BAKTAGenome Explorer: Kingella denitrificans (GCA_916719905.1)
Select a Genome:
|
BAKTA Annotations for GCA_916719905.1
|
Search & Sort all 3664 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 3501 | CAKAPP010000156.1 | GCA916719905_01748 | gene | open | 2-250 | |||
| 3502 | CAKAPP010000156.1 | GCA916719905_01749 | gene | open | 517-1230 | yobV | ||
| 3503 | CAKAPP010000156.1 | GCA916719905_01750 | gene | open | 1349-1942 | gstA | ||
| 3504 | CAKAPP010000156.1 | GCA916719905_01751 | gene | open | 2480-3133 | |||
| 3505 | CAKAPP010000157.1 | GCA916719905_01752 | CDS | open | 36-470 | _na 144_aa | moaC | cyclic pyranopterin monophosphate synthase MoaC |
| 3506 | CAKAPP010000157.1 | GCA916719905_01753 | CDS | open | 530-1015 | _na 161_aa | Secreted protein | |
| 3507 | CAKAPP010000157.1 | GCA916719905_01754 | CDS | open | 1093-1341 | _na 82_aa | moaD | molybdopterin converting factor subunit 1 |
| 3508 | CAKAPP010000157.1 | GCA916719905_01755 | CDS | open | 1343-1780 | _na 145_aa | Molybdopterin synthase catalytic subunit | |
| 3509 | CAKAPP010000157.1 | GCA916719905_01756 | CDS | open | 1857-2411 | _na 184_aa | Transmembrane protein | |
| 3510 | CAKAPP010000157.1 | GCA916719905_01757 | CDS | open | 2489-3220 | _na 243_aa | hypothetical protein | |
| 3511 | CAKAPP010000157.1 | GCA916719905_01752 | gene | open | 36-470 | moaC | ||
| 3512 | CAKAPP010000157.1 | GCA916719905_01753 | gene | open | 530-1015 | |||
| 3513 | CAKAPP010000157.1 | GCA916719905_01754 | gene | open | 1093-1341 | moaD | ||
| 3514 | CAKAPP010000157.1 | GCA916719905_01755 | gene | open | 1343-1780 | |||
| 3515 | CAKAPP010000157.1 | GCA916719905_01756 | gene | open | 1857-2411 | |||
| 3516 | CAKAPP010000157.1 | GCA916719905_01757 | gene | open | 2489-3220 | |||
| 3517 | CAKAPP010000158.1 | GCA916719905_01758 | CDS | open | 51-1178 | _na 375_aa | dapE | succinyl-diaminopimelate desuccinylase |
| 3518 | CAKAPP010000158.1 | GCA916719905_01759 | CDS | open | 1212-1985 | _na 257_aa | hypothetical protein | |
| 3519 | CAKAPP010000158.1 | GCA916719905_01760 | CDS | open | 2057-2551 | _na 164_aa | Antioxidant%2C AhpC/TSA family | |
| 3520 | CAKAPP010000158.1 | GCA916719905_01761 | CDS | open | 2750-3169 | _na 139_aa | DUF4189 domain-containing protein | |
| 3521 | CAKAPP010000158.1 | GCA916719905_01758 | gene | open | 51-1178 | dapE | ||
| 3522 | CAKAPP010000158.1 | GCA916719905_01759 | gene | open | 1212-1985 | |||
| 3523 | CAKAPP010000158.1 | GCA916719905_01760 | gene | open | 2057-2551 | |||
| 3524 | CAKAPP010000158.1 | GCA916719905_01761 | gene | open | 2750-3169 | |||
| 3525 | CAKAPP010000159.1 | GCA916719905_01762 | CDS | open | 68-1846 | _na 592_aa | Type III pantothenate kinase | |
| 3526 | CAKAPP010000159.1 | GCA916719905_01763 | CDS | open | 1967-2515 | _na 182_aa | yciW | Alkylhydroperoxidase AhpD family core domain protein |
| 3527 | CAKAPP010000159.1 | GCA916719905_01764 | CDS | open | 2547-3056 | _na 169_aa | hypothetical protein | |
| 3528 | CAKAPP010000159.1 | GCA916719905_01762 | gene | open | 68-1846 | |||
| 3529 | CAKAPP010000159.1 | GCA916719905_01763 | gene | open | 1967-2515 | yciW | ||
| 3530 | CAKAPP010000159.1 | GCA916719905_01764 | gene | open | 2547-3056 | |||
| 3531 | CAKAPP010000160.1 | GCA916719905_01765 | CDS | open | 409-891 | _na 160_aa | hypothetical protein | |
| 3532 | CAKAPP010000160.1 | GCA916719905_01766 | CDS | open | 1288-3195 | _na 635_aa | RNB-like protein | |
| 3533 | CAKAPP010000160.1 | GCA916719905_01765 | gene | open | 409-891 | |||
| 3534 | CAKAPP010000160.1 | GCA916719905_01766 | gene | open | 1288-3195 | |||
| 3535 | CAKAPP010000161.1 | GCA916719905_01767 | CDS | open | 136-1635 | _na 499_aa | Amino acid carrier protein | |
| 3536 | CAKAPP010000161.1 | GCA916719905_01768 | CDS | open | 1733-1828 | _na 31_aa | hypothetical protein | |
| 3537 | CAKAPP010000161.1 | GCA916719905_01769 | CDS | open | 1872-2987 | _na 371_aa | asd | aspartate-semialdehyde dehydrogenase |
| 3538 | CAKAPP010000161.1 | GCA916719905_01767 | gene | open | 136-1635 | |||
| 3539 | CAKAPP010000161.1 | GCA916719905_01768 | gene | open | 1733-1828 | |||
| 3540 | CAKAPP010000161.1 | GCA916719905_01769 | gene | open | 1872-2987 | asd | ||
| 3541 | CAKAPP010000161.1 | GCA916719905_01770 | gene | open | 3123-3176 | |||
| 3542 | CAKAPP010000161.1 | GCA916719905_01770 | tRNA | open | 3123-3176 | tRNA-Xxx | ||
| 3543 | CAKAPP010000162.1 | GCA916719905_01771 | CDS | open | 101-682 | _na 193_aa | metW | methionine biosynthesis protein MetW |
| 3544 | CAKAPP010000162.1 | GCA916719905_01772 | CDS | open | 706-1293 | _na 195_aa | Glutamine amidotransferase%2C class I | |
| 3545 | CAKAPP010000162.1 | GCA916719905_01773 | CDS | open | 1333-2403 | _na 356_aa | rfbB | dTDP-glucose 4%2C6-dehydratase |
| 3546 | CAKAPP010000162.1 | GCA916719905_01771 | gene | open | 101-682 | metW | ||
| 3547 | CAKAPP010000162.1 | GCA916719905_01772 | gene | open | 706-1293 | |||
| 3548 | CAKAPP010000162.1 | GCA916719905_01773 | gene | open | 1333-2403 | rfbB | ||
| 3549 | CAKAPP010000163.1 | GCA916719905_01774 | CDS | open | 13-306 | _na 97_aa | hypothetical protein | |
| 3550 | CAKAPP010000163.1 | GCA916719905_01775 | CDS | open | 474-2165 | _na 563_aa | rpsA | 30S ribosomal protein S1 |
| 3551 | CAKAPP010000163.1 | GCA916719905_01776 | CDS | open | 2178-2477 | _na 99_aa | integration host factor subunit beta | |
| 3552 | CAKAPP010000163.1 | GCA916719905_01777 | CDS | open | 2606-2983 | _na 125_aa | Holo-[acyl-carrier-protein] synthase | |
| 3553 | CAKAPP010000163.1 | GCA916719905_01774 | gene | open | 13-306 | |||
| 3554 | CAKAPP010000163.1 | GCA916719905_01775 | gene | open | 474-2165 | rpsA | ||
| 3555 | CAKAPP010000163.1 | GCA916719905_01776 | gene | open | 2178-2477 | |||
