BAKTAGenome Explorer: Lancefieldella parvula (GCA_937923135.1)
Select a Genome:
|
BAKTA Annotations for GCA_937923135.1
|
Search & Sort all 2796 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 2501 | CALAIM010000017.1 | GCA937923135_01096 | tRNA | open | 2218-2293 | trnK | tRNA-Lys(ctt) | |
| 2502 | CALAIM010000017.1 | GCA937923135_01108 | tRNA | open | 16941-17016 | trnG | tRNA-Gly(tcc) | |
| 2503 | CALAIM010000017.1 | GCA937923135_01109 | tRNA | open | 17040-17116 | trnP | tRNA-Pro(tgg) | |
| 2504 | CALAIM010000017.1 | GCA937923135_01114 | tRNA | open | 24219-24304 | trnL | tRNA-Leu(tag) | |
| 2505 | CALAIM010000017.1 | GCA937923135_01170 | tRNA | open | 81878-81954 | trnR | tRNA-Arg(ccg) | |
| 2506 | CALAIM010000017.1 | GCA937923135_01221 | tRNA | open | 135339-135414 | trnA | tRNA-Ala(ggc) | |
| 2507 | CALAIM010000017.1 | GCA937923135_01222 | tRNA | open | 135455-135530 | trnI | tRNA-Ile2(cat) | |
| 2508 | CALAIM010000017.1 | GCA937923135_01225 | tRNA | open | 136555-136629 | trnV | tRNA-Val(cac) | |
| 2509 | CALAIM010000017.1 | GCA937923135_01247 | tRNA | open | 160614-160690 | trnP | tRNA-Pro(ggg) | |
| 2510 | CALAIM010000018.1 | GCA937923135_01290 | gene | open | 35220-35313 | Bacteria_small_SRP | ||
| 2511 | CALAIM010000018.1 | GCA937923135_01312 | gene | open | 55404-56915 | rrs | ||
| 2512 | CALAIM010000018.1 | GCA937923135_01290 | ncRNA | open | 35220-35313 | Bacterial small signal recognition particle RNA | ||
| 2513 | CALAIM010000018.1 | GCA937923135_01312 | rRNA | open | 55404-56915 | rrs | 16S ribosomal RNA | |
| 2514 | CALAIM010000018.1 | GCA937923135_01251 | CDS | open | 714-890 | _na 58_aa | hypothetical protein | |
| 2515 | CALAIM010000018.1 | GCA937923135_01252 | CDS | open | 1060-2319 | _na 419_aa | bofC | Stp1/IreP family PP2C-type Ser/Thr phosphatase |
| 2516 | CALAIM010000018.1 | GCA937923135_01253 | CDS | open | 2327-2740 | _na 137_aa | fHA | FHA domain-containing protein |
| 2517 | CALAIM010000018.1 | GCA937923135_01254 | CDS | open | 2740-3864 | _na 374_aa | fHA | DUF3662 domain-containing protein |
| 2518 | CALAIM010000018.1 | GCA937923135_01255 | CDS | open | 3851-5647 | _na 598_aa | sPS1 | Serine/threonine protein kinase |
| 2519 | CALAIM010000018.1 | GCA937923135_01257 | CDS | open | 5909-6130 | _na 73_aa | DUF6724 domain-containing protein | |
| 2520 | CALAIM010000018.1 | GCA937923135_01258 | CDS | open | 6241-7524 | _na 427_aa | serS | serine--tRNA ligase |
| 2521 | CALAIM010000018.1 | GCA937923135_01259 | CDS | open | 7669-7989 | _na 106_aa | hypothetical protein | |
| 2522 | CALAIM010000018.1 | GCA937923135_01262 | CDS | open | 8405-8680 | _na 91_aa | hypothetical protein | |
| 2523 | CALAIM010000018.1 | GCA937923135_01263 | CDS | open | 8667-9236 | _na 189_aa | hypothetical protein | |
| 2524 | CALAIM010000018.1 | GCA937923135_01264 | CDS | open | 9476-9574 | _na 32_aa | hypothetical protein | |
| 2525 | CALAIM010000018.1 | GCA937923135_01265 | CDS | open | 9650-11347 | _na 565_aa | amyA | Putative alpha%2Calpha-phosphotrehalase |
| 2526 | CALAIM010000018.1 | GCA937923135_01266 | CDS | open | 11398-12894 | _na 498_aa | treB | PTS trehalose transporter subunit IIBC |
| 2527 | CALAIM010000018.1 | GCA937923135_01267 | CDS | open | 13111-13830 | _na 239_aa | treR | trehalose operon repressor |
| 2528 | CALAIM010000018.1 | GCA937923135_01268 | CDS | open | 13849-14244 | _na 131_aa | baeS | Sensor-like histidine kinase SenX3 |
| 2529 | CALAIM010000018.1 | GCA937923135_01269 | CDS | open | 14329-15264 | _na 311_aa | gluQRS | tRNA glutamyl-Q(34) synthetase GluQRS |
| 2530 | CALAIM010000018.1 | GCA937923135_01270 | CDS | open | 15267-15896 | _na 209_aa | GNAT family N-acetyltransferase | |
| 2531 | CALAIM010000018.1 | GCA937923135_01271 | CDS | open | 16037-17626 | _na 529_aa | purH | bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase |
| 2532 | CALAIM010000018.1 | GCA937923135_01272 | CDS | open | 17679-18341 | _na 220_aa | Branched-chain-amino-acid aminotransferase | |
| 2533 | CALAIM010000018.1 | GCA937923135_01273 | CDS | open | 18736-22290 | _na 1184_aa | nifJ | pyruvate:ferredoxin (flavodoxin) oxidoreductase |
| 2534 | CALAIM010000018.1 | GCA937923135_01274 | CDS | open | 22439-23851 | _na 470_aa | murT | Lipid II isoglutaminyl synthase (glutamine-hydrolyzing) subunit MurT |
| 2535 | CALAIM010000018.1 | GCA937923135_01275 | CDS | open | 23844-24590 | _na 248_aa | CobB/CobQ domain protein glutamine amidotransferase | |
| 2536 | CALAIM010000018.1 | GCA937923135_01276 | CDS | open | 24618-24791 | _na 57_aa | hypothetical protein | |
| 2537 | CALAIM010000018.1 | GCA937923135_01277 | CDS | open | 24806-25432 | _na 208_aa | queT | QueT transporter |
| 2538 | CALAIM010000018.1 | GCA937923135_01278 | CDS | open | 25439-26779 | _na 446_aa | lytS | histidine kinase |
| 2539 | CALAIM010000018.1 | GCA937923135_01279 | CDS | open | 26828-27541 | _na 237_aa | lytT | Two component transcriptional regulator%2C LytTR family |
| 2540 | CALAIM010000018.1 | GCA937923135_01280 | CDS | open | 27594-28091 | _na 165_aa | yfcE | Phosphoesterase |
| 2541 | CALAIM010000018.1 | GCA937923135_01281 | CDS | open | 28051-28767 | _na 238_aa | pgpB | Phosphoesterase PA-phosphatase related |
| 2542 | CALAIM010000018.1 | GCA937923135_01282 | CDS | open | 28867-29184 | _na 105_aa | trxA | thioredoxin |
| 2543 | CALAIM010000018.1 | GCA937923135_01283 | CDS | open | 29336-29863 | _na 175_aa | hypothetical protein | |
| 2544 | CALAIM010000018.1 | GCA937923135_01284 | CDS | open | 29960-31666 | _na 568_aa | pgi | glucose-6-phosphate isomerase |
| 2545 | CALAIM010000018.1 | GCA937923135_01285 | CDS | open | 31896-32474 | _na 192_aa | hypothetical protein | |
| 2546 | CALAIM010000018.1 | GCA937923135_01286 | CDS | open | 32529-33023 | _na 164_aa | agaB | PTS system sorbose subfamily IIB component |
| 2547 | CALAIM010000018.1 | GCA937923135_01287 | CDS | open | 33043-33909 | _na 288_aa | manY | PTS system sorbose-specific iic component |
| 2548 | CALAIM010000018.1 | GCA937923135_01288 | CDS | open | 33912-34730 | _na 272_aa | manZ | PTS system mannose/fructose/sorbose family IID component |
| 2549 | CALAIM010000018.1 | GCA937923135_01289 | CDS | open | 34823-35161 | _na 112_aa | DUF485 domain-containing protein | |
| 2550 | CALAIM010000018.1 | GCA937923135_01291 | CDS | open | 35373-36062 | _na 229_aa | dedA | SNARE associated Golgi protein |
| 2551 | CALAIM010000018.1 | GCA937923135_01292 | CDS | open | 36135-37823 | _na 562_aa | hypothetical protein | |
| 2552 | CALAIM010000018.1 | GCA937923135_01293 | CDS | open | 38039-39106 | _na 355_aa | prfA | peptide chain release factor 1 |
| 2553 | CALAIM010000018.1 | GCA937923135_01294 | CDS | open | 39119-40012 | _na 297_aa | prmC | peptide chain release factor N(5)-glutamine methyltransferase |
| 2554 | CALAIM010000018.1 | GCA937923135_01295 | CDS | open | 40069-40719 | _na 216_aa | tsaC | L-threonylcarbamoyladenylate synthase |
| 2555 | CALAIM010000018.1 | GCA937923135_01296 | CDS | open | 40809-41273 | _na 154_aa | rpiB | ribose 5-phosphate isomerase B |
| 2556 | CALAIM010000018.1 | GCA937923135_01297 | CDS | open | 41396-42040 | _na 214_aa | upp | uracil phosphoribosyltransferase |
| 2557 | CALAIM010000018.1 | GCA937923135_01298 | CDS | open | 42346-42501 | _na 51_aa | hypothetical protein | |
| 2558 | CALAIM010000018.1 | GCA937923135_01299 | CDS | open | 42549-43349 | _na 266_aa | atpB | F0F1 ATP synthase subunit A |
| 2559 | CALAIM010000018.1 | GCA937923135_01300 | CDS | open | 43486-43680 | _na 64_aa | atpE | ATP synthase F(0) sector subunit c |
| 2560 | CALAIM010000018.1 | GCA937923135_01301 | CDS | open | 43723-44334 | _na 203_aa | atpF | F0F1 ATP synthase subunit B |
| 2561 | CALAIM010000018.1 | GCA937923135_01302 | CDS | open | 44324-44797 | _na 157_aa | atpH | ATP synthase F1 subunit delta |
| 2562 | CALAIM010000018.1 | GCA937923135_01303 | CDS | open | 44797-46470 | _na 557_aa | atpA | F0F1 ATP synthase subunit alpha |
| 2563 | CALAIM010000018.1 | GCA937923135_01304 | CDS | open | 46528-47394 | _na 288_aa | atpG | ATP synthase F1 subunit gamma |
| 2564 | CALAIM010000018.1 | GCA937923135_01305 | CDS | open | 47394-48875 | _na 493_aa | atpD | F0F1 ATP synthase subunit beta |
| 2565 | CALAIM010000018.1 | GCA937923135_01306 | CDS | open | 48884-49306 | _na 140_aa | atpC | ATP synthase F1 subunit epsilon |
| 2566 | CALAIM010000018.1 | GCA937923135_01307 | CDS | open | 49334-50617 | _na 427_aa | murA | UDP-N-acetylglucosamine 1-carboxyvinyltransferase |
| 2567 | CALAIM010000018.1 | GCA937923135_01308 | CDS | open | 50621-51844 | _na 407_aa | Cell envelope-related transcriptional attenuator domain-containing protein | |
| 2568 | CALAIM010000018.1 | GCA937923135_01309 | CDS | open | 51953-52381 | _na 142_aa | mntR | Manganese transport regulator |
| 2569 | CALAIM010000018.1 | GCA937923135_01310 | CDS | open | 52502-53395 | _na 297_aa | galU | UTP--glucose-1-phosphate uridylyltransferase |
| 2570 | CALAIM010000018.1 | GCA937923135_01311 | CDS | open | 53376-54791 | _na 471_aa | manB | Phosphoglucomutase/phosphomannomutase alpha/beta/alpha domain I |
| 2571 | CALAIM010000018.1 | GCA937923135_01251 | gene | open | 714-890 | |||
| 2572 | CALAIM010000018.1 | GCA937923135_01252 | gene | open | 1060-2319 | bofC | ||
| 2573 | CALAIM010000018.1 | GCA937923135_01253 | gene | open | 2327-2740 | fHA | ||
| 2574 | CALAIM010000018.1 | GCA937923135_01254 | gene | open | 2740-3864 | fHA | ||
| 2575 | CALAIM010000018.1 | GCA937923135_01255 | gene | open | 3851-5647 | sPS1 | ||
| 2576 | CALAIM010000018.1 | GCA937923135_01257 | gene | open | 5909-6130 | |||
| 2577 | CALAIM010000018.1 | GCA937923135_01258 | gene | open | 6241-7524 | serS | ||
| 2578 | CALAIM010000018.1 | GCA937923135_01259 | gene | open | 7669-7989 | |||
| 2579 | CALAIM010000018.1 | GCA937923135_01262 | gene | open | 8405-8680 | |||
| 2580 | CALAIM010000018.1 | GCA937923135_01263 | gene | open | 8667-9236 | |||
| 2581 | CALAIM010000018.1 | GCA937923135_01264 | gene | open | 9476-9574 | |||
| 2582 | CALAIM010000018.1 | GCA937923135_01265 | gene | open | 9650-11347 | amyA | ||
| 2583 | CALAIM010000018.1 | GCA937923135_01266 | gene | open | 11398-12894 | treB | ||
| 2584 | CALAIM010000018.1 | GCA937923135_01267 | gene | open | 13111-13830 | treR | ||
| 2585 | CALAIM010000018.1 | GCA937923135_01268 | gene | open | 13849-14244 | baeS | ||
| 2586 | CALAIM010000018.1 | GCA937923135_01269 | gene | open | 14329-15264 | gluQRS | ||
| 2587 | CALAIM010000018.1 | GCA937923135_01270 | gene | open | 15267-15896 | |||
| 2588 | CALAIM010000018.1 | GCA937923135_01271 | gene | open | 16037-17626 | purH | ||
| 2589 | CALAIM010000018.1 | GCA937923135_01272 | gene | open | 17679-18341 | |||
| 2590 | CALAIM010000018.1 | GCA937923135_01273 | gene | open | 18736-22290 | nifJ | ||
| 2591 | CALAIM010000018.1 | GCA937923135_01274 | gene | open | 22439-23851 | murT | ||
| 2592 | CALAIM010000018.1 | GCA937923135_01275 | gene | open | 23844-24590 | |||
| 2593 | CALAIM010000018.1 | GCA937923135_01276 | gene | open | 24618-24791 | |||
| 2594 | CALAIM010000018.1 | GCA937923135_01277 | gene | open | 24806-25432 | queT | ||
| 2595 | CALAIM010000018.1 | GCA937923135_01278 | gene | open | 25439-26779 | lytS | ||
| 2596 | CALAIM010000018.1 | GCA937923135_01279 | gene | open | 26828-27541 | lytT | ||
| 2597 | CALAIM010000018.1 | GCA937923135_01280 | gene | open | 27594-28091 | yfcE | ||
| 2598 | CALAIM010000018.1 | GCA937923135_01281 | gene | open | 28051-28767 | pgpB | ||
| 2599 | CALAIM010000018.1 | GCA937923135_01282 | gene | open | 28867-29184 | trxA | ||
| 2600 | CALAIM010000018.1 | GCA937923135_01283 | gene | open | 29336-29863 | |||
| 2601 | CALAIM010000018.1 | GCA937923135_01284 | gene | open | 29960-31666 | pgi | ||
| 2602 | CALAIM010000018.1 | GCA937923135_01285 | gene | open | 31896-32474 | |||
| 2603 | CALAIM010000018.1 | GCA937923135_01286 | gene | open | 32529-33023 | agaB | ||
| 2604 | CALAIM010000018.1 | GCA937923135_01287 | gene | open | 33043-33909 | manY | ||
| 2605 | CALAIM010000018.1 | GCA937923135_01288 | gene | open | 33912-34730 | manZ | ||
