HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Schaalia hongkongensis (GCA_937922695.1)

Select a Genome:
BAKTA Annotations for GCA_937922695.1
Genome Selected: Schaalia hongkongensis
ContigsBases CDSrRNA tmRNAtRNA
106 2604341 2208 1 1 48
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4534 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:5]    |    Number of Records Found: 4534 [10 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
2001 CALAIK010000055.1 GCA937922695_00993 gene open 22327-24003 pgm
2002 CALAIK010000055.1 GCA937922695_00994 gene open 24281-25621
2003 CALAIK010000055.1 GCA937922695_00997 gene open 26406-27902
2004 CALAIK010000055.1 GCA937922695_00998 gene open 28869-29468
2005 CALAIK010000055.1 GCA937922695_00999 gene open 29626-31875
2006 CALAIK010000055.1 GCA937922695_01000 gene open 31887-32180 merR
2007 CALAIK010000055.1 GCA937922695_01001 gene open 32248-32853
2008 CALAIK010000055.1 GCA937922695_01002 gene open 33119-34462 ribBA
2009 CALAIK010000055.1 GCA937922695_01003 gene open 35107-36060 csgG
2010 CALAIK010000055.1 GCA937922695_01004 gene open 36210-36452
2011 CALAIK010000055.1 GCA937922695_01005 gene open 37924-38802
2012 CALAIK010000055.1 GCA937922695_00995 gene open 25740-25826 trnS
2013 CALAIK010000055.1 GCA937922695_00996 gene open 25896-25985 trnS
2014 CALAIK010000055.1 GCA937922695_00995 tRNA open 25740-25826 trnS tRNA-Ser(tga)
2015 CALAIK010000055.1 GCA937922695_00996 tRNA open 25896-25985 trnS tRNA-Ser(gct)
2016 CALAIK010000056.1 GCA937922695_01006 CDS open 318-503 _na     61_aa hypothetical protein
2017 CALAIK010000056.1 GCA937922695_01007 CDS open 1259-2476 _na     405_aa Type II/IV secretion system protein
2018 CALAIK010000056.1 GCA937922695_01008 CDS open 2473-3333 _na     286_aa gspF Type II secretion system protein GspF domain-containing protein
2019 CALAIK010000056.1 GCA937922695_01009 CDS open 3344-4246 _na     300_aa Type II secretion system protein F
2020 CALAIK010000056.1 GCA937922695_01010 CDS open 4273-4464 _na     63_aa Pilus assembly protein Flp/PilA
2021 CALAIK010000056.1 GCA937922695_01011 CDS open 4436-4855 _na     139_aa TadE-like protein
2022 CALAIK010000056.1 GCA937922695_01012 CDS open 4842-5267 _na     141_aa TadE-like protein
2023 CALAIK010000056.1 GCA937922695_01013 CDS open 5260-5826 _na     188_aa hypothetical protein
2024 CALAIK010000056.1 GCA937922695_01014 CDS open 5987-7348 _na     453_aa gdhA NADP-specific glutamate dehydrogenase
2025 CALAIK010000056.1 GCA937922695_01006 gene open 318-503
2026 CALAIK010000056.1 GCA937922695_01007 gene open 1259-2476
2027 CALAIK010000056.1 GCA937922695_01008 gene open 2473-3333 gspF
2028 CALAIK010000056.1 GCA937922695_01009 gene open 3344-4246
2029 CALAIK010000056.1 GCA937922695_01010 gene open 4273-4464
2030 CALAIK010000056.1 GCA937922695_01011 gene open 4436-4855
2031 CALAIK010000056.1 GCA937922695_01012 gene open 4842-5267
2032 CALAIK010000056.1 GCA937922695_01013 gene open 5260-5826
2033 CALAIK010000056.1 GCA937922695_01014 gene open 5987-7348 gdhA
2034 CALAIK010000057.1 GCA937922695_01015 CDS open 944-1663 _na     239_aa PF13338 domain protein
2035 CALAIK010000057.1 GCA937922695_01016 CDS open 1890-3203 _na     437_aa hypothetical protein
2036 CALAIK010000057.1 GCA937922695_01017 CDS open 3315-4415 _na     366_aa ychF redox-regulated ATPase YchF
2037 CALAIK010000057.1 GCA937922695_01018 CDS open 4488-6536 _na     682_aa ATP-binding region ATPase domain protein
2038 CALAIK010000057.1 GCA937922695_01019 CDS open 6962-9916 _na     984_aa AAA family ATPase
2039 CALAIK010000057.1 GCA937922695_01020 CDS open 9947-11131 _na     394_aa yadH ABC transporter
2040 CALAIK010000057.1 GCA937922695_01021 CDS open 11118-12260 _na     380_aa ABC transporter
2041 CALAIK010000057.1 GCA937922695_01022 CDS open 12262-13479 _na     405_aa ABC transporter ATP-binding protein
2042 CALAIK010000057.1 GCA937922695_01023 CDS open 13661-14905 _na     414_aa histidine kinase
2043 CALAIK010000057.1 GCA937922695_01024 CDS open 14902-15687 _na     261_aa citB DNA-binding response regulator
2044 CALAIK010000057.1 GCA937922695_01025 CDS open 16214-16468 _na     84_aa hypothetical protein
2045 CALAIK010000057.1 GCA937922695_01026 CDS open 16556-17989 _na     477_aa hypothetical protein
2046 CALAIK010000057.1 GCA937922695_01027 CDS open 17962-19179 _na     405_aa Orc1-like AAA ATPase domain-containing protein
2047 CALAIK010000057.1 GCA937922695_01028 CDS open 19658-20089 _na     143_aa hypothetical protein
2048 CALAIK010000057.1 GCA937922695_01029 CDS open 20356-21660 _na     434_aa hypothetical protein
2049 CALAIK010000057.1 GCA937922695_01030 CDS open 21799-22680 _na     293_aa Alpha/beta hydrolase
2050 CALAIK010000057.1 GCA937922695_01031 CDS open 22847-23710 _na     287_aa tetR TetR family transcriptional regulator
2051 CALAIK010000057.1 GCA937922695_01032 CDS open 24335-25645 _na     436_aa CN hydrolase domain-containing protein
2052 CALAIK010000057.1 GCA937922695_01033 CDS open 25852-27411 _na     519_aa alpha-amylase
2053 CALAIK010000057.1 GCA937922695_01034 CDS open 27467-28366 _na     299_aa Zinc ABC transporter permease
2054 CALAIK010000057.1 GCA937922695_01035 CDS open 28437-29699 _na     420_aa Ribose operon repressor
2055 CALAIK010000057.1 GCA937922695_01036 CDS open 29889-31403 _na     504_aa D-xylose ABC transporter ATP-binding protein
2056 CALAIK010000057.1 GCA937922695_01037 CDS open 31400-32446 _na     348_aa lsrC Autoinducer 2 import system permease protein LsrC
2057 CALAIK010000057.1 GCA937922695_01038 CDS open 32443-33495 _na     350_aa lsrD Autoinducer 2 import system permease protein LsrD