| 3556 | CAKAPP010000163.1 | GCA916719905_01777 | gene | open | 2606-2983 | |||
| 3557 | CAKAPP010000164.1 | GCA916719905_01778 | CDS | open | 683-1090 | _na 135_aa | Glyoxalase family protein | |
| 3558 | CAKAPP010000164.1 | GCA916719905_01779 | CDS | open | 1184-2659 | _na 491_aa | trpE | anthranilate synthase component I |
| 3559 | CAKAPP010000164.1 | GCA916719905_01780 | CDS | open | 2656-3069 | _na 137_aa | hypothetical protein | |
| 3560 | CAKAPP010000164.1 | GCA916719905_01778 | gene | open | 683-1090 | |||
| 3561 | CAKAPP010000164.1 | GCA916719905_01779 | gene | open | 1184-2659 | trpE | ||
| 3562 | CAKAPP010000164.1 | GCA916719905_01780 | gene | open | 2656-3069 | |||
| 3563 | CAKAPP010000165.1 | GCA916719905_01781 | CDS | open | 84-725 | _na 213_aa | DUF218 domain-containing protein | |
| 3564 | CAKAPP010000165.1 | GCA916719905_01782 | CDS | open | 722-1081 | _na 119_aa | arsC | arsenate reductase (glutaredoxin) |
| 3565 | CAKAPP010000165.1 | GCA916719905_01783 | CDS | open | 1179-1739 | _na 186_aa | ampD | 1%2C6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD |
| 3566 | CAKAPP010000165.1 | GCA916719905_01784 | CDS | open | 1974-2777 | _na 267_aa | hypothetical protein | |
| 3567 | CAKAPP010000165.1 | GCA916719905_01781 | gene | open | 84-725 | |||
| 3568 | CAKAPP010000165.1 | GCA916719905_01782 | gene | open | 722-1081 | arsC | ||
| 3569 | CAKAPP010000165.1 | GCA916719905_01783 | gene | open | 1179-1739 | ampD | ||
| 3570 | CAKAPP010000165.1 | GCA916719905_01784 | gene | open | 1974-2777 | |||
| 3571 | CAKAPP010000166.1 | GCA916719905_01785 | CDS | open | 115-933 | _na 272_aa | ADP-ribosylglycohydrolase | |
| 3572 | CAKAPP010000166.1 | GCA916719905_01786 | CDS | open | 1020-1436 | _na 138_aa | hypothetical protein | |
| 3573 | CAKAPP010000166.1 | GCA916719905_01787 | CDS | open | 1525-1941 | _na 138_aa | hypothetical protein | |
| 3574 | CAKAPP010000166.1 | GCA916719905_01788 | CDS | open | 2120-2971 | _na 283_aa | DUF711 domain-containing protein | |
| 3575 | CAKAPP010000166.1 | GCA916719905_01785 | gene | open | 115-933 | |||
| 3576 | CAKAPP010000166.1 | GCA916719905_01786 | gene | open | 1020-1436 | |||
| 3577 | CAKAPP010000166.1 | GCA916719905_01787 | gene | open | 1525-1941 | |||
| 3578 | CAKAPP010000166.1 | GCA916719905_01788 | gene | open | 2120-2971 | |||
| 3579 | CAKAPP010000167.1 | GCA916719905_01789 | CDS | open | 175-660 | _na 161_aa | hypothetical protein | |
| 3580 | CAKAPP010000167.1 | GCA916719905_01790 | CDS | open | 741-1049 | _na 102_aa | hypothetical protein | |
| 3581 | CAKAPP010000167.1 | GCA916719905_01791 | CDS | open | 1523-2704 | _na 393_aa | dapC | succinyldiaminopimelate transaminase |
| 3582 | CAKAPP010000167.1 | GCA916719905_01789 | gene | open | 175-660 | |||
| 3583 | CAKAPP010000167.1 | GCA916719905_01790 | gene | open | 741-1049 | |||
| 3584 | CAKAPP010000167.1 | GCA916719905_01791 | gene | open | 1523-2704 | dapC | ||
| 3585 | CAKAPP010000168.1 | GCA916719905_01792 | CDS | open | 33-1310 | _na 425_aa | purB | adenylosuccinate lyase |
| 3586 | CAKAPP010000168.1 | GCA916719905_01793 | CDS | open | 1322-1807 | _na 161_aa | DUF2231 domain-containing protein | |
| 3587 | CAKAPP010000168.1 | GCA916719905_01794 | CDS | open | 1871-2689 | _na 272_aa | mutM | bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase |
| 3588 | CAKAPP010000168.1 | GCA916719905_01792 | gene | open | 33-1310 | purB | ||
| 3589 | CAKAPP010000168.1 | GCA916719905_01793 | gene | open | 1322-1807 | |||
| 3590 | CAKAPP010000168.1 | GCA916719905_01794 | gene | open | 1871-2689 | mutM | ||
| 3591 | CAKAPP010000169.1 | GCA916719905_01795 | CDS | open | 591-2090 | _na 499_aa | nusA | Transcription termination/antitermination protein NusA |
| 3592 | CAKAPP010000169.1 | GCA916719905_01796 | CDS | open | 2197-2634 | _na 145_aa | rimP | ribosome maturation factor RimP |
| 3593 | CAKAPP010000169.1 | GCA916719905_01795 | gene | open | 591-2090 | nusA | ||
| 3594 | CAKAPP010000169.1 | GCA916719905_01796 | gene | open | 2197-2634 | rimP | ||
| 3595 | CAKAPP010000170.1 | GCA916719905_01797 | CDS | open | 28-213 | _na 61_aa | hypothetical protein | |
| 3596 | CAKAPP010000170.1 | GCA916719905_01798 | CDS | open | 401-811 | _na 136_aa | PepSY domain-containing protein | |
| 3597 | CAKAPP010000170.1 | GCA916719905_01799 | CDS | open | 890-1198 | _na 102_aa | Peptidase propeptide and YPEB domain protein | |
| 3598 | CAKAPP010000170.1 | GCA916719905_01800 | CDS | open | 1368-1667 | _na 99_aa | hypothetical protein | |
| 3599 | CAKAPP010000170.1 | GCA916719905_01801 | CDS | open | 1809-2777 | _na 322_aa | Integral membrane protein | |
| 3600 | CAKAPP010000170.1 | GCA916719905_01797 | gene | open | 28-213 | |||
| 3601 | CAKAPP010000170.1 | GCA916719905_01798 | gene | open | 401-811 | |||
| 3602 | CAKAPP010000170.1 | GCA916719905_01799 | gene | open | 890-1198 | |||
| 3603 | CAKAPP010000170.1 | GCA916719905_01800 | gene | open | 1368-1667 | |||
| 3604 | CAKAPP010000170.1 | GCA916719905_01801 | gene | open | 1809-2777 | |||
| 3605 | CAKAPP010000171.1 | GCA916719905_01802 | CDS | open | 261-1157 | _na 298_aa | Calcineurin-like phosphoesterase domain-containing protein | |
| 3606 | CAKAPP010000171.1 | GCA916719905_01803 | CDS | open | 1235-1453 | _na 72_aa | hypothetical protein | |
| 3607 | CAKAPP010000171.1 | GCA916719905_01804 | CDS | open | 1498-2337 | _na 279_aa | Nudix hydrolase domain-containing protein | |
| 3608 | CAKAPP010000171.1 | GCA916719905_01805 | CDS | open | 2429-2788 | _na 119_aa | hypothetical protein | |
| 3609 | CAKAPP010000171.1 | GCA916719905_01802 | gene | open | 261-1157 | |||
| 3610 | CAKAPP010000171.1 | GCA916719905_01803 | gene | open | 1235-1453 | |||