| 2606 | CALAIM010000018.1 | GCA937923135_01289 | gene | open | 34823-35161 | |||
| 2607 | CALAIM010000018.1 | GCA937923135_01291 | gene | open | 35373-36062 | dedA | ||
| 2608 | CALAIM010000018.1 | GCA937923135_01292 | gene | open | 36135-37823 | |||
| 2609 | CALAIM010000018.1 | GCA937923135_01293 | gene | open | 38039-39106 | prfA | ||
| 2610 | CALAIM010000018.1 | GCA937923135_01294 | gene | open | 39119-40012 | prmC | ||
| 2611 | CALAIM010000018.1 | GCA937923135_01295 | gene | open | 40069-40719 | tsaC | ||
| 2612 | CALAIM010000018.1 | GCA937923135_01296 | gene | open | 40809-41273 | rpiB | ||
| 2613 | CALAIM010000018.1 | GCA937923135_01297 | gene | open | 41396-42040 | upp | ||
| 2614 | CALAIM010000018.1 | GCA937923135_01298 | gene | open | 42346-42501 | |||
| 2615 | CALAIM010000018.1 | GCA937923135_01299 | gene | open | 42549-43349 | atpB | ||
| 2616 | CALAIM010000018.1 | GCA937923135_01300 | gene | open | 43486-43680 | atpE | ||
| 2617 | CALAIM010000018.1 | GCA937923135_01301 | gene | open | 43723-44334 | atpF | ||
| 2618 | CALAIM010000018.1 | GCA937923135_01302 | gene | open | 44324-44797 | atpH | ||
| 2619 | CALAIM010000018.1 | GCA937923135_01303 | gene | open | 44797-46470 | atpA | ||
| 2620 | CALAIM010000018.1 | GCA937923135_01304 | gene | open | 46528-47394 | atpG | ||
| 2621 | CALAIM010000018.1 | GCA937923135_01305 | gene | open | 47394-48875 | atpD | ||
| 2622 | CALAIM010000018.1 | GCA937923135_01306 | gene | open | 48884-49306 | atpC | ||
| 2623 | CALAIM010000018.1 | GCA937923135_01307 | gene | open | 49334-50617 | murA | ||
| 2624 | CALAIM010000018.1 | GCA937923135_01308 | gene | open | 50621-51844 | |||
| 2625 | CALAIM010000018.1 | GCA937923135_01309 | gene | open | 51953-52381 | mntR | ||
| 2626 | CALAIM010000018.1 | GCA937923135_01310 | gene | open | 52502-53395 | galU | ||
| 2627 | CALAIM010000018.1 | GCA937923135_01311 | gene | open | 53376-54791 | manB | ||
| 2628 | CALAIM010000018.1 | GCA937923135_01256 | gene | open | 5781-5867 | trnL | ||
| 2629 | CALAIM010000018.1 | GCA937923135_01260 | gene | open | 8026-8102 | trnR | ||
| 2630 | CALAIM010000018.1 | GCA937923135_01261 | gene | open | 8216-8306 | trnS | ||
| 2631 | CALAIM010000018.1 | GCA937923135_01313 | gene | open | 57019-57092 | trnA | ||
| 2632 | CALAIM010000018.1 | GCA937923135_01256 | tRNA | open | 5781-5867 | trnL | tRNA-Leu(cag) | |
| 2633 | CALAIM010000018.1 | GCA937923135_01260 | tRNA | open | 8026-8102 | trnR | tRNA-Arg(acg) | |
| 2634 | CALAIM010000018.1 | GCA937923135_01261 | tRNA | open | 8216-8306 | trnS | tRNA-Ser(gct) | |
| 2635 | CALAIM010000018.1 | GCA937923135_01313 | tRNA | open | 57019-57092 | trnA | tRNA-Ala(tgc) | |
| 2636 | CALAIM010000019.1 | GCA937923135_01314 | CDS | open | 12-626 | _na 204_aa | hypothetical protein | |
| 2637 | CALAIM010000019.1 | GCA937923135_01315 | CDS | open | 688-1149 | _na 153_aa | hypothetical protein | |
| 2638 | CALAIM010000019.1 | GCA937923135_01316 | CDS | open | 1170-1697 | _na 175_aa | hypothetical protein | |
| 2639 | CALAIM010000019.1 | GCA937923135_01314 | gene | open | 12-626 | |||
| 2640 | CALAIM010000019.1 | GCA937923135_01315 | gene | open | 688-1149 | |||
| 2641 | CALAIM010000019.1 | GCA937923135_01316 | gene | open | 1170-1697 | |||
| 2642 | CALAIM010000020.1 | GCA937923135_01392 | gene | open | 98328-98443 | rrf | ||
| 2643 | CALAIM010000020.1 | GCA937923135_01393 | gene | open | 98556-101493 | rrl | ||
| 2644 | CALAIM010000020.1 | GCA937923135_01392 | rRNA | open | 98328-98443 | rrf | 5S ribosomal RNA | |
| 2645 | CALAIM010000020.1 | GCA937923135_01393 | rRNA | open | 98556-101493 | rrl | 23S ribosomal RNA | |
| 2646 | CALAIM010000020.1 | repeat_region | open | 20919-22545 | CRISPR array with 25 repeats of length 36%2C consensus sequence GTTTAGTTACCAGTCAGAATGTCACTGCGCCAAAAC and spacer length 29 | |||
| 2647 | CALAIM010000020.1 | GCA937923135_01318 | CDS | open | 289-1842 | _na 517_aa | murE | UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2%2C 6-diaminopimelate ligase |