2058 CALAIK010000057.1 GCA937922695_01039 CDS open 33560-34627 _na     355_aa rhaS rhamnose ABC transporter substrate-binding protein
2059 CALAIK010000057.1 GCA937922695_01040 CDS open 34815-35180 _na     121_aa L-rhamnose mutarotase
2060 CALAIK010000057.1 GCA937922695_01041 CDS open 35230-36411 _na     393_aa rhaI L-rhamnose isomerase
2061 CALAIK010000057.1 GCA937922695_01042 CDS open 36408-37946 _na     512_aa Carbohydrate kinase
2062 CALAIK010000057.1 GCA937922695_01043 CDS open 38019-39119 _na     366_aa Class II aldolase/adducin N-terminal domain protein
2063 CALAIK010000057.1 GCA937922695_01044 CDS open 39250-39714 _na     154_aa DUF1772 domain-containing protein
2064 CALAIK010000057.1 GCA937922695_01045 CDS open 39920-40768 _na     282_aa Histidine kinase
2065 CALAIK010000057.1 GCA937922695_01046 CDS open 40781-41620 _na     279_aa Histidine kinase
2066 CALAIK010000057.1 GCA937922695_01047 CDS open 41629-42456 _na     275_aa hypothetical protein
2067 CALAIK010000057.1 GCA937922695_01048 CDS open 42588-43895 _na     435_aa Lipoprotein
2068 CALAIK010000057.1 GCA937922695_01049 CDS open 44129-44761 _na     210_aa Acetyltransferase%2C GNAT family
2069 CALAIK010000057.1 GCA937922695_01050 CDS open 44980-46473 _na     497_aa glutamine synthetase
2070 CALAIK010000057.1 GCA937922695_01051 CDS open 46505-47269 _na     254_aa ABC transporter
2071 CALAIK010000057.1 GCA937922695_01052 CDS open 47266-48201 _na     311_aa ABC transporter
2072 CALAIK010000057.1 GCA937922695_01053 CDS open 48164-49000 _na     278_aa Transcriptional regulator
2073 CALAIK010000057.1 GCA937922695_01054 CDS open 49280-50239 _na     319_aa Lipoprotein
2074 CALAIK010000057.1 GCA937922695_01055 CDS open 50236-50808 _na     190_aa Acyltransferase
2075 CALAIK010000057.1 GCA937922695_01056 CDS open 50947-51786 _na     279_aa Putative glucose-6-phosphate 1-epimerase
2076 CALAIK010000057.1 GCA937922695_01057 CDS open 52012-53931 _na     639_aa typA translational GTPase TypA
2077 CALAIK010000057.1 GCA937922695_01058 CDS open 54025-54435 _na     136_aa Glyoxalase-like domain protein
2078 CALAIK010000057.1 GCA937922695_01059 CDS open 55585-55857 _na     90_aa Ferrous iron transport protein A
2079 CALAIK010000057.1 GCA937922695_01060 CDS open 56062-56406 _na     114_aa fdxA ferredoxin
2080 CALAIK010000057.1 GCA937922695_01061 CDS open 56408-57541 _na     377_aa dapC succinyldiaminopimelate transaminase
2081 CALAIK010000057.1 GCA937922695_01062 CDS open 57788-58738 _na     316_aa dapD 2%2C3%2C4%2C5-tetrahydropyridine-2%2C6-dicarboxylate N-succinyltransferase
2082 CALAIK010000057.1 GCA937922695_01063 CDS open 58778-59470 _na     230_aa Nucleoside triphosphate pyrophosphatase
2083 CALAIK010000057.1 GCA937922695_01064 CDS open 59699-60730 _na     343_aa Cyclase
2084 CALAIK010000057.1 GCA937922695_01065 CDS open 60825-61505 _na     226_aa DNA-binding response regulator
2085 CALAIK010000057.1 GCA937922695_01066 CDS open 61521-62843 _na     440_aa mprB Signal transduction histidine-protein kinase/phosphatase MprB
2086 CALAIK010000057.1 GCA937922695_01067 CDS open 62867-64018 _na     383_aa 5-(carboxyamino)imidazole ribonucleotide synthase
2087 CALAIK010000057.1 GCA937922695_01068 CDS open 64078-64632 _na     184_aa N5-carboxyaminoimidazole ribonucleotide mutase
2088 CALAIK010000057.1 GCA937922695_01069 CDS open 64752-65747 _na     331_aa galE UDP-glucose 4-epimerase GalE
2089 CALAIK010000057.1 GCA937922695_01070 CDS open 65834-66379 _na     181_aa hypothetical protein
2090 CALAIK010000057.1 GCA937922695_01071 CDS open 66376-67434 _na     352_aa PF06114 domain protein
2091 CALAIK010000057.1 GCA937922695_01072 CDS open 67633-69000 _na     455_aa Cell envelope-related transcriptional attenuator domain-containing protein
2092 CALAIK010000057.1 GCA937922695_01073 CDS open 68997-70343 _na     448_aa Cell envelope-related transcriptional attenuator domain-containing protein
2093 CALAIK010000057.1 GCA937922695_01074 CDS open 70351-70830 _na     159_aa DUF2304 domain-containing protein
2094 CALAIK010000057.1 GCA937922695_01075 CDS open 70830-71510 _na     226_aa Glycosyltransferase%2C group 2 family protein
2095 CALAIK010000057.1 GCA937922695_01076 CDS open 71639-72241 _na     200_aa N-acetyltransferase
2096 CALAIK010000057.1 GCA937922695_01077 CDS open 72238-73335 _na     365_aa degT Aminotransferase DegT
2097 CALAIK010000057.1 GCA937922695_01078 CDS open 73344-74372 _na     342_aa Dehydrogenase
2098 CALAIK010000057.1 GCA937922695_01079 CDS open 74394-75503 _na     369_aa Glycosyltransferase%2C group 1 family protein
2099 CALAIK010000057.1 GCA937922695_01080 CDS open 75500-77119 _na     539_aa asparagine synthase (glutamine-hydrolyzing)
2100 CALAIK010000057.1 GCA937922695_01081 CDS open 77253-78656 _na     467_aa Polysaccharide biosynthesis protein
2101 CALAIK010000057.1 GCA937922695_01082 CDS open 78653-79900 _na     415_aa Glycosyltransferase
2102 CALAIK010000057.1 GCA937922695_01083 CDS open 79852-80577 _na     241_aa hypothetical protein
2103 CALAIK010000057.1 GCA937922695_01015 gene open 944-1663
2104 CALAIK010000057.1 GCA937922695_01016 gene open 1890-3203
2105 CALAIK010000057.1 GCA937922695_01017 gene open 3315-4415 ychF
2106 CALAIK010000057.1 GCA937922695_01018 gene open 4488-6536
2107 CALAIK010000057.1 GCA937922695_01019 gene open 6962-9916
2108 CALAIK010000057.1 GCA937922695_01020 gene open 9947-11131 yadH
2109 CALAIK010000057.1 GCA937922695_01021 gene open 11118-12260
2110 CALAIK010000057.1 GCA937922695_01022 gene open 12262-13479
2111 CALAIK010000057.1 GCA937922695_01023 gene open 13661-14905
2112 CALAIK010000057.1 GCA937922695_01024 gene open 14902-15687 citB