| 3611 | CAKAPP010000171.1 | GCA916719905_01804 | gene | open | 1498-2337 | |||
| 3612 | CAKAPP010000171.1 | GCA916719905_01805 | gene | open | 2429-2788 | |||
| 3613 | CAKAPP010000172.1 | GCA916719905_01806 | CDS | open | 262-2775 | _na 837_aa | ileS | isoleucine--tRNA ligase |
| 3614 | CAKAPP010000172.1 | GCA916719905_01806 | gene | open | 262-2775 | ileS | ||
| 3615 | CAKAPP010000173.1 | GCA916719905_01807 | CDS | open | 162-494 | _na 110_aa | DUF883 domain-containing protein | |
| 3616 | CAKAPP010000173.1 | GCA916719905_01808 | CDS | open | 589-1014 | _na 141_aa | hypothetical protein | |
| 3617 | CAKAPP010000173.1 | GCA916719905_01809 | CDS | open | 1004-1360 | _na 118_aa | DUF3618 domain-containing protein | |
| 3618 | CAKAPP010000173.1 | GCA916719905_01810 | CDS | open | 1682-2713 | _na 343_aa | gumN | GumN protein |
| 3619 | CAKAPP010000173.1 | GCA916719905_01807 | gene | open | 162-494 | |||
| 3620 | CAKAPP010000173.1 | GCA916719905_01808 | gene | open | 589-1014 | |||
| 3621 | CAKAPP010000173.1 | GCA916719905_01809 | gene | open | 1004-1360 | |||
| 3622 | CAKAPP010000173.1 | GCA916719905_01810 | gene | open | 1682-2713 | gumN | ||
| 3623 | CAKAPP010000174.1 | GCA916719905_01811 | CDS | open | 487-720 | _na 77_aa | hypothetical protein | |
| 3624 | CAKAPP010000174.1 | GCA916719905_01812 | CDS | open | 836-1732 | _na 298_aa | rdgC | Recombination-associated protein RdgC |
| 3625 | CAKAPP010000174.1 | GCA916719905_01813 | CDS | open | 1935-2762 | _na 275_aa | 8-oxo-dGTP diphosphatase | |
| 3626 | CAKAPP010000174.1 | GCA916719905_01811 | gene | open | 487-720 | |||
| 3627 | CAKAPP010000174.1 | GCA916719905_01812 | gene | open | 836-1732 | rdgC | ||
| 3628 | CAKAPP010000174.1 | GCA916719905_01813 | gene | open | 1935-2762 | |||
| 3629 | CAKAPP010000175.1 | GCA916719905_01814 | CDS | open | 176-919 | _na 247_aa | rlpA | Endolytic peptidoglycan transglycosylase RlpA |
| 3630 | CAKAPP010000175.1 | GCA916719905_01815 | CDS | open | 1013-1477 | _na 154_aa | trmL | tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL |
| 3631 | CAKAPP010000175.1 | GCA916719905_01816 | CDS | open | 1586-2284 | _na 232_aa | comF | ComF family protein |
| 3632 | CAKAPP010000175.1 | GCA916719905_01814 | gene | open | 176-919 | rlpA | ||
| 3633 | CAKAPP010000175.1 | GCA916719905_01815 | gene | open | 1013-1477 | trmL | ||
| 3634 | CAKAPP010000175.1 | GCA916719905_01816 | gene | open | 1586-2284 | comF | ||
| 3635 | CAKAPP010000176.1 | GCA916719905_01817 | CDS | open | 133-1224 | _na 363_aa | hypothetical protein | |
| 3636 | CAKAPP010000176.1 | GCA916719905_01818 | CDS | open | 1377-2621 | _na 414_aa | Surface lipoprotein assembly modifier C-terminal beta-barrel domain-containing protein | |
| 3637 | CAKAPP010000176.1 | GCA916719905_01817 | gene | open | 133-1224 | |||
| 3638 | CAKAPP010000176.1 | GCA916719905_01818 | gene | open | 1377-2621 | |||
