-11671 yejF
1012 CAJPUJ010000020.1 GCA905373815_00503 gene open 11671-12675 dppD
1013 CAJPUJ010000020.1 GCA905373815_00504 gene open 13388-14095
1014 CAJPUJ010000020.1 GCA905373815_00505 gene open 14105-14917
1015 CAJPUJ010000020.1 GCA905373815_00506 gene open 14910-15809
1016 CAJPUJ010000020.1 GCA905373815_00507 gene open 15821-16837 ycaO
1017 CAJPUJ010000021.1 GCA905373815_00509 gene open 674-747 dfrA-dnaX
1018 CAJPUJ010000021.1 GCA905373815_00509 ncRNA open 674-747 dfrA-dnaX RNA
1019 CAJPUJ010000021.1 GCA905373815_00508 CDS open 7-582 _na     191_aa Trep-Strep domain-containing protein
1020 CAJPUJ010000021.1 GCA905373815_00510 CDS open 947-2332 _na     461_aa glmU bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU
1021 CAJPUJ010000021.1 GCA905373815_00511 CDS open 2349-3311 _na     320_aa prsA Ribose-phosphate pyrophosphokinase
1022 CAJPUJ010000021.1 GCA905373815_00512 CDS open 3301-3888 _na     195_aa pth aminoacyl-tRNA hydrolase
1023 CAJPUJ010000021.1 GCA905373815_00513 CDS open 3925-7431 _na     1168_aa mfd transcription-repair coupling factor
1024 CAJPUJ010000021.1 GCA905373815_00514 CDS open 7506-8492 _na     328_aa surA peptidylprolyl isomerase
1025 CAJPUJ010000021.1 GCA905373815_00515 CDS open 8611-8889 _na     92_aa hupA DNA-binding protein
1026 CAJPUJ010000021.1 GCA905373815_00516 CDS open 9084-9845 _na     253_aa rpsB 30S ribosomal protein S2
1027 CAJPUJ010000021.1 GCA905373815_00517 CDS open 9932-11002 _na     356_aa tsf translation elongation factor Ts
1028 CAJPUJ010000021.1 GCA905373815_00518 CDS open 11148-12542 _na     464_aa norM Multidrug transporter MatE
1029 CAJPUJ010000021.1 GCA905373815_00519 CDS open 12923-13969 _na     348_aa afuA ABC transporter substrate-binding protein
1030 CAJPUJ010000021.1 GCA905373815_00520 CDS open 14068-15714 _na     548_aa fbpB ABC transporter permease
1031 CAJPUJ010000021.1 GCA905373815_00521 CDS open 15686-16633 _na     315_aa potA Iron ABC transporter ATP-binding protein
1032 CAJPUJ010000021.1 GCA905373815_00508 gene open 7-582
1033 CAJPUJ010000021.1 GCA905373815_00510 gene open 947-2332 glmU
1034 CAJPUJ010000021.1 GCA905373815_00511 gene open 2349-3311 prsA
1035 CAJPUJ010000021.1 GCA905373815_00512 gene open 3301-3888 pth
1036 CAJPUJ010000021.1 GCA905373815_00513 gene open 3925-7431 mfd
1037 CAJPUJ010000021.1 GCA905373815_00514 gene open 7506-8492 surA
1038 CAJPUJ010000021.1 GCA905373815_00515 gene open 8611-8889 hupA
1039 CAJPUJ010000021.1 GCA905373815_00516 gene open 9084-9845 rpsB
1040 CAJPUJ010000021.1 GCA905373815_00517 gene open 9932-11002 tsf
1041 CAJPUJ010000021.1 GCA905373815_00518 gene open 11148-12542 norM
1042 CAJPUJ010000021.1 GCA905373815_00519 gene open 12923-13969 afuA
1043 CAJPUJ010000021.1 GCA905373815_00520 gene open 14068-15714 fbpB
1044 CAJPUJ010000021.1 GCA905373815_00521 gene open 15686-16633 potA
1045 CAJPUJ010000022.1 GCA905373815_00522 CDS open 96-1250 _na     384_aa hypothetical protein
1046 CAJPUJ010000022.1 GCA905373815_00523 CDS open 1268-1789 _na     173_aa hypothetical protein
1047 CAJPUJ010000022.1 GCA905373815_00524 CDS open 1767-2153 _na     128_aa hypothetical protein
1048 CAJPUJ010000022.1 GCA905373815_00525 CDS open 2238-2444 _na     68_aa rpmB 50S ribosomal protein L28
1049 CAJPUJ010000022.1 GCA905373815_00526 CDS open 2718-3899 _na     393_aa yhiN FAD-dependent oxidoreductase
1050 CAJPUJ010000022.1 GCA905373815_00527 CDS open 3902-4558 _na     218_aa cmk (d)CMP kinase
1051 CAJPUJ010000022.1 GCA905373815_00528 CDS open 4551-5141 _na     196_aa plsC 1-acyl-sn-glycerol-3-phosphate acyltransferase
1052 CAJPUJ010000022.1 GCA905373815_00529 CDS open 5119-7128 _na     669_aa ispH bifunctional 4-hydroxy-3-methylbut-2-enyl diphosphate reductase/30S ribosomal protein S1
1053 CAJPUJ010000022.1 GCA905373815_00530 CDS open 7230-8594 _na     454_aa norM putative multidrug resistance protein NorM
1054 CAJPUJ010000022.1 GCA905373815_00531 CDS open 8664-9017 _na     117_aa yloU Asp23/Gls24 family envelope stress response protein
1055 CAJPUJ010000022.1 GCA905373815_00532 CDS open 9027-10649 _na     540_aa fakA Dihydroxyacetone kinase
1056 CAJPUJ010000022.1 GCA905373815_00533 CDS open 10686-12713 _na     675_aa recG ATP-dependent DNA helicase RecG
1057 CAJPUJ010000022.1 GCA905373815_00534 CDS open 12764-13084 _na     106_aa hypothetical protein
1058 CAJPUJ010000022.1 GCA905373815_00535 CDS open 13102-14364 _na     420_aa ABC transporter ATP-binding protein
1059 CAJPUJ010000022.1 GCA905373815_00536 CDS open 14357-15946 _na     529_aa mdlB ABC transporter ATP-binding protein
1060 CAJPUJ010000022.1 GCA905373815_00537 CDS open 16109-16705 _na     198_aa Lipoprotein
1061 CAJPUJ010000022.1 GCA905373815_00522 gene open 96-1250
1062 CAJPUJ010000022.1 GCA905373815_00523 gene open 1268-1789
1063 CAJPUJ010000022.1 GCA905373815_00524 gene open 1767-2153
1064 CAJPUJ010000022.1 GCA905373815_00525 gene open 2238-2444 rpmB
1065 CAJPUJ010000022.1 GCA905373815_00526 gene open 2718-3899 yhiN
1066 CAJPUJ010000022.1 GCA905373815_00527 gene open 3902-4558 cmk
1067 CAJPUJ010000022.1 GCA905373815_00528 gene open 4551-5141 plsC
1068 CAJPUJ010000022.1 GCA905373815_00529 gene open 5119-7128 ispH
1069 CAJPUJ010000022.1 GCA905373815_00530 gene open 7230-8594 norM
1070 CAJPUJ010000022.1 GCA905373815_00531 gene open 8664-9017 yloU
1071 CAJPUJ010000022.1 GCA905373815_00532 gene open 9027-10649 fakA
1072 CAJPUJ010000022.1 GCA905373815_00533 gene open 10686-12713 recG
1073 CAJPUJ010000022.1 GCA905373815_00534 gene open 12764-13084
1074 CAJPUJ010000022.1 GCA905373815_00535 gene open 13102-14364
1075 CAJPUJ010000022.1 GCA905373815_00536 gene open 14357-15946 mdlB
1076 CAJPUJ010000022.1 GCA905373815_00537 gene open 16109-16705
1077 CAJPUJ010000023.1 GCA905373815_00538 CDS open 658-2379 _na     573_aa mdlB ABC transporter%2C ATP-binding protein
1078 CAJPUJ010000023.1 GCA905373815_00539 CDS open 2641-3603 _na     320_aa araC HTH araC/xylS-type domain-containing protein
1079 CAJPUJ010000023.1 GCA905373815_00540 CDS open 4377-5423 _na     348_aa Cell division protein Fic
1080 CAJPUJ010000023.1 GCA905373815_00541 CDS open 6146-7249 _na     367_aa Protein kinase domain-containing protein
1081 CAJPUJ010000023.1 GCA905373815_00542 CDS open 7485-7943 _na     152_aa tnpA IS200/IS605 family transposase
1082 CAJPUJ010000023.1 GCA905373815_00543 CDS open 8057-8440 _na     127_aa Site-specific recombinase
1083 CAJPUJ010000023.1 GCA905373815_00544 CDS open 8496-9881 _na     461_aa DUF4026 domain-containing protein
1084 CAJPUJ010000023.1 GCA905373815_00545 CDS open 10812-11594 _na     260_aa ABC-2 type transporter
1085 CAJPUJ010000023.1 GCA905373815_00546 CDS open 11596-12375 _na     259_aa ABC transporter permease
1086 CAJPUJ010000023.1 GCA905373815_00547 CDS open 12372-13304 _na     310_aa ABC transporter ATP-binding protein
1087 CAJPUJ010000023.1 GCA905373815_00548 CDS open 13316-14692 _na     458_aa radical SAM/SPASM domain-containing protein
1088 CAJPUJ010000023.1 GCA905373815_00549 CDS open 14695-15756 _na     353_aa radical SAM/SPASM domain-containing protein
1089 CAJPUJ010000023.1 GCA905373815_00538 gene open 658-2379 mdlB
1090 CAJPUJ010000023.1 GCA905373815_00539 gene open 2641-3603 araC
1091 CAJPUJ010000023.1 GCA905373815_00540 gene open 4377-5423
1092 CAJPUJ010000023.1 GCA905373815_00541 gene open 6146-7249
1093 CAJPUJ010000023.1 GCA905373815_00542 gene open 7485-7943 tnpA
1094 CAJPUJ010000023.1 GCA905373815_00543 gene open 8057-8440
1095 CAJPUJ010000023.1 GCA905373815_00544 gene open 8496-9881
1096 CAJPUJ010000023.1 GCA905373815_00545 gene open 10812-11594
1097 CAJPUJ010000023.1 GCA905373815_00546 gene open 11596-12375
1098 CAJPUJ010000023.1 GCA905373815_00547 gene open 12372-13304
1099 CAJPUJ010000023.1 GCA905373815_00548 gene open 13316-14692
1100 CAJPUJ010000023.1 GCA905373815_00549 gene open 14695-15756
1101 CAJPUJ010000024.1 GCA905373815_00550 CDS open 325-636 _na     103_aa rpsJ 30S ribosomal protein S10
1102 CAJPUJ010000024.1 GCA905373815_00551 CDS open 689-1315 _na     208_aa rplC 50S ribosomal protein L3
1103 CAJPUJ010000024.1 GCA905373815_00552 CDS open 1333-1956 _na     207_aa rplD 50S ribosomal protein L4
1104 CAJPUJ010000024.1 GCA905373815_00553 CDS open 1956-2243 _na     95_aa rplW 50S ribosomal protein L23
1105 CAJPUJ010000024.1 GCA905373815_00554 CDS open 2261-3094 _na     277_aa rplB 50S ribosomal protein L2
1106 CAJPUJ010000024.1 GCA905373815_00555 CDS open 3111-3395 _na     94_aa rpsS 30S ribosomal protein S19
1107 CAJPUJ010000024.1 GCA905373815_00556 CDS open 3415-3747 _na     110_aa rplV 50S ribosomal protein L22
1108 CAJPUJ010000024.1 GCA905373815_00557 CDS open 3765-4499 _na     244_aa rpsC 30S ribosomal protein S3
1109 CAJPUJ010000024.1 GCA905373815_00558 CDS open 4523-4957 _na     144_aa rplP 50S ribosomal protein L16
1110 CAJPUJ010000024.1 GCA905373815_00559 CDS open 4971-5153 _na     60_aa rpmC 50S ribosomal protein L29
1111 CAJPUJ010000024.1 GCA905373815_00560 CDS open 5160-5414 _na     84_aa rpsQ 30S ribosomal protein S17
1112 CAJPUJ010000024.1 GCA905373815_00561 CDS open 5439-5807 _na     122_aa rplN 50S ribosomal protein L14
1113 CAJPUJ010000024.1 GCA905373815_00562 CDS open 5822-6133 _na     103_aa rplX 50S ribosomal protein L24
1114 CAJPUJ010000024.1 GCA905373815_00563 CDS open 6153-6695 _na     180_aa rplE 50S ribosomal protein L5
1115 CAJPUJ010000024.1 GCA905373815_00564 CDS open 6710-6979 _na     89_aa rpsN 30S ribosomal protein S14
1116 CAJPUJ010000024.1 GCA905373815_00565 CDS open 7004-7399 _na     131_aa rpsH 30S ribosomal protein S8
1117 CAJPUJ010000024.1 GCA905373815_00566 CDS open 7433-7972 _na     179_aa rplF 50S ribosomal protein L6
1118 CAJPUJ010000024.1 GCA905373815_00567 CDS open 7989-8354 _na     121_aa rplR 50S ribosomal protein L18
1119 CAJPUJ010000024.1 GCA905373815_00568 CDS open 8372-8878 _na     168_aa rpsE 30S ribosomal protein S5
1120 CAJPUJ010000024.1 GCA905373815_00569 CDS open 8893-9072 _na     59_aa rpmD 50S ribosomal protein L30
1121 CAJPUJ010000024.1 GCA905373815_00570 CDS open 9086-9535 _na     149_aa rplO 50S ribosomal protein L15
1122 CAJPUJ010000024.1 GCA905373815_00571 CDS open 9537-10814 _na     425_aa secY preprotein translocase subunit SecY
1123 CAJPUJ010000024.1 GCA905373815_00572 CDS open 10832-11473 _na     213_aa adk adenylate kinase
1124 CAJPUJ010000024.1 GCA905373815_00573 CDS open 11500-11781 _na     93_aa KOW domain-containing protein
1125 CAJPUJ010000024.1 GCA905373815_00574 CDS open 11794-12012 _na     72_aa infA translation initiation factor IF-1
1126 CAJPUJ010000024.1 GCA905373815_00575 CDS open 12166-12534 _na     122_aa rpsM 30S ribosomal protein S13
1127 CAJPUJ010000024.1 GCA905373815_00576 CDS open 12548-12943 _na     131_aa rpsK 30S ribosomal protein S11
1128 CAJPUJ010000024.1 GCA905373815_00577 CDS open 13006-13947 _na     313_aa rpoA DNA-directed RNA polymerase subunit alpha
1129 CAJPUJ010000024.1 GCA905373815_00578 CDS open 13966-14310 _na     114_aa rplQ 50S ribosomal protein L17
1130 CAJPUJ010000024.1 GCA905373815_00579 CDS open 14566-15702 _na     378_aa nifS cysteine desulfurase
1131 CAJPUJ010000024.1 GCA905373815_00550 gene open 325-636 rpsJ
1132 CAJPUJ010000024.1 GCA905373815_00551 gene open 689-1315 rplC
1133 CAJPUJ010000024.1 GCA905373815_00552 gene open 1333-1956 rplD
1134 CAJPUJ010000024.1 GCA905373815_00553 gene open 1956-2243 rplW
1135 CAJPUJ010000024.1 GCA905373815_00554 gene open 2261-3094 rplB
1136 CAJPUJ010000024.1 GCA905373815_00555 gene open 3111-3395 rpsS
1137 CAJPUJ010000024.1 GCA905373815_00556 gene open 3415-3747 rplV
1138 CAJPUJ010000024.1 GCA905373815_00557 gene open 3765-4499 rpsC
1139 CAJPUJ010000024.1 GCA905373815_00558 gene open 4523-4957 rplP
1140 CAJPUJ010000024.1 GCA905373815_00559 gene open 4971-5153 rpmC
1141 CAJPUJ010000024.1 GCA905373815_00560 gene open 5160-5414 rpsQ
1142 CAJPUJ010000024.1 GCA905373815_00561 gene open 5439-5807 rplN
1143 CAJPUJ010000024.1 GCA905373815_00562 gene open 5822-6133 rplX
1144 CAJPUJ010000024.1 GCA905373815_00563 gene open 6153-6695 rplE
1145 CAJPUJ010000024.1 GCA905373815_00564 gene open 6710-6979 rpsN
1146 CAJPUJ010000024.1 GCA905373815_00565 gene open 7004-7399 rpsH
1147 CAJPUJ010000024.1 GCA905373815_00566 gene open 7433-7972 rplF
1148 CAJPUJ010000024.1 GCA905373815_00567 gene open 7989-8354 rplR
1149 CAJPUJ010000024.1 GCA905373815_00568 gene open 8372-8878 rpsE
1150 CAJPUJ010000024.1 GCA905373815_00569 gene open 8893-9072 rpmD
1151 CAJPUJ010000024.1 GCA905373815_00570 gene open 9086-9535 rplO
1152 CAJPUJ010000024.1 GCA905373815_00571 gene open 9537-10814 secY
1153 CAJPUJ010000024.1 GCA905373815_00572 gene open 10832-11473 adk
1154 CAJPUJ010000024.1 GCA905373815_00573 gene open 11500-11781
1155 CAJPUJ010000024.1 GCA905373815_00574 gene open 11794-12012 infA
1156 CAJPUJ010000024.1 GCA905373815_00575 gene open 12166-12534 rpsM
1157 CAJPUJ010000024.1 GCA905373815_00576 gene open 12548-12943 rpsK
1158 CAJPUJ010000024.1 GCA905373815_00577 gene open 13006-13947 rpoA
1159 CAJPUJ010000024.1 GCA905373815_00578 gene open 13966-14310 rplQ
1160 CAJPUJ010000024.1 GCA905373815_00579 gene open 14566-15702 nifS
1161 CAJPUJ010000025.1 GCA905373815_00580 CDS open 209-622 _na     137_aa mscL large-conductance mechanosensitive channel protein MscL
1162 CAJPUJ010000025.1 GCA905373815_00581 CDS open 701-1306 _na     201_aa ubiG Methyltransferase
1163 CAJPUJ010000025.1 GCA905373815_00582 CDS open 1337-1825 _na     162_aa sTE14 Isoprenylcysteine carboxyl methyltransferase family protein
1164 CAJPUJ010000025.1 GCA905373815_00583 CDS open 1836-2330 _na     164_aa rimI Acetyltransferase
1165 CAJPUJ010000025.1 GCA905373815_00584 CDS open 2779-4314 _na     511_aa rny ribonuclease Y
1166 CAJPUJ010000025.1 GCA905373815_00585 CDS open 4511-5110 _na     199_aa mobA MobA-like NTP transferase domain-containing protein
1167 CAJPUJ010000025.1 GCA905373815_00586 CDS open 5110-5571 _na     153_aa ebsC Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase
1168 CAJPUJ010000025.1 GCA905373815_00587 CDS open 5558-6193 _na     211_aa udk uridine kinase
1169 CAJPUJ010000025.1 GCA905373815_00588 CDS open 6203-7429 _na     408_aa tyrS tyrosine--tRNA ligase
1170 CAJPUJ010000025.1 GCA905373815_00589 CDS open 7612-8271 _na     219_aa sapB Magnesium transporter
1171 CAJPUJ010000025.1 GCA905373815_00590 CDS open 8367-10391 _na     674_aa yvbJ TcaA second domain-containing protein
1172 CAJPUJ010000025.1 GCA905373815_00591 CDS open 10416-12164 _na     582_aa pepF oligoendopeptidase F
1173 CAJPUJ010000025.1 GCA905373815_00592 CDS open 12305-12628 _na     107_aa Intracellular sulfur oxidation protein%2C DsrE/DsrF family
1174 CAJPUJ010000025.1 GCA905373815_00593 CDS open 12637-14037 _na     466_aa ftsI beta-lactamase
1175 CAJPUJ010000025.1 GCA905373815_00594 CDS open 14047-15306 _na     419_aa ftsW Cell cycle protein
1176 CAJPUJ010000025.1 GCA905373815_00595 CDS open 15299-15664 _na     121_aa FHA domain-containing protein
1177 CAJPUJ010000025.1 GCA905373815_00580 gene open 209-622 mscL
1178 CAJPUJ010000025.1 GCA905373815_00581 gene open 701-1306 ubiG
1179 CAJPUJ010000025.1 GCA905373815_00582 gene open 1337-1825 sTE14
1180 CAJPUJ010000025.1 GCA905373815_00583 gene open 1836-2330 rimI
1181 CAJPUJ010000025.1 GCA905373815_00584 gene open 2779-4314 rny
1182 CAJPUJ010000025.1 GCA905373815_00585 gene open 4511-5110 mobA
1183 CAJPUJ010000025.1 GCA905373815_00586 gene open 5110-5571 ebsC
1184 CAJPUJ010000025.1 GCA905373815_00587 gene open 5558-6193 udk
1185 CAJPUJ010000025.1 GCA905373815_00588 gene open 6203-7429 tyrS
1186 CAJPUJ010000025.1 GCA905373815_00589 gene open 7612-8271 sapB
1187 CAJPUJ010000025.1 GCA905373815_00590 gene open 8367-10391 yvbJ
1188 CAJPUJ010000025.1 GCA905373815_00591 gene open 10416-12164 pepF
1189 CAJPUJ010000025.1 GCA905373815_00592 gene open 12305-12628
1190 CAJPUJ010000025.1 GCA905373815_00593 gene open 12637-14037 ftsI
1191 CAJPUJ010000025.1 GCA905373815_00594 gene open 14047-15306 ftsW
1192 CAJPUJ010000025.1 GCA905373815_00595 gene open 15299-15664
1193 CAJPUJ010000026.1 regulatory_region open 14025-14207 T-box leader
1194 CAJPUJ010000026.1 GCA905373815_00596 CDS open 89-2497 _na     802_aa rlhA Peptidase%2C U32 family
1195 CAJPUJ010000026.1 GCA905373815_00597 CDS open 2582-2998 _na     138_aa hypothetical protein