2113 CALAIK010000057.1 GCA937922695_01025 gene open 16214-16468
2114 CALAIK010000057.1 GCA937922695_01026 gene open 16556-17989
2115 CALAIK010000057.1 GCA937922695_01027 gene open 17962-19179
2116 CALAIK010000057.1 GCA937922695_01028 gene open 19658-20089
2117 CALAIK010000057.1 GCA937922695_01029 gene open 20356-21660
2118 CALAIK010000057.1 GCA937922695_01030 gene open 21799-22680
2119 CALAIK010000057.1 GCA937922695_01031 gene open 22847-23710 tetR
2120 CALAIK010000057.1 GCA937922695_01032 gene open 24335-25645
2121 CALAIK010000057.1 GCA937922695_01033 gene open 25852-27411
2122 CALAIK010000057.1 GCA937922695_01034 gene open 27467-28366
2123 CALAIK010000057.1 GCA937922695_01035 gene open 28437-29699
2124 CALAIK010000057.1 GCA937922695_01036 gene open 29889-31403
2125 CALAIK010000057.1 GCA937922695_01037 gene open 31400-32446 lsrC
2126 CALAIK010000057.1 GCA937922695_01038 gene open 32443-33495 lsrD
2127 CALAIK010000057.1 GCA937922695_01039 gene open 33560-34627 rhaS
2128 CALAIK010000057.1 GCA937922695_01040 gene open 34815-35180
2129 CALAIK010000057.1 GCA937922695_01041 gene open 35230-36411 rhaI
2130 CALAIK010000057.1 GCA937922695_01042 gene open 36408-37946
2131 CALAIK010000057.1 GCA937922695_01043 gene open 38019-39119
2132 CALAIK010000057.1 GCA937922695_01044 gene open 39250-39714
2133 CALAIK010000057.1 GCA937922695_01045 gene open 39920-40768
2134 CALAIK010000057.1 GCA937922695_01046 gene open 40781-41620
2135 CALAIK010000057.1 GCA937922695_01047 gene open 41629-42456
2136 CALAIK010000057.1 GCA937922695_01048 gene open 42588-43895
2137 CALAIK010000057.1 GCA937922695_01049 gene open 44129-44761
2138 CALAIK010000057.1 GCA937922695_01050 gene open 44980-46473
2139 CALAIK010000057.1 GCA937922695_01051 gene open 46505-47269
2140 CALAIK010000057.1 GCA937922695_01052 gene open 47266-48201
2141 CALAIK010000057.1 GCA937922695_01053 gene open 48164-49000
2142 CALAIK010000057.1 GCA937922695_01054 gene open 49280-50239
2143 CALAIK010000057.1 GCA937922695_01055 gene open 50236-50808
2144 CALAIK010000057.1 GCA937922695_01056 gene open 50947-51786
2145 CALAIK010000057.1 GCA937922695_01057 gene open 52012-53931 typA
2146 CALAIK010000057.1 GCA937922695_01058 gene open 54025-54435
2147 CALAIK010000057.1 GCA937922695_01059 gene open 55585-55857
2148 CALAIK010000057.1 GCA937922695_01060 gene open 56062-56406 fdxA
2149 CALAIK010000057.1 GCA937922695_01061 gene open 56408-57541 dapC
2150 CALAIK010000057.1 GCA937922695_01062 gene open 57788-58738 dapD
2151 CALAIK010000057.1 GCA937922695_01063 gene open 58778-59470
2152 CALAIK010000057.1 GCA937922695_01064 gene open 59699-60730
2153 CALAIK010000057.1 GCA937922695_01065 gene open 60825-61505
2154 CALAIK010000057.1 GCA937922695_01066 gene open 61521-62843 mprB
2155 CALAIK010000057.1 GCA937922695_01067 gene open 62867-64018
2156 CALAIK010000057.1 GCA937922695_01068 gene open 64078-64632
2157 CALAIK010000057.1 GCA937922695_01069 gene open 64752-65747 galE
2158 CALAIK010000057.1 GCA937922695_01070 gene open 65834-66379
2159 CALAIK010000057.1 GCA937922695_01071 gene open 66376-67434
2160 CALAIK010000057.1 GCA937922695_01072 gene open 67633-69000
2161 CALAIK010000057.1 GCA937922695_01073 gene open 68997-70343
2162 CALAIK010000057.1 GCA937922695_01074 gene open 70351-70830
2163 CALAIK010000057.1 GCA937922695_01075 gene open 70830-71510
2164 CALAIK010000057.1 GCA937922695_01076 gene open 71639-72241
2165 CALAIK010000057.1 GCA937922695_01077 gene open 72238-73335 degT
2166 CALAIK010000057.1 GCA937922695_01078 gene open 73344-74372
2167 CALAIK010000057.1 GCA937922695_01079 gene open 74394-75503
2168 CALAIK010000057.1 GCA937922695_01080 gene open 75500-77119
2169 CALAIK010000057.1 GCA937922695_01081 gene open 77253-78656
2170 CALAIK010000057.1 GCA937922695_01082 gene open 78653-79900
2171 CALAIK010000057.1 GCA937922695_01083 gene open 79852-80577
2172 CALAIK010000058.1 GCA937922695_01084 CDS open 426-1157 _na     243_aa DUF6318 domain-containing protein
2173 CALAIK010000058.1 GCA937922695_01085 CDS open 1663-2169 _na     168_aa DUF6318 domain-containing protein
2174 CALAIK010000058.1 GCA937922695_01086 CDS open 2718-4073 _na     451_aa Xylulose kinase
2175 CALAIK010000058.1 GCA937922695_01087 CDS open 4319-5695 _na     458_aa Alpha-L-fucosidase
2176 CALAIK010000058.1 GCA937922695_01088 CDS open 5695-6552 _na     285_aa ABC transporter permease
2177 CALAIK010000058.1 GCA937922695_01089 CDS open 6545-7465 _na     306_aa hypothetical protein
2178 CALAIK010000058.1 GCA937922695_01090 CDS open 7638-8894 _na     418_aa ABC transporter substrate-binding protein
2179 CALAIK010000058.1 GCA937922695_01091 CDS open 9238-10269 _na     343_aa Inosine/uridine-preferring nucleoside hydrolase domain-containing protein
2180 CALAIK010000058.1 GCA937922695_01092 CDS open 10256-11308 _na     350_aa lacI LacI family transcriptional regulator
2181 CALAIK010000058.1 GCA937922695_01093 CDS open 11359-12714 _na     451_aa MFS transporter
2182 CALAIK010000058.1 GCA937922695_01094 CDS open 12915-13673 _na     252_aa hypothetical protein
2183 CALAIK010000058.1 GCA937922695_01095 CDS open 13768-14511 _na     247_aa hypothetical protein
2184 CALAIK010000058.1 GCA937922695_01096 CDS open 14508-15194 _na     228_aa Transcriptional regulator
2185 CALAIK010000058.1 GCA937922695_01097 CDS open 15340-16704 _na     454_aa Cell filamentation protein Fic
2186 CALAIK010000058.1 GCA937922695_01098 CDS open 16898-18199 _na     433_aa ATP-binding protein
2187 CALAIK010000058.1 GCA937922695_01099 CDS open 18932-19318 _na     128_aa hypothetical protein
2188 CALAIK010000058.1 GCA937922695_01100 CDS open 19611-20765 _na     384_aa hypothetical protein
2189 CALAIK010000058.1 GCA937922695_01101 CDS open 20606-20950 _na     114_aa hypothetical protein
2190 CALAIK010000058.1 GCA937922695_01102 CDS open 21691-22617 _na     308_aa anchored repeat-type ABC transporter permease subunit
2191 CALAIK010000058.1 GCA937922695_01103 CDS open 22614-23399 _na     261_aa anchored repeat-type ABC transporter ATP-binding subunit
2192 CALAIK010000058.1 GCA937922695_01104 CDS open 23396-24577 _na     393_aa Cell surface protein
2193 CALAIK010000058.1 GCA937922695_01105 CDS open 24574-26241 _na     555_aa anchored repeat ABC transporter%2C substrate-binding protein
2194 CALAIK010000058.1 GCA937922695_01106 CDS open 26231-27877 _na     548_aa ABC transporter-associated repeat-like protein
2195 CALAIK010000058.1 GCA937922695_01107 CDS open 28612-29190 _na     192_aa hypothetical protein
2196 CALAIK010000058.1 GCA937922695_01108 CDS open 29187-29690 _na     167_aa DUF6301 domain-containing protein
2197 CALAIK010000058.1 GCA937922695_01109 CDS open 30383-31681 _na     432_aa gntR GntR family transcriptional regulator
2198 CALAIK010000058.1 GCA937922695_01110 CDS open 31709-32680 _na     323_aa D-alanine--D-alanine ligase
2199 CALAIK010000058.1 GCA937922695_01111 CDS open 32747-33376 _na     209_aa HAD hydrolase%2C family IA%2C variant 3 domain protein
2200 CALAIK010000058.1 GCA937922695_01112 CDS open 33521-34804 _na     427_aa parB Chromosome partitioning protein ParB
2201 CALAIK010000058.1 GCA937922695_01113 CDS open 35022-35903 _na     293_aa Chromosome partitioning protein
2202 CALAIK010000058.1 GCA937922695_01114 CDS open 36003-36713 _na     236_aa rsmG 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG
2203 CALAIK010000058.1 GCA937922695_01115 CDS open 36706-37209 _na     167_aa Single-stranded DNA-binding protein
2204 CALAIK010000058.1 GCA937922695_01116 CDS open 37251-38594 _na     447_aa yidC Membrane protein insertase YidC
2205 CALAIK010000058.1 GCA937922695_01117 CDS open 38651-38998 _na     115_aa yidD membrane protein insertion efficiency factor YidD
2206 CALAIK010000058.1 GCA937922695_01118 CDS open 38995-39357 _na     120_aa rnpA ribonuclease P protein component
2207 CALAIK010000058.1 GCA937922695_01119 CDS open 39367-39507 _na     46_aa rpmH 50S ribosomal protein L34
2208 CALAIK010000058.1 GCA937922695_01120 CDS open 39955-41406 _na     483_aa dnaA chromosomal replication initiator protein DnaA
2209 CALAIK010000058.1 GCA937922695_01121 CDS open 41796-42932 _na     378_aa dnaN DNA polymerase III subunit beta
2210 CALAIK010000058.1 GCA937922695_01122 CDS open 42940-44127 _na     395_aa recF DNA replication/repair protein RecF
2211 CALAIK010000058.1 GCA937922695_01123 CDS open 44120-44830 _na     236_aa RNA-binding protein
2212 CALAIK010000058.1 GCA937922695_01124 CDS open 44962-45987 _na     341_aa DUF5067 domain-containing protein
2213 CALAIK010000058.1 GCA937922695_01125 CDS open 46089-47084 _na     331_aa hypothetical protein
2214 CALAIK010000058.1 GCA937922695_01126 CDS open 47251-48147 _na     298_aa DUF5067 domain-containing protein
2215 CALAIK010000058.1 GCA937922695_01127 CDS open 48359-50401 _na     680_aa gyrB DNA topoisomerase (ATP-hydrolyzing) subunit B
2216 CALAIK010000058.1 GCA937922695_01128 CDS open 50467-53019 _na     850_aa gyrA DNA gyrase subunit A
2217 CALAIK010000058.1 GCA937922695_01129 CDS open 53133-53531 _na     132_aa DUF3566 domain-containing protein
2218 CALAIK010000058.1 GCA937922695_01130 CDS open 53518-54417 _na     299_aa DUF2974 domain-containing protein
2219 CALAIK010000058.1 GCA937922695_01131 CDS open 54423-55481 _na     352_aa DUF2974 domain-containing protein
2220 CALAIK010000058.1 GCA937922695_01133 CDS open 55778-55912 _na     44_aa PH domain-containing protein
2221 CALAIK010000058.1 GCA937922695_01135 CDS open 56044-56220 _na     58_aa hypothetical protein
2222 CALAIK010000058.1 GCA937922695_01136 CDS open 56320-58233 _na     637_aa ATP-dependent endonuclease
2223 CALAIK010000058.1 GCA937922695_01137 CDS open 58230-59885 _na     551_aa DNA 3'-5' helicase
2224 CALAIK010000058.1 GCA937922695_01138 CDS open 60421-61611 _na     396_aa Major facilitator superfamily (MFS) profile domain-containing protein
2225 CALAIK010000058.1 GCA937922695_01139 CDS open 61592-61912 _na     106_aa HTH arsR-type domain-containing protein
2226 CALAIK010000058.1 GCA937922695_01140 CDS open 62070-63023 _na     317_aa NAD(P)-dependent oxidoreductase
2227 CALAIK010000058.1 GCA937922695_01141 CDS open 63197-63838 _na     213_aa Phosphatidic acid phosphatase type 2/haloperoxidase domain-containing protein
2228 CALAIK010000058.1 GCA937922695_01142 CDS open 63860-64240 _na     126_aa YchJ-like middle NTF2-like domain-containing protein
2229 CALAIK010000058.1 GCA937922695_01143 CDS open 64237-65262 _na     341_aa trxB thioredoxin-disulfide reductase
2230 CALAIK010000058.1 GCA937922695_01144 CDS open 65303-68362 _na     1019_aa murJ Murein biosynthesis integral membrane protein MurJ
2231 CALAIK010000058.1 GCA937922695_01145 CDS open 68359-71037 _na     892_aa Conjugal transfer protein
2232 CALAIK010000058.1 GCA937922695_01146 CDS open 71037-71480 _na     147_aa mutT DNA mismatch repair protein MutT
2233 CALAIK010000058.1 GCA937922695_01147 CDS open 71633-73231 _na     532_aa CCA tRNA nucleotidyltransferase
2234 CALAIK010000058.1 GCA937922695_01148 CDS open 73355-74821 _na     488_aa gndA NADP-dependent phosphogluconate dehydrogenase
2235 CALAIK010000058.1 GCA937922695_01149 CDS open 75008-77458 _na     816_aa peptidoglycan glycosyltransferase
2236 CALAIK010000058.1 GCA937922695_01084 gene open 426-1157
2237 CALAIK010000058.1 GCA937922695_01085 gene open 1663-2169
2238 CALAIK010000058.1 GCA937922695_01086 gene open 2718-4073
2239 CALAIK010000058.1 GCA937922695_01087 gene open 4319-5695
2240 CALAIK010000058.1 GCA937922695_01088 gene open 5695-6552
2241 CALAIK010000058.1 GCA937922695_01089 gene open 6545-7465
2242 CALAIK010000058.1 GCA937922695_01090 gene open 7638-8894
2243 CALAIK010000058.1 GCA937922695_01091 gene open 9238-10269
2244 CALAIK010000058.1 GCA937922695_01092 gene open 10256-11308 lacI
2245 CALAIK010000058.1 GCA937922695_01093 gene open 11359-12714
2246 CALAIK010000058.1 GCA937922695_01094 gene open 12915-13673
2247 CALAIK010000058.1 GCA937922695_01095 gene open 13768-14511
2248 CALAIK010000058.1 GCA937922695_01096 gene open 14508-15194
2249 CALAIK010000058.1 GCA937922695_01097 gene open 15340-16704
2250 CALAIK010000058.1 GCA937922695_01098 gene open 16898-18199
2251 CALAIK010000058.1 GCA937922695_01099 gene open 18932-19318
2252 CALAIK010000058.1 GCA937922695_01100 gene open 19611-20765
2253 CALAIK010000058.1 GCA937922695_01101 gene open 20606-20950
2254 CALAIK010000058.1 GCA937922695_01102 gene open 21691-22617
2255 CALAIK010000058.1 GCA937922695_01103 gene open 22614-23399
2256 CALAIK010000058.1 GCA937922695_01104 gene open 23396-24577
2257 CALAIK010000058.1 GCA937922695_01105 gene open 24574-26241
2258 CALAIK010000058.1 GCA937922695_01106 gene open 26231-27877
2259 CALAIK010000058.1 GCA937922695_01107 gene open 28612-29190
2260 CALAIK010000058.1 GCA937922695_01108 gene open 29187-29690
2261 CALAIK010000058.1 GCA937922695_01109 gene open 30383-31681 gntR
2262 CALAIK010000058.1 GCA937922695_01110 gene open 31709-32680
2263 CALAIK010000058.1 GCA937922695_01111 gene open 32747-33376
2264 CALAIK010000058.1 GCA937922695_01112 gene open 33521-34804 parB
2265 CALAIK010000058.1 GCA937922695_01113 gene open 35022-35903
2266 CALAIK010000058.1 GCA937922695_01114 gene open 36003-36713 rsmG
2267 CALAIK010000058.1 GCA937922695_01115 gene open 36706-37209
2268 CALAIK010000058.1 GCA937922695_01116 gene open 37251-38594 yidC
2269 CALAIK010000058.1 GCA937922695_01117 gene open 38651-38998 yidD
2270 CALAIK010000058.1 GCA937922695_01118 gene open 38995-39357 rnpA
2271 CALAIK010000058.1 GCA937922695_01119 gene open 39367-39507 rpmH
2272 CALAIK010000058.1 GCA937922695_01120 gene open 39955-41406 dnaA
2273 CALAIK010000058.1 GCA937922695_01121 gene open 41796-42932 dnaN
2274 CALAIK010000058.1 GCA937922695_01122 gene open 42940-44127 recF
2275 CALAIK010000058.1 GCA937922695_01123 gene open 44120-44830
2276 CALAIK010000058.1 GCA937922695_01124 gene open 44962-45987
2277 CALAIK010000058.1 GCA937922695_01125 gene open 46089-47084
2278 CALAIK010000058.1 GCA937922695_01126 gene open 47251-48147
2279 CALAIK010000058.1 GCA937922695_01127 gene open 48359-50401 gyrB
2280 CALAIK010000058.1 GCA937922695_01128 gene open 50467-53019 gyrA
2281 CALAIK010000058.1 GCA937922695_01129 gene open 53133-53531
2282 CALAIK010000058.1 GCA937922695_01130 gene open 53518-54417
2283 CALAIK010000058.1 GCA937922695_01131 gene open 54423-55481
2284 CALAIK010000058.1 GCA937922695_01133 gene open 55778-55912
2285 CALAIK010000058.1 GCA937922695_01135 gene open 56044-56220
2286 CALAIK010000058.1 GCA937922695_01136 gene open 56320-58233
2287 CALAIK010000058.1 GCA937922695_01137 gene open 58230-59885
2288 CALAIK010000058.1 GCA937922695_01138 gene open 60421-61611
2289 CALAIK010000058.1 GCA937922695_01139 gene open 61592-61912
2290 CALAIK010000058.1 GCA937922695_01140 gene open 62070-63023
2291 CALAIK010000058.1 GCA937922695_01141 gene open 63197-63838
2292 CALAIK010000058.1 GCA937922695_01142 gene open 63860-64240
2293 CALAIK010000058.1 GCA937922695_01143 gene open 64237-65262 trxB
2294 CALAIK010000058.1 GCA937922695_01144 gene open 65303-68362 murJ
2295 CALAIK010000058.1 GCA937922695_01145 gene open 68359-71037
2296 CALAIK010000058.1 GCA937922695_01146 gene open 71037-71480 mutT
2297 CALAIK010000058.1 GCA937922695_01147 gene open 71633-73231
2298 CALAIK010000058.1 GCA937922695_01148 gene open 73355-74821 gndA
2299 CALAIK010000058.1 GCA937922695_01149 gene open 75008-77458
2300 CALAIK010000058.1 GCA937922695_01132 gene open 55668-55744 trnI
2301 CALAIK010000058.1 GCA937922695_01134 gene open 55922-55994 trnA
2302 CALAIK010000058.1 GCA937922695_01132 tRNA open 55668-55744 trnI tRNA-Ile(gat)
2303 CALAIK010000058.1 GCA937922695_01134 tRNA open 55922-55994 trnA tRNA-Ala(tgc)
2304 CALAIK010000059.1 GCA937922695_01150 CDS open 267-1304 _na     345_aa S1 motif domain-containing protein
2305 CALAIK010000059.1 GCA937922695_01150 gene open 267-1304
2306 CALAIK010000060.1 GCA937922695_01151 CDS open 27-809 _na     260_aa phosphoenolpyruvate carboxykinase domain-containing protein
2307 CALAIK010000060.1 GCA937922695_01152 CDS open 1014-4394 _na     1126_aa DUF5979 domain-containing protein
2308 CALAIK010000060.1 GCA937922695_01153 CDS open 4553-5542 _na     329_aa mMP0363 AAA family ATPase
2309 CALAIK010000060.1 GCA937922695_01154 CDS open 5583-6476 _na     297_aa DUF58 domain-containing protein
2310 CALAIK010000060.1 GCA937922695_01155 CDS open 6873-7178 _na     101_aa hypothetical protein
2311 CALAIK010000060.1 GCA937922695_01156 CDS open 8103-8285 _na     60_aa hypothetical protein
2312 CALAIK010000060.1 GCA937922695_01151 gene open 27-809
2313 CALAIK010000060.1 GCA937922695_01152 gene open 1014-4394
2314 CALAIK010000060.1 GCA937922695_01153 gene open 4553-5542 mMP0363
2315 CALAIK010000060.1 GCA937922695_01154 gene open 5583-6476
2316 CALAIK010000060.1 GCA937922695_01155 gene open 6873-7178
2317 CALAIK010000060.1 GCA937922695_01156 gene open 8103-8285
2318 CALAIK010000061.1 GCA937922695_01157 CDS open 379-717 _na     112_aa hypothetical protein
