HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Aggregatibacter segnis (GCA_934255625.1)

Select a Genome:
BAKTA Annotations for GCA_934255625.1
Genome Selected: Aggregatibacter segnis
ContigsBases CDSrRNA tmRNAtRNA
33 1,877,499 1757 2 1 46
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3659 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:3]    |    Number of Records Found: 3659 [8 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1001 CAKQOR010000004.1 GCA934255625_00544 CDS open 92066-92689 _na     207_aa lexA transcriptional repressor LexA
1002 CAKQOR010000004.1 GCA934255625_00545 CDS open 92841-93218 _na     125_aa rpsF 30S ribosomal protein S6
1003 CAKQOR010000004.1 GCA934255625_00546 CDS open 93205-93531 _na     108_aa priB primosomal replication protein N
1004 CAKQOR010000004.1 GCA934255625_00547 CDS open 93544-93774 _na     76_aa rpsR 30S ribosomal protein S18
1005 CAKQOR010000004.1 GCA934255625_00548 CDS open 93790-94239 _na     149_aa rplI 50S ribosomal protein L9
1006 CAKQOR010000004.1 GCA934255625_00549 CDS open 94281-94406 _na     41_aa hypothetical protein
1007 CAKQOR010000004.1 GCA934255625_00550 CDS open 94452-95567 _na     371_aa dprA DNA-processing protein DprA
1008 CAKQOR010000004.1 GCA934255625_00551 CDS open 95618-95788 _na     56_aa Zinc-finger domain-containing protein
1009 CAKQOR010000004.1 GCA934255625_00552 CDS open 95788-96423 _na     211_aa RNA polymerase sigma factor
1010 CAKQOR010000004.1 GCA934255625_00553 CDS open 96535-96825 _na     96_aa Pentapeptide MXKDX repeat protein
1011 CAKQOR010000004.1 GCA934255625_00554 CDS open 97057-99030 _na     657_aa Sulfatase domain protein
1012 CAKQOR010000004.1 GCA934255625_00555 CDS open 99099-99758 _na     219_aa NAD(P)H-flavin oxidoreductase
1013 CAKQOR010000004.1 GCA934255625_00556 CDS open 99876-100169 _na     97_aa yggU DUF167 domain-containing protein
1014 CAKQOR010000004.1 GCA934255625_00557 CDS open 100196-100756 _na     186_aa YGGT family protein
1015 CAKQOR010000004.1 GCA934255625_00558 CDS open 100772-101719 _na     315_aa corA magnesium/cobalt transporter CorA
1016 CAKQOR010000004.1 GCA934255625_00560 CDS open 102139-102939 _na     266_aa Methyltransferase domain-containing protein
1017 CAKQOR010000004.1 GCA934255625_00561 CDS open 103087-106185 _na     1032_aa acrB RND superfamily acriflavine resistance protein B
1018 CAKQOR010000004.1 GCA934255625_00562 CDS open 106199-107389 _na     396_aa RND superfamily acriflavine resistance protein A
1019 CAKQOR010000004.1 GCA934255625_00563 CDS open 107418-107993 _na     191_aa tetR TetR family transcriptional regulator
1020 CAKQOR010000004.1 GCA934255625_00564 CDS open 108187-109008 _na     273_aa ftsN cell division protein FtsN
1021 CAKQOR010000004.1 GCA934255625_00565 CDS open 109115-111313 _na     732_aa priA primosomal protein N'
1022 CAKQOR010000004.1 GCA934255625_00566 CDS open 111539-111751 _na     70_aa rpmE 50S ribosomal protein L31
1023 CAKQOR010000004.1 GCA934255625_00567 CDS open 111868-112749 _na     293_aa Choline kinase
1024 CAKQOR010000004.1 GCA934255625_00568 CDS open 112765-113661 _na     298_aa DMT family transporter
1025 CAKQOR010000004.1 GCA934255625_00569 CDS open 113658-114347 _na     229_aa CTP--phosphocholine cytidylyltransferase
1026 CAKQOR010000004.1 GCA934255625_00570 CDS open 114352-115149 _na     265_aa licD Phosphorylcholine transferase LicD
1027 CAKQOR010000004.1 GCA934255625_00571 CDS open 115183-116001 _na     272_aa mutM DNA-formamidopyrimidine glycosylase
1028 CAKQOR010000004.1 GCA934255625_00572 CDS open 116071-116241 _na     56_aa rpmG 50S ribosomal protein L33
1029 CAKQOR010000004.1 GCA934255625_00573 CDS open 116253-116489 _na     78_aa rpmB 50S ribosomal protein L28
1030 CAKQOR010000004.1 GCA934255625_00574 CDS open 116698-117357 _na     219_aa radC DNA repair protein RadC
1031 CAKQOR010000004.1 GCA934255625_00575 CDS open 117534-118733 _na     399_aa coaBC bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC
1032 CAKQOR010000004.1 GCA934255625_00576 CDS open 118803-119258 _na     151_aa dut dUTP diphosphatase
1033 CAKQOR010000004.1 GCA934255625_00577 CDS open 119258-119857 _na     199_aa slmA nucleoid occlusion factor SlmA
1034 CAKQOR010000004.1 GCA934255625_00578 CDS open 119881-120099 _na     72_aa yheU YheU family protein
1035 CAKQOR010000004.1 GCA934255625_00579 CDS open 120138-120785 _na     215_aa crp cAMP-activated global transcriptional regulator CRP
1036 CAKQOR010000004.1 GCA934255625_00580 CDS open 120905-122275 _na     456_aa gorA glutathione-disulfide reductase
1037 CAKQOR010000004.1 GCA934255625_00581 CDS open 122385-123230 _na     281_aa rlmJ Ribosomal RNA large subunit methyltransferase J
1038 CAKQOR010000004.1 GCA934255625_00582 CDS open 123323-125890 _na     855_aa mrcA Penicillin-binding protein 1A
1039 CAKQOR010000004.1 GCA934255625_00583 CDS open 126001-126822 _na     273_aa Competence protein A
1040 CAKQOR010000004.1 GCA934255625_00584 CDS open 126819-127337 _na     172_aa comB Competence protein ComB
1041 CAKQOR010000004.1 GCA934255625_00585 CDS open 127334-127780 _na     148_aa Competence C protein
1042 CAKQOR010000004.1 GCA934255625_00586 CDS open 127872-128258 _na     128_aa comD Competence protein ComD
1043 CAKQOR010000004.1 GCA934255625_00587 CDS open 128278-129702 _na     474_aa pilQ Type IV pilus secretin PilQ
1044 CAKQOR010000004.1 GCA934255625_00588 CDS open 129845-130444 _na     199_aa aroK shikimate kinase AroK
1045 CAKQOR010000004.1 GCA934255625_00589 CDS open 130478-131566 _na     362_aa aroB 3-dehydroquinate synthase
1046 CAKQOR010000004.1 GCA934255625_00590 CDS open 131571-132437 _na     288_aa Site-specific DNA-methyltransferase (adenine-specific)
1047 CAKQOR010000004.1 GCA934255625_00591 CDS open 132534-133019 _na     161_aa Single-stranded DNA-binding protein
