BAKTAGenome Explorer: Fusobacterium nucleatum_sensu_stricto (GCA_937924985.1)
Select a Genome:
|
BAKTA Annotations for GCA_937924985.1
|
Search & Sort all 4627 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 3501 | CALEYI010000169.1 | GCA937924985_01743 | gene | open | 4642-6048 | |||
| 3502 | CALEYI010000169.1 | GCA937924985_01744 | gene | open | 6443-6778 | relE | ||
| 3503 | CALEYI010000169.1 | GCA937924985_01745 | gene | open | 6771-7142 | vapI | ||
| 3504 | CALEYI010000169.1 | GCA937924985_01746 | gene | open | 7152-7505 | |||
| 3505 | CALEYI010000169.1 | GCA937924985_01747 | gene | open | 7551-7730 | |||
| 3506 | CALEYI010000170.1 | GCA937924985_01748 | CDS | open | 1290-1760 | _na 156_aa | ybaK | Cys-tRNA(Pro) deacylase |
| 3507 | CALEYI010000170.1 | GCA937924985_01748 | gene | open | 1290-1760 | ybaK | ||
| 3508 | CALEYI010000171.1 | GCA937924985_01749 | CDS | open | 99-722 | _na 207_aa | hypothetical protein | |
| 3509 | CALEYI010000171.1 | GCA937924985_01750 | CDS | open | 731-1654 | _na 307_aa | hypothetical protein | |
| 3510 | CALEYI010000171.1 | GCA937924985_01751 | CDS | open | 1638-3419 | _na 593_aa | hypothetical protein | |
| 3511 | CALEYI010000171.1 | GCA937924985_01752 | CDS | open | 3430-7455 | _na 1341_aa | hypothetical protein | |
| 3512 | CALEYI010000171.1 | GCA937924985_01753 | CDS | open | 7484-7834 | _na 116_aa | hypothetical protein | |
| 3513 | CALEYI010000171.1 | GCA937924985_01754 | CDS | open | 7803-9407 | _na 534_aa | Recombinase | |
| 3514 | CALEYI010000171.1 | GCA937924985_01755 | CDS | open | 9420-9524 | _na 34_aa | hypothetical protein | |
| 3515 | CALEYI010000171.1 | GCA937924985_01756 | CDS | open | 9503-10018 | _na 171_aa | dUTPase | |
| 3516 | CALEYI010000171.1 | GCA937924985_01757 | CDS | open | 10018-10311 | _na 97_aa | Phage protein | |
| 3517 | CALEYI010000171.1 | GCA937924985_01758 | CDS | open | 10314-10772 | _na 152_aa | SAM-dependent methyltransferase | |
| 3518 | CALEYI010000171.1 | GCA937924985_01759 | CDS | open | 10772-11356 | _na 194_aa | hypothetical protein | |
| 3519 | CALEYI010000171.1 | GCA937924985_01760 | CDS | open | 11356-11535 | _na 59_aa | DUF951 domain-containing protein | |
| 3520 | CALEYI010000171.1 | GCA937924985_01761 | CDS | open | 11535-11687 | _na 50_aa | fbpA | Fur-regulated basic protein FbpA |
| 3521 | CALEYI010000171.1 | GCA937924985_01762 | CDS | open | 11690-12127 | _na 145_aa | DUF3310 domain-containing protein | |
| 3522 | CALEYI010000171.1 | GCA937924985_01763 | CDS | open | 12153-12431 | _na 92_aa | hypothetical protein | |
| 3523 | CALEYI010000171.1 | GCA937924985_01764 | CDS | open | 12432-13151 | _na 239_aa | Phage protein | |
| 3524 | CALEYI010000171.1 | GCA937924985_01765 | CDS | open | 13163-13417 | _na 84_aa | DUF3781 domain-containing protein | |
| 3525 | CALEYI010000171.1 | GCA937924985_01766 | CDS | open | 13427-13804 | _na 125_aa | single-stranded DNA-binding protein | |
| 3526 | CALEYI010000171.1 | GCA937924985_01767 | CDS | open | 13812-14321 | _na 169_aa | Siphovirus Gp157 family protein | |