2319 CALAIK010000061.1 GCA937922695_01158 CDS open 721-1008 _na     95_aa Secreted protein
2320 CALAIK010000061.1 GCA937922695_01159 CDS open 2341-3534 _na     397_aa Methionine synthase%2C vitamin-B12 independent
2321 CALAIK010000061.1 GCA937922695_01160 CDS open 3849-4526 _na     225_aa Lipoprotein
2322 CALAIK010000061.1 GCA937922695_01161 CDS open 4707-5756 _na     349_aa Peptidoglycan binding domain protein
2323 CALAIK010000061.1 GCA937922695_01162 CDS open 5747-6385 _na     212_aa ABC transporter%2C ATP-binding protein
2324 CALAIK010000061.1 GCA937922695_01163 CDS open 6553-7620 _na     355_aa hypothetical protein
2325 CALAIK010000061.1 GCA937922695_01164 CDS open 7617-8429 _na     270_aa Class I glutamine amidotransferase
2326 CALAIK010000061.1 GCA937922695_01165 CDS open 8698-8973 _na     91_aa Protein G-related albumin-binding (GA) module domain-containing protein
2327 CALAIK010000061.1 GCA937922695_01166 CDS open 9768-10175 _na     135_aa hypothetical protein
2328 CALAIK010000061.1 GCA937922695_01157 gene open 379-717
2329 CALAIK010000061.1 GCA937922695_01158 gene open 721-1008
2330 CALAIK010000061.1 GCA937922695_01159 gene open 2341-3534
2331 CALAIK010000061.1 GCA937922695_01160 gene open 3849-4526
2332 CALAIK010000061.1 GCA937922695_01161 gene open 4707-5756
2333 CALAIK010000061.1 GCA937922695_01162 gene open 5747-6385
2334 CALAIK010000061.1 GCA937922695_01163 gene open 6553-7620
2335 CALAIK010000061.1 GCA937922695_01164 gene open 7617-8429
2336 CALAIK010000061.1 GCA937922695_01165 gene open 8698-8973
2337 CALAIK010000061.1 GCA937922695_01166 gene open 9768-10175
2338 CALAIK010000062.1 GCA937922695_01167 CDS open 894-1352 _na     152_aa rplI 50S ribosomal protein L9
2339 CALAIK010000062.1 GCA937922695_01168 CDS open 1371-1613 _na     80_aa rpsR 30S ribosomal protein S18
2340 CALAIK010000062.1 GCA937922695_01169 CDS open 1727-2320 _na     197_aa Single-stranded DNA-binding protein
2341 CALAIK010000062.1 GCA937922695_01170 CDS open 2356-2646 _na     96_aa rpsF 30S ribosomal protein S6
2342 CALAIK010000062.1 GCA937922695_01171 CDS open 2890-4404 _na     504_aa MATE family efflux transporter
2343 CALAIK010000062.1 GCA937922695_01172 CDS open 4820-6172 _na     450_aa dnaB replicative DNA helicase
2344 CALAIK010000062.1 GCA937922695_01173 CDS open 6617-6973 _na     118_aa Methylmalonyl-CoA mutase
2345 CALAIK010000062.1 GCA937922695_01174 CDS open 7120-7836 _na     238_aa Lipoprotein
2346 CALAIK010000062.1 GCA937922695_01175 CDS open 8436-8654 _na     72_aa MMPL family transporter
2347 CALAIK010000062.1 GCA937922695_01176 CDS open 9025-9234 _na     69_aa Cold-shock protein
2348 CALAIK010000062.1 GCA937922695_01177 CDS open 9702-10520 _na     272_aa ABC transporter ATP-binding protein
2349 CALAIK010000062.1 GCA937922695_01178 CDS open 10517-11545 _na     342_aa Iron ABC transporter permease
2350 CALAIK010000062.1 GCA937922695_01179 CDS open 11609-12727 _na     372_aa Peptide ABC transporter substrate-binding protein
2351 CALAIK010000062.1 GCA937922695_01180 CDS open 12784-13608 _na     274_aa Alkane 1-monooxygenase
2352 CALAIK010000062.1 GCA937922695_01167 gene open 894-1352 rplI
2353 CALAIK010000062.1 GCA937922695_01168 gene open 1371-1613 rpsR
2354 CALAIK010000062.1 GCA937922695_01169 gene open 1727-2320
2355 CALAIK010000062.1 GCA937922695_01170 gene open 2356-2646 rpsF
2356 CALAIK010000062.1 GCA937922695_01171 gene open 2890-4404
2357 CALAIK010000062.1 GCA937922695_01172 gene open 4820-6172 dnaB
2358 CALAIK010000062.1 GCA937922695_01173 gene open 6617-6973
2359 CALAIK010000062.1 GCA937922695_01174 gene open 7120-7836
2360 CALAIK010000062.1 GCA937922695_01175 gene open 8436-8654
2361 CALAIK010000062.1 GCA937922695_01176 gene open 9025-9234
2362 CALAIK010000062.1 GCA937922695_01177 gene open 9702-10520
2363 CALAIK010000062.1 GCA937922695_01178 gene open 10517-11545
2364 CALAIK010000062.1 GCA937922695_01179 gene open 11609-12727
2365 CALAIK010000062.1 GCA937922695_01180 gene open 12784-13608
2366 CALAIK010000063.1 GCA937922695_01181 CDS open 628-1653 _na     341_aa lacI LacI family transcriptional regulator
2367 CALAIK010000063.1 GCA937922695_01182 CDS open 1768-4671 _na     967_aa beta-galactosidase
2368 CALAIK010000063.1 GCA937922695_01183 CDS open 4802-6199 _na     465_aa ABC transporter substrate-binding protein
2369 CALAIK010000063.1 GCA937922695_01181 gene open 628-1653 lacI
2370 CALAIK010000063.1 GCA937922695_01182 gene open 1768-4671
2371 CALAIK010000063.1 GCA937922695_01183 gene open 4802-6199
2372 CALAIK010000064.1 GCA937922695_01184 CDS open 129-860 _na     243_aa Class I glutamine amidotransferase
2373 CALAIK010000064.1 GCA937922695_01185 CDS open 1007-2338 _na     443_aa Nuclease SbcCD subunit D
2374 CALAIK010000064.1 GCA937922695_01184 gene open 129-860
2375 CALAIK010000064.1 GCA937922695_01185 gene open 1007-2338
2376 CALAIK010000065.1 GCA937922695_01186 CDS open 153-833 _na     226_aa Manganese transport regulator
2377 CALAIK010000065.1 GCA937922695_01189 CDS open 1303-1953 _na     216_aa hypothetical protein
2378 CALAIK010000065.1 GCA937922695_01190 CDS open 2136-3827 _na     563_aa ABC-2 type transport system permease protein
2379 CALAIK010000065.1 GCA937922695_01191 CDS open 3812-4600 _na     262_aa ABC transporter%2C ATP-binding protein
2380 CALAIK010000065.1 GCA937922695_01192 CDS open 4800-5426 _na     208_aa hypothetical protein
2381 CALAIK010000065.1 GCA937922695_01186 gene open 153-833
2382 CALAIK010000065.1 GCA937922695_01189 gene open 1303-1953
2383 CALAIK010000065.1 GCA937922695_01190 gene open 2136-3827
2384 CALAIK010000065.1 GCA937922695_01191 gene open 3812-4600