1048 CAKQOR010000004.1 GCA934255625_00592 CDS open 133189-136020 _na     943_aa uvrA excinuclease ABC subunit UvrA
1049 CAKQOR010000004.1 GCA934255625_00593 CDS open 136155-137522 _na     455_aa pssA CDP-diacylglycerol--serine O-phosphatidyltransferase
1050 CAKQOR010000004.1 GCA934255625_00594 CDS open 137694-138770 _na     358_aa tRNA/rRNA methyltransferase
1051 CAKQOR010000004.1 GCA934255625_00595 CDS open 138830-139090 _na     86_aa yfhL YfhL family 4Fe-4S dicluster ferredoxin
1052 CAKQOR010000004.1 GCA934255625_00596 CDS open 139157-139852 _na     231_aa Pancreatic ribonuclease
1053 CAKQOR010000004.1 GCA934255625_00597 CDS open 139990-141153 _na     387_aa pgk phosphoglycerate kinase
1054 CAKQOR010000004.1 GCA934255625_00598 CDS open 141279-142358 _na     359_aa fbaA class II fructose-bisphosphate aldolase
1055 CAKQOR010000004.1 GCA934255625_00599 CDS open 142478-143410 _na     310_aa Lysophospholipase L2
1056 CAKQOR010000004.1 GCA934255625_00600 CDS open 143388-143774 _na     128_aa crcB fluoride efflux transporter CrcB
1057 CAKQOR010000004.1 GCA934255625_00601 CDS open 143774-144592 _na     272_aa Cof family hydrolase
1058 CAKQOR010000004.1 GCA934255625_00602 CDS open 144747-146399 _na     550_aa ilvG acetolactate synthase 2 catalytic subunit
1059 CAKQOR010000004.1 GCA934255625_00603 CDS open 146404-146619 _na     71_aa ilvM acetolactate synthase 2 small subunit
1060 CAKQOR010000004.1 GCA934255625_00604 CDS open 146883-147467 _na     194_aa Lipoprotein
1061 CAKQOR010000004.1 GCA934255625_00605 CDS open 147584-147676 _na     30_aa hypothetical protein
1062 CAKQOR010000004.1 GCA934255625_00606 CDS open 148160-149998 _na     612_aa ilvD dihydroxy-acid dehydratase
1063 CAKQOR010000004.1 GCA934255625_00607 CDS open 150173-151753 _na     526_aa ilvA threonine ammonia-lyase%2C biosynthetic
1064 CAKQOR010000004.1 GCA934255625_00608 CDS open 151911-152831 _na     306_aa Dialkylrecorsinol condensing enzyme
1065 CAKQOR010000004.1 GCA934255625_00609 CDS open 152834-153994 _na     386_aa 3-oxoacyl-(Acyl-carrier-protein) synthase III
1066 CAKQOR010000004.1 GCA934255625_00610 CDS open 153984-154373 _na     129_aa XRE family transcriptional regulator
1067 CAKQOR010000004.1 GCA934255625_00611 CDS open 154463-155389 _na     308_aa Peptidase
1068 CAKQOR010000004.1 GCA934255625_00612 CDS open 155400-155882 _na     160_aa SRP54-type proteins GTP-binding domain-containing protein
1069 CAKQOR010000004.1 GCA934255625_00613 CDS open 155889-156611 _na     240_aa sagG ABC transporter%2C ATP-binding protein SagG
1070 CAKQOR010000004.1 GCA934255625_00458 gene open 412-1200 oCH1
1071 CAKQOR010000004.1 GCA934255625_00459 gene open 1315-2688 argH
1072 CAKQOR010000004.1 GCA934255625_00460 gene open 2958-4307 gdhA
1073 CAKQOR010000004.1 GCA934255625_00461 gene open 4506-5336
1074 CAKQOR010000004.1 GCA934255625_00462 gene open 5407-8883 dnaE
1075 CAKQOR010000004.1 GCA934255625_00463 gene open 9126-10913 fAA1
1076 CAKQOR010000004.1 GCA934255625_00464 gene open 11194-13320 nrdD
1077 CAKQOR010000004.1 GCA934255625_00465 gene open 13764-14231 nrdG
1078 CAKQOR010000004.1 GCA934255625_00466 gene open 14260-15051 tatD
1079 CAKQOR010000004.1 GCA934255625_00467 gene open 15095-15607
1080 CAKQOR010000004.1 GCA934255625_00468 gene open 15707-17086 cysS
1081 CAKQOR010000004.1 GCA934255625_00469 gene open 17212-18174 lipA
1082 CAKQOR010000004.1 GCA934255625_00470 gene open 18229-18867 lipB
1083 CAKQOR010000004.1 GCA934255625_00471 gene open 18913-19215 ybeD
1084 CAKQOR010000004.1 GCA934255625_00472 gene open 19288-20475
1085 CAKQOR010000004.1 GCA934255625_00473 gene open 20506-21369 rlpA
1086 CAKQOR010000004.1 GCA934255625_00474 gene open 21417-22538 rodA
1087 CAKQOR010000004.1 GCA934255625_00475 gene open 22525-24462 mrdA
1088 CAKQOR010000004.1 GCA934255625_00476 gene open 24463-24930 rlmH
1089 CAKQOR010000004.1 GCA934255625_00477 gene open 24979-25287 rsfS
1090 CAKQOR010000004.1 GCA934255625_00478 gene open 25354-26652 rhlB
1091 CAKQOR010000004.1 GCA934255625_00479 gene open 26908-28170 rho
1092 CAKQOR010000004.1 GCA934255625_00480 gene open 28300-29526
1093 CAKQOR010000004.1 GCA934255625_00481 gene open 29752-29982 acpP
1094 CAKQOR010000004.1 GCA934255625_00482 gene open 30252-30980 fabG
1095 CAKQOR010000004.1 GCA934255625_00483 gene open 31002-31940 fabD
1096 CAKQOR010000004.1 GCA934255625_00484 gene open 32048-32998 fabH
1097 CAKQOR010000004.1 GCA934255625_00485 gene open 33034-34068 plsX
1098 CAKQOR010000004.1 GCA934255625_00486 gene open 34096-34266 rpmF
1099 CAKQOR010000004.1 GCA934255625_00487 gene open 34283-34807 yceD
1100 CAKQOR010000004.1 GCA934255625_00488 gene open 34879-35520 bioD
1101 CAKQOR010000004.1 GCA934255625_00489 gene open 35520-36284 bioC
1102 CAKQOR010000004.1 GCA934255625_00490 gene open 36275-36928
1103 CAKQOR010000004.1 GCA934255625_00491 gene open 36913-38085
1104 CAKQOR010000004.1 GCA934255625_00492 gene open 38078-39367 bioA
1105 CAKQOR010000004.1 GCA934255625_00493 gene open 39595-40464 asd
1106 CAKQOR010000004.1 GCA934255625_00494 gene open 40490-41122 fkpA
1107 CAKQOR010000004.1 GCA934255625_00495 gene open 41341-41679 glnB
1108 CAKQOR010000004.1 GCA934255625_00496 gene open 41683-42738 perM
1109 CAKQOR010000004.1 GCA934255625_00497 gene open 42863-43906
1110 CAKQOR010000004.1 GCA934255625_00498 gene open 43908-44540 tmk
1111 CAKQOR010000004.1 GCA934255625_00499 gene open 44537-45520
1112 CAKQOR010000004.1 GCA934255625_00500 gene open 45524-46306 tatD
1113 CAKQOR010000004.1 GCA934255625_00501 gene open 46338-46862
1114 CAKQOR010000004.1 GCA934255625_00502 gene open 46954-48249 mpfA
1115 CAKQOR010000004.1 GCA934255625_00503 gene open 48394-48876 folA
1116 CAKQOR010000004.1 GCA934255625_00504 gene open 48916-49380 yjjB
1117 CAKQOR010000004.1 GCA934255625_00505 gene open 49382-50167 yjjP
1118 CAKQOR010000004.1 GCA934255625_00506 gene open 50333-51439
1119 CAKQOR010000004.1 GCA934255625_00507 gene open 51533-52114 mog
1120 CAKQOR010000004.1 GCA934255625_00508 gene open 52183-53112
1121 CAKQOR010000004.1 GCA934255625_00509 gene open 53112-53744 plsC
1122 CAKQOR010000004.1 GCA934255625_00510 gene open 53755-54363 ynbA
1123 CAKQOR010000004.1 GCA934255625_00511 gene open 54381-56243
1124 CAKQOR010000004.1 GCA934255625_00512 gene open 56283-56882 rnhB
1125 CAKQOR010000004.1 GCA934255625_00513 gene open 56875-58059 lpxB
1126 CAKQOR010000004.1 GCA934255625_00514 gene open 58140-58928 lpxA
1127 CAKQOR010000004.1 GCA934255625_00515 gene open 58948-59400 fabZ
1128 CAKQOR010000004.1 GCA934255625_00516 gene open 59489-60520 lpxD
1129 CAKQOR010000004.1 GCA934255625_00517 gene open 60520-61098 ompH
1130 CAKQOR010000004.1 GCA934255625_00518 gene open 61198-63600 bamA
1131 CAKQOR010000004.1 GCA934255625_00519 gene open 63627-64961 rseP
1132 CAKQOR010000004.1 GCA934255625_00520 gene open 64972-65841
1133 CAKQOR010000004.1 GCA934255625_00521 gene open 65856-66575 uppS
1134 CAKQOR010000004.1 GCA934255625_00522 gene open 66598-67803 ispC
1135 CAKQOR010000004.1 GCA934255625_00523 gene open 67914-68471 frr
1136 CAKQOR010000004.1 GCA934255625_00524 gene open 68510-69232 pyrH
1137 CAKQOR010000004.1 GCA934255625_00525 gene open 69385-71043
1138 CAKQOR010000004.1 GCA934255625_00526 gene open 71200-72984
1139 CAKQOR010000004.1 GCA934255625_00527 gene open 73700-75247 leuA
1140 CAKQOR010000004.1 GCA934255625_00528 gene open 75352-76428 leuB
1141 CAKQOR010000004.1 GCA934255625_00529 gene open 76510-78039 leuC
1142 CAKQOR010000004.1 GCA934255625_00530 gene open 78065-78667 leuD
1143 CAKQOR010000004.1 GCA934255625_00531 gene open 78732-79166
1144 CAKQOR010000004.1 GCA934255625_00532 gene open 79295-80053
1145 CAKQOR010000004.1 GCA934255625_00533 gene open 80115-80867 bioC
1146 CAKQOR010000004.1 GCA934255625_00534 gene open 80869-82113 mtr
1147 CAKQOR010000004.1 GCA934255625_00535 gene open 82268-82795 ppa
1148 CAKQOR010000004.1 GCA934255625_00536 gene open 82874-83647
1149 CAKQOR010000004.1 GCA934255625_00537 gene open 83729-84493 tolA
1150 CAKQOR010000004.1 GCA934255625_00538 gene open 84504-84968 exbD
1151 CAKQOR010000004.1 GCA934255625_00539 gene open 84978-85442 exbB
1152 CAKQOR010000004.1 GCA934255625_00540 gene open 85622-86884 corB
1153 CAKQOR010000004.1 GCA934255625_00541 gene open 86960-87754
1154 CAKQOR010000004.1 GCA934255625_00542 gene open 87907-89286 ffh
1155 CAKQOR010000004.1 GCA934255625_00543 gene open 89412-91853 plsB
1156 CAKQOR010000004.1 GCA934255625_00544 gene open 92066-92689 lexA
1157 CAKQOR010000004.1 GCA934255625_00545 gene open 92841-93218 rpsF
1158 CAKQOR010000004.1 GCA934255625_00546 gene open 93205-93531 priB
1159 CAKQOR010000004.1 GCA934255625_00547 gene open 93544-93774 rpsR
1160 CAKQOR010000004.1 GCA934255625_00548 gene open 93790-94239 rplI
1161 CAKQOR010000004.1 GCA934255625_00549 gene open 94281-94406
1162 CAKQOR010000004.1 GCA934255625_00550 gene open 94452-95567 dprA
1163 CAKQOR010000004.1 GCA934255625_00551 gene open 95618-95788
1164 CAKQOR010000004.1 GCA934255625_00552 gene open 95788-96423
1165 CAKQOR010000004.1 GCA934255625_00553 gene open 96535-96825
1166 CAKQOR010000004.1 GCA934255625_00554 gene open 97057-99030
1167 CAKQOR010000004.1 GCA934255625_00555 gene open 99099-99758
1168 CAKQOR010000004.1 GCA934255625_00556 gene open 99876-100169 yggU
1169 CAKQOR010000004.1 GCA934255625_00557 gene open 100196-100756
1170 CAKQOR010000004.1 GCA934255625_00558 gene open 100772-101719 corA
1171 CAKQOR010000004.1 GCA934255625_00560 gene open 102139-102939
1172 CAKQOR010000004.1 GCA934255625_00561 gene open 103087-106185 acrB
1173 CAKQOR010000004.1 GCA934255625_00562 gene open 106199-107389
1174 CAKQOR010000004.1 GCA934255625_00563 gene open 107418-107993 tetR
1175 CAKQOR010000004.1 GCA934255625_00564 gene open 108187-109008 ftsN
1176 CAKQOR010000004.1 GCA934255625_00565 gene open 109115-111313 priA
1177 CAKQOR010000004.1 GCA934255625_00566 gene open 111539-111751 rpmE
1178 CAKQOR010000004.1 GCA934255625_00567 gene open 111868-112749
1179 CAKQOR010000004.1 GCA934255625_00568 gene open 112765-113661
1180 CAKQOR010000004.1 GCA934255625_00569 gene open 113658-114347
1181 CAKQOR010000004.1 GCA934255625_00570 gene open 114352-115149 licD
1182 CAKQOR010000004.1 GCA934255625_00571 gene open 115183-116001 mutM
1183 CAKQOR010000004.1 GCA934255625_00572 gene open 116071-116241 rpmG
1184 CAKQOR010000004.1 GCA934255625_00573 gene open 116253-116489 rpmB
1185 CAKQOR010000004.1 GCA934255625_00574 gene open 116698-117357 radC
1186 CAKQOR010000004.1 GCA934255625_00575 gene open 117534-118733 coaBC
1187 CAKQOR010000004.1 GCA934255625_00576 gene open 118803-119258 dut
1188 CAKQOR010000004.1 GCA934255625_00577 gene open 119258-119857 slmA
1189 CAKQOR010000004.1 GCA934255625_00578 gene open 119881-120099 yheU
1190 CAKQOR010000004.1 GCA934255625_00579 gene open 120138-120785 crp
1191 CAKQOR010000004.1 GCA934255625_00580 gene open 120905-122275 gorA
1192 CAKQOR010000004.1 GCA934255625_00581 gene open 122385-123230 rlmJ
1193 CAKQOR010000004.1 GCA934255625_00582 gene open 123323-125890 mrcA
1194 CAKQOR010000004.1 GCA934255625_00583 gene open 126001-126822
1195 CAKQOR010000004.1 GCA934255625_00584 gene open 126819-127337 comB
1196 CAKQOR010000004.1 GCA934255625_00585 gene open 127334-127780
1197 CAKQOR010000004.1 GCA934255625_00586 gene open 127872-128258 comD
1198 CAKQOR010000004.1 GCA934255625_00587 gene open 128278-129702 pilQ
1199 CAKQOR010000004.1 GCA934255625_00588 gene open 129845-130444 aroK
1200 CAKQOR010000004.1 GCA934255625_00589 gene open 130478-131566 aroB
1201 CAKQOR010000004.1 GCA934255625_00590 gene open 131571-132437
1202 CAKQOR010000004.1 GCA934255625_00591 gene open 132534-133019
1203 CAKQOR010000004.1 GCA934255625_00592 gene open 133189-136020 uvrA