| 3527 | CALEYI010000171.1 | GCA937924985_01768 | CDS | open | 14334-15023 | _na 229_aa | Single-stranded DNA-binding protein | |
| 3528 | CALEYI010000171.1 | GCA937924985_01769 | CDS | open | 15034-15138 | _na 34_aa | Transposase | |
| 3529 | CALEYI010000171.1 | GCA937924985_01770 | CDS | open | 15128-15250 | _na 40_aa | hypothetical protein | |
| 3530 | CALEYI010000171.1 | GCA937924985_01771 | CDS | open | 15251-15457 | _na 68_aa | Antitoxin | |
| 3531 | CALEYI010000171.1 | GCA937924985_01772 | CDS | open | 15458-15697 | _na 79_aa | hypothetical protein | |
| 3532 | CALEYI010000171.1 | GCA937924985_01773 | CDS | open | 15707-16081 | _na 124_aa | DUF695 domain-containing protein | |
| 3533 | CALEYI010000171.1 | GCA937924985_01774 | CDS | open | 16239-16661 | _na 140_aa | HTH cro/C1-type domain-containing protein | |
| 3534 | CALEYI010000171.1 | GCA937924985_01775 | CDS | open | 16686-17144 | _na 152_aa | hypothetical protein | |
| 3535 | CALEYI010000171.1 | GCA937924985_01776 | CDS | open | 17302-17538 | _na 78_aa | hypothetical protein | |
| 3536 | CALEYI010000171.1 | GCA937924985_01777 | CDS | open | 17495-17596 | _na 33_aa | hypothetical protein | |
| 3537 | CALEYI010000171.1 | GCA937924985_01778 | CDS | open | 17819-18250 | _na 143_aa | Transcriptional regulator | |
| 3538 | CALEYI010000171.1 | GCA937924985_01779 | CDS | open | 19005-19727 | _na 240_aa | Phage conserved hypothetical protein C-terminal domain-containing protein | |
| 3539 | CALEYI010000171.1 | GCA937924985_01780 | CDS | open | 19729-20529 | _na 266_aa | AAA+ ATPase domain-containing protein | |
| 3540 | CALEYI010000171.1 | GCA937924985_01781 | CDS | open | 20540-20713 | _na 57_aa | hypothetical protein | |
| 3541 | CALEYI010000171.1 | GCA937924985_01782 | CDS | open | 20724-21206 | _na 160_aa | Mobilization protein | |
| 3542 | CALEYI010000171.1 | GCA937924985_01783 | CDS | open | 21208-21465 | _na 85_aa | VRR-NUC domain-containing protein | |
| 3543 | CALEYI010000171.1 | GCA937924985_01784 | CDS | open | 21477-21695 | _na 72_aa | hypothetical protein | |
| 3544 | CALEYI010000171.1 | GCA937924985_01785 | CDS | open | 21902-22315 | _na 137_aa | hypothetical protein | |
| 3545 | CALEYI010000171.1 | GCA937924985_01786 | CDS | open | 22294-22524 | _na 76_aa | hypothetical protein | |
| 3546 | CALEYI010000171.1 | GCA937924985_01787 | CDS | open | 22546-22740 | _na 64_aa | hypothetical protein | |
| 3547 | CALEYI010000171.1 | GCA937924985_01788 | CDS | open | 23113-23808 | _na 231_aa | HTH luxR-type domain-containing protein | |
| 3548 | CALEYI010000171.1 | GCA937924985_01789 | CDS | open | 23753-25165 | _na 470_aa | Terminase | |
| 3549 | CALEYI010000171.1 | GCA937924985_01790 | CDS | open | 25159-25572 | _na 137_aa | GNAT family N-acetyltransferase | |
| 3550 | CALEYI010000171.1 | GCA937924985_01791 | CDS | open | 25560-26138 | _na 192_aa | hypothetical protein | |
| 3551 | CALEYI010000171.1 | GCA937924985_01792 | CDS | open | 26142-27794 | _na 550_aa | Phage portal protein | |
| 3552 | CALEYI010000171.1 | GCA937924985_01793 | CDS | open | 27784-28020 | _na 78_aa | hypothetical protein | |
| 3553 | CALEYI010000171.1 | GCA937924985_01794 | CDS | open | