BAKTAGenome Explorer: Campylobacter showae (GCA_937924935.1)
Select a Genome:
|
BAKTA Annotations for GCA_937924935.1
|
Search & Sort all 4497 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 2001 | CALEYF010000115.1 | GCA937924935_00992 | gene | open | 710-1735 | |||
| 2002 | CALEYF010000115.1 | GCA937924935_00993 | gene | open | 2141-2644 | arcD | ||
| 2003 | CALEYF010000115.1 | GCA937924935_00994 | gene | open | 3134-4063 | |||
| 2004 | CALEYF010000115.1 | GCA937924935_00995 | gene | open | 4397-7804 | asmA | ||
| 2005 | CALEYF010000115.1 | GCA937924935_00996 | gene | open | 8073-8441 | |||
| 2006 | CALEYF010000115.1 | GCA937924935_00997 | gene | open | 8578-9594 | mnmA | ||
| 2007 | CALEYF010000115.1 | GCA937924935_00998 | gene | open | 9965-10561 | |||
| 2008 | CALEYF010000115.1 | GCA937924935_00999 | gene | open | 10675-11508 | fliY | ||
| 2009 | CALEYF010000115.1 | GCA937924935_01000 | gene | open | 11501-12610 | fliM | ||
| 2010 | CALEYF010000115.1 | GCA937924935_01001 | gene | open | 12610-13317 | |||
| 2011 | CALEYF010000115.1 | GCA937924935_01002 | gene | open | 13289-13642 | |||
| 2012 | CALEYF010000115.1 | GCA937924935_01003 | gene | open | 13658-14524 | fleN | ||
| 2013 | CALEYF010000115.1 | GCA937924935_01004 | gene | open | 14517-15887 | flhF | ||
| 2014 | CALEYF010000115.1 | GCA937924935_01005 | gene | open | 16039-16539 | folK | ||
| 2015 | CALEYF010000115.1 | GCA937924935_01006 | gene | open | 16536-17561 | |||
| 2016 | CALEYF010000115.1 | GCA937924935_01007 | gene | open | 17574-17972 | aroQ | ||
| 2017 | CALEYF010000116.1 | GCA937924935_01008 | CDS | open | 110-1309 | _na 399_aa | Cytosine-specific methyltransferase | |
| 2018 | CALEYF010000116.1 | GCA937924935_01009 | CDS | open | 1319-3436 | _na 705_aa | sensor histidine kinase | |
| 2019 | CALEYF010000116.1 | GCA937924935_01010 | CDS | open | 3569-4603 | _na 344_aa | Periplasmic diheme cytochrome c peroxidase | |
| 2020 | CALEYF010000116.1 | GCA937924935_01011 | CDS | open | 4755-5069 | _na 104_aa | rplU | 50S ribosomal protein L21 |
| 2021 | CALEYF010000116.1 | GCA937924935_01012 | CDS | open | 5081-5338 | _na 85_aa | rpmA | 50S ribosomal protein L27 |
| 2022 | CALEYF010000116.1 | GCA937924935_01013 | CDS | open | 5602-6657 | _na 351_aa | obgE | GTPase ObgE |
| 2023 | CALEYF010000116.1 | GCA937924935_01014 | CDS | open | 6661-7596 | _na 311_aa | fmt | methionyl-tRNA formyltransferase |
| 2024 | CALEYF010000116.1 | GCA937924935_01015 | CDS | open | 7657-8292 | _na 211_aa | biotin--[acetyl-CoA-carboxylase] ligase | |
| 2025 | CALEYF010000116.1 | GCA937924935_01016 | CDS | open | 8449-9231 | _na 260_aa | Chromosome partitioning protein | |
| 2026 | CALEYF010000116.1 | GCA937924935_01008 | gene | open | 110-1309 | |||
| 2027 | CALEYF010000116.1 | GCA937924935_01009 | gene | open | 1319-3436 | |||
| 2028 | CALEYF010000116.1 | GCA937924935_01010 | gene | open | 3569-4603 | |||
| 2029 | CALEYF010000116.1 | GCA937924935_01011 | gene | open | 4755-5069 | rplU | ||
| 2030 | CALEYF010000116.1 | GCA937924935_01012 | gene | open | 5081-5338 | rpmA | ||
| 2031 | CALEYF010000116.1 | GCA937924935_01013 | gene | open | 5602-6657 | obgE | ||
| 2032 | CALEYF010000116.1 | GCA937924935_01014 | gene | open | 6661-7596 | fmt | ||
| 2033 | CALEYF010000116.1 | GCA937924935_01015 | gene | open | 7657-8292 | |||
| 2034 | CALEYF010000116.1 | GCA937924935_01016 | gene | open | 8449-9231 | |||
| 2035 | CALEYF010000117.1 | GCA937924935_01017 | CDS | open | 97-4137 | _na 1346_aa | Surface array protein | |
| 2036 | CALEYF010000117.1 | GCA937924935_01018 | CDS | open | 4360-8067 | _na 1235_aa | Surface array protein | |
| 2037 | CALEYF010000117.1 | GCA937924935_01019 | CDS | open | 8329-9186 | _na 285_aa | UDP-glucose 4-epimerase | |
| 2038 | CALEYF010000117.1 | GCA937924935_01020 | CDS | open | 9176-9820 | _na 214_aa | hypothetical protein | |
| 2039 | CALEYF010000117.1 | GCA937924935_01017 | gene | open | 97-4137 | |||
| 2040 | CALEYF010000117.1 | GCA937924935_01018 | gene | open | 4360-8067 | |||
| 2041 | CALEYF010000117.1 | GCA937924935_01019 | gene | open | 8329-9186 | |||
| 2042 | CALEYF010000117.1 | GCA937924935_01020 | gene | open | 9176-9820 | |||
| 2043 | CALEYF010000118.1 | GCA937924935_01021 | CDS | open | 36-2363 | _na 775_aa | mutS2 | endonuclease MutS2 |
| 2044 | CALEYF010000118.1 | GCA937924935_01022 | CDS | open | 2391-2738 | _na 115_aa | Integral membrane protein | |
| 2045 | CALEYF010000118.1 | GCA937924935_01023 | CDS | open | 2735-4210 | _na 491_aa | murC | UDP-N-acetylmuramate--L-alanine ligase |
| 2046 | CALEYF010000118.1 | GCA937924935_01024 | CDS | open | 4710-5066 | _na 118_aa | MmcQ-like protein | |
| 2047 | CALEYF010000118.1 | GCA937924935_01025 | CDS | open | 5066-5668 | _na 200_aa | DNA-3-methyladenine glycosylase I | |
| 2048 | CALEYF010000118.1 | GCA937924935_01026 | CDS | open | 6171-9539 | _na 1122_aa | surface layer protein SapB11 | |
| 2049 | CALEYF010000118.1 | GCA937924935_01021 | gene | open | 36-2363 | mutS2 | ||
| 2050 | CALEYF010000118.1 | GCA937924935_01022 | gene | open | 2391-2738 | |||
| 2051 | CALEYF010000118.1 | GCA937924935_01023 | gene | open | 2735-4210 | murC | ||
| 2052 | CALEYF010000118.1 | GCA937924935_01024 | gene | open | 4710-5066 | |||
| 2053 | CALEYF010000118.1 | GCA937924935_01025 | gene | open | 5066-5668 | |||
| 2054 | CALEYF010000118.1 | GCA937924935_01026 | gene | open | 6171-9539 | |||
| 2055 | CALEYF010000119.1 | GCA937924935_01027 | CDS | open | 117-1181 | _na 354_aa | xerH | Tyrosine recombinase XerH |
| 2056 | CALEYF010000119.1 | GCA937924935_01028 | CDS | open | 1404-2687 | _na 427_aa | hypothetical protein | |
| 2057 | CALEYF010000119.1 | GCA937924935_01027 | gene | open | 117-1181 | xerH | ||
| 2058 | CALEYF010000119.1 | GCA937924935_01028 | gene | open | 1404-2687 | |||
| 2059 | CALEYF010000120.1 | GCA937924935_01029 | CDS | open | 210-968 | _na 252_aa | phage tail protein | |
| 2060 | CALEYF010000120.1 | GCA937924935_01030 | CDS | open | 968-2011 | _na 347_aa | Phage baseplate assembly protein J%2C putative | |
| 2061 | CALEYF010000120.1 | GCA937924935_01031 | CDS | open | 2008-2298 | _na 96_aa | Phage baseplate assembly protein W | |
| 2062 | CALEYF010000120.1 | GCA937924935_01032 | CDS | open | 2410-2874 | _na 154_aa | Phage-related baseplate assembly protein | |
| 2063 | CALEYF010000120.1 | GCA937924935_01033 | CDS | open | 2876-3331 | _na 151_aa | hypothetical protein | |
| 2064 | CALEYF010000120.1 | GCA937924935_01034 | CDS | open | 3331-3624 | _na 97_aa | hypothetical protein | |