1204 CAKQOR010000004.1 GCA934255625_00593 gene open 136155-137522 pssA
1205 CAKQOR010000004.1 GCA934255625_00594 gene open 137694-138770
1206 CAKQOR010000004.1 GCA934255625_00595 gene open 138830-139090 yfhL
1207 CAKQOR010000004.1 GCA934255625_00596 gene open 139157-139852
1208 CAKQOR010000004.1 GCA934255625_00597 gene open 139990-141153 pgk
1209 CAKQOR010000004.1 GCA934255625_00598 gene open 141279-142358 fbaA
1210 CAKQOR010000004.1 GCA934255625_00599 gene open 142478-143410
1211 CAKQOR010000004.1 GCA934255625_00600 gene open 143388-143774 crcB
1212 CAKQOR010000004.1 GCA934255625_00601 gene open 143774-144592
1213 CAKQOR010000004.1 GCA934255625_00602 gene open 144747-146399 ilvG
1214 CAKQOR010000004.1 GCA934255625_00603 gene open 146404-146619 ilvM
1215 CAKQOR010000004.1 GCA934255625_00604 gene open 146883-147467
1216 CAKQOR010000004.1 GCA934255625_00605 gene open 147584-147676
1217 CAKQOR010000004.1 GCA934255625_00606 gene open 148160-149998 ilvD
1218 CAKQOR010000004.1 GCA934255625_00607 gene open 150173-151753 ilvA
1219 CAKQOR010000004.1 GCA934255625_00608 gene open 151911-152831
1220 CAKQOR010000004.1 GCA934255625_00609 gene open 152834-153994
1221 CAKQOR010000004.1 GCA934255625_00610 gene open 153984-154373
1222 CAKQOR010000004.1 GCA934255625_00611 gene open 154463-155389
1223 CAKQOR010000004.1 GCA934255625_00612 gene open 155400-155882
1224 CAKQOR010000004.1 GCA934255625_00613 gene open 155889-156611 sagG
1225 CAKQOR010000004.1 GCA934255625_00455 gene open 1-72 trnV
1226 CAKQOR010000004.1 GCA934255625_00456 gene open 111-186 trnV
1227 CAKQOR010000004.1 GCA934255625_00457 gene open 225-300 trnV
1228 CAKQOR010000004.1 GCA934255625_00455 tRNA open 1-72 trnV tRNA-Val(tac)
1229 CAKQOR010000004.1 GCA934255625_00456 tRNA open 111-186 trnV tRNA-Val(tac)
1230 CAKQOR010000004.1 GCA934255625_00457 tRNA open 225-300 trnV tRNA-Val(tac)
1231 CAKQOR010000005.1 GCA934255625_00677 gene open 77267-77383 AaHKsRNA96
1232 CAKQOR010000005.1 GCA934255625_00677 ncRNA open 77267-77383 Aggregatibacter sRNA 96
1233 CAKQOR010000005.1 regulatory_region open 66903-66990 TPP riboswitch aptamer (THI element)
1234 CAKQOR010000005.1 repeat_region open 12863-13681 CRISPR array with 14 repeats of length 28%2C consensus sequence TTTCTAAGCTGCCTATTCGGCAGTGAAG and spacer length 32
1235 CAKQOR010000005.1 repeat_region open 15086-16506 CRISPR array with 24 repeats of length 28%2C consensus sequence TTTCTAAGCTGCCTATTCGGCAGTGAAG and spacer length 32
1236 CAKQOR010000005.1 GCA934255625_00614 CDS open 108-2087 _na     659_aa rnb exoribonuclease II
1237 CAKQOR010000005.1 GCA934255625_00615 CDS open 2212-3000 _na     262_aa fabI Enoyl-[acyl-carrier-protein] reductase [NADH] FabI
1238 CAKQOR010000005.1 GCA934255625_00616 CDS open 3091-3846 _na     251_aa Nif3-like dinuclear metal center hexameric protein
1239 CAKQOR010000005.1 GCA934255625_00617 CDS open 4219-5184 _na     321_aa cas1f type I-F CRISPR-associated endonuclease Cas1f
1240 CAKQOR010000005.1 GCA934255625_00618 CDS open 5181-8474 _na     1097_aa cas3f type I-F CRISPR-associated helicase Cas3f
1241 CAKQOR010000005.1 GCA934255625_00619 CDS open 8521-9081 _na     186_aa cas6f type I-F CRISPR-associated endoribonuclease Cas6/Csy4
1242 CAKQOR010000005.1 GCA934255625_00620 CDS open 9084-10088 _na     334_aa csy3 type I-F CRISPR-associated protein Csy3
1243 CAKQOR010000005.1 GCA934255625_00621 CDS open 10088-11047 _na     319_aa csy2 type I-F CRISPR-associated protein Csy2
1244 CAKQOR010000005.1 GCA934255625_00622 CDS open 11057-12397 _na     446_aa csy1 type I-F CRISPR-associated protein Csy1
1245 CAKQOR010000005.1 GCA934255625_00623 CDS open 16676-18184 _na     502_aa lysS lysine--tRNA ligase
1246 CAKQOR010000005.1 GCA934255625_00624 CDS open 18234-19211 _na     325_aa prfB peptide chain release factor 2
1247 CAKQOR010000005.1 GCA934255625_00625 CDS open 19500-20183 _na     227_aa dsbC bifunctional protein-disulfide isomerase/oxidoreductase DsbC
1248 CAKQOR010000005.1 GCA934255625_00626 CDS open 20196-21929 _na     577_aa recJ single-stranded-DNA-specific exonuclease RecJ
1249 CAKQOR010000005.1 GCA934255625_00627 CDS open 21937-22596 _na     219_aa dsbA Thiol:disulfide interchange protein DsbA
1250 CAKQOR010000005.1 GCA934255625_00628 CDS open 22619-23311 _na     230_aa mtnN 5'-methylthioadenosine/adenosylhomocysteine nucleosidase
1251 CAKQOR010000005.1 GCA934255625_00629 CDS open 23463-24158 _na     231_aa Cobalt ABC superfamily ATP binding cassette transporter%2C binding protein
1252 CAKQOR010000005.1 GCA934255625_00630 CDS open 24163-24663 _na     166_aa Nickel transport protein
1253 CAKQOR010000005.1 GCA934255625_00631 CDS open 24666-25316 _na     216_aa cbiM cobalt transporter CbiM
1254 CAKQOR010000005.1 GCA934255625_00632 CDS open 25313-25978 _na     221_aa Cobalt ABC superfamily ATP binding cassette transporter permease
1255 CAKQOR010000005.1 GCA934255625_00633 CDS open 25975-26598 _na     207_aa Cobalt ABC superfamily ATP binding cassette transporter%2C ABC protein
1256 CAKQOR010000005.1 GCA934255625_00634 CDS open 26677-27483 _na     268_aa hypB hydrogenase nickel incorporation protein HypB
1257 CAKQOR010000005.1 GCA934255625_00635 CDS open 27499-28611 _na     370_aa hypD hydrogenase formation protein HypD
1258 CAKQOR010000005.1 GCA934255625_00636 CDS open 28611-29624 _na     337_aa hypE hydrogenase expression/formation protein HypE
1259 CAKQOR010000005.1 GCA934255625_00637 CDS open 30008-30307 _na     99_aa Pathogenicity locus
1260 CAKQOR010000005.1 GCA934255625_00638 CDS open 30404-31006 _na     200_aa carboxylesterase
1261 CAKQOR010000005.1 GCA934255625_00639 CDS open 31138-31953 _na     271_aa shikimate 5-dehydrogenase
1262 CAKQOR010000005.1 GCA934255625_00640 CDS open 32091-34379 _na     762_aa hypF carbamoyltransferase HypF