2385 CALAIK010000065.1 GCA937922695_01192 gene open 4800-5426
2386 CALAIK010000065.1 GCA937922695_01187 gene open 964-1036 trnK
2387 CALAIK010000065.1 GCA937922695_01188 gene open 1068-1140 trnK
2388 CALAIK010000065.1 GCA937922695_01187 tRNA open 964-1036 trnK tRNA-Lys(ctt)
2389 CALAIK010000065.1 GCA937922695_01188 tRNA open 1068-1140 trnK tRNA-Lys(ctt)
2390 CALAIK010000066.1 GCA937922695_01193 CDS open 285-1553 _na     422_aa hypothetical protein
2391 CALAIK010000066.1 GCA937922695_01194 CDS open 1687-2613 _na     308_aa Brp/Blh family beta-carotene 15%2C15'-monooxygenase
2392 CALAIK010000066.1 GCA937922695_01195 CDS open 2637-3467 _na     276_aa Oxidoreductase
2393 CALAIK010000066.1 GCA937922695_01196 CDS open 3776-4657 _na     293_aa cobQ Cobalamin biosynthesis protein CobQ
2394 CALAIK010000066.1 GCA937922695_01197 CDS open 4641-5861 _na     406_aa tadA TadA family conjugal transfer-associated ATPase
2395 CALAIK010000066.1 GCA937922695_01198 CDS open 5858-7102 _na     414_aa Type II secretion system protein F
2396 CALAIK010000066.1 GCA937922695_01199 CDS open 7195-7938 _na     247_aa Methyltransferase
2397 CALAIK010000066.1 GCA937922695_01200 CDS open 8001-9041 _na     346_aa Band 7 domain-containing protein
2398 CALAIK010000066.1 GCA937922695_01201 CDS open 9045-9251 _na     68_aa hicB Toxin-antitoxin system HicB family antitoxin
2399 CALAIK010000066.1 GCA937922695_01202 CDS open 9408-9854 _na     148_aa doxX DoxX family protein
2400 CALAIK010000066.1 GCA937922695_01203 CDS open 9851-10594 _na     247_aa TetR/AcrR family transcriptional regulator
2401 CALAIK010000066.1 GCA937922695_01204 CDS open 11321-12286 _na     321_aa NADPH:quinone reductase
2402 CALAIK010000066.1 GCA937922695_01205 CDS open 12709-12957 _na     82_aa DUF4244 domain-containing protein
2403 CALAIK010000066.1 GCA937922695_01206 CDS open 13029-13529 _na     166_aa hypothetical protein
2404 CALAIK010000066.1 GCA937922695_01207 CDS open 13538-14161 _na     207_aa Rv3654c family TadE-like protein
2405 CALAIK010000066.1 GCA937922695_01208 CDS open 14981-17527 _na     848_aa rhlE ATP-dependent RNA helicase rhlE
2406 CALAIK010000066.1 GCA937922695_01209 CDS open 17514-18014 _na     166_aa Histidine kinase
2407 CALAIK010000066.1 GCA937922695_01210 CDS open 18011-18457 _na     148_aa Histidine kinase
2408 CALAIK010000066.1 GCA937922695_01193 gene open 285-1553
2409 CALAIK010000066.1 GCA937922695_01194 gene open 1687-2613
2410 CALAIK010000066.1 GCA937922695_01195 gene open 2637-3467
2411 CALAIK010000066.1 GCA937922695_01196 gene open 3776-4657 cobQ
2412 CALAIK010000066.1 GCA937922695_01197 gene open 4641-5861 tadA
2413 CALAIK010000066.1 GCA937922695_01198 gene open 5858-7102
2414 CALAIK010000066.1 GCA937922695_01199 gene open 7195-7938
2415 CALAIK010000066.1 GCA937922695_01200 gene open 8001-9041
2416 CALAIK010000066.1 GCA937922695_01201 gene open 9045-9251 hicB
2417 CALAIK010000066.1 GCA937922695_01202 gene open 9408-9854 doxX
2418 CALAIK010000066.1 GCA937922695_01203 gene open 9851-10594
2419 CALAIK010000066.1 GCA937922695_01204 gene open 11321-12286
2420 CALAIK010000066.1 GCA937922695_01205 gene open 12709-12957
2421 CALAIK010000066.1 GCA937922695_01206 gene open 13029-13529
2422 CALAIK010000066.1 GCA937922695_01207 gene open 13538-14161
2423 CALAIK010000066.1 GCA937922695_01208 gene open 14981-17527 rhlE
2424 CALAIK010000066.1 GCA937922695_01209 gene open 17514-18014
2425 CALAIK010000066.1 GCA937922695_01210 gene open 18011-18457
2426 CALAIK010000067.1 GCA937922695_01211 CDS open 41-322 _na     93_aa hypothetical protein
2427 CALAIK010000067.1 GCA937922695_01212 CDS open 501-1625 _na     374_aa Alpha/beta hydrolase family protein
2428 CALAIK010000067.1 GCA937922695_01213 CDS open 1699-3192 _na     497_aa Cell division topological specificity factor
2429 CALAIK010000067.1 GCA937922695_01214 CDS open 3405-3734 _na     109_aa hypothetical protein
2430 CALAIK010000067.1 GCA937922695_01215 CDS open 3804-6920 _na     1038_aa FAD-binding oxidoreductase
2431 CALAIK010000067.1 GCA937922695_01211 gene open 41-322
2432 CALAIK010000067.1 GCA937922695_01212 gene open 501-1625
2433 CALAIK010000067.1 GCA937922695_01213 gene open 1699-3192
2434 CALAIK010000067.1 GCA937922695_01214 gene open 3405-3734
2435 CALAIK010000067.1 GCA937922695_01215 gene open 3804-6920
2436 CALAIK010000068.1 repeat_region open 39501-40207 CRISPR array with 12 repeats of length 28%2C consensus sequence GTTTTCCCCGCACGCGCGGGGATGAGCC and spacer length 33
2437 CALAIK010000068.1 repeat_region open 40295-41490 CRISPR array with 20 repeats of length 27%2C consensus sequence TTTTCCCCGCACGCGCGGGGATGAGCC and spacer length 34
2438 CALAIK010000068.1 repeat_region open 41575-45266 CRISPR array with 61 repeats of length 28%2C consensus sequence GTTTTCCCCGCACGCGCGGGGATGAGCC and spacer length 32
2439 CALAIK010000068.1 repeat_region open 45839-49353 CRISPR array with 58 repeats of length 28%2C consensus sequence GTTTTCCCCGCACGCGCGGGGATGAGCC and spacer length 33
2440 CALAIK010000068.1 GCA937922695_01216 CDS open 42-1034 _na     330_aa hypothetical protein
2441 CALAIK010000068.1 GCA937922695_01217 CDS open 1054-2748 _na     564_aa Phosphoenolpyruvate-protein phosphotransferase
2442 CALAIK010000068.1 GCA937922695_01218 CDS open 3092-4408 _na     438_aa metL1 aspartate kinase
2443 CALAIK010000068.1 GCA937922695_01219 CDS open 4542-5594 _na     350_aa aspartate-semialdehyde dehydrogenase
2444 CALAIK010000068.1 GCA937922695_01220 CDS open 5698-6069 _na     123_aa trxA thioredoxin
2445 CALAIK010000068.1 GCA937922695_01221 CDS open 6123-6761 _na     212_aa tetR TetR family transcriptional regulator
2446 CALAIK010000068.1 GCA937922695_01222 CDS open 6766-7338 _na     190_aa 8-oxo-dGTP diphosphatase
2447 CALAIK010000068.1 GCA937922695_01224 CDS open 7806-8420 _na     204_aa thiJ Thiamine biosynthesis protein ThiJ
2448 CALAIK010000068.1 GCA937922695_01225 CDS open 8620-10233 _na     537_aa hypothetical protein
2449 CALAIK010000068.1 GCA937922695_01226 CDS open 10362-10937 _na     191_aa GNAT family N-acetyltransferase
2450 CALAIK010000068.1 GCA937922695_01227 CDS open 11449-12507 _na     352_aa hlyD Secretion protein HlyD
2451 CALAIK010000068.1 GCA937922695_01228 CDS open 12509-13339 _na     276_aa ABC transporter ATP-binding protein
2452 CALAIK010000068.1 GCA937922695_01229 CDS open 13336-14700 _na     454_aa ftsX Cell division protein FtsX
2453 CALAIK010000068.1 GCA937922695_01230 CDS open 14721-15650 _na     309_aa Adenine DNA glycosylase
2454 CALAIK010000068.1 GCA937922695_01231 CDS open 15824-16462 _na     212_aa TM2 domain-containing protein
2455 CALAIK010000068.1 GCA937922695_01232 CDS open 16581-17177 _na     198_aa TM2 domain-containing protein
2456 CALAIK010000068.1 GCA937922695_01233 CDS open 17279-17860 _na     193_aa dcd dCTP deaminase
2457 CALAIK010000068.1 GCA937922695_01234 CDS open 19172-20404 _na     410_aa PRTRC system protein E
2458 CALAIK010000068.1 GCA937922695_01235 CDS open 20472-23045 _na     857_aa Fe-S oxidoreductase
2459 CALAIK010000068.1 GCA937922695_01236 CDS open 23351-24985 _na     544_aa purF amidophosphoribosyltransferase
2460 CALAIK010000068.1 GCA937922695_01237 CDS open 25079-26212 _na     377_aa Phosphoribosylformylglycinamidine cyclo-ligase
2461 CALAIK010000068.1 GCA937922695_01238 CDS open 26226-26510 _na     94_aa DUF3073 domain-containing protein
2462 CALAIK010000068.1 GCA937922695_01239 CDS open 26720-27034 _na     104_aa DUF3618 domain-containing protein
2463 CALAIK010000068.1 GCA937922695_01240 CDS open 27031-27867 _na     278_aa phage holin family protein
2464 CALAIK010000068.1 GCA937922695_01241 CDS open 28159-29262 _na     367_aa ABC transporter domain-containing protein
2465 CALAIK010000068.1 GCA937922695_01242 CDS open 29750-29953 _na     67_aa Ada DNA repair metal-binding domain-containing protein
2466 CALAIK010000068.1 GCA937922695_01243 CDS open 30052-33072 _na     1006_aa CRISPR-associated helicase/endonuclease Cas3
2467 CALAIK010000068.1 GCA937922695_01244 CDS open 33069-34733 _na     554_aa Cse1 family CRISPR-associated protein
2468 CALAIK010000068.1 GCA937922695_01245 CDS open 34730-35419 _na     229_aa casB type I-E CRISPR-associated protein Cse2/CasB
2469 CALAIK010000068.1 GCA937922695_01246 CDS open 35469-36623 _na     384_aa cas7e type I-E CRISPR-associated protein Cas7/Cse4/CasC
2470 CALAIK010000068.1 GCA937922695_01247 CDS open 36620-37348 _na     242_aa cas5e type I-E CRISPR-associated protein Cas5/CasD
2471 CALAIK010000068.1 GCA937922695_01248 CDS open 37349-38107 _na     252_aa cas6e type I-E CRISPR-associated protein Cas6/Cse3/CasE
2472 CALAIK010000068.1 GCA937922695_01249 CDS open 38104-39072 _na     322_aa cas1e type I-E CRISPR-associated endonuclease Cas1e
2473 CALAIK010000068.1 GCA937922695_01250 CDS open 39069-39482 _na     137_aa cas2e type I-E CRISPR-associated endoribonuclease Cas2e
2474 CALAIK010000068.1 GCA937922695_01254 CDS open 50406-52196 _na     596_aa mscS Transporter%2C small conductance mechanosensitive ion channel MscS family protein
2475 CALAIK010000068.1 GCA937922695_01255 CDS open 52251-52667 _na     138_aa msrB Peptide methionine sulfoxide reductase MsrB
2476 CALAIK010000068.1 GCA937922695_01256 CDS open 52668-53534 _na     288_aa eamA EamA domain-containing protein
2477 CALAIK010000068.1 GCA937922695_01257 CDS open 53636-54880 _na     414_aa Bcr/CflA family drug resistance efflux transporter
2478 CALAIK010000068.1 GCA937922695_01258 CDS open 54893-57058 _na     721_aa pfkB Carbohydrate kinase PfkB domain-containing protein
2479 CALAIK010000068.1 GCA937922695_01260 CDS open 57277-57867 _na     196_aa Histone acetyltransferase
2480 CALAIK010000068.1 GCA937922695_01261 CDS open 58439-59908 _na     489_aa mutT DNA mismatch repair protein MutT
2481 CALAIK010000068.1 GCA937922695_01262 CDS open 60071-60550 _na     159_aa Septum formation domain protein
2482 CALAIK010000068.1 GCA937922695_01263 CDS open 60553-61614 _na     353_aa pitA Inorganic phosphate transporter
2483 CALAIK010000068.1 GCA937922695_01264 CDS open 61618-62250 _na     210_aa Phosphate transport regulator
2484 CALAIK010000068.1 GCA937922695_01265 CDS open 62337-62963 _na     208_aa hypothetical protein
2485 CALAIK010000068.1 GCA937922695_01266 CDS open 62973-63155 _na     60_aa hypothetical protein
2486 CALAIK010000068.1 GCA937922695_01216 gene open 42-1034
2487 CALAIK010000068.1 GCA937922695_01217 gene open 1054-2748
2488 CALAIK010000068.1 GCA937922695_01218 gene open 3092-4408 metL1
2489 CALAIK010000068.1 GCA937922695_01219 gene open 4542-5594
2490 CALAIK010000068.1 GCA937922695_01220 gene open 5698-6069 trxA
2491 CALAIK010000068.1 GCA937922695_01221 gene open 6123-6761 tetR
2492 CALAIK010000068.1 GCA937922695_01222 gene open 6766-7338
2493 CALAIK010000068.1 GCA937922695_01224 gene open 7806-8420 thiJ
2494 CALAIK010000068.1 GCA937922695_01225 gene open 8620-10233
2495 CALAIK010000068.1 GCA937922695_01226 gene open 10362-10937
2496 CALAIK010000068.1 GCA937922695_01227 gene open 11449-12507 hlyD
2497 CALAIK010000068.1 GCA937922695_01228 gene open 12509-13339
2498 CALAIK010000068.1 GCA937922695_01229 gene open 13336-14700 ftsX
2499 CALAIK010000068.1 GCA937922695_01230 gene open 14721-15650
2500 CALAIK010000068.1 GCA937922695_01231 gene open 15824-16462