| 2065 | CALEYF010000120.1 | GCA937924935_01035 | CDS | open | 3617-3931 | _na 104_aa | hypothetical protein | |
| 2066 | CALEYF010000120.1 | GCA937924935_01036 | CDS | open | 4072-5814 | _na 580_aa | phage major capsid protein | |
| 2067 | CALEYF010000120.1 | GCA937924935_01037 | CDS | open | 5807-7228 | _na 473_aa | phage portal protein | |
| 2068 | CALEYF010000120.1 | GCA937924935_01038 | CDS | open | 7228-7533 | _na 101_aa | hypothetical protein | |
| 2069 | CALEYF010000120.1 | GCA937924935_01039 | CDS | open | 7588-7803 | _na 71_aa | hypothetical protein | |
| 2070 | CALEYF010000120.1 | GCA937924935_01029 | gene | open | 210-968 | |||
| 2071 | CALEYF010000120.1 | GCA937924935_01030 | gene | open | 968-2011 | |||
| 2072 | CALEYF010000120.1 | GCA937924935_01031 | gene | open | 2008-2298 | |||
| 2073 | CALEYF010000120.1 | GCA937924935_01032 | gene | open | 2410-2874 | |||
| 2074 | CALEYF010000120.1 | GCA937924935_01033 | gene | open | 2876-3331 | |||
| 2075 | CALEYF010000120.1 | GCA937924935_01034 | gene | open | 3331-3624 | |||
| 2076 | CALEYF010000120.1 | GCA937924935_01035 | gene | open | 3617-3931 | |||
| 2077 | CALEYF010000120.1 | GCA937924935_01036 | gene | open | 4072-5814 | |||
| 2078 | CALEYF010000120.1 | GCA937924935_01037 | gene | open | 5807-7228 | |||
| 2079 | CALEYF010000120.1 | GCA937924935_01038 | gene | open | 7228-7533 | |||
| 2080 | CALEYF010000120.1 | GCA937924935_01039 | gene | open | 7588-7803 | |||
| 2081 | CALEYF010000121.1 | GCA937924935_01040 | CDS | open | 123-800 | _na 225_aa | Putative periplasmic ATP /GTP-binding protein | |
| 2082 | CALEYF010000121.1 | GCA937924935_01041 | CDS | open | 813-2012 | _na 399_aa | Glycosyltransferase RgtA/B/C/D-like domain-containing protein | |
| 2083 | CALEYF010000121.1 | GCA937924935_01042 | CDS | open | 2028-2468 | _na 146_aa | Putative nucleotide phosphoribosyltransferase | |
| 2084 | CALEYF010000121.1 | GCA937924935_01043 | CDS | open | 2478-3770 | _na 430_aa | Putative permease | |
| 2085 | CALEYF010000121.1 | GCA937924935_01044 | CDS | open | 3781-4851 | _na 356_aa | mqnE | aminofutalosine synthase MqnE |
| 2086 | CALEYF010000121.1 | GCA937924935_01045 | CDS | open | 4965-7421 | _na 818_aa | HD domain-containing protein | |
| 2087 | CALEYF010000121.1 | GCA937924935_01040 | gene | open | 123-800 | |||
| 2088 | CALEYF010000121.1 | GCA937924935_01041 | gene | open | 813-2012 | |||
| 2089 | CALEYF010000121.1 | GCA937924935_01042 | gene | open | 2028-2468 | |||
| 2090 | CALEYF010000121.1 | GCA937924935_01043 | gene | open | 2478-3770 | |||
| 2091 | CALEYF010000121.1 | GCA937924935_01044 | gene | open | 3781-4851 | mqnE | ||
| 2092 | CALEYF010000121.1 | GCA937924935_01045 | gene | open | 4965-7421 | |||
| 2093 | CALEYF010000122.1 | GCA937924935_01046 | CDS | open | 236-1438 | _na 400_aa | restriction endonuclease subunit S | |
| 2094 | CALEYF010000122.1 | GCA937924935_01047 | CDS | open | 1435-2925 | _na 496_aa | type I restriction-modification system subunit M | |
| 2095 | CALEYF010000122.1 | GCA937924935_01048 | CDS | open | 2927-3511 | _na 194_aa | Restriction modification system DNA specificity domain protein | |
| 2096 | CALEYF010000122.1 | GCA937924935_01046 | gene | open | 236-1438 | |||
| 2097 | CALEYF010000122.1 | GCA937924935_01047 | gene | open | 1435-2925 | |||
| 2098 | CALEYF010000122.1 | GCA937924935_01048 | gene | open | 2927-3511 | |||
| 2099 | CALEYF010000123.1 | GCA937924935_01049 | CDS | open | 211-1602 | _na 463_aa | penicillin-binding protein 2 | |
| 2100 | CALEYF010000123.1 | GCA937924935_01049 | gene | open | 211-1602 | |||
| 2101 | CALEYF010000124.1 | GCA937924935_01050 | CDS | open | 189-956 | _na 255_aa | HTH lysR-type domain-containing protein | |
| 2102 | CALEYF010000124.1 | GCA937924935_01051 | CDS | open | 949-1731 | _na 260_aa | fdhD | formate dehydrogenase accessory sulfurtransferase FdhD |
| 2103 | CALEYF010000124.1 | GCA937924935_01052 | CDS | open | 2503-2712 | _na 69_aa | moeB | molybdopterin biosynthesis protein MoeB |
| 2104 | CALEYF010000124.1 | GCA937924935_01053 | CDS | open | 2772-3437 | _na 221_aa | Zinc metalloprotease | |
| 2105 | CALEYF010000124.1 | GCA937924935_01054 | CDS | open | 3427-4635 | _na 402_aa | uvrB | UvrB domain 3-containing protein |
| 2106 | CALEYF010000124.1 | GCA937924935_01050 | gene | open | 189-956 | |||
| 2107 | CALEYF010000124.1 | GCA937924935_01051 | gene | open | 949-1731 | fdhD | ||
| 2108 | CALEYF010000124.1 | GCA937924935_01052 | gene | open | 2503-2712 | moeB | ||
| 2109 | CALEYF010000124.1 | GCA937924935_01053 | gene | open | 2772-3437 | |||
| 2110 | CALEYF010000124.1 | GCA937924935_01054 | gene | open | 3427-4635 | uvrB | ||
| 2111 | CALEYF010000125.1 | GCA937924935_01055 | CDS | open | 63-1397 | _na 444_aa | Putative poly(Beta-D-mannuronate) O-acetylase | |
| 2112 | CALEYF010000125.1 | GCA937924935_01056 | CDS | open | 1397-2500 | _na 367_aa | SGNH hydrolase-type esterase domain-containing protein | |
| 2113 | CALEYF010000125.1 | GCA937924935_01057 | CDS | open | 2936-3415 | _na 159_aa | Oxygen-insensitive NAD(P)H nitroreductase / Dihydropteridine reductase | |
| 2114 | CALEYF010000125.1 | GCA937924935_01058 | CDS | open | 3396-3566 | _na 56_aa | nitroreductase family protein | |
| 2115 | CALEYF010000125.1 | GCA937924935_01059 | CDS | open | 3715-4077 | _na 120_aa | hypothetical protein | |
| 2116 | CALEYF010000125.1 | GCA937924935_01055 | gene | open | 63-1397 | |||
| 2117 | CALEYF010000125.1 | GCA937924935_01056 | gene | open | 1397-2500 | |||
| 2118 | CALEYF010000125.1 | GCA937924935_01057 | gene | open | 2936-3415 | |||
| 2119 | CALEYF010000125.1 | GCA937924935_01058 | gene | open | 3396-3566 | |||
| 2120 | CALEYF010000125.1 | GCA937924935_01059 | gene | open | 3715-4077 | |||
| 2121 | CALEYF010000126.1 | GCA937924935_01060 | CDS | open | 14-253 | _na 79_aa | hypothetical protein | |
| 2122 | CALEYF010000126.1 | GCA937924935_01061 | CDS | open | 366-884 | _na 172_aa | Pyridoxamine 5'-phosphate oxidase family protein | |
| 2123 | CALEYF010000126.1 | GCA937924935_01062 | CDS | open | 965-1270 | _na 101_aa | Periplasmic protein | |
| 2124 | CALEYF010000126.1 | GCA937924935_01063 | CDS | open | 1482-2168 | _na 228_aa | ung | uracil-DNA glycosylase |
| 2125 | CALEYF010000126.1 | GCA937924935_01064 | CDS | open | 2330-2860 | _na 176_aa | YbaK/aminoacyl-tRNA synthetase-associated domain-containing protein | |
| 2126 | CALEYF010000126.1 | GCA937924935_01065 | CDS | open | 2885-4648 | _na 587_aa | DUF4209 domain-containing protein | |