1263 CAKQOR010000005.1 GCA934255625_00641 CDS open 34669-36159 _na     496_aa leucyl aminopeptidase
1264 CAKQOR010000005.1 GCA934255625_00642 CDS open 36312-37406 _na     364_aa lptF LPS export ABC transporter permease LptF
1265 CAKQOR010000005.1 GCA934255625_00643 CDS open 37422-38489 _na     355_aa lptG LPS export ABC transporter permease LptG
1266 CAKQOR010000005.1 GCA934255625_00644 CDS open 38663-39547 _na     294_aa metF methylenetetrahydrofolate reductase
1267 CAKQOR010000005.1 GCA934255625_00645 CDS open 39639-40388 _na     249_aa znuB zinc ABC transporter permease subunit ZnuB
1268 CAKQOR010000005.1 GCA934255625_00646 CDS open 40436-41233 _na     265_aa znuC zinc ABC transporter ATP-binding protein ZnuC
1269 CAKQOR010000005.1 GCA934255625_00647 CDS open 41403-42926 _na     507_aa mepM murein DD-endopeptidase MepM
1270 CAKQOR010000005.1 GCA934255625_00648 CDS open 43014-43772 _na     252_aa Iron chelate ABC superfamily ATP binding cassette transporter%2C ABC protein
1271 CAKQOR010000005.1 GCA934255625_00649 CDS open 43784-44725 _na     313_aa ceuC Iron chelate ABC superfamily ATP binding cassette transporter%2C membrane protein
1272 CAKQOR010000005.1 GCA934255625_00650 CDS open 44715-45680 _na     321_aa yfhA putative siderophore transport system permease protein yfhA
1273 CAKQOR010000005.1 GCA934255625_00651 CDS open 45756-46655 _na     299_aa yclQ putative ABC transporter solute-binding protein yclQ
1274 CAKQOR010000005.1 GCA934255625_00652 CDS open 46899-48875 _na     658_aa cpdB 2'%2C3'-cyclic-nucleotide 2'-phosphodiesterase
1275 CAKQOR010000005.1 GCA934255625_00653 CDS open 48964-49881 _na     305_aa fdhE formate dehydrogenase accessory protein FdhE
1276 CAKQOR010000005.1 GCA934255625_00654 CDS open 49972-51087 _na     371_aa Aminotransferase
1277 CAKQOR010000005.1 GCA934255625_00655 CDS open 51218-51634 _na     138_aa OB-fold nucleic acid binding domain protein
1278 CAKQOR010000005.1 GCA934255625_00656 CDS open 51724-52395 _na     223_aa Two component response regulator
1279 CAKQOR010000005.1 GCA934255625_00657 CDS open 52382-53749 _na     455_aa qseC quorum sensing histidine kinase QseC
1280 CAKQOR010000005.1 GCA934255625_00658 CDS open 53897-55234 _na     445_aa argG argininosuccinate synthase
1281 CAKQOR010000005.1 GCA934255625_00659 CDS open 55320-56150 _na     276_aa NAD dependent epimerase/dehydratase family
1282 CAKQOR010000005.1 GCA934255625_00660 CDS open 56216-57076 _na     286_aa purC phosphoribosylaminoimidazolesuccinocarboxamide synthase
1283 CAKQOR010000005.1 GCA934255625_00661 CDS open 57311-58345 _na     344_aa ompC OmpC protein
1284 CAKQOR010000005.1 GCA934255625_00662 CDS open 59054-60637 _na     527_aa prfC peptide chain release factor 3
1285 CAKQOR010000005.1 GCA934255625_00663 CDS open 60711-61658 _na     315_aa BASS family bile acid/Na+ symporter
1286 CAKQOR010000005.1 GCA934255625_00664 CDS open 61836-64769 _na     977_aa glnE bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase
1287 CAKQOR010000005.1 GCA934255625_00665 CDS open 64947-66302 _na     451_aa tetratricopeptide repeat protein
1288 CAKQOR010000005.1 GCA934255625_00666 CDS open 66380-66808 _na     142_aa hypothetical protein
1289 CAKQOR010000005.1 GCA934255625_00667 CDS open 66805-67029 _na     74_aa hypothetical protein
1290 CAKQOR010000005.1 GCA934255625_00668 CDS open 67118-67927 _na     269_aa hydroxymethylpyrimidine kinase
1291 CAKQOR010000005.1 GCA934255625_00669 CDS open 67949-68953 _na     334_aa thiB thiamine ABC transporter substrate binding subunit
1292 CAKQOR010000005.1 GCA934255625_00670 CDS open 68962-70605 _na     547_aa thiP thiamine/thiamine pyrophosphate ABC transporter permease ThiP
1293 CAKQOR010000005.1 GCA934255625_00671 CDS open 70589-71236 _na     215_aa thiQ thiamine ABC transporter ATP-binding protein
1294 CAKQOR010000005.1 GCA934255625_00672 CDS open 71282-72286 _na     334_aa bioB biotin synthase BioB
1295 CAKQOR010000005.1 GCA934255625_00673 CDS open 72367-73833 _na     488_aa ptsG2 PTS family N-acetylglucosamine-specific porter component IIBC
1296 CAKQOR010000005.1 GCA934255625_00674 CDS open 74032-75165 _na     377_aa nanM N-acetylneuraminate epimerase
1297 CAKQOR010000005.1 GCA934255625_00675 CDS open 75330-77180 _na     616_aa dctM Sialic acid TRAP transporter permease protein
1298 CAKQOR010000005.1 GCA934255625_00676 CDS open 77248-78234 _na     328_aa dctP Neu5Ac-binding protein
1299 CAKQOR010000005.1 GCA934255625_00678 CDS open 78496-79197 _na     233_aa nanE Putative N-acetylmannosamine-6-phosphate 2-epimerase
1300 CAKQOR010000005.1 GCA934255625_00679 CDS open 79212-80093 _na     293_aa N-acetylmannosamine kinase
1301 CAKQOR010000005.1 GCA934255625_00680 CDS open 80102-80974 _na     290_aa rpiR RpiR family transcriptional regulator
1302 CAKQOR010000005.1 GCA934255625_00681 CDS open 80988-81866 _na     292_aa nanA N-acetylneuraminate lyase
1303 CAKQOR010000005.1 GCA934255625_00682 CDS open 82014-82817 _na     267_aa nagB glucosamine-6-phosphate deaminase
1304 CAKQOR010000005.1 GCA934255625_00683 CDS open 82868-84013 _na     381_aa nagA N-acetylglucosamine-6-phosphate deacetylase
1305 CAKQOR010000005.1 GCA934255625_00684 CDS open 84129-85190 _na     353_aa hemH ferrochelatase
1306 CAKQOR010000005.1 GCA934255625_00685 CDS open 85183-85605 _na     140_aa ybdB Esterase YbdB
1307 CAKQOR010000005.1 GCA934255625_00686 CDS open 85613-88783 _na     1056_aa FAD-binding oxidoreductase
1308 CAKQOR010000005.1 GCA934255625_00687 CDS open 89135-90172 _na     345_aa ompA porin OmpA
1309 CAKQOR010000005.1 GCA934255625_00688 CDS open 90276-90857 _na     193_aa lemA LemA family protein
1310 CAKQOR010000005.1 GCA934255625_00689 CDS open 90878-91327 _na     149_aa TPM domain-containing protein
1311 CAKQOR010000005.1 GCA934255625_00690 CDS open 91320-92126 _na     268_aa TPM domain-containing protein