| 3639 | CAKAPP010000177.1 | GCA916719905_01819 | CDS | open | 397-873 | _na 158_aa | DUF302 domain-containing protein | |
| 3640 | CAKAPP010000177.1 | GCA916719905_01820 | CDS | open | 974-1780 | _na 268_aa | DUF2071 domain-containing protein | |
| 3641 | CAKAPP010000177.1 | GCA916719905_01821 | CDS | open | 1885-2589 | _na 234_aa | Tat pathway signal sequence domain protein | |
| 3642 | CAKAPP010000177.1 | GCA916719905_01819 | gene | open | 397-873 | |||
| 3643 | CAKAPP010000177.1 | GCA916719905_01820 | gene | open | 974-1780 | |||
| 3644 | CAKAPP010000177.1 | GCA916719905_01821 | gene | open | 1885-2589 | |||
| 3645 | CAKAPP010000178.1 | GCA916719905_01822 | CDS | open | 277-1047 | _na 256_aa | 1-acyl-sn-glycerol-3-phosphate acyltransferase | |
| 3646 | CAKAPP010000178.1 | GCA916719905_01823 | CDS | open | 1176-2069 | _na 297_aa | ADP-dependent (S)-NAD(P)H-hydrate dehydratase | |
| 3647 | CAKAPP010000178.1 | GCA916719905_01824 | CDS | open | 2155-2565 | _na 136_aa | Ribosomal protein P2 | |
| 3648 | CAKAPP010000178.1 | GCA916719905_01822 | gene | open | 277-1047 | |||
| 3649 | CAKAPP010000178.1 | GCA916719905_01823 | gene | open | 1176-2069 | |||
| 3650 | CAKAPP010000178.1 | GCA916719905_01824 | gene | open | 2155-2565 | |||
| 3651 | CAKAPP010000179.1 | GCA916719905_01825 | CDS | open | 66-515 | _na 149_aa | dtd | D-aminoacyl-tRNA deacylase |
| 3652 | CAKAPP010000179.1 | GCA916719905_01826 | CDS | open | 534-1694 | _na 386_aa | Protein-arginine rhamnosyltransferase | |
| 3653 | CAKAPP010000179.1 | GCA916719905_01827 | CDS | open | 1783-2538 | _na 251_aa | extracellular solute-binding protein | |
| 3654 | CAKAPP010000179.1 | GCA916719905_01825 | gene | open | 66-515 | dtd | ||
| 3655 | CAKAPP010000179.1 | GCA916719905_01826 | gene | open | 534-1694 | |||
| 3656 | CAKAPP010000179.1 | GCA916719905_01827 | gene | open | 1783-2538 | |||
| 3657 | CAKAPP010000180.1 | repeat_region | open | 1125-1298 | CRISPR array with 3 repeats of length 32%2C consensus sequence GTTTCAACACACAGCCACCCGAAGGTGGCTGG and spacer length 34 | |||
| 3658 | CAKAPP010000180.1 | repeat_region | open | 1323-2557 | CRISPR array with 19 repeats of length 32%2C consensus sequence GTTTCAACACACAGCCGCCTGAAGGCGGCTGG and spacer length 34 | |||
| 3659 | CAKAPP010000180.1 | GCA916719905_01828 | CDS | open | 69-590 | _na 173_aa | hypothetical protein | |
| 3660 | CAKAPP010000180.1 | GCA916719905_01828 | gene | open | 69-590 | |||
| 3661 | CAKAPP010000181.1 | GCA916719905_01829 | CDS | open | 48-1805 | _na 585_aa | NADP-dependent malic enzyme | |
| 3662 | CAKAPP010000181.1 | GCA916719905_01830 | CDS | open | 2262-2552 | _na 96_aa | hypothetical protein | |
| 3663 | CAKAPP010000181.1 | GCA916719905_01829 | gene | open | 48-1805 | |||
| 3664 | CAKAPP010000181.1 | GCA916719905_01830 | gene | open | 2262-2552 |