1196 CAJPUJ010000026.1 GCA905373815_00598 CDS open 3038-3454 _na     138_aa hypothetical protein
1197 CAJPUJ010000026.1 GCA905373815_00599 CDS open 3530-4537 _na     335_aa lolD ABC transporter
1198 CAJPUJ010000026.1 GCA905373815_00600 CDS open 4530-5231 _na     233_aa hypB CobW/HypB/UreG nucleotide-binding domain-containing protein
1199 CAJPUJ010000026.1 GCA905373815_00601 CDS open 5240-6457 _na     405_aa afuA DUF1858 domain-containing protein
1200 CAJPUJ010000026.1 GCA905373815_00602 CDS open 6556-7929 _na     457_aa Iron transport-associated domain protein
1201 CAJPUJ010000026.1 GCA905373815_00603 CDS open 8040-8465 _na     141_aa yhfA OsmC family protein
1202 CAJPUJ010000026.1 GCA905373815_00604 CDS open 8468-9733 _na     421_aa ATP synthase F0%2C A subunit
1203 CAJPUJ010000026.1 GCA905373815_00605 CDS open 9814-10545 _na     243_aa Methyltransferase
1204 CAJPUJ010000026.1 GCA905373815_00606 CDS open 10548-11069 _na     173_aa hpt hypoxanthine phosphoribosyltransferase
1205 CAJPUJ010000026.1 GCA905373815_00607 CDS open 11047-11247 _na     66_aa Cation:proton antiporter
1206 CAJPUJ010000026.1 GCA905373815_00608 CDS open 11256-13883 _na     875_aa valS valine--tRNA ligase
1207 CAJPUJ010000026.1 GCA905373815_00609 CDS open 14382-15017 _na     211_aa ahpC alkyl hydroperoxide reductase subunit C
1208 CAJPUJ010000026.1 GCA905373815_00610 CDS open 15150-15362 _na     70_aa hypothetical protein
1209 CAJPUJ010000026.1 GCA905373815_00611 CDS open 15359-15475 _na     38_aa hypothetical protein
1210 CAJPUJ010000026.1 GCA905373815_00596 gene open 89-2497 rlhA
1211 CAJPUJ010000026.1 GCA905373815_00597 gene open 2582-2998
1212 CAJPUJ010000026.1 GCA905373815_00598 gene open 3038-3454
1213 CAJPUJ010000026.1 GCA905373815_00599 gene open 3530-4537 lolD
1214 CAJPUJ010000026.1 GCA905373815_00600 gene open 4530-5231 hypB
1215 CAJPUJ010000026.1 GCA905373815_00601 gene open 5240-6457 afuA
1216 CAJPUJ010000026.1 GCA905373815_00602 gene open 6556-7929
1217 CAJPUJ010000026.1 GCA905373815_00603 gene open 8040-8465 yhfA
1218 CAJPUJ010000026.1 GCA905373815_00604 gene open 8468-9733
1219 CAJPUJ010000026.1 GCA905373815_00605 gene open 9814-10545
1220 CAJPUJ010000026.1 GCA905373815_00606 gene open 10548-11069 hpt
1221 CAJPUJ010000026.1 GCA905373815_00607 gene open 11047-11247
1222 CAJPUJ010000026.1 GCA905373815_00608 gene open 11256-13883 valS
1223 CAJPUJ010000026.1 GCA905373815_00609 gene open 14382-15017 ahpC
1224 CAJPUJ010000026.1 GCA905373815_00610 gene open 15150-15362
1225 CAJPUJ010000026.1 GCA905373815_00611 gene open 15359-15475
1226 CAJPUJ010000027.1 regulatory_region open 882-947 pemK RNA
1227 CAJPUJ010000027.1 regulatory_region open 8199-8449 T-box leader
1228 CAJPUJ010000027.1 GCA905373815_00612 CDS open 74-550 _na     158_aa RNA polymerase sigma-70 region 4 domain-containing protein
1229 CAJPUJ010000027.1 GCA905373815_00613 CDS open 1036-1197 _na     53_aa Site-specific DNA recombinase
1230 CAJPUJ010000027.1 GCA905373815_00614 CDS open 1426-1989 _na     187_aa Phage protein
1231 CAJPUJ010000027.1 GCA905373815_00615 CDS open 2301-2936 _na     211_aa hypothetical protein
1232 CAJPUJ010000027.1 GCA905373815_00616 CDS open 3444-4607 _na     387_aa tetratricopeptide repeat protein
1233 CAJPUJ010000027.1 GCA905373815_00617 CDS open 4645-5031 _na     128_aa DUF5085 domain-containing protein
1234 CAJPUJ010000027.1 GCA905373815_00618 CDS open 5351-7159 _na     602_aa LPXTG-motif cell wall anchor domain protein
1235 CAJPUJ010000027.1 GCA905373815_00619 CDS open 7393-8109 _na     238_aa PF06541 family protein
1236 CAJPUJ010000027.1 GCA905373815_00620 CDS open 8561-9847 _na     428_aa brnQ branched-chain amino acid transport system II carrier protein
1237 CAJPUJ010000027.1 GCA905373815_00621 CDS open 9872-11152 _na     426_aa mET17 O-acetylhomoserine aminocarboxypropyltransferase
1238 CAJPUJ010000027.1 GCA905373815_00622 CDS open 11297-12775 _na     492_aa DKNYY family protein
1239 CAJPUJ010000027.1 GCA905373815_00612 gene open 74-550
1240 CAJPUJ010000027.1 GCA905373815_00613 gene open 1036-1197
1241 CAJPUJ010000027.1 GCA905373815_00614 gene open 1426-1989
1242 CAJPUJ010000027.1 GCA905373815_00615 gene open 2301-2936
1243 CAJPUJ010000027.1 GCA905373815_00616 gene open 3444-4607
1244 CAJPUJ010000027.1 GCA905373815_00617 gene open 4645-5031
1245 CAJPUJ010000027.1 GCA905373815_00618 gene open 5351-7159
1246 CAJPUJ010000027.1 GCA905373815_00619 gene open 7393-8109
1247 CAJPUJ010000027.1 GCA905373815_00620 gene open 8561-9847 brnQ
1248 CAJPUJ010000027.1 GCA905373815_00621 gene open 9872-11152 mET17
1249 CAJPUJ010000027.1 GCA905373815_00622 gene open 11297-12775
1250 CAJPUJ010000028.1 GCA905373815_00623 CDS open 469-1947 _na     492_aa kdpD histidine kinase
1251 CAJPUJ010000028.1 GCA905373815_00624 CDS open 1932-2615 _na     227_aa ompR Chemotaxis protein CheY
1252 CAJPUJ010000028.1 GCA905373815_00625 CDS open 2771-4420 _na     549_aa fdhF formate dehydrogenase subunit alpha
1253 CAJPUJ010000028.1 GCA905373815_00626 CDS open 4469-5533 _na     354_aa Molybdopterin oxidoreductase Fe4S4 domain protein
1254 CAJPUJ010000028.1 GCA905373815_00627 CDS open 5550-7145 _na     531_aa rnfB Protein HymB
1255 CAJPUJ010000028.1 GCA905373815_00628 CDS open 7156-7641 _na     161_aa nuoE NAD(P)H-dependent oxidoreductase subunit E
1256 CAJPUJ010000028.1 GCA905373815_00629 CDS open 7958-8068 _na     36_aa hypothetical protein
1257 CAJPUJ010000028.1 GCA905373815_00630 CDS open 8068-8343 _na     91_aa ptsH HPr family phosphocarrier protein
1258 CAJPUJ010000028.1 GCA905373815_00631 CDS open 8584-9255 _na     223_aa lolD ABC transporter ATP-binding protein
1259 CAJPUJ010000028.1 GCA905373815_00632 CDS open 9257-10465 _na     402_aa lolE Putative hemin transport system permease protein HrtB
1260 CAJPUJ010000028.1 GCA905373815_00633 CDS open 10489-10947 _na     152_aa DUF4418 domain-containing protein
1261 CAJPUJ010000028.1 GCA905373815_00634 CDS open 10969-11388 _na     139_aa tpp15 FMN-binding domain-containing protein
1262 CAJPUJ010000028.1 GCA905373815_00635 CDS open 11404-12081 _na     225_aa lolD ABC transporter ATP-binding protein
1263 CAJPUJ010000028.1 GCA905373815_00636 CDS open 12085-13302 _na     405_aa lolE ABC transporter permease
1264 CAJPUJ010000028.1 GCA905373815_00637 CDS open 13292-14572 _na     426_aa lolE ABC transporter permease
1265 CAJPUJ010000028.1 GCA905373815_00638 CDS open 14574-15200 _na     208_aa Fe-S-containing protein
1266 CAJPUJ010000028.1 GCA905373815_00623 gene open 469-1947 kdpD
1267 CAJPUJ010000028.1 GCA905373815_00624 gene open 1932-2615 ompR
1268 CAJPUJ010000028.1 GCA905373815_00625 gene open 2771-4420 fdhF
1269 CAJPUJ010000028.1 GCA905373815_00626 gene open 4469-5533
1270 CAJPUJ010000028.1 GCA905373815_00627 gene open 5550-7145 rnfB
1271 CAJPUJ010000028.1 GCA905373815_00628 gene open 7156-7641 nuoE
1272 CAJPUJ010000028.1 GCA905373815_00629 gene open 7958-8068
1273 CAJPUJ010000028.1 GCA905373815_00630 gene open 8068-8343 ptsH
1274 CAJPUJ010000028.1 GCA905373815_00631 gene open 8584-9255 lolD
1275 CAJPUJ010000028.1 GCA905373815_00632 gene open 9257-10465 lolE
1276 CAJPUJ010000028.1 GCA905373815_00633 gene open 10489-10947
1277 CAJPUJ010000028.1 GCA905373815_00634 gene open 10969-11388 tpp15
1278 CAJPUJ010000028.1 GCA905373815_00635 gene open 11404-12081 lolD
1279 CAJPUJ010000028.1 GCA905373815_00636 gene open 12085-13302 lolE
1280 CAJPUJ010000028.1 GCA905373815_00637 gene open 13292-14572 lolE
1281 CAJPUJ010000028.1 GCA905373815_00638 gene open 14574-15200
1282 CAJPUJ010000029.1 GCA905373815_00639 CDS open 8-730 _na     240_aa CAAX protease
1283 CAJPUJ010000029.1 GCA905373815_00640 CDS open 793-1512 _na     239_aa CPBP family intramembrane metalloprotease
1284 CAJPUJ010000029.1 GCA905373815_00641 CDS open 1562-2269 _na     235_aa CAAX protease
1285 CAJPUJ010000029.1 GCA905373815_00642 CDS open 2329-3507 _na     392_aa abgB Amidohydrolase
1286 CAJPUJ010000029.1 GCA905373815_00643 CDS open 3541-4197 _na     218_aa Membrane protein
1287 CAJPUJ010000029.1 GCA905373815_00644 CDS open 4199-4921 _na     240_aa DUF5058 domain-containing protein
1288 CAJPUJ010000029.1 GCA905373815_00645 CDS open 5047-6591 _na     514_aa pucR PucR family transcriptional regulator ligand-binding domain-containing protein
1289 CAJPUJ010000029.1 GCA905373815_00646 CDS open 6767-7000 _na     77_aa Histidine kinase
1290 CAJPUJ010000029.1 GCA905373815_00647 CDS open 7133-8533 _na     466_aa lpdA dihydrolipoyl dehydrogenase
1291 CAJPUJ010000029.1 GCA905373815_00648 CDS open 8590-10683 _na     697_aa tex S1 motif domain-containing protein
1292 CAJPUJ010000029.1 GCA905373815_00649 CDS open 10998-11798 _na     266_aa DUF169 domain-containing protein
1293 CAJPUJ010000029.1 GCA905373815_00650 CDS open 11865-12782 _na     305_aa tehA C4-dicarboxylate ABC transporter
1294 CAJPUJ010000029.1 GCA905373815_00651 CDS open 13073-13477 _na     134_aa infC translation initiation factor IF-3
1295 CAJPUJ010000029.1 GCA905373815_00652 CDS open 13493-13684 _na     63_aa rpmI 50S ribosomal protein L35
1296 CAJPUJ010000029.1 GCA905373815_00653 CDS open 13703-14047 _na     114_aa rplT 50S ribosomal protein L20
1297 CAJPUJ010000029.1 GCA905373815_00654 CDS open 14036-14338 _na     100_aa hypothetical protein
1298 CAJPUJ010000029.1 GCA905373815_00639 gene open 8-730
1299 CAJPUJ010000029.1 GCA905373815_00640 gene open 793-1512
1300 CAJPUJ010000029.1 GCA905373815_00641 gene open 1562-2269
1301 CAJPUJ010000029.1 GCA905373815_00642 gene open 2329-3507 abgB
1302 CAJPUJ010000029.1 GCA905373815_00643 gene open 3541-4197
1303 CAJPUJ010000029.1 GCA905373815_00644 gene open 4199-4921
1304 CAJPUJ010000029.1 GCA905373815_00645 gene open 5047-6591 pucR
1305 CAJPUJ010000029.1 GCA905373815_00646 gene open 6767-7000
1306 CAJPUJ010000029.1 GCA905373815_00647 gene open 7133-8533 lpdA
1307 CAJPUJ010000029.1 GCA905373815_00648 gene open 8590-10683 tex
1308 CAJPUJ010000029.1 GCA905373815_00649 gene open 10998-11798
1309 CAJPUJ010000029.1 GCA905373815_00650 gene open 11865-12782 tehA
1310 CAJPUJ010000029.1 GCA905373815_00651 gene open 13073-13477 infC
1311 CAJPUJ010000029.1 GCA905373815_00652 gene open 13493-13684 rpmI
1312 CAJPUJ010000029.1 GCA905373815_00653 gene open 13703-14047 rplT
1313 CAJPUJ010000029.1 GCA905373815_00654 gene open 14036-14338
1314 CAJPUJ010000030.1 GCA905373815_00655 CDS open 48-356 _na     102_aa hypothetical protein
1315 CAJPUJ010000030.1 GCA905373815_00656 CDS open 386-526 _na     46_aa hypothetical protein
1316 CAJPUJ010000030.1 GCA905373815_00657 CDS open 504-743 _na     79_aa DUF6176 domain-containing protein
1317 CAJPUJ010000030.1 GCA905373815_00658 CDS open 771-1532 _na     253_aa ubiE Methyltransferase
1318 CAJPUJ010000030.1 GCA905373815_00659 CDS open 1563-2000 _na     145_aa rimI N-acetyltransferase domain-containing protein