| 2127 | CALEYF010000126.1 | GCA937924935_01067 | CDS | open | 4893-5048 | _na 51_aa | Entericidin EcnAB | |
| 2128 | CALEYF010000126.1 | GCA937924935_01060 | gene | open | 14-253 | |||
| 2129 | CALEYF010000126.1 | GCA937924935_01061 | gene | open | 366-884 | |||
| 2130 | CALEYF010000126.1 | GCA937924935_01062 | gene | open | 965-1270 | |||
| 2131 | CALEYF010000126.1 | GCA937924935_01063 | gene | open | 1482-2168 | ung | ||
| 2132 | CALEYF010000126.1 | GCA937924935_01064 | gene | open | 2330-2860 | |||
| 2133 | CALEYF010000126.1 | GCA937924935_01065 | gene | open | 2885-4648 | |||
| 2134 | CALEYF010000126.1 | GCA937924935_01067 | gene | open | 4893-5048 | |||
| 2135 | CALEYF010000126.1 | GCA937924935_01066 | gene | open | 4773-4862 | trnS | ||
| 2136 | CALEYF010000126.1 | GCA937924935_01068 | gene | open | 5068-5141 | trnC | ||
| 2137 | CALEYF010000126.1 | GCA937924935_01069 | gene | open | 5152-5238 | trnL | ||
| 2138 | CALEYF010000126.1 | GCA937924935_01066 | tRNA | open | 4773-4862 | trnS | tRNA-Ser(tga) | |
| 2139 | CALEYF010000126.1 | GCA937924935_01068 | tRNA | open | 5068-5141 | trnC | tRNA-Cys(gca) | |
| 2140 | CALEYF010000126.1 | GCA937924935_01069 | tRNA | open | 5152-5238 | trnL | tRNA-Leu(taa) | |
| 2141 | CALEYF010000127.1 | GCA937924935_01070 | CDS | open | 165-773 | _na 202_aa | Phospholipid-binding domain protein | |
| 2142 | CALEYF010000127.1 | GCA937924935_01071 | CDS | open | 1005-3464 | _na 819_aa | SSD domain-containing protein | |
| 2143 | CALEYF010000127.1 | GCA937924935_01072 | CDS | open | 3472-4059 | _na 195_aa | Toluene tolerance protein Ttg2D | |
| 2144 | CALEYF010000127.1 | GCA937924935_01073 | CDS | open | 4061-4882 | _na 273_aa | Putative periplasmic protein | |
| 2145 | CALEYF010000127.1 | GCA937924935_01074 | CDS | open | 4902-5309 | _na 135_aa | hypothetical protein | |
| 2146 | CALEYF010000127.1 | GCA937924935_01070 | gene | open | 165-773 | |||
| 2147 | CALEYF010000127.1 | GCA937924935_01071 | gene | open | 1005-3464 | |||
| 2148 | CALEYF010000127.1 | GCA937924935_01072 | gene | open | 3472-4059 | |||
| 2149 | CALEYF010000127.1 | GCA937924935_01073 | gene | open | 4061-4882 | |||
| 2150 | CALEYF010000127.1 | GCA937924935_01074 | gene | open | 4902-5309 | |||
| 2151 | CALEYF010000128.1 | GCA937924935_01075 | CDS | open | 67-804 | _na 245_aa | DNA alkylation repair protein | |
| 2152 | CALEYF010000128.1 | GCA937924935_01076 | CDS | open | 1193-1555 | _na 120_aa | hypothetical protein | |
| 2153 | CALEYF010000128.1 | GCA937924935_01077 | CDS | open | 1565-2365 | _na 266_aa | phosphatidylserine decarboxylase | |
| 2154 | CALEYF010000128.1 | GCA937924935_01078 | CDS | open | 2362-3453 | _na 363_aa | Calcineurin-like phosphoesterase domain-containing protein | |
| 2155 | CALEYF010000128.1 | GCA937924935_01079 | CDS | open | 3799-4215 | _na 138_aa | ybeY | rRNA maturation RNase YbeY |
| 2156 | CALEYF010000128.1 | GCA937924935_01080 | CDS | open | 4639-5277 | _na 212_aa | 7-cyano-7-deazaguanine synthase | |
| 2157 | CALEYF010000128.1 | GCA937924935_01081 | CDS | open | 5678-6685 | _na 335_aa | Ferrochelatase | |
| 2158 | CALEYF010000128.1 | GCA937924935_01082 | CDS | open | 6692-8611 | _na 639_aa | metG | methionine--tRNA ligase |
| 2159 | CALEYF010000128.1 | GCA937924935_01083 | CDS | open | 8629-8841 | _na 70_aa | Uracil-DNA glycosylase | |
| 2160 | CALEYF010000128.1 | GCA937924935_01084 | CDS | open | 8838-9692 | _na 284_aa | class 1 fructose-bisphosphatase | |
| 2161 | CALEYF010000128.1 | GCA937924935_01085 | CDS | open | 9689-10171 | _na 160_aa | mobB | molybdopterin-guanine dinucleotide biosynthesis protein B |
| 2162 | CALEYF010000128.1 | GCA937924935_01086 | CDS | open | 10272-10766 | _na 164_aa | Lipoprotein | |
| 2163 | CALEYF010000128.1 | GCA937924935_01087 | CDS | open | 10672-12303 | _na 543_aa | Soluble lytic murein transglycosylase | |
| 2164 | CALEYF010000128.1 | GCA937924935_01088 | CDS | open | 12287-12574 | _na 95_aa | Yggt family protein | |
| 2165 | CALEYF010000128.1 | GCA937924935_01089 | CDS | open | 12571-13872 | _na 433_aa | gltX | glutamate--tRNA ligase |
| 2166 | CALEYF010000128.1 | GCA937924935_01090 | CDS | open | 13998-14405 | _na 135_aa | mscL | large-conductance mechanosensitive channel protein MscL |
| 2167 | CALEYF010000128.1 | GCA937924935_01091 | CDS | open | 14415-15053 | _na 212_aa | Transcriptional regulator%2C Crp/Fnr family | |
| 2168 | CALEYF010000128.1 | GCA937924935_01092 | CDS | open | 15172-16746 | _na 524_aa | mrdA | penicillin-binding protein 2 |
| 2169 | CALEYF010000128.1 | GCA937924935_01075 | gene | open | 67-804 | |||
| 2170 | CALEYF010000128.1 | GCA937924935_01076 | gene | open | 1193-1555 | |||
| 2171 | CALEYF010000128.1 | GCA937924935_01077 | gene | open | 1565-2365 | |||
| 2172 | CALEYF010000128.1 | GCA937924935_01078 | gene | open | 2362-3453 | |||
| 2173 | CALEYF010000128.1 | GCA937924935_01079 | gene | open | 3799-4215 | ybeY | ||
| 2174 | CALEYF010000128.1 | GCA937924935_01080 | gene | open | 4639-5277 | |||
| 2175 | CALEYF010000128.1 | GCA937924935_01081 | gene | open | 5678-6685 | |||
| 2176 | CALEYF010000128.1 | GCA937924935_01082 | gene | open | 6692-8611 | metG | ||
| 2177 | CALEYF010000128.1 | GCA937924935_01083 | gene | open | 8629-8841 | |||
| 2178 | CALEYF010000128.1 | GCA937924935_01084 | gene | open | 8838-9692 | |||
| 2179 | CALEYF010000128.1 | GCA937924935_01085 | gene | open | 9689-10171 | mobB | ||
| 2180 | CALEYF010000128.1 | GCA937924935_01086 | gene | open | 10272-10766 | |||
| 2181 | CALEYF010000128.1 | GCA937924935_01087 | gene | open | 10672-12303 | |||
| 2182 | CALEYF010000128.1 | GCA937924935_01088 | gene | open | 12287-12574 | |||
| 2183 | CALEYF010000128.1 | GCA937924935_01089 | gene | open | 12571-13872 | gltX | ||
| 2184 | CALEYF010000128.1 | GCA937924935_01090 | gene | open | 13998-14405 | mscL | ||
| 2185 | CALEYF010000128.1 | GCA937924935_01091 | gene | open | 14415-15053 | |||
| 2186 | CALEYF010000128.1 | GCA937924935_01092 | gene | open | 15172-16746 | mrdA | ||
| 2187 | CALEYF010000129.1 | GCA937924935_01093 | CDS | open | 96-863 | _na 255_aa | YgjP-like metallopeptidase domain-containing protein | |
| 2188 | CALEYF010000129.1 | GCA937924935_01094 | CDS | open | 839-1780 | _na 313_aa | MATE family efflux transporter | |
| 2189 | CALEYF010000129.1 | GCA937924935_01095 | CDS | open | 1893-2159 | _na 88_aa | hypothetical protein | |