| 2648 | CALAIM010000020.1 | GCA937923135_01319 | CDS | open | 2212-4683 | _na 823_aa | xFP | phosphoketolase |
| 2649 | CALAIM010000020.1 | GCA937923135_01320 | CDS | open | 5005-6078 | _na 357_aa | HTH lacI-type domain-containing protein | |
| 2650 | CALAIM010000020.1 | GCA937923135_01321 | CDS | open | 6276-7640 | _na 454_aa | UPF0210 protein Apar_1221 | |
| 2651 | CALAIM010000020.1 | GCA937923135_01322 | CDS | open | 7696-10422 | _na 908_aa | Helicase ATP-binding domain-containing protein | |
| 2652 | CALAIM010000020.1 | GCA937923135_01323 | CDS | open | 10645-11781 | _na 378_aa | elyC | DUF218 domain-containing protein |
| 2653 | CALAIM010000020.1 | GCA937923135_01324 | CDS | open | 11828-14101 | _na 757_aa | Na+/H+ antiporter | |
| 2654 | CALAIM010000020.1 | GCA937923135_01325 | CDS | open | 14103-14951 | _na 282_aa | Esterase | |
| 2655 | CALAIM010000020.1 | GCA937923135_01326 | CDS | open | 14991-16337 | _na 448_aa | comEC | Beta-lactamase domain protein |
| 2656 | CALAIM010000020.1 | GCA937923135_01327 | CDS | open | 16337-16612 | _na 91_aa | DUF3006 domain-containing protein | |
| 2657 | CALAIM010000020.1 | GCA937923135_01328 | CDS | open | 16777-18096 | _na 439_aa | Lipoprotein | |
| 2658 | CALAIM010000020.1 | GCA937923135_01329 | CDS | open | 18395-19681 | _na 428_aa | baeS | Sensor-like histidine kinase SenX3 |
| 2659 | CALAIM010000020.1 | GCA937923135_01330 | CDS | open | 19722-20396 | _na 224_aa | ompR | Two component transcriptional regulator%2C winged helix family |
| 2660 | CALAIM010000020.1 | GCA937923135_01331 | CDS | open | 23265-23573 | _na 102_aa | cas2 | CRISPR-associated endonuclease Cas2 |
| 2661 | CALAIM010000020.1 | GCA937923135_01332 | CDS | open | 23597-24475 | _na 292_aa | cas1 | type II CRISPR-associated endonuclease Cas1 |
| 2662 | CALAIM010000020.1 | GCA937923135_01333 | CDS | open | 24465-28562 | _na 1365_aa | CRISPR-associated endonuclease Cas9 | |
| 2663 | CALAIM010000020.1 | GCA937923135_01334 | CDS | open | 28971-29669 | _na 232_aa | HTH cro/C1-type domain-containing protein | |
| 2664 | CALAIM010000020.1 | GCA937923135_01335 | CDS | open | 30026-30310 | _na 94_aa | hypothetical protein | |
| 2665 | CALAIM010000020.1 | GCA937923135_01336 | CDS | open | 30378-31157 | _na 259_aa | hsdR | type I restriction enzyme HsdR N-terminal domain-containing protein |
| 2666 | CALAIM010000020.1 | GCA937923135_01337 | CDS | open | 31415-33070 | _na 551_aa | MBG domain-containing protein | |
| 2667 | CALAIM010000020.1 | GCA937923135_01338 | CDS | open | 33150-33509 | _na 119_aa | hypothetical protein | |
| 2668 | CALAIM010000020.1 | GCA937923135_01339 | CDS | open | 33509-34087 | _na 192_aa | pncA | Isochorismatase family protein |
| 2669 | CALAIM010000020.1 | GCA937923135_01340 | CDS | open | 34416-35342 | _na 308_aa | Lipocalin-like domain-containing protein | |
| 2670 | CALAIM010000020.1 | GCA937923135_01341 | CDS | open | 35536-36093 | _na 185_aa | tsaE | tRNA threonylcarbamoyladenosine biosynthesis protein TsaE |
| 2671 | CALAIM010000020.1 | GCA937923135_01342 | CDS | open | 36086-36751 | _na 221_aa | udg4 | Type-4 uracil-DNA glycosylase |
| 2672 | CALAIM010000020.1 | GCA937923135_01343 | CDS | open | 36751-37905 | _na 384_aa | alr | alanine racemase |
| 2673 | CALAIM010000020.1 | GCA937923135_01344 | CDS | open | 37915-39540 | _na 541_aa | nnr2 | Bifunctional NAD(P)H-hydrate repair enzyme |
| 2674 | CALAIM010000020.1 | GCA937923135_01345 | CDS | open | 39544-40074 | _na 176_aa | acpS | Holo-[acyl-carrier-protein] synthase |
| 2675 | CALAIM010000020.1 | GCA937923135_01346 | CDS | open | 40099-41442 | _na 447_aa | glmM | phosphoglucosamine mutase |
| 2676 | CALAIM010000020.1 | GCA937923135_01347 | CDS | open | 41669-42064 | _na 131_aa | rpsI | 30S ribosomal protein S9 |
| 2677 | CALAIM010000020.1 | GCA937923135_01348 | CDS | open | 42068-42508 | _na 146_aa | rplM | 50S ribosomal protein L13 |
| 2678 | CALAIM010000020.1 | GCA937923135_01349 | CDS | open | 42880-43890 | _na 336_aa | frmB | Putative esterase |
| 2679 | CALAIM010000020.1 | GCA937923135_01350 | CDS | open | 43994-44932 | _na 312_aa | pfkB | 1-phosphofructokinase |
| 2680 | CALAIM010000020.1 | GCA937923135_01351 | CDS | open | 45140-46126 | _na 328_aa | yjjU | Patatin |
| 2681 | CALAIM010000020.1 | GCA937923135_01352 | CDS | open | 46370-46714 | _na 114_aa | hypothetical protein | |
| 2682 | CALAIM010000020.1 | GCA937923135_01353 | CDS | open | 46760-47464 | _na 234_aa | hipB | Transcriptional regulator%2C XRE family |
| 2683 | CALAIM010000020.1 | GCA937923135_01354 | CDS | open | 47570-48664 | _na 364_aa | mupG | MupG family TIM beta-alpha barrel fold protein |
| 2684 | CALAIM010000020.1 | GCA937923135_01355 | CDS | open | 48755-50041 | _na 428_aa | celB | Permease IIC component |
| 2685 | CALAIM010000020.1 | GCA937923135_01356 | CDS | open | 50111-50425 | _na 104_aa | celA | Phosphotransferase system lactose/cellobiose-specific IIB subunit |
| 2686 | CALAIM010000020.1 | GCA937923135_01357 | CDS | open | 50632-54888 | _na 1418_aa | sacC | LPXTG-motif cell wall anchor domain protein |
| 2687 | CALAIM010000020.1 | GCA937923135_01358 | CDS | open | 55242-55760 | _na 172_aa | DUF3021 domain-containing protein | |
| 2688 | CALAIM010000020.1 | GCA937923135_01359 | CDS | open | 55833-56276 | _na 147_aa | HTH LytTR-type domain-containing protein | |
| 2689 | CALAIM010000020.1 | GCA937923135_01360 | CDS | open | 56503-58767 | _na 754_aa | Prealbumin-like fold domain-containing protein | |
| 2690 | CALAIM010000020.1 | GCA937923135_01361 | CDS | open | 58920-59891 | _na 323_aa | srtA | Sortase family protein |
| 2691 | CALAIM010000020.1 | GCA937923135_01362 | CDS | open | 59917-61344 | _na 475_aa | LPXTG-motif cell wall anchor domain protein | |
| 2692 | CALAIM010000020.1 | GCA937923135_01363 | CDS | open | 61483-64074 | _na 863_aa | clfA | Cna B domain protein |
| 2693 | CALAIM010000020.1 | GCA937923135_01364 | CDS | open | 64338-66398 | _na 686_aa | Conserved repeat domain protein | |
| 2694 | CALAIM010000020.1 | GCA937923135_01365 | CDS | open | 66584-66865 | _na 93_aa | DUF1049 domain-containing protein | |
| 2695 | CALAIM010000020.1 | GCA937923135_01366 | CDS | open | 66960-68642 | _na 560_aa | wrbA | NAD(P)H dehydrogenase (Quinone) |
| 2696 | CALAIM010000020.1 | GCA937923135_01367 | CDS | open | 68623-69180 | _na 185_aa | padR | Transcriptional regulator%2C PadR-like family |
| 2697 | CALAIM010000020.1 | GCA937923135_01368 | CDS | open | 69610-70257 | _na 215_aa | Metallo-beta-lactamase domain protein | |
| 2698 | CALAIM010000020.1 | GCA937923135_01369 | CDS | open | 70273-71064 | _na 263_aa | ubiE | Methyltransferase type 11 |
| 2699 | CALAIM010000020.1 | GCA937923135_01370 | CDS | open | 71824-72558 | _na 244_aa | yoaK | DUF1275 domain-containing protein |
| 2700 | CALAIM010000020.1 | GCA937923135_01371 | CDS | open | 72688-72825 | _na 45_aa | norV | Rubredoxin-like domain-containing protein |
| 2701 | CALAIM010000020.1 | GCA937923135_01372 | CDS | open | 73088-73573 | _na 161_aa | smpB | SsrA-binding protein SmpB |
| 2702 | CALAIM010000020.1 | GCA937923135_01373 | CDS | open | 73576-74511 | _na 311_aa | Tetratricopeptide repeat protein | |
| 2703 | CALAIM010000020.1 | GCA937923135_01374 | CDS | open | 74593-76605 | _na 670_aa | rnr | ribonuclease R |
| 2704 | CALAIM010000020.1 | GCA937923135_01375 | CDS | open | 76838-78085 | _na 415_aa | hutI | Amidohydrolase |
| 2705 | CALAIM010000020.1 | GCA937923135_01376 | CDS | open | 78221-79663 | _na 480_aa | potE | Amino acid permease-associated region |
| 2706 | CALAIM010000020.1 | GCA937923135_01377 | CDS | open | 79888-80736 | _na 282_aa | lysR | Transcriptional regulator%2C LysR family |
| 2707 | CALAIM010000020.1 | GCA937923135_01378 | CDS | open | 80934-81869 | _na 311_aa | ftsX | permease-like cell division protein FtsX |
| 2708 | CALAIM010000020.1 | GCA937923135_01379 | CDS | open | 81847-82875 | _na 342_aa | ftsE | cell division ATP-binding protein FtsE |
| 2709 | CALAIM010000020.1 | GCA937923135_01380 | CDS | open | 83488-84138 | _na 216_aa | eda | KDPG and KHG aldolase |