1319 CAJPUJ010000030.1 GCA905373815_00660 CDS open 2181-3626 _na     481_aa gltX glutamate--tRNA ligase
1320 CAJPUJ010000030.1 GCA905373815_00661 CDS open 3643-5340 _na     565_aa DUF2207 domain-containing protein
1321 CAJPUJ010000030.1 GCA905373815_00662 CDS open 5433-7169 _na     578_aa DUF2207 domain-containing protein
1322 CAJPUJ010000030.1 GCA905373815_00663 CDS open 7215-7763 _na     182_aa lemA LemA family protein
1323 CAJPUJ010000030.1 GCA905373815_00664 CDS open 7898-8374 _na     158_aa yehR YehR family protein
1324 CAJPUJ010000030.1 GCA905373815_00665 CDS open 8607-9092 _na     161_aa yehR DUF1307 domain-containing protein
1325 CAJPUJ010000030.1 GCA905373815_00666 CDS open 9264-9740 _na     158_aa yehR DUF1307 domain-containing protein
1326 CAJPUJ010000030.1 GCA905373815_00667 CDS open 9929-10891 _na     320_aa znuA Manganese transporter
1327 CAJPUJ010000030.1 GCA905373815_00668 CDS open 10960-11670 _na     236_aa znuC ABC transporter ATP-binding protein
1328 CAJPUJ010000030.1 GCA905373815_00669 CDS open 11674-12558 _na     294_aa znuB Metal ABC transporter permease
1329 CAJPUJ010000030.1 GCA905373815_00670 CDS open 12555-13664 _na     369_aa znuB Metal ABC transporter permease
1330 CAJPUJ010000030.1 GCA905373815_00671 CDS open 13722-14216 _na     164_aa hisB1 D%2CD-heptose 1%2C7-bisphosphate phosphatase
1331 CAJPUJ010000030.1 GCA905373815_00655 gene open 48-356
1332 CAJPUJ010000030.1 GCA905373815_00656 gene open 386-526
1333 CAJPUJ010000030.1 GCA905373815_00657 gene open 504-743
1334 CAJPUJ010000030.1 GCA905373815_00658 gene open 771-1532 ubiE
1335 CAJPUJ010000030.1 GCA905373815_00659 gene open 1563-2000 rimI
1336 CAJPUJ010000030.1 GCA905373815_00660 gene open 2181-3626 gltX
1337 CAJPUJ010000030.1 GCA905373815_00661 gene open 3643-5340
1338 CAJPUJ010000030.1 GCA905373815_00662 gene open 5433-7169
1339 CAJPUJ010000030.1 GCA905373815_00663 gene open 7215-7763 lemA
1340 CAJPUJ010000030.1 GCA905373815_00664 gene open 7898-8374 yehR
1341 CAJPUJ010000030.1 GCA905373815_00665 gene open 8607-9092 yehR
1342 CAJPUJ010000030.1 GCA905373815_00666 gene open 9264-9740 yehR
1343 CAJPUJ010000030.1 GCA905373815_00667 gene open 9929-10891 znuA
1344 CAJPUJ010000030.1 GCA905373815_00668 gene open 10960-11670 znuC
1345 CAJPUJ010000030.1 GCA905373815_00669 gene open 11674-12558 znuB
1346 CAJPUJ010000030.1 GCA905373815_00670 gene open 12555-13664 znuB
1347 CAJPUJ010000030.1 GCA905373815_00671 gene open 13722-14216 hisB1
1348 CAJPUJ010000031.1 GCA905373815_00674 gene open 2595-2665 dfrA-dnaX
1349 CAJPUJ010000031.1 GCA905373815_00674 ncRNA open 2595-2665 dfrA-dnaX RNA
1350 CAJPUJ010000031.1 GCA905373815_00672 CDS open 349-1215 _na     288_aa BRO family protein
1351 CAJPUJ010000031.1 GCA905373815_00673 CDS open 1270-2496 _na     408_aa purD phosphoribosylamine--glycine ligase
1352 CAJPUJ010000031.1 GCA905373815_00675 CDS open 2857-6255 _na     1132_aa lolE ABC transporter ATP-binding protein
1353 CAJPUJ010000031.1 GCA905373815_00676 CDS open 6476-7423 _na     315_aa wcaG UDP-glucose 4-epimerase
1354 CAJPUJ010000031.1 GCA905373815_00677 CDS open 7445-8629 _na     394_aa bioF glycine C-acetyltransferase
1355 CAJPUJ010000031.1 GCA905373815_00678 CDS open 8924-10540 _na     538_aa degQ Trypsin-like peptidase domain-containing protein
1356 CAJPUJ010000031.1 GCA905373815_00679 CDS open 10651-11043 _na     130_aa Lipoprotein
1357 CAJPUJ010000031.1 GCA905373815_00680 CDS open 10995-11138 _na     47_aa hypothetical protein
1358 CAJPUJ010000031.1 GCA905373815_00681 CDS open 11491-13233 _na     580_aa srmB RNA helicase
1359 CAJPUJ010000031.1 GCA905373815_00682 CDS open 13249-13953 _na     234_aa spoU RNA methyltransferase
1360 CAJPUJ010000031.1 GCA905373815_00672 gene open 349-1215
1361 CAJPUJ010000031.1 GCA905373815_00673 gene open 1270-2496 purD
1362 CAJPUJ010000031.1 GCA905373815_00675 gene open 2857-6255 lolE
1363 CAJPUJ010000031.1 GCA905373815_00676 gene open 6476-7423 wcaG
1364 CAJPUJ010000031.1 GCA905373815_00677 gene open 7445-8629 bioF
1365 CAJPUJ010000031.1 GCA905373815_00678 gene open 8924-10540 degQ
1366 CAJPUJ010000031.1 GCA905373815_00679 gene open 10651-11043
1367 CAJPUJ010000031.1 GCA905373815_00680 gene open 10995-11138
1368 CAJPUJ010000031.1 GCA905373815_00681 gene open 11491-13233 srmB
1369 CAJPUJ010000031.1 GCA905373815_00682 gene open 13249-13953 spoU
1370 CAJPUJ010000032.1 repeat_region open 8701-10358 CRISPR array with 25 repeats of length 30%2C consensus sequence ATTTACATTACAGTATGTTTCTATTTAAAC and spacer length 36
1371 CAJPUJ010000032.1 GCA905373815_00683 CDS open 351-1400 _na     349_aa nrdB ribonucleotide-diphosphate reductase subunit beta
1372 CAJPUJ010000032.1 GCA905373815_00684 CDS open 1413-3938 _na     841_aa nrdD ribonucleoside-diphosphate reductase subunit alpha
1373 CAJPUJ010000032.1 GCA905373815_00685 CDS open 4120-4788 _na     222_aa trmB tRNA (guanosine(46)-N7)-methyltransferase TrmB
1374 CAJPUJ010000032.1 GCA905373815_00686 CDS open 5155-5856 _na     233_aa gph Hydrolase
1375 CAJPUJ010000032.1 GCA905373815_00687 CDS open 6132-6638 _na     168_aa DUF3899 domain-containing protein
1376 CAJPUJ010000032.1 GCA905373815_00688 CDS open 7274-7759 _na     161_aa ABC transporter permease
1377 CAJPUJ010000032.1 GCA905373815_00689 CDS open 7860-8420 _na     186_aa DUF4304 domain-containing protein
1378 CAJPUJ010000032.1 GCA905373815_00690 CDS open 10628-11410 _na     260_aa cmr6 type III-B CRISPR module RAMP protein Cmr6
1379 CAJPUJ010000032.1 GCA905373815_00691 CDS open 11403-11861 _na     152_aa hypothetical protein
1380 CAJPUJ010000032.1 GCA905373815_00692 CDS open 11851-12717 _na     288_aa cmr4 type III-B CRISPR module RAMP protein Cmr4
1381 CAJPUJ010000032.1 GCA905373815_00693 CDS open 12707-13873 _na     388_aa type III-B CRISPR module-associated Cmr3 family protein
1382 CAJPUJ010000032.1 GCA905373815_00683 gene open 351-1400 nrdB
1383 CAJPUJ010000032.1 GCA905373815_00684 gene open 1413-3938 nrdD
1384 CAJPUJ010000032.1 GCA905373815_00685 gene open 4120-4788 trmB
1385 CAJPUJ010000032.1 GCA905373815_00686 gene open 5155-5856 gph
1386 CAJPUJ010000032.1 GCA905373815_00687 gene open 6132-6638
1387 CAJPUJ010000032.1 GCA905373815_00688 gene open 7274-7759
1388 CAJPUJ010000032.1 GCA905373815_00689 gene open 7860-8420
1389 CAJPUJ010000032.1 GCA905373815_00690 gene open 10628-11410 cmr6
1390 CAJPUJ010000032.1 GCA905373815_00691 gene open 11403-11861
1391 CAJPUJ010000032.1 GCA905373815_00692 gene open 11851-12717 cmr4
1392 CAJPUJ010000032.1 GCA905373815_00693 gene open 12707-13873
1393 CAJPUJ010000033.1 GCA905373815_00694 CDS open 379-825 _na     148_aa dps Ferritin%2C Dps family protein
1394 CAJPUJ010000033.1 GCA905373815_00695 CDS open 1250-2953 _na     567_aa proS proline--tRNA ligase
1395 CAJPUJ010000033.1 GCA905373815_00696 CDS open 3072-4862 _na     596_aa cydD ABC transporter ATP-binding protein
1396 CAJPUJ010000033.1 GCA905373815_00697 CDS open 4852-6507 _na     551_aa mdlB ABC transporter ATP-binding protein
1397 CAJPUJ010000033.1 GCA905373815_00698 CDS open 6565-6972 _na     135_aa ybaN Inner membrane protein YbaN
1398 CAJPUJ010000033.1 GCA905373815_00699 CDS open 7189-9312 _na     707_aa nrdD anaerobic ribonucleoside-triphosphate reductase
1399 CAJPUJ010000033.1 GCA905373815_00700 CDS open 9325-9819 _na     164_aa nrdG anaerobic ribonucleoside-triphosphate reductase activating protein
1400 CAJPUJ010000033.1 GCA905373815_00701 CDS open 9822-10994 _na     390_aa fieF Cation diffusion facilitator family transporter
1401 CAJPUJ010000033.1 GCA905373815_00702 CDS open 11084-12829 _na     581_aa sunT ABC transporter ATP-binding protein
1402 CAJPUJ010000033.1 GCA905373815_00694 gene open 379-825 dps
1403 CAJPUJ010000033.1 GCA905373815_00695 gene open 1250-2953 proS
1404 CAJPUJ010000033.1 GCA905373815_00696 gene open 3072-4862 cydD
1405 CAJPUJ010000033.1 GCA905373815_00697 gene open 4852-6507 mdlB
1406 CAJPUJ010000033.1 GCA905373815_00698 gene open 6565-6972 ybaN
1407 CAJPUJ010000033.1 GCA905373815_00699 gene open 7189-9312 nrdD
1408 CAJPUJ010000033.1 GCA905373815_00700 gene open 9325-9819 nrdG
1409 CAJPUJ010000033.1 GCA905373815_00701 gene open 9822-10994 fieF
1410 CAJPUJ010000033.1 GCA905373815_00702 gene open 11084-12829 sunT
1411 CAJPUJ010000034.1 GCA905373815_00703 CDS open 100-612 _na     170_aa pncA Isochorismatase family protein
1412 CAJPUJ010000034.1 GCA905373815_00704 CDS open 786-1127 _na     113_aa hinT HIT family hydrolase
1413 CAJPUJ010000034.1 GCA905373815_00705 CDS open 1273-1452 _na     59_aa rpsU 30S ribosomal protein S21
1414 CAJPUJ010000034.1 GCA905373815_00706 CDS open 2017-3135 _na     372_aa marR Carbohydrate kinase
1415 CAJPUJ010000034.1 GCA905373815_00707 CDS open 3107-4027 _na     306_aa psuG Pseudouridine-5'-phosphate glycosidase
1416 CAJPUJ010000034.1 GCA905373815_00708 CDS open 4486-5169 _na     227_aa HAD family hydrolase
1417 CAJPUJ010000034.1 GCA905373815_00709 CDS open 5357-5902 _na     181_aa pseudouridine-5'-phosphate glycosidase
1418 CAJPUJ010000034.1 GCA905373815_00710 CDS open 6014-7429 _na     471_aa sunT ABC transporter permease
1419 CAJPUJ010000034.1 GCA905373815_00711 CDS open 7453-7773 _na     106_aa tfoX Competence protein TfoX
1420 CAJPUJ010000034.1 GCA905373815_00712 CDS open 7834-8193 _na     119_aa hypothetical protein
1421 CAJPUJ010000034.1 GCA905373815_00713 CDS open 8275-10899 _na     874_aa ppdK pyruvate%2C phosphate dikinase
1422 CAJPUJ010000034.1 GCA905373815_00714 CDS open 10913-11719 _na     268_aa ppsR Putative pyruvate%2C phosphate dikinase regulatory protein
1423 CAJPUJ010000034.1 GCA905373815_00715 CDS open 11933-13330 _na     465_aa erfK Peptidoglycan-binding protein
1424 CAJPUJ010000034.1 GCA905373815_00703 gene open 100-612 pncA
1425 CAJPUJ010000034.1 GCA905373815_00704 gene open 786-1127 hinT
1426 CAJPUJ010000034.1 GCA905373815_00705 gene open 1273-1452 rpsU
1427 CAJPUJ010000034.1 GCA905373815_00706 gene open 2017-3135 marR
1428 CAJPUJ010000034.1 GCA905373815_00707 gene open 3107-4027 psuG
1429 CAJPUJ010000034.1 GCA905373815_00708 gene open 4486-5169
1430 CAJPUJ010000034.1 GCA905373815_00709 gene open 5357-5902
1431 CAJPUJ010000034.1 GCA905373815_00710 gene open 6014-7429 sunT
1432 CAJPUJ010000034.1 GCA905373815_00711 gene open 7453-7773 tfoX
1433 CAJPUJ010000034.1 GCA905373815_00712 gene open 7834-8193
1434 CAJPUJ010000034.1 GCA905373815_00713 gene open 8275-10899 ppdK
1435 CAJPUJ010000034.1 GCA905373815_00714 gene open 10913-11719 ppsR
1436 CAJPUJ010000034.1 GCA905373815_00715 gene open 11933-13330 erfK
1437 CAJPUJ010000035.1 GCA905373815_00716 CDS open 63-362 _na     99_aa hypothetical protein
1438 CAJPUJ010000035.1 GCA905373815_00717 CDS open 378-629 _na     83_aa ireB IreB family regulatory phosphoprotein
1439 CAJPUJ010000035.1 GCA905373815_00718 CDS open 685-1110 _na     141_aa ruvX Holliday junction resolvase RuvX