| 2190 | CALEYF010000129.1 | GCA937924935_01096 | CDS | open | 2324-3637 | _na 437_aa | Sodium-dependent tyrosine transporter | |
| 2191 | CALEYF010000129.1 | GCA937924935_01097 | CDS | open | 3647-5587 | _na 646_aa | abc-f | ribosomal protection-like ABC-F family protein |
| 2192 | CALEYF010000129.1 | GCA937924935_01098 | CDS | open | 5584-6030 | _na 148_aa | hypothetical protein | |
| 2193 | CALEYF010000129.1 | GCA937924935_01099 | CDS | open | 6065-6400 | _na 111_aa | hypothetical protein | |
| 2194 | CALEYF010000129.1 | GCA937924935_01100 | CDS | open | 6620-7756 | _na 378_aa | WG repeat-containing protein | |
| 2195 | CALEYF010000129.1 | GCA937924935_01101 | CDS | open | 7890-8648 | _na 252_aa | Flagellin | |
| 2196 | CALEYF010000129.1 | GCA937924935_01093 | gene | open | 96-863 | |||
| 2197 | CALEYF010000129.1 | GCA937924935_01094 | gene | open | 839-1780 | |||
| 2198 | CALEYF010000129.1 | GCA937924935_01095 | gene | open | 1893-2159 | |||
| 2199 | CALEYF010000129.1 | GCA937924935_01096 | gene | open | 2324-3637 | |||
| 2200 | CALEYF010000129.1 | GCA937924935_01097 | gene | open | 3647-5587 | abc-f | ||
| 2201 | CALEYF010000129.1 | GCA937924935_01098 | gene | open | 5584-6030 | |||
| 2202 | CALEYF010000129.1 | GCA937924935_01099 | gene | open | 6065-6400 | |||
| 2203 | CALEYF010000129.1 | GCA937924935_01100 | gene | open | 6620-7756 | |||
| 2204 | CALEYF010000129.1 | GCA937924935_01101 | gene | open | 7890-8648 | |||
| 2205 | CALEYF010000131.1 | GCA937924935_01102 | CDS | open | 71-811 | _na 246_aa | Tetrathionate reductase subunit B | |
| 2206 | CALEYF010000131.1 | GCA937924935_01103 | CDS | open | 822-3821 | _na 999_aa | Tetrathionate reductase TtrDE%2C catalytic subunit D | |
| 2207 | CALEYF010000131.1 | GCA937924935_01102 | gene | open | 71-811 | |||
| 2208 | CALEYF010000131.1 | GCA937924935_01103 | gene | open | 822-3821 | |||
| 2209 | CALEYF010000132.1 | GCA937924935_01104 | CDS | open | 196-1143 | _na 315_aa | queH | Epoxyqueuosine reductase QueH |
| 2210 | CALEYF010000132.1 | GCA937924935_01105 | CDS | open | 1280-1726 | _na 148_aa | fabZ | 3-hydroxyacyl-ACP dehydratase FabZ |
| 2211 | CALEYF010000132.1 | GCA937924935_01106 | CDS | open | 1737-2525 | _na 262_aa | lpxA | acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase |
| 2212 | CALEYF010000132.1 | GCA937924935_01107 | CDS | open | 2525-3757 | _na 410_aa | clpX | ATP-dependent Clp protease ATP-binding subunit ClpX |
| 2213 | CALEYF010000132.1 | GCA937924935_01108 | CDS | open | 3766-4803 | _na 345_aa | mreB | Cell shape-determining protein MreB |
| 2214 | CALEYF010000132.1 | GCA937924935_01109 | CDS | open | 4793-5548 | _na 251_aa | mreC | rod shape-determining protein MreC |
| 2215 | CALEYF010000132.1 | GCA937924935_01110 | CDS | open | 5548-8835 | _na 1095_aa | carB | carbamoyl-phosphate synthase large subunit |
| 2216 | CALEYF010000132.1 | GCA937924935_01111 | CDS | open | 8832-9542 | _na 236_aa | HTH HARE-type domain-containing protein | |
| 2217 | CALEYF010000132.1 | GCA937924935_01112 | CDS | open | 9542-9733 | _na 63_aa | DpnD/PcfM family protein | |
| 2218 | CALEYF010000132.1 | GCA937924935_01113 | CDS | open | 9741-9935 | _na 64_aa | Restriction endonuclease R-IB | |
| 2219 | CALEYF010000132.1 | GCA937924935_01114 | CDS | open | 9891-10187 | _na 98_aa | DpnII family type II restriction endonuclease | |
| 2220 | CALEYF010000132.1 | GCA937924935_01115 | CDS | open | 10206-10562 | _na 118_aa | DpnII family type II restriction endonuclease | |
| 2221 | CALEYF010000132.1 | GCA937924935_01116 | CDS | open | 10555-11352 | _na 265_aa | Methyltransferase | |
| 2222 | CALEYF010000132.1 | GCA937924935_01117 | CDS | open | 11382-12287 | _na 301_aa | Permease of the drug/metabolite transporter (DMT) superfamily | |
| 2223 | CALEYF010000132.1 | GCA937924935_01118 | CDS | open | 12301-12723 | _na 140_aa | YrdC/Sua5 family protein%2C required for threonylcarbamoyladenosine (T(6)A) formation in tRNA | |
| 2224 | CALEYF010000132.1 | GCA937924935_01104 | gene | open | 196-1143 | queH | ||
| 2225 | CALEYF010000132.1 | GCA937924935_01105 | gene | open | 1280-1726 | fabZ | ||
| 2226 | CALEYF010000132.1 | GCA937924935_01106 | gene | open | 1737-2525 | lpxA | ||
| 2227 | CALEYF010000132.1 | GCA937924935_01107 | gene | open | 2525-3757 | clpX | ||
| 2228 | CALEYF010000132.1 | GCA937924935_01108 | gene | open | 3766-4803 | mreB | ||
| 2229 | CALEYF010000132.1 | GCA937924935_01109 | gene | open | 4793-5548 | mreC | ||
| 2230 | CALEYF010000132.1 | GCA937924935_01110 | gene | open | 5548-8835 | carB | ||
| 2231 | CALEYF010000132.1 | GCA937924935_01111 | gene | open | 8832-9542 | |||
| 2232 | CALEYF010000132.1 | GCA937924935_01112 | gene | open | 9542-9733 | |||
| 2233 | CALEYF010000132.1 | GCA937924935_01113 | gene | open | 9741-9935 | |||
| 2234 | CALEYF010000132.1 | GCA937924935_01114 | gene | open | 9891-10187 | |||
| 2235 | CALEYF010000132.1 | GCA937924935_01115 | gene | open | 10206-10562 | |||
| 2236 | CALEYF010000132.1 | GCA937924935_01116 | gene | open | 10555-11352 | |||
| 2237 | CALEYF010000132.1 | GCA937924935_01117 | gene | open | 11382-12287 | |||
| 2238 | CALEYF010000132.1 | GCA937924935_01118 | gene | open | 12301-12723 | |||
| 2239 | CALEYF010000133.1 | GCA937924935_01119 | CDS | open | 189-800 | _na 203_aa | hypothetical protein | |
| 2240 | CALEYF010000133.1 | GCA937924935_01120 | CDS | open | 766-1437 | _na 223_aa | hypothetical protein | |
| 2241 | CALEYF010000133.1 | GCA937924935_01119 | gene | open | 189-800 | |||
| 2242 | CALEYF010000133.1 | GCA937924935_01120 | gene | open | 766-1437 | |||
| 2243 | CALEYF010000134.1 | GCA937924935_01121 | CDS | open | 266-361 | _na 31_aa | hypothetical protein | |
| 2244 | CALEYF010000134.1 | GCA937924935_01122 | CDS | open | 429-854 | _na 141_aa | fdhF | formate dehydrogenase subunit alpha |
| 2245 | CALEYF010000134.1 | GCA937924935_01123 | CDS | open | 867-2687 | _na 606_aa | Myb2 protein | |
| 2246 | CALEYF010000134.1 | GCA937924935_01124 | CDS | open | 2865-3884 | _na 339_aa | ABC transporter substrate-binding protein | |
| 2247 | CALEYF010000134.1 | GCA937924935_01125 | CDS | open | 3947-5419 | _na 490_aa | subtype B tannase | |
| 2248 | CALEYF010000134.1 | GCA937924935_01126 | CDS | open | 5856-6863 | _na 335_aa | btuC | Vitamin B12 ABC transporter%2C permease component BtuC |
| 2249 | CALEYF010000134.1 | GCA937924935_01127 | CDS | open | 6839-7636 | _na 265_aa | ABC transporter%2C ATP-binding protein | |
| 2250 | CALEYF010000134.1 | GCA937924935_01128 | CDS | open | 8075-9433 | _na 452_aa | gdhA | NADP-specific glutamate dehydrogenase |