| 2710 | CALAIM010000020.1 | GCA937923135_01381 | CDS | open | 84211-85107 | _na 298_aa | dapA | Dihydrodipicolinate synthetase |
| 2711 | CALAIM010000020.1 | GCA937923135_01382 | CDS | open | 85147-85755 | _na 202_aa | gutQ | Sugar isomerase (SIS) |
| 2712 | CALAIM010000020.1 | GCA937923135_01383 | CDS | open | 85800-86414 | _na 204_aa | Photosystem I assembly protein Ycf4 | |
| 2713 | CALAIM010000020.1 | GCA937923135_01384 | CDS | open | 86513-87820 | _na 435_aa | ulaA | Ascorbate-specific PTS system EIIC component |
| 2714 | CALAIM010000020.1 | GCA937923135_01385 | CDS | open | 87983-88282 | _na 99_aa | sgaB | Phosphotransferase system lactose/cellobiose-specific IIB subunit |
| 2715 | CALAIM010000020.1 | GCA937923135_01386 | CDS | open | 88282-88737 | _na 151_aa | ptsN | Ascorbate-specific PTS system EIIA component |
| 2716 | CALAIM010000020.1 | GCA937923135_01387 | CDS | open | 89117-89899 | _na 260_aa | glpR | Transcriptional regulator%2C DeoR family |
| 2717 | CALAIM010000020.1 | GCA937923135_01388 | CDS | open | 90055-90936 | _na 293_aa | yitT | DUF2179 domain-containing protein |
| 2718 | CALAIM010000020.1 | GCA937923135_01389 | CDS | open | 90938-92047 | _na 369_aa | prfB | peptide chain release factor 2 |
| 2719 | CALAIM010000020.1 | GCA937923135_01390 | CDS | open | 92050-94800 | _na 916_aa | secA | preprotein translocase subunit SecA |
| 2720 | CALAIM010000020.1 | GCA937923135_01391 | CDS | open | 94891-98013 | _na 1040_aa | dnrI | Transcriptional regulator%2C SARP family |
| 2721 | CALAIM010000020.1 | GCA937923135_01318 | gene | open | 289-1842 | murE | ||
| 2722 | CALAIM010000020.1 | GCA937923135_01319 | gene | open | 2212-4683 | xFP | ||
| 2723 | CALAIM010000020.1 | GCA937923135_01320 | gene | open | 5005-6078 | |||
| 2724 | CALAIM010000020.1 | GCA937923135_01321 | gene | open | 6276-7640 | |||
| 2725 | CALAIM010000020.1 | GCA937923135_01322 | gene | open | 7696-10422 | |||
| 2726 | CALAIM010000020.1 | GCA937923135_01323 | gene | open | 10645-11781 | elyC | ||
| 2727 | CALAIM010000020.1 | GCA937923135_01324 | gene | open | 11828-14101 | |||
| 2728 | CALAIM010000020.1 | GCA937923135_01325 | gene | open | 14103-14951 | |||
| 2729 | CALAIM010000020.1 | GCA937923135_01326 | gene | open | 14991-16337 | comEC | ||
| 2730 | CALAIM010000020.1 | GCA937923135_01327 | gene | open | 16337-16612 | |||
| 2731 | CALAIM010000020.1 | GCA937923135_01328 | gene | open | 16777-18096 | |||
| 2732 | CALAIM010000020.1 | GCA937923135_01329 | gene | open | 18395-19681 | baeS | ||
| 2733 | CALAIM010000020.1 | GCA937923135_01330 | gene | open | 19722-20396 | ompR | ||
| 2734 | CALAIM010000020.1 | GCA937923135_01331 | gene | open | 23265-23573 | cas2 | ||
| 2735 | CALAIM010000020.1 | GCA937923135_01332 | gene | open | 23597-24475 | cas1 | ||
| 2736 | CALAIM010000020.1 | GCA937923135_01333 | gene | open | 24465-28562 | |||
| 2737 | CALAIM010000020.1 | GCA937923135_01334 | gene | open | 28971-29669 | |||
| 2738 | CALAIM010000020.1 | GCA937923135_01335 | gene | open | 30026-30310 | |||
| 2739 | CALAIM010000020.1 | GCA937923135_01336 | gene | open | 30378-31157 | hsdR | ||
| 2740 | CALAIM010000020.1 | GCA937923135_01337 | gene | open | 31415-33070 | |||
| 2741 | CALAIM010000020.1 | GCA937923135_01338 | gene | open | 33150-33509 | |||
| 2742 | CALAIM010000020.1 | GCA937923135_01339 | gene | open | 33509-34087 | pncA | ||
| 2743 | CALAIM010000020.1 | GCA937923135_01340 | gene | open | 34416-35342 | |||
| 2744 | CALAIM010000020.1 | GCA937923135_01341 | gene | open | 35536-36093 | tsaE | ||
| 2745 | CALAIM010000020.1 | GCA937923135_01342 | gene | open | 36086-36751 | udg4 | ||
| 2746 | CALAIM010000020.1 | GCA937923135_01343 | gene | open | 36751-37905 | alr | ||
| 2747 | CALAIM010000020.1 | GCA937923135_01344 | gene | open | 37915-39540 | nnr2 | ||
| 2748 | CALAIM010000020.1 | GCA937923135_01345 | gene | open | 39544-40074 | acpS | ||
| 2749 | CALAIM010000020.1 | GCA937923135_01346 | gene | open | 40099-41442 | glmM | ||
| 2750 | CALAIM010000020.1 | GCA937923135_01347 | gene | open | 41669-42064 | rpsI | ||
| 2751 | CALAIM010000020.1 | GCA937923135_01348 | gene | open | 42068-42508 | rplM | ||
| 2752 | CALAIM010000020.1 | GCA937923135_01349 | gene | open | 42880-43890 | frmB | ||
| 2753 | CALAIM010000020.1 | GCA937923135_01350 | gene | open | 43994-44932 | pfkB | ||
| 2754 | CALAIM010000020.1 | GCA937923135_01351 | gene | open | 45140-46126 | yjjU | ||
| 2755 | CALAIM010000020.1 | GCA937923135_01352 | gene | open | 46370-46714 | |||
| 2756 | CALAIM010000020.1 | GCA937923135_01353 | gene | open | 46760-47464 | hipB | ||
| 2757 | CALAIM010000020.1 | GCA937923135_01354 | gene | open | 47570-48664 | mupG | ||
| 2758 | CALAIM010000020.1 | GCA937923135_01355 | gene | open | 48755-50041 | celB | ||
| 2759 | CALAIM010000020.1 | GCA937923135_01356 | gene | open | 50111-50425 | celA | ||
| 2760 | CALAIM010000020.1 | GCA937923135_01357 | gene | open | 50632-54888 | sacC | ||
| 2761 | CALAIM010000020.1 | GCA937923135_01358 | gene | open | 55242-55760 | |||
| 2762 | CALAIM010000020.1 | GCA937923135_01359 | gene | open | 55833-56276 | |||
| 2763 | CALAIM010000020.1 | GCA937923135_01360 | gene | open | 56503-58767 | |||
| 2764 | CALAIM010000020.1 | GCA937923135_01361 | gene | open | 58920-59891 | srtA | ||
| 2765 | CALAIM010000020.1 | GCA937923135_01362 | gene | open | 59917-61344 | |||
| 2766 | CALAIM010000020.1 | GCA937923135_01363 | gene | open | 61483-64074 | clfA | ||
| 2767 | CALAIM010000020.1 | GCA937923135_01364 | gene | open | 64338-66398 | |||
| 2768 | CALAIM010000020.1 | GCA937923135_01365 | gene | open | 66584-66865 | |||
| 2769 | CALAIM010000020.1 | GCA937923135_01366 | gene | open | 66960-68642 | wrbA | ||
| 2770 | CALAIM010000020.1 | GCA937923135_01367 | gene | open | 68623-69180 | padR | ||
| 2771 | CALAIM010000020.1 | GCA937923135_01368 | gene | open | 69610-70257 | |||
| 2772 | CALAIM010000020.1 | GCA937923135_01369 | gene | open | 70273-71064 | ubiE | ||
| 2773 | CALAIM010000020.1 | GCA937923135_01370 | gene | open | 71824-72558 | yoaK | ||
| 2774 | CALAIM010000020.1 | GCA937923135_01371 | gene | open | 72688-72825 | norV | ||
| 2775 | CALAIM010000020.1 | GCA937923135_01372 | gene | open | 73088-73573 | smpB | ||
| 2776 | CALAIM010000020.1 | GCA937923135_01373 | gene | open | 73576-74511 | |||
| 2777 | CALAIM010000020.1 | GCA937923135_01374 | gene | open | 74593-76605 | rnr | ||
| 2778 | CALAIM010000020.1 | GCA937923135_01375 | gene | open | 76838-78085 | hutI | ||
| 2779 | CALAIM010000020.1 | GCA937923135_01376 | gene | open | 78221-79663 | potE | ||
| 2780 | CALAIM010000020.1 | GCA937923135_01377 | gene | open | 79888-80736 | lysR | ||
| 2781 | CALAIM010000020.1 | GCA937923135_01378 | gene | open | 80934-81869 | ftsX | ||
| 2782 | CALAIM010000020.1 | GCA937923135_01379 | gene | open | 81847-82875 | ftsE | ||
| 2783 | CALAIM010000020.1 | GCA937923135_01380 | gene | open | 83488-84138 | eda | ||
| 2784 | CALAIM010000020.1 | GCA937923135_01381 | gene | open | 84211-85107 | dapA | ||
| 2785 | CALAIM010000020.1 | GCA937923135_01382 | gene | open | 85147-85755 | gutQ | ||
| 2786 | CALAIM010000020.1 | GCA937923135_01383 | gene | open | 85800-86414 | |||
| 2787 | CALAIM010000020.1 | GCA937923135_01384 | gene | open | 86513-87820 | ulaA | ||
| 2788 | CALAIM010000020.1 | GCA937923135_01385 | gene | open | 87983-88282 | sgaB | ||
| 2789 | CALAIM010000020.1 | GCA937923135_01386 | gene | open | 88282-88737 | ptsN | ||
| 2790 | CALAIM010000020.1 | GCA937923135_01387 | gene | open | 89117-89899 | glpR | ||
| 2791 | CALAIM010000020.1 | GCA937923135_01388 | gene | open | 90055-90936 | yitT | ||
| 2792 | CALAIM010000020.1 | GCA937923135_01389 | gene | open | 90938-92047 | prfB | ||
| 2793 | CALAIM010000020.1 | GCA937923135_01390 | gene | open | 92050-94800 | secA | ||
| 2794 | CALAIM010000020.1 | GCA937923135_01391 | gene | open | 94891-98013 | dnrI | ||
| 2795 | CALAIM010000020.1 | GCA937923135_01317 | gene | open | 1-71 | trnfM | ||
| 2796 | CALAIM010000020.1 | GCA937923135_01317 | tRNA | open | 1-71 | trnfM | tRNA-fMet(cat) |