1440 CAJPUJ010000035.1 GCA905373815_00719 CDS open 1121-1363 _na     80_aa DUF1292 domain-containing protein
1441 CAJPUJ010000035.1 GCA905373815_00720 CDS open 1379-1822 _na     147_aa fur Fur family transcriptional regulator
1442 CAJPUJ010000035.1 GCA905373815_00721 CDS open 1832-3505 _na     557_aa rnjA Ribonuclease J
1443 CAJPUJ010000035.1 GCA905373815_00722 CDS open 3514-3837 _na     107_aa ylbF YlbF family regulator
1444 CAJPUJ010000035.1 GCA905373815_00723 CDS open 3837-4475 _na     212_aa trmR tRNA 5-hydroxyuridine methyltransferase
1445 CAJPUJ010000035.1 GCA905373815_00724 CDS open 4542-5771 _na     409_aa rlhA Peptidase%2C U32 family
1446 CAJPUJ010000035.1 GCA905373815_00725 CDS open 5787-6323 _na     178_aa rimL GNAT family acetyltransferase
1447 CAJPUJ010000035.1 GCA905373815_00726 CDS open 6505-6771 _na     88_aa rpsO 30S ribosomal protein S15
1448 CAJPUJ010000035.1 GCA905373815_00727 CDS open 6828-8927 _na     699_aa pnp polyribonucleotide nucleotidyltransferase
1449 CAJPUJ010000035.1 GCA905373815_00728 CDS open 9003-9992 _na     329_aa trpS tryptophan--tRNA ligase
1450 CAJPUJ010000035.1 GCA905373815_00729 CDS open 10213-10380 _na     55_aa hypothetical protein
1451 CAJPUJ010000035.1 GCA905373815_00730 CDS open 10410-11105 _na     231_aa Uracil-DNA glycosylase-like domain-containing protein
1452 CAJPUJ010000035.1 GCA905373815_00731 CDS open 11155-12555 _na     466_aa murC UDP-N-acetylmuramate--L-alanine ligase
1453 CAJPUJ010000035.1 GCA905373815_00732 CDS open 12671-13168 _na     165_aa Lipoprotein
1454 CAJPUJ010000035.1 GCA905373815_00716 gene open 63-362
1455 CAJPUJ010000035.1 GCA905373815_00717 gene open 378-629 ireB
1456 CAJPUJ010000035.1 GCA905373815_00718 gene open 685-1110 ruvX
1457 CAJPUJ010000035.1 GCA905373815_00719 gene open 1121-1363
1458 CAJPUJ010000035.1 GCA905373815_00720 gene open 1379-1822 fur
1459 CAJPUJ010000035.1 GCA905373815_00721 gene open 1832-3505 rnjA
1460 CAJPUJ010000035.1 GCA905373815_00722 gene open 3514-3837 ylbF
1461 CAJPUJ010000035.1 GCA905373815_00723 gene open 3837-4475 trmR
1462 CAJPUJ010000035.1 GCA905373815_00724 gene open 4542-5771 rlhA
1463 CAJPUJ010000035.1 GCA905373815_00725 gene open 5787-6323 rimL
1464 CAJPUJ010000035.1 GCA905373815_00726 gene open 6505-6771 rpsO
1465 CAJPUJ010000035.1 GCA905373815_00727 gene open 6828-8927 pnp
1466 CAJPUJ010000035.1 GCA905373815_00728 gene open 9003-9992 trpS
1467 CAJPUJ010000035.1 GCA905373815_00729 gene open 10213-10380
1468 CAJPUJ010000035.1 GCA905373815_00730 gene open 10410-11105
1469 CAJPUJ010000035.1 GCA905373815_00731 gene open 11155-12555 murC
1470 CAJPUJ010000035.1 GCA905373815_00732 gene open 12671-13168
1471 CAJPUJ010000036.1 GCA905373815_00733 CDS open 185-745 _na     186_aa hpt hypoxanthine phosphoribosyltransferase
1472 CAJPUJ010000036.1 GCA905373815_00734 CDS open 764-2719 _na     651_aa ftsH ATP-dependent zinc metalloprotease FtsH
1473 CAJPUJ010000036.1 GCA905373815_00735 CDS open 2770-3246 _na     158_aa DUF5673 domain-containing protein
1474 CAJPUJ010000036.1 GCA905373815_00736 CDS open 3246-4121 _na     291_aa alkA DNA-(apurinic or apyrimidinic site) lyase
1475 CAJPUJ010000036.1 GCA905373815_00737 CDS open 4287-4829 _na     180_aa aF2118 Cro/Cl family transcriptional regulator
1476 CAJPUJ010000036.1 GCA905373815_00738 CDS open 4839-5888 _na     349_aa potA spermidine/putrescine ABC transporter ATP-binding protein
1477 CAJPUJ010000036.1 GCA905373815_00739 CDS open 5889-6716 _na     275_aa potB ABC transporter permease
1478 CAJPUJ010000036.1 GCA905373815_00740 CDS open 6706-7482 _na     258_aa potC Spermidine/putrescine ABC transporter permease
1479 CAJPUJ010000036.1 GCA905373815_00741 CDS open 7475-8509 _na     344_aa potD Putrescine ABC transporter%2C periplasmic spermidine
1480 CAJPUJ010000036.1 GCA905373815_00742 CDS open 8553-9578 _na     341_aa frvX Aminopeptidase
1481 CAJPUJ010000036.1 GCA905373815_00743 CDS open 9709-9936 _na     75_aa Lipoprotein
1482 CAJPUJ010000036.1 GCA905373815_00744 CDS open 9960-11459 _na     499_aa pepD C69 family dipeptidase
1483 CAJPUJ010000036.1 GCA905373815_00745 CDS open 11610-12467 _na     285_aa pdxS pyridoxal 5'-phosphate synthase lyase subunit PdxS
1484 CAJPUJ010000036.1 GCA905373815_00746 CDS open 12560-13117 _na     185_aa thiN thiamine diphosphokinase
1485 CAJPUJ010000036.1 GCA905373815_00733 gene open 185-745 hpt
1486 CAJPUJ010000036.1 GCA905373815_00734 gene open 764-2719 ftsH
1487 CAJPUJ010000036.1 GCA905373815_00735 gene open 2770-3246
1488 CAJPUJ010000036.1 GCA905373815_00736 gene open 3246-4121 alkA
1489 CAJPUJ010000036.1 GCA905373815_00737 gene open 4287-4829 aF2118
1490 CAJPUJ010000036.1 GCA905373815_00738 gene open 4839-5888 potA
1491 CAJPUJ010000036.1 GCA905373815_00739 gene open 5889-6716 potB
1492 CAJPUJ010000036.1 GCA905373815_00740 gene open 6706-7482 potC
1493 CAJPUJ010000036.1 GCA905373815_00741 gene open 7475-8509 potD
1494 CAJPUJ010000036.1 GCA905373815_00742 gene open 8553-9578 frvX
1495 CAJPUJ010000036.1 GCA905373815_00743 gene open 9709-9936
1496 CAJPUJ010000036.1 GCA905373815_00744 gene open 9960-11459 pepD
1497 CAJPUJ010000036.1 GCA905373815_00745 gene open 11610-12467 pdxS
1498 CAJPUJ010000036.1 GCA905373815_00746 gene open 12560-13117 thiN
1499 CAJPUJ010000037.1 regulatory_region open 9625-9738 FMN riboswitch aptamer (RFN element)
1500 CAJPUJ010000037.1 GCA905373815_00747 CDS open 393-872 _na     159_aa cdnL CarD family transcriptional regulator