| 2251 | CALEYF010000134.1 | GCA937924935_01121 | gene | open | 266-361 | |||
| 2252 | CALEYF010000134.1 | GCA937924935_01122 | gene | open | 429-854 | fdhF | ||
| 2253 | CALEYF010000134.1 | GCA937924935_01123 | gene | open | 867-2687 | |||
| 2254 | CALEYF010000134.1 | GCA937924935_01124 | gene | open | 2865-3884 | |||
| 2255 | CALEYF010000134.1 | GCA937924935_01125 | gene | open | 3947-5419 | |||
| 2256 | CALEYF010000134.1 | GCA937924935_01126 | gene | open | 5856-6863 | btuC | ||
| 2257 | CALEYF010000134.1 | GCA937924935_01127 | gene | open | 6839-7636 | |||
| 2258 | CALEYF010000134.1 | GCA937924935_01128 | gene | open | 8075-9433 | gdhA | ||
| 2259 | CALEYF010000135.1 | GCA937924935_01129 | CDS | open | 332-829 | _na 165_aa | Phosphatidylglycerophosphatase A | |
| 2260 | CALEYF010000135.1 | GCA937924935_01130 | CDS | open | 983-1369 | _na 128_aa | fatty-acid--CoA ligase | |
| 2261 | CALEYF010000135.1 | GCA937924935_01131 | CDS | open | 1473-4487 | _na 1004_aa | Cytochrome c biogenesis protein | |
| 2262 | CALEYF010000135.1 | GCA937924935_01132 | CDS | open | 4573-5136 | _na 187_aa | Serine hydrolase family protein | |
| 2263 | CALEYF010000135.1 | GCA937924935_01133 | CDS | open | 5964-6407 | _na 147_aa | hypothetical protein | |
| 2264 | CALEYF010000135.1 | GCA937924935_01129 | gene | open | 332-829 | |||
| 2265 | CALEYF010000135.1 | GCA937924935_01130 | gene | open | 983-1369 | |||
| 2266 | CALEYF010000135.1 | GCA937924935_01131 | gene | open | 1473-4487 | |||
| 2267 | CALEYF010000135.1 | GCA937924935_01132 | gene | open | 4573-5136 | |||
| 2268 | CALEYF010000135.1 | GCA937924935_01133 | gene | open | 5964-6407 | |||
| 2269 | CALEYF010000136.1 | GCA937924935_01134 | CDS | open | 60-1382 | _na 440_aa | hslU | HslU--HslV peptidase ATPase subunit |
| 2270 | CALEYF010000136.1 | GCA937924935_01135 | CDS | open | 1390-1923 | _na 177_aa | hslV | ATP-dependent protease subunit HslV |
| 2271 | CALEYF010000136.1 | GCA937924935_01136 | CDS | open | 1924-2370 | _na 148_aa | rplI | 50S ribosomal protein L9 |
| 2272 | CALEYF010000136.1 | GCA937924935_01137 | CDS | open | 2385-3608 | _na 407_aa | argG | argininosuccinate synthase |
| 2273 | CALEYF010000136.1 | GCA937924935_01138 | CDS | open | 3775-4020 | _na 81_aa | Ribosome-associated heat shock protein implicated in the recycling of the 50S subunit | |
| 2274 | CALEYF010000136.1 | GCA937924935_01139 | CDS | open | 4017-4418 | _na 133_aa | tsaE | tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE |
| 2275 | CALEYF010000136.1 | GCA937924935_01140 | CDS | open | 4411-5139 | _na 242_aa | lptB | LPS export ABC transporter ATP-binding protein |
| 2276 | CALEYF010000136.1 | GCA937924935_01141 | CDS | open | 5139-6401 | _na 420_aa | RNA polymerase factor sigma-54 | |
| 2277 | CALEYF010000136.1 | GCA937924935_01134 | gene | open | 60-1382 | hslU | ||
| 2278 | CALEYF010000136.1 | GCA937924935_01135 | gene | open | 1390-1923 | hslV | ||
| 2279 | CALEYF010000136.1 | GCA937924935_01136 | gene | open | 1924-2370 | rplI | ||
| 2280 | CALEYF010000136.1 | GCA937924935_01137 | gene | open | 2385-3608 | argG | ||
| 2281 | CALEYF010000136.1 | GCA937924935_01138 | gene | open | 3775-4020 | |||
| 2282 | CALEYF010000136.1 | GCA937924935_01139 | gene | open | 4017-4418 | tsaE | ||
| 2283 | CALEYF010000136.1 | GCA937924935_01140 | gene | open | 4411-5139 | lptB | ||
| 2284 | CALEYF010000136.1 | GCA937924935_01141 | gene | open | 5139-6401 | |||
| 2285 | CALEYF010000137.1 | GCA937924935_01142 | CDS | open | 2-451 | _na 149_aa | hypothetical protein | |
| 2286 | CALEYF010000137.1 | GCA937924935_01143 | CDS | open | 569-1216 | _na 215_aa | tyrosine-type recombinase/integrase | |
| 2287 | CALEYF010000137.1 | GCA937924935_01144 | CDS | open | 1439-1684 | _na 81_aa | hypothetical protein | |
| 2288 | CALEYF010000137.1 | GCA937924935_01145 | CDS | open | 1681-1851 | _na 56_aa | hypothetical protein | |
| 2289 | CALEYF010000137.1 | GCA937924935_01146 | CDS | open | 1840-2010 | _na 56_aa | hypothetical protein | |
| 2290 | CALEYF010000137.1 | GCA937924935_01147 | CDS | open | 2197-2811 | _na 204_aa | N-acetyltransferase domain-containing protein | |
| 2291 | CALEYF010000137.1 | GCA937924935_01148 | CDS | open | 2804-3262 | _na 152_aa | MBL fold metallo-hydrolase | |
| 2292 | CALEYF010000137.1 | GCA937924935_01142 | gene | open | 2-451 | |||
| 2293 | CALEYF010000137.1 | GCA937924935_01143 | gene | open | 569-1216 | |||
| 2294 | CALEYF010000137.1 | GCA937924935_01144 | gene | open | 1439-1684 | |||
| 2295 | CALEYF010000137.1 | GCA937924935_01145 | gene | open | 1681-1851 | |||
| 2296 | CALEYF010000137.1 | GCA937924935_01146 | gene | open | 1840-2010 | |||
| 2297 | CALEYF010000137.1 | GCA937924935_01147 | gene | open | 2197-2811 | |||
| 2298 | CALEYF010000137.1 | GCA937924935_01148 | gene | open | 2804-3262 | |||
| 2299 | CALEYF010000138.1 | GCA937924935_01149 | CDS | open | 487-1644 | _na 385_aa | alpha/beta fold hydrolase | |
| 2300 | CALEYF010000138.1 | GCA937924935_01150 | CDS | open | 1644-1874 | _na 76_aa | Type II toxin-antitoxin system Phd/YefM family antitoxin | |
| 2301 | CALEYF010000138.1 | GCA937924935_01149 | gene | open | 487-1644 | |||
| 2302 | CALEYF010000138.1 | GCA937924935_01150 | gene | open | 1644-1874 | |||
| 2303 | CALEYF010000139.1 | GCA937924935_01151 | CDS | open | 162-1220 | _na 352_aa | NAD dependent epimerase/dehydratase family protein | |
| 2304 | CALEYF010000139.1 | GCA937924935_01152 | CDS | open | 1272-2189 | _na 305_aa | putative 3'-5' exonuclease PolB-like domain-containing protein | |
| 2305 | CALEYF010000139.1 | GCA937924935_01153 | CDS | open | 2253-3239 | _na 328_aa | waaC | lipopolysaccharide heptosyltransferase I |
| 2306 | CALEYF010000139.1 | GCA937924935_01154 | CDS | open | 3232-4125 | _na 297_aa | lipid A biosynthesis lauroyl acyltransferase | |
| 2307 | CALEYF010000139.1 | GCA937924935_01155 | CDS | open | 4119-4892 | _na 257_aa | Glycosyltransferase%2C group 2 family protein | |
| 2308 | CALEYF010000139.1 | GCA937924935_01156 | CDS | open | 4889-5977 | _na 362_aa | rfaQ | putative lipopolysaccharide heptosyltransferase III |
| 2309 | CALEYF010000139.1 | GCA937924935_01157 | CDS | open | 6343-6852 | _na 169_aa | hypothetical protein | |
| 2310 | CALEYF010000139.1 | GCA937924935_01158 | CDS | open | 6886-7101 | _na 71_aa | hypothetical protein | |
| 2311 | CALEYF010000139.1 | GCA937924935_01159 | CDS | open | 7244-7984 | _na 246_aa | Polysaccharide deacetylase | |
| 2312 | CALEYF010000139.1 | GCA937924935_01160 | CDS | open | 7992-9248 | _na 418_aa | O-antigen polymerase | |
| 2313 | CALEYF010000139.1 | GCA937924935_01161 | CDS | open | 9541-10782 | _na 413_aa | glycosyltransferase family 9 protein | |
| 2314 | CALEYF010000139.1 | GCA937924935_01162 | CDS | open | 10730-11227 | _na 165_aa | glycosyltransferase | |
| 2315 | CALEYF010000139.1 | GCA937924935_01151 | gene | open | 162-1220 | |||
| 2316 | CALEYF010000139.1 | GCA937924935_01152 | gene | open | 1272-2189 | |||
| 2317 | CALEYF010000139.1 | GCA937924935_01153 | gene | open | 2253-3239 | waaC | ||
| 2318 | CALEYF010000139.1 | GCA937924935_01154 | gene | open | 3232-4125 | |||
| 2319 | CALEYF010000139.1 | GCA937924935_01155 | gene | open | 4119-4892 | |||
| 2320 | CALEYF010000139.1 | GCA937924935_01156 | gene | open | 4889-5977 | rfaQ | ||
| 2321 | CALEYF010000139.1 | GCA937924935_01157 | gene | open | 6343-6852 | |||
| 2322 | CALEYF010000139.1 | GCA937924935_01158 | gene | open | 6886-7101 | |||
| 2323 | CALEYF010000139.1 | GCA937924935_01159 | gene | open | 7244-7984 | |||
| 2324 | CALEYF010000139.1 | GCA937924935_01160 | gene | open | 7992-9248 | |||
| 2325 | CALEYF010000139.1 | GCA937924935_01161 | gene | open | 9541-10782 | |||
| 2326 | CALEYF010000139.1 | GCA937924935_01162 | gene | open | 10730-11227 | |||
| 2327 | CALEYF010000140.1 | GCA937924935_01163 | CDS | open | 155-679 | _na 174_aa | hypothetical protein | |
| 2328 | CALEYF010000140.1 | GCA937924935_01164 | CDS | open | 956-1981 | _na 341_aa | NADPH dehydrogenase | |
| 2329 | CALEYF010000140.1 | GCA937924935_01165 | CDS | open | 2141-2809 | _na 222_aa | DUF2625 domain-containing protein | |
| 2330 | CALEYF010000140.1 | GCA937924935_01166 | CDS | open | 2888-3706 | _na 272_aa | fabI | enoyl-ACP reductase FabI |
| 2331 | CALEYF010000140.1 | GCA937924935_01167 | CDS | open | 3861-4541 | _na 226_aa | tpiA | triose-phosphate isomerase |
| 2332 | CALEYF010000140.1 | GCA937924935_01168 | CDS | open | 4545-5744 | _na 399_aa | pgk | Phosphoglycerate kinase |
| 2333 | CALEYF010000140.1 | GCA937924935_01169 | CDS | open | 5761-6756 | _na 331_aa | gap | type I glyceraldehyde-3-phosphate dehydrogenase |
| 2334 | CALEYF010000140.1 | GCA937924935_01170 | CDS | open | 7070-7642 | _na 190_aa | nadD | nicotinate (nicotinamide) nucleotide adenylyltransferase |
| 2335 | CALEYF010000140.1 | GCA937924935_01171 | CDS | open | 7606-7932 | _na 108_aa | rsfS | ribosome silencing factor |
| 2336 | CALEYF010000140.1 | GCA937924935_01172 | CDS | open | 8346-9692 | _na 448_aa | PQQ enzyme repeat protein | |
| 2337 | CALEYF010000140.1 | GCA937924935_01173 | CDS | open | 10126-10833 | _na 235_aa | NADP-dependent oxidoreductase domain-containing protein | |
| 2338 | CALEYF010000140.1 | GCA937924935_01174 | CDS | open | 11049-11918 | _na 289_aa | ypfJ | YpfJ protein%2C zinc metalloprotease superfamily |
| 2339 | CALEYF010000140.1 | GCA937924935_01175 | CDS | open | 12143-12490 | _na 115_aa | vanZ | VanZ family protein |
| 2340 | CALEYF010000140.1 | GCA937924935_01176 | CDS | open | 12558-14144 | _na 528_aa | argS | arginine--tRNA ligase |
| 2341 | CALEYF010000140.1 | GCA937924935_01177 | CDS | open | 14154-14378 | _na 74_aa | tatA | Sec-independent protein translocase protein TatA |
| 2342 | CALEYF010000140.1 | GCA937924935_01178 | CDS | open | 14419-15027 | _na 202_aa | gmk | guanylate kinase |
| 2343 | CALEYF010000140.1 | GCA937924935_01179 | CDS | open | 15028-16641 | _na 537_aa | Highly acidic protein | |
| 2344 | CALEYF010000140.1 | GCA937924935_01180 | CDS | open | 16706-17467 | _na 253_aa | fliR | flagellar biosynthetic protein FliR |
| 2345 | CALEYF010000140.1 | GCA937924935_01181 | CDS | open | 17889-18545 | _na 218_aa | ABC transporter%2C ATP-binding protein | |
| 2346 | CALEYF010000140.1 | GCA937924935_01182 | CDS | open | 18550-19614 | _na 354_aa | tsf | translation elongation factor Ts |
| 2347 | CALEYF010000140.1 | GCA937924935_01183 | CDS | open | 19614-20414 | _na 266_aa | rpsB | 30S ribosomal protein S2 |
| 2348 | CALEYF010000140.1 | GCA937924935_01184 | CDS | open | 20699-21838 | _na 379_aa | iadA | beta-aspartyl-peptidase |
| 2349 | CALEYF010000140.1 | GCA937924935_01185 | CDS | open | 22028-22243 | _na 71_aa | Acetyltransferase | |
| 2350 | CALEYF010000140.1 | GCA937924935_01186 | CDS | open | 22378-22947 | _na 189_aa | beta-lactamase | |
| 2351 | CALEYF010000140.1 | GCA937924935_01187 | CDS | open | 23068-23790 | _na 240_aa | pgeF | peptidoglycan editing factor PgeF |
| 2352 | CALEYF010000140.1 | GCA937924935_01188 | CDS | open | 23816-24448 | _na 210_aa | riboflavin synthase | |
| 2353 | CALEYF010000140.1 | GCA937924935_01189 | CDS | open | 24658-25296 | _na 212_aa | HTH crp-type domain-containing protein | |
| 2354 | CALEYF010000140.1 | GCA937924935_01163 | gene | open | 155-679 | |||
| 2355 | CALEYF010000140.1 | GCA937924935_01164 | gene | open | 956-1981 | |||
| 2356 | CALEYF010000140.1 | GCA937924935_01165 | gene | open | 2141-2809 | |||
| 2357 | CALEYF010000140.1 | GCA937924935_01166 | gene | open | 2888-3706 | fabI | ||
| 2358 | CALEYF010000140.1 | GCA937924935_01167 | gene | open | 3861-4541 | tpiA | ||
| 2359 | CALEYF010000140.1 | GCA937924935_01168 | gene | open | 4545-5744 | pgk | ||
| 2360 | CALEYF010000140.1 | GCA937924935_01169 | gene | open | 5761-6756 | gap | ||
| 2361 | CALEYF010000140.1 | GCA937924935_01170 | gene | open | 7070-7642 | nadD | ||
| 2362 | CALEYF010000140.1 | GCA937924935_01171 | gene | open | 7606-7932 | rsfS | ||
| 2363 | CALEYF010000140.1 | GCA937924935_01172 | gene | open | 8346-9692 | |||
| 2364 | CALEYF010000140.1 | GCA937924935_01173 | gene | open | 10126-10833 | |||
| 2365 | CALEYF010000140.1 | GCA937924935_01174 | gene | open | 11049-11918 | ypfJ | ||
| 2366 | CALEYF010000140.1 | GCA937924935_01175 | gene | open | 12143-12490 | vanZ | ||
| 2367 | CALEYF010000140.1 | GCA937924935_01176 | gene | open | 12558-14144 | argS | ||
| 2368 | CALEYF010000140.1 | GCA937924935_01177 | gene | open | 14154-14378 | tatA | ||
| 2369 | CALEYF010000140.1 | GCA937924935_01178 | gene | open | 14419-15027 | gmk | ||
| 2370 | CALEYF010000140.1 | GCA937924935_01179 | gene | open | 15028-16641 | |||
| 2371 | CALEYF010000140.1 | GCA937924935_01180 | gene | open | 16706-17467 | fliR | ||
| 2372 | CALEYF010000140.1 | GCA937924935_01181 | gene | open | 17889-18545 | |||
| 2373 | CALEYF010000140.1 | GCA937924935_01182 | gene | open | 18550-19614 | tsf | ||
| 2374 | CALEYF010000140.1 | GCA937924935_01183 | gene | open | 19614-20414 | rpsB | ||
| 2375 | CALEYF010000140.1 | GCA937924935_01184 | gene | open | 20699-21838 | iadA | ||
| 2376 | CALEYF010000140.1 | GCA937924935_01185 | gene | open | 22028-22243 | |||
| 2377 | CALEYF010000140.1 | GCA937924935_01186 | gene | open | 22378-22947 | |||
| 2378 | CALEYF010000140.1 | GCA937924935_01187 | gene | open | 23068-23790 | pgeF | ||
| 2379 | CALEYF010000140.1 | GCA937924935_01188 | gene | open | 23816-24448 | |||
| 2380 | CALEYF010000140.1 | GCA937924935_01189 | gene | open | 24658-25296 | |||
| 2381 | CALEYF010000141.1 | GCA937924935_01190 | CDS | open | 420-1814 | _na 464_aa | argH | argininosuccinate lyase |
| 2382 | CALEYF010000141.1 | GCA937924935_01191 | CDS | open | 2164-2337 | _na 57_aa | NAD(P)H-dependent oxidoreductase | |
| 2383 | CALEYF010000141.1 | GCA937924935_01192 | CDS | open | 2338-2742 | _na 134_aa | Modulator of drug activity B | |
| 2384 | CALEYF010000141.1 | GCA937924935_01193 | CDS | open | 2876-2986 | _na 36_aa | hypothetical protein | |
| 2385 | CALEYF010000141.1 | GCA937924935_01194 | CDS | open | 2955-3086 | _na 43_aa | hypothetical protein | |
| 2386 | CALEYF010000141.1 | GCA937924935_01195 | CDS | open | 3175-4080 | _na 301_aa | araC | AraC family transcriptional regulator |
| 2387 | CALEYF010000141.1 | GCA937924935_01196 | CDS | open | 4244-5326 | _na 360_aa | putative protein PA2218 | |
| 2388 | CALEYF010000141.1 | GCA937924935_01197 | CDS | open | 5373-6230 | _na 285_aa | Iron-containing alcohol dehydrogenase | |
| 2389 | CALEYF010000141.1 | GCA937924935_01198 | CDS | open | 6233-6520 | _na 95_aa | iron-containing alcohol dehydrogenase | |
| 2390 | CALEYF010000141.1 | GCA937924935_01199 | CDS | open | 6538-6744 | _na 68_aa | hypothetical protein | |
| 2391 | CALEYF010000141.1 | GCA937924935_01200 | CDS | open | 7171-8574 | _na 467_aa | Putative periplasmic protein | |
| 2392 | CALEYF010000141.1 | GCA937924935_01201 | CDS | open | 8593-10170 | _na 525_aa | pckA | phosphoenolpyruvate carboxykinase (ATP) |
| 2393 | CALEYF010000141.1 | GCA937924935_01202 | CDS | open | 10189-10773 | _na 194_aa | hypothetical protein | |
| 2394 | CALEYF010000141.1 | GCA937924935_01190 | gene | open | 420-1814 | argH | ||
| 2395 | CALEYF010000141.1 | GCA937924935_01191 | gene | open | 2164-2337 | |||
| 2396 | CALEYF010000141.1 | GCA937924935_01192 | gene | open | 2338-2742 | |||
| 2397 | CALEYF010000141.1 | GCA937924935_01193 | gene | open | 2876-2986 | |||
| 2398 | CALEYF010000141.1 | GCA937924935_01194 | gene | open | 2955-3086 | |||
| 2399 | CALEYF010000141.1 | GCA937924935_01195 | gene | open | 3175-4080 | araC | ||
| 2400 | CALEYF010000141.1 | GCA937924935_01196 | gene | open | 4244-5326 | |||
| 2401 | CALEYF010000141.1 | GCA937924935_01197 | gene | open | 5373-6230 | |||
| 2402 | CALEYF010000141.1 | GCA937924935_01198 | gene | open | 6233-6520 | |||
| 2403 | CALEYF010000141.1 | GCA937924935_01199 | gene | open | 6538-6744 | |||
| 2404 | CALEYF010000141.1 | GCA937924935_01200 | gene | open | 7171-8574 | |||
| 2405 | CALEYF010000141.1 | GCA937924935_01201 | gene | open | 8593-10170 | pckA | ||
| 2406 | CALEYF010000141.1 | GCA937924935_01202 | gene | open | 10189-10773 | |||
| 2407 | CALEYF010000142.1 | GCA937924935_01203 | CDS | open | 317-1504 | _na 395_aa | Major outer membrane protein | |
| 2408 | CALEYF010000142.1 | GCA937924935_01204 | CDS | open | 1809-2285 | _na 158_aa | Lipoprotein | |
| 2409 | CALEYF010000142.1 | GCA937924935_01205 | CDS | open | 2263-2898 | _na 211_aa | Hydrogenase-4 component G | |
| 2410 | CALEYF010000142.1 | GCA937924935_01206 | CDS | open | 2968-3315 | _na 115_aa | napD | Chaperone NapD |
| 2411 | CALEYF010000142.1 | GCA937924935_01207 | CDS | open | 3312-4283 | _na 323_aa | Carbon-nitrogen family hydrolase | |
| 2412 | CALEYF010000142.1 | GCA937924935_01208 | CDS | open | 4280-4750 | _na 156_aa | Ferredoxin-type protein | |
| 2413 | CALEYF010000142.1 | GCA937924935_01209 | CDS | open | 4747-5346 | _na 199_aa | Periplasmic nitrate reductase%2C electron transfer subunit | |
| 2414 | CALEYF010000142.1 | GCA937924935_01210 | CDS | open | 5343-6143 | _na 266_aa | napH | quinol dehydrogenase ferredoxin subunit NapH |
| 2415 | CALEYF010000142.1 | GCA937924935_01211 | CDS | open | 6140-6904 | _na 254_aa | napG | ferredoxin-type protein NapG |
| 2416 | CALEYF010000142.1 | GCA937924935_01212 | CDS | open | 6907-9693 | _na 928_aa | napA | nitrate reductase catalytic subunit NapA |
| 2417 | CALEYF010000142.1 | GCA937924935_01203 | gene | open | 317-1504 | |||
| 2418 | CALEYF010000142.1 | GCA937924935_01204 | gene | open | 1809-2285 | |||
| 2419 | CALEYF010000142.1 | GCA937924935_01205 | gene | open | 2263-2898 | |||
| 2420 | CALEYF010000142.1 | GCA937924935_01206 | gene | open | 2968-3315 | napD | ||
| 2421 | CALEYF010000142.1 | GCA937924935_01207 | gene | open | 3312-4283 | |||
| 2422 | CALEYF010000142.1 | GCA937924935_01208 | gene | open | 4280-4750 | |||
| 2423 | CALEYF010000142.1 | GCA937924935_01209 | gene | open | 4747-5346 | |||
| 2424 | CALEYF010000142.1 | GCA937924935_01210 | gene | open | 5343-6143 | napH | ||
| 2425 | CALEYF010000142.1 | GCA937924935_01211 | gene | open | 6140-6904 | napG | ||
| 2426 | CALEYF010000142.1 | GCA937924935_01212 | gene | open | 6907-9693 | napA | ||
| 2427 | CALEYF010000143.1 | GCA937924935_01213 | CDS | open | 92-817 | _na 241_aa | hypothetical protein | |
| 2428 | CALEYF010000143.1 | GCA937924935_01214 | CDS | open | 828-1808 | _na 326_aa | hypothetical protein | |
| 2429 | CALEYF010000143.1 | GCA937924935_01215 | CDS | open | 1989-3179 | _na 396_aa | Major outer membrane protein | |
| 2430 | CALEYF010000143.1 | GCA937924935_01216 | CDS | open | 4299-4736 | _na 145_aa | Ferritin-like protein | |
| 2431 | CALEYF010000143.1 | GCA937924935_01217 | CDS | open | 5445-6131 | _na 228_aa | hypothetical protein | |
| 2432 | CALEYF010000143.1 | GCA937924935_01213 | gene | open | 92-817 | |||
| 2433 | CALEYF010000143.1 | GCA937924935_01214 | gene | open | 828-1808 | |||
| 2434 | CALEYF010000143.1 | GCA937924935_01215 | gene | open | 1989-3179 | |||
| 2435 | CALEYF010000143.1 | GCA937924935_01216 | gene | open | 4299-4736 | |||
| 2436 | CALEYF010000143.1 | GCA937924935_01217 | gene | open | 5445-6131 | |||
| 2437 | CALEYF010000144.1 | repeat_region | open | 2143-2432 | CRISPR array with 4 repeats of length 37%2C consensus sequence GTTTCAATCCCCTAGATCGGGGAAATTTGAATCAAAT and spacer length 44 | |||