1312 CAKQOR010000005.1 GCA934255625_00691 CDS open 92220-92549 _na     109_aa grxD Grx4 family monothiol glutaredoxin
1313 CAKQOR010000005.1 GCA934255625_00692 CDS open 92675-93127 _na     150_aa UPF0756 membrane protein NT05HA_0561
1314 CAKQOR010000005.1 GCA934255625_00693 CDS open 93128-93508 _na     126_aa DUF423 domain-containing protein
1315 CAKQOR010000005.1 GCA934255625_00694 CDS open 93515-97426 _na     1303_aa hrpA ATP-dependent RNA helicase HrpA
1316 CAKQOR010000005.1 GCA934255625_00695 CDS open 97441-98151 _na     236_aa hypothetical protein
1317 CAKQOR010000005.1 GCA934255625_00696 CDS open 98392-98619 _na     75_aa hypothetical protein
1318 CAKQOR010000005.1 GCA934255625_00697 CDS open 98688-99332 _na     214_aa adk adenylate kinase
1319 CAKQOR010000005.1 GCA934255625_00698 CDS open 99464-100762 _na     432_aa ampG Beta-lactamase induction signal transducer AmpG
1320 CAKQOR010000005.1 GCA934255625_00699 CDS open 100778-101119 _na     113_aa hypA hydrogenase maturation nickel metallochaperone HypA
1321 CAKQOR010000005.1 GCA934255625_00700 CDS open 101125-102141 _na     338_aa galE UDP-glucose 4-epimerase GalE
1322 CAKQOR010000005.1 GCA934255625_00701 CDS open 102413-103744 _na     443_aa nCS2 Putative permease HI_0125
1323 CAKQOR010000005.1 GCA934255625_00702 CDS open 103797-105107 _na     436_aa tRNA(Ile)-lysidine synthase
1324 CAKQOR010000005.1 GCA934255625_00703 CDS open 105152-106009 _na     285_aa pdxY pyridoxal kinase PdxY
1325 CAKQOR010000005.1 GCA934255625_00704 CDS open 106090-107043 _na     317_aa accA acetyl-CoA carboxylase carboxyl transferase subunit alpha
1326 CAKQOR010000005.1 GCA934255625_00705 CDS open 107625-109184 _na     519_aa guaA glutamine-hydrolyzing GMP synthase
1327 CAKQOR010000005.1 GCA934255625_00706 CDS open 109351-110220 _na     289_aa DMT family transporter
1328 CAKQOR010000005.1 GCA934255625_00707 CDS open 110343-111698 _na     451_aa dcuC anaerobic C4-dicarboxylate transporter DcuC
1329 CAKQOR010000005.1 GCA934255625_00708 CDS open 111853-113229 _na     458_aa NCS2 family nucleobase:cation symporter-2
1330 CAKQOR010000005.1 GCA934255625_00709 CDS open 113436-114902 _na     488_aa guaB IMP dehydrogenase
1331 CAKQOR010000005.1 GCA934255625_00710 CDS open 115054-115986 _na     310_aa birA bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA
1332 CAKQOR010000005.1 GCA934255625_00614 gene open 108-2087 rnb
1333 CAKQOR010000005.1 GCA934255625_00615 gene open 2212-3000 fabI
1334 CAKQOR010000005.1 GCA934255625_00616 gene open 3091-3846
1335 CAKQOR010000005.1 GCA934255625_00617 gene open 4219-5184 cas1f
1336 CAKQOR010000005.1 GCA934255625_00618 gene open 5181-8474 cas3f
1337 CAKQOR010000005.1 GCA934255625_00619 gene open 8521-9081 cas6f
1338 CAKQOR010000005.1 GCA934255625_00620 gene open 9084-10088 csy3
1339 CAKQOR010000005.1 GCA934255625_00621 gene open 10088-11047 csy2
1340 CAKQOR010000005.1 GCA934255625_00622 gene open 11057-12397 csy1
1341 CAKQOR010000005.1 GCA934255625_00623 gene open 16676-18184 lysS
1342 CAKQOR010000005.1 GCA934255625_00624 gene open 18234-19211 prfB
1343 CAKQOR010000005.1 GCA934255625_00625 gene open 19500-20183 dsbC
1344 CAKQOR010000005.1 GCA934255625_00626 gene open 20196-21929 recJ
1345 CAKQOR010000005.1 GCA934255625_00627 gene open 21937-22596 dsbA
1346 CAKQOR010000005.1 GCA934255625_00628 gene open 22619-23311 mtnN
1347 CAKQOR010000005.1 GCA934255625_00629 gene open 23463-24158
1348 CAKQOR010000005.1 GCA934255625_00630 gene open 24163-24663
1349 CAKQOR010000005.1 GCA934255625_00631 gene open 24666-25316 cbiM
1350 CAKQOR010000005.1 GCA934255625_00632 gene open 25313-25978
1351 CAKQOR010000005.1 GCA934255625_00633 gene open 25975-26598
1352 CAKQOR010000005.1 GCA934255625_00634 gene open 26677-27483 hypB
1353 CAKQOR010000005.1 GCA934255625_00635 gene open 27499-28611 hypD
1354 CAKQOR010000005.1 GCA934255625_00636 gene open 28611-29624 hypE
1355 CAKQOR010000005.1 GCA934255625_00637 gene open 30008-30307
1356 CAKQOR010000005.1 GCA934255625_00638 gene open 30404-31006
1357 CAKQOR010000005.1 GCA934255625_00639 gene open 31138-31953
1358 CAKQOR010000005.1 GCA934255625_00640 gene open 32091-34379 hypF
1359 CAKQOR010000005.1 GCA934255625_00641 gene open 34669-36159
1360 CAKQOR010000005.1 GCA934255625_00642 gene open 36312-37406 lptF
1361 CAKQOR010000005.1 GCA934255625_00643 gene open 37422-38489 lptG
1362 CAKQOR010000005.1 GCA934255625_00644 gene open 38663-39547 metF
1363 CAKQOR010000005.1 GCA934255625_00645 gene open 39639-40388 znuB
1364 CAKQOR010000005.1 GCA934255625_00646 gene open 40436-41233 znuC
1365 CAKQOR010000005.1 GCA934255625_00647 gene open 41403-42926 mepM
1366 CAKQOR010000005.1 GCA934255625_00648 gene open 43014-43772
1367 CAKQOR010000005.1 GCA934255625_00649 gene open 43784-44725 ceuC
1368 CAKQOR010000005.1 GCA934255625_00650 gene open 44715-45680 yfhA
1369 CAKQOR010000005.1 GCA934255625_00651 gene open 45756-46655 yclQ
1370 CAKQOR010000005.1 GCA934255625_00652 gene open 46899-48875 cpdB
1371 CAKQOR010000005.1 GCA934255625_00653 gene open 48964-49881 fdhE
1372 CAKQOR010000005.1 GCA934255625_00654 gene open 49972-51087
1373 CAKQOR010000005.1 GCA934255625_00655 gene open 51218-51634
1374 CAKQOR010000005.1 GCA934255625_00656 gene open 51724-52395
1375 CAKQOR010000005.1 GCA934255625_00657 gene open 52382-53749 qseC
1376 CAKQOR010000005.1 GCA934255625_00658 gene open 53897-55234 argG
1377 CAKQOR010000005.1 GCA934255625_00659 gene open 55320-56150
1378 CAKQOR010000005.1 GCA934255625_00660 gene open 56216-57076 purC
1379 CAKQOR010000005.1 GCA934255625_00661 gene open 57311-58345 ompC
1380 CAKQOR010000005.1 GCA934255625_00662 gene open 59054-60637 prfC
1381 CAKQOR010000005.1 GCA934255625_00663 gene open 60711-61658
1382 CAKQOR010000005.1 GCA934255625_00664 gene open 61836-64769 glnE
1383 CAKQOR010000005.1 GCA934255625_00665 gene open 64947-66302
1384 CAKQOR010000005.1 GCA934255625_00666 gene open 66380-66808
1385 CAKQOR010000005.1 GCA934255625_00667 gene open 66805-67029
1386 CAKQOR010000005.1 GCA934255625_00668 gene open 67118-67927
1387 CAKQOR010000005.1 GCA934255625_00669 gene open 67949-68953 thiB
1388 CAKQOR010000005.1 GCA934255625_00670 gene open 68962-70605 thiP
1389 CAKQOR010000005.1 GCA934255625_00671 gene open 70589-71236 thiQ
1390 CAKQOR010000005.1 GCA934255625_00672 gene open 71282-72286 bioB
1391 CAKQOR010000005.1 GCA934255625_00673 gene open 72367-73833 ptsG2
1392 CAKQOR010000005.1 GCA934255625_00674 gene open 74032-75165 nanM
1393 CAKQOR010000005.1 GCA934255625_00675 gene open 75330-77180 dctM
1394 CAKQOR010000005.1 GCA934255625_00676 gene open 77248-78234 dctP
1395 CAKQOR010000005.1 GCA934255625_00678 gene open 78496-79197 nanE
1396 CAKQOR010000005.1 GCA934255625_00679 gene open 79212-80093
1397 CAKQOR010000005.1 GCA934255625_00680 gene open 80102-80974 rpiR
1398 CAKQOR010000005.1 GCA934255625_00681 gene open 80988-81866 nanA
1399 CAKQOR010000005.1 GCA934255625_00682 gene open 82014-82817 nagB
1400 CAKQOR010000005.1 GCA934255625_00683 gene open 82868-84013 nagA
1401 CAKQOR010000005.1 GCA934255625_00684 gene open 84129-85190 hemH
1402 CAKQOR010000005.1 GCA934255625_00685 gene open 85183-85605 ybdB
1403 CAKQOR010000005.1 GCA934255625_00686 gene open 85613-88783
1404 CAKQOR010000005.1 GCA934255625_00687 gene open 89135-90172 ompA
1405 CAKQOR010000005.1 GCA934255625_00688 gene open 90276-90857 lemA
1406 CAKQOR010000005.1 GCA934255625_00689 gene open 90878-91327
1407 CAKQOR010000005.1 GCA934255625_00690 gene open 91320-92126
1408 CAKQOR010000005.1 GCA934255625_00691 gene open 92220-92549 grxD
1409 CAKQOR010000005.1 GCA934255625_00692 gene open 92675-93127
1410 CAKQOR010000005.1 GCA934255625_00693 gene open 93128-93508
1411 CAKQOR010000005.1 GCA934255625_00694 gene open 93515-97426 hrpA
1412 CAKQOR010000005.1 GCA934255625_00695 gene open 97441-98151
1413 CAKQOR010000005.1 GCA934255625_00696 gene open 98392-98619
1414 CAKQOR010000005.1 GCA934255625_00697 gene open 98688-99332 adk
1415 CAKQOR010000005.1 GCA934255625_00698 gene open 99464-100762 ampG
1416 CAKQOR010000005.1 GCA934255625_00699 gene open 100778-101119 hypA
1417 CAKQOR010000005.1 GCA934255625_00700 gene open 101125-102141 galE
1418 CAKQOR010000005.1 GCA934255625_00701 gene open 102413-103744 nCS2
1419 CAKQOR010000005.1 GCA934255625_00702 gene open 103797-105107
1420 CAKQOR010000005.1 GCA934255625_00703 gene open 105152-106009 pdxY
1421 CAKQOR010000005.1 GCA934255625_00704 gene open 106090-107043 accA
1422 CAKQOR010000005.1 GCA934255625_00705 gene open 107625-109184 guaA
1423 CAKQOR010000005.1 GCA934255625_00706 gene open 109351-110220
1424 CAKQOR010000005.1 GCA934255625_00707 gene open 110343-111698 dcuC
1425 CAKQOR010000005.1 GCA934255625_00708 gene open 111853-113229
1426 CAKQOR010000005.1 GCA934255625_00709 gene open 113436-114902 guaB
1427 CAKQOR010000005.1 GCA934255625_00710 gene open 115054-115986 birA
1428 CAKQOR010000006.1 regulatory_region open 25871-25999 Histidine operon leader
1429 CAKQOR010000006.1 regulatory_region open 49712-49845 CpoB/ybgF ICR thermometer
1430 CAKQOR010000006.1 regulatory_region open 109730-109832 TPP riboswitch aptamer (THI element)
1431 CAKQOR010000006.1 GCA934255625_00713 CDS open 352-1704 _na     450_aa lysC lysine-sensitive aspartokinase 3
1432 CAKQOR010000006.1 GCA934255625_00714 CDS open 1823-3085 _na     420_aa glutamate-5-semialdehyde dehydrogenase
1433 CAKQOR010000006.1 GCA934255625_00715 CDS open 3094-3765 _na     223_aa yadS Glycine transporter domain-containing protein
1434 CAKQOR010000006.1 GCA934255625_00716 CDS open 3977-4783 _na     268_aa Gamma-glutamyl phosphate reductase
1435 CAKQOR010000006.1 GCA934255625_00717 CDS open 4885-5889 _na     334_aa fbp class 1 fructose-bisphosphatase
1436 CAKQOR010000006.1 GCA934255625_00718 CDS open 6044-7417 _na     457_aa mpl UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase
1437 CAKQOR010000006.1 GCA934255625_00720 CDS open 7806-8912 _na     368_aa mltA murein transglycosylase A
1438 CAKQOR010000006.1 GCA934255625_00721 CDS open 8912-9682 _na     256_aa tcdA tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA
1439 CAKQOR010000006.1 GCA934255625_00722 CDS open 9783-10844 _na     353_aa znuA zinc ABC transporter substrate-binding protein ZnuA
1440 CAKQOR010000006.1 GCA934255625_00723 CDS open 10974-11786 _na     270_aa 5'-nucleotidase%2C lipoprotein e(P4) family
1441 CAKQOR010000006.1 GCA934255625_00724 CDS open 11920-12318 _na     132_aa doxX DoxX family protein
1442 CAKQOR010000006.1 GCA934255625_00725 CDS open 12424-14190 _na     588_aa dsbD Thiol:disulfide interchange protein DsbD
1443 CAKQOR010000006.1 GCA934255625_00726 CDS open 14344-14904 _na     186_aa Cytokinin riboside 5'-monophosphate phosphoribohydrolase
1444 CAKQOR010000006.1 GCA934255625_00727 CDS open 15123-15389 _na     88_aa rpmE2 type B 50S ribosomal protein L31
1445 CAKQOR010000006.1 GCA934255625_00728 CDS open 15399-15539 _na     46_aa ykgO type B 50S ribosomal protein L36
1446 CAKQOR010000006.1 GCA934255625_00729 CDS open 15783-16487 _na     234_aa arcA two-component system response regulator ArcA
1447 CAKQOR010000006.1 GCA934255625_00730 CDS open 16729-17211 _na     160_aa smpB SsrA-binding protein SmpB
1448 CAKQOR010000006.1 GCA934255625_00731 CDS open 17288-18463 _na     391_aa cgtA Obg family GTPase CgtA
1449 CAKQOR010000006.1 GCA934255625_00732 CDS open 18491-19444 _na     317_aa L-rhamnose-H(+) symporter
1450 CAKQOR010000006.1 GCA934255625_00733 CDS open 19475-19732 _na     85_aa rpmA 50S ribosomal protein L27
1451 CAKQOR010000006.1 GCA934255625_00734 CDS open 19753-20064 _na     103_aa rplU 50S ribosomal protein L21
1452 CAKQOR010000006.1 GCA934255625_00735 CDS open 20305-21294 _na     329_aa ispB octaprenyl diphosphate synthase