| 2438 | CALEYF010000144.1 | GCA937924935_01218 | CDS | open | 319-618 | _na 99_aa | Type III restriction enzyme C-terminal endonuclease domain-containing protein | |
| 2439 | CALEYF010000144.1 | GCA937924935_01219 | CDS | open | 708-2000 | _na 430_aa | TM1812 family CRISPR-associated protein | |
| 2440 | CALEYF010000144.1 | GCA937924935_01220 | CDS | open | 2968-3513 | _na 181_aa | Fic family protein | |
| 2441 | CALEYF010000144.1 | GCA937924935_01221 | CDS | open | 3657-4025 | _na 122_aa | sigma factor-like helix-turn-helix DNA-binding protein | |
| 2442 | CALEYF010000144.1 | GCA937924935_01218 | gene | open | 319-618 | |||
| 2443 | CALEYF010000144.1 | GCA937924935_01219 | gene | open | 708-2000 | |||
| 2444 | CALEYF010000144.1 | GCA937924935_01220 | gene | open | 2968-3513 | |||
| 2445 | CALEYF010000144.1 | GCA937924935_01221 | gene | open | 3657-4025 | |||
| 2446 | CALEYF010000145.1 | GCA937924935_01222 | CDS | open | 66-278 | _na 70_aa | Secreted protein | |
| 2447 | CALEYF010000145.1 | GCA937924935_01223 | CDS | open | 269-757 | _na 162_aa | Host-nuclease inhibitor protein Gam%2C putative | |
| 2448 | CALEYF010000145.1 | GCA937924935_01224 | CDS | open | 845-1213 | _na 122_aa | hypothetical protein | |
| 2449 | CALEYF010000145.1 | GCA937924935_01225 | CDS | open | 1207-1455 | _na 82_aa | hypothetical protein | |
| 2450 | CALEYF010000145.1 | GCA937924935_01226 | CDS | open | 1532-1777 | _na 81_aa | hypothetical protein | |
| 2451 | CALEYF010000145.1 | GCA937924935_01227 | CDS | open | 1795-2076 | _na 93_aa | hypothetical protein | |
| 2452 | CALEYF010000145.1 | GCA937924935_01228 | CDS | open | 2073-2525 | _na 150_aa | hypothetical protein | |
| 2453 | CALEYF010000145.1 | GCA937924935_01229 | CDS | open | 2512-2985 | _na 157_aa | hypothetical protein | |
| 2454 | CALEYF010000145.1 | GCA937924935_01230 | CDS | open | 3250-3735 | _na 161_aa | phage virion morphogenesis protein | |
| 2455 | CALEYF010000145.1 | GCA937924935_01231 | CDS | open | 3855-4994 | _na 379_aa | phage minor head protein | |
| 2456 | CALEYF010000145.1 | GCA937924935_01222 | gene | open | 66-278 | |||
| 2457 | CALEYF010000145.1 | GCA937924935_01223 | gene | open | 269-757 | |||
| 2458 | CALEYF010000145.1 | GCA937924935_01224 | gene | open | 845-1213 | |||
| 2459 | CALEYF010000145.1 | GCA937924935_01225 | gene | open | 1207-1455 | |||
| 2460 | CALEYF010000145.1 | GCA937924935_01226 | gene | open | 1532-1777 | |||
| 2461 | CALEYF010000145.1 | GCA937924935_01227 | gene | open | 1795-2076 | |||
| 2462 | CALEYF010000145.1 | GCA937924935_01228 | gene | open | 2073-2525 | |||
| 2463 | CALEYF010000145.1 | GCA937924935_01229 | gene | open | 2512-2985 | |||
| 2464 | CALEYF010000145.1 | GCA937924935_01230 | gene | open | 3250-3735 | |||
| 2465 | CALEYF010000145.1 | GCA937924935_01231 | gene | open | 3855-4994 | |||
| 2466 | CALEYF010000146.1 | GCA937924935_01232 | CDS | open | 224-709 | _na 161_aa | Integral membrane protein | |
| 2467 | CALEYF010000146.1 | GCA937924935_01233 | CDS | open | 846-1469 | _na 207_aa | yihA | ribosome biogenesis GTP-binding protein YihA/YsxC |
| 2468 | CALEYF010000146.1 | GCA937924935_01234 | CDS | open | 1466-1942 | _na 158_aa | lptA | lipopolysaccharide transport periplasmic protein LptA |
| 2469 | CALEYF010000146.1 | GCA937924935_01235 | CDS | open | 1951-2478 | _na 175_aa | lptC | LPS export ABC transporter periplasmic protein LptC |
| 2470 | CALEYF010000146.1 | GCA937924935_01236 | CDS | open | 2469-2957 | _na 162_aa | kdsC | 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase KdsC |
| 2471 | CALEYF010000146.1 | GCA937924935_01237 | CDS | open | 2954-3358 | _na 134_aa | hisB | imidazoleglycerol-phosphate dehydratase HisB |
| 2472 | CALEYF010000146.1 | GCA937924935_01232 | gene | open | 224-709 | |||
| 2473 | CALEYF010000146.1 | GCA937924935_01233 | gene | open | 846-1469 | yihA | ||
| 2474 | CALEYF010000146.1 | GCA937924935_01234 | gene | open | 1466-1942 | lptA | ||
| 2475 | CALEYF010000146.1 | GCA937924935_01235 | gene | open | 1951-2478 | lptC | ||
| 2476 | CALEYF010000146.1 | GCA937924935_01236 | gene | open | 2469-2957 | kdsC | ||
| 2477 | CALEYF010000146.1 | GCA937924935_01237 | gene | open | 2954-3358 | hisB | ||
| 2478 | CALEYF010000147.1 | GCA937924935_01238 | CDS | open | 147-1034 | _na 295_aa | hypothetical protein | |
| 2479 | CALEYF010000147.1 | GCA937924935_01239 | CDS | open | 1043-1462 | _na 139_aa | hypothetical protein | |
| 2480 | CALEYF010000147.1 | GCA937924935_01240 | CDS | open | 1464-1715 | _na 83_aa | hypothetical protein | |
| 2481 | CALEYF010000147.1 | GCA937924935_01241 | CDS | open | 1712-2326 | _na 204_aa | hypothetical protein | |
| 2482 | CALEYF010000147.1 | GCA937924935_01242 | CDS | open | 2323-3963 | _na 546_aa | hypothetical protein | |
| 2483 | CALEYF010000147.1 | GCA937924935_01244 | CDS | open | 4538-5875 | _na 445_aa | purF | amidophosphoribosyltransferase |
| 2484 | CALEYF010000147.1 | GCA937924935_01245 | CDS | open | 6185-6952 | _na 255_aa | dapB | 4-hydroxy-tetrahydrodipicolinate reductase |
| 2485 | CALEYF010000147.1 | GCA937924935_01246 | CDS | open | 7095-9938 | _na 947_aa | Zinc protease | |
| 2486 | CALEYF010000147.1 | GCA937924935_01247 | CDS | open | 10113-10652 | _na 179_aa | Ankyrin domain protein | |
| 2487 | CALEYF010000147.1 | GCA937924935_01238 | gene | open | 147-1034 | |||
| 2488 | CALEYF010000147.1 | GCA937924935_01239 | gene | open | 1043-1462 | |||
| 2489 | CALEYF010000147.1 | GCA937924935_01240 | gene | open | 1464-1715 | |||
| 2490 | CALEYF010000147.1 | GCA937924935_01241 | gene | open | 1712-2326 | |||
| 2491 | CALEYF010000147.1 | GCA937924935_01242 | gene | open | 2323-3963 | |||
| 2492 | CALEYF010000147.1 | GCA937924935_01244 | gene | open | 4538-5875 | purF | ||
| 2493 | CALEYF010000147.1 | GCA937924935_01245 | gene | open | 6185-6952 | dapB | ||
| 2494 | CALEYF010000147.1 | GCA937924935_01246 | gene | open | 7095-9938 | |||
| 2495 | CALEYF010000147.1 | GCA937924935_01247 | gene | open | 10113-10652 | |||
| 2496 | CALEYF010000147.1 | GCA937924935_01243 | gene | open | 4229-4305 | trnM | ||
| 2497 | CALEYF010000147.1 | GCA937924935_01243 | tRNA | open | 4229-4305 | trnM | tRNA-Met(cat) | |
| 2498 | CALEYF010000148.1 | GCA937924935_01248 | CDS | open | 617-1054 | _na 145_aa | fxsA | FxsA cytoplasmic membrane protein |
| 2499 | CALEYF010000148.1 | GCA937924935_01249 | CDS | open | 1051-2763 | _na 570_aa | proline--tRNA ligase | |
| 2500 | CALEYF010000148.1 | GCA937924935_01250 | CDS | open | 2760-4052 | _na 430_aa | hemA | glutamyl-tRNA reductase |