1453 CAKQOR010000006.1 GCA934255625_00736 CDS open 21296-22024 _na     242_aa queH Epoxyqueuosine reductase QueH
1454 CAKQOR010000006.1 GCA934255625_00737 CDS open 22311-23735 _na     474_aa miaB tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB
1455 CAKQOR010000006.1 GCA934255625_00738 CDS open 23791-24363 _na     190_aa Primosomal replication protein N
1456 CAKQOR010000006.1 GCA934255625_00739 CDS open 24419-25768 _na     449_aa gntP GntP family gluconate:H+ symporter
1457 CAKQOR010000006.1 GCA934255625_00740 CDS open 26126-26779 _na     217_aa rnt ribonuclease T
1458 CAKQOR010000006.1 GCA934255625_00741 CDS open 26867-27274 _na     135_aa gloA lactoylglutathione lyase
1459 CAKQOR010000006.1 GCA934255625_00742 CDS open 27422-29518 _na     698_aa Ferric enterobactin receptor
1460 CAKQOR010000006.1 GCA934255625_00743 CDS open 29819-32374 _na     851_aa Brp/Blh family beta-carotene 15%2C15'-monooxygenase
1461 CAKQOR010000006.1 GCA934255625_00744 CDS open 32469-33191 _na     240_aa cmoA carboxy-S-adenosyl-L-methionine synthase CmoA
1462 CAKQOR010000006.1 GCA934255625_00745 CDS open 33356-35122 _na     588_aa aspS aspartate--tRNA ligase
1463 CAKQOR010000006.1 GCA934255625_00746 CDS open 35181-35576 _na     131_aa hypothetical protein
1464 CAKQOR010000006.1 GCA934255625_00747 CDS open 35855-37123 _na     422_aa mntH Nramp family divalent metal transporter
1465 CAKQOR010000006.1 GCA934255625_00748 CDS open 37301-37681 _na     126_aa Dihydroneopterin triphosphate diphosphatase
1466 CAKQOR010000006.1 GCA934255625_00749 CDS open 37694-38434 _na     246_aa tACO1 YebC/PmpR family DNA-binding transcriptional regulator
1467 CAKQOR010000006.1 GCA934255625_00750 CDS open 38444-38875 _na     143_aa Excinuclease ABC subunit A
1468 CAKQOR010000006.1 GCA934255625_00751 CDS open 38933-39505 _na     190_aa ruvC crossover junction endodeoxyribonuclease RuvC
1469 CAKQOR010000006.1 GCA934255625_00752 CDS open 39569-40183 _na     204_aa ruvA Holliday junction branch migration protein RuvA
1470 CAKQOR010000006.1 GCA934255625_00753 CDS open 40199-41212 _na     337_aa ruvB Holliday junction branch migration DNA helicase RuvB
1471 CAKQOR010000006.1 GCA934255625_00754 CDS open 41264-41587 _na     107_aa ruvB ATP-dependent DNA helicase RuvB
1472 CAKQOR010000006.1 GCA934255625_00755 CDS open 42032-43597 _na     521_aa Cytochrome D ubiquinol oxidase subunit I
1473 CAKQOR010000006.1 GCA934255625_00756 CDS open 43612-44751 _na     379_aa cydB cytochrome d ubiquinol oxidase subunit II
1474 CAKQOR010000006.1 GCA934255625_00757 CDS open 44762-44860 _na     32_aa Cytochrome bd oxidase small subunit%2C CydX/CbdX family
1475 CAKQOR010000006.1 GCA934255625_00758 CDS open 44865-45152 _na     95_aa ybgE cyd operon protein YbgE
1476 CAKQOR010000006.1 GCA934255625_00759 CDS open 45266-45670 _na     134_aa ybgC tol-pal system-associated acyl-CoA thioesterase
1477 CAKQOR010000006.1 GCA934255625_00760 CDS open 45700-46389 _na     229_aa tolQ protein TolQ
1478 CAKQOR010000006.1 GCA934255625_00761 CDS open 46475-46897 _na     140_aa tolR colicin uptake protein TolR
1479 CAKQOR010000006.1 GCA934255625_00762 CDS open 46915-48030 _na     371_aa tolA cell envelope integrity protein TolA
1480 CAKQOR010000006.1 GCA934255625_00763 CDS open 48064-49344 _na     426_aa tolB Tol-Pal system beta propeller repeat protein TolB
1481 CAKQOR010000006.1 GCA934255625_00764 CDS open 49359-49811 _na     150_aa pal peptidoglycan-associated lipoprotein Pal
1482 CAKQOR010000006.1 GCA934255625_00767 CDS open 50404-50925 _na     173_aa Type II secretory pathway protein
1483 CAKQOR010000006.1 GCA934255625_00768 CDS open 50912-51655 _na     247_aa pulJ Type II secretory pathway%2C component PulJ
1484 CAKQOR010000006.1 GCA934255625_00769 CDS open 51652-52347 _na     231_aa DUF2572 domain-containing protein
1485 CAKQOR010000006.1 GCA934255625_00770 CDS open 52322-52624 _na     100_aa DUF5374 domain-containing protein
1486 CAKQOR010000006.1 GCA934255625_00771 CDS open 52663-56058 _na     1131_aa recC exodeoxyribonuclease V subunit gamma
1487 CAKQOR010000006.1 GCA934255625_00772 CDS open 56061-56504 _na     147_aa rimI ribosomal protein S18-alanine N-acetyltransferase
1488 CAKQOR010000006.1 GCA934255625_00773 CDS open 56517-56957 _na     146_aa DNA polymerase III subunit psi
1489 CAKQOR010000006.1 GCA934255625_00774 CDS open 57025-58029 _na     334_aa rsmC 16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC
1490 CAKQOR010000006.1 GCA934255625_00775 CDS open 58115-59536 _na     473_aa protein-N(pi)-phosphohistidine--sucrose phosphotransferase
1491 CAKQOR010000006.1 GCA934255625_00776 CDS open 59726-61327 _na     533_aa purH bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase
1492 CAKQOR010000006.1 GCA934255625_00777 CDS open 61521-62810 _na     429_aa purD Phosphoribosylamine--glycine ligase
1493 CAKQOR010000006.1 GCA934255625_00778 CDS open 63025-64287 _na     420_aa glyA Serine hydroxymethyltransferase
1494 CAKQOR010000006.1 GCA934255625_00779 CDS open 64449-65414 _na     321_aa secF Protein-export membrane protein SecF
1495 CAKQOR010000006.1 GCA934255625_00780 CDS open 65432-67282 _na     616_aa secD Protein translocase subunit SecD
1496 CAKQOR010000006.1 GCA934255625_00781 CDS open 67313-67612 _na     99_aa yajC preprotein translocase subunit YajC
1497 CAKQOR010000006.1 GCA934255625_00782 CDS open 67775-67996 _na     73_aa sirA Disulfide bond formation regulator protein SirA
1498 CAKQOR010000006.1 GCA934255625_00783 CDS open 68016-68534 _na     172_aa Hemerythrin HHE cation binding domain protein
1499 CAKQOR010000006.1 GCA934255625_00784 CDS open 68618-69769 _na     383_aa tgt tRNA guanosine(34) transglycosylase Tgt
1500 CAKQOR010000006.1 GCA934255625_00785 CDS open 69878-70969 _na     363_aa queA tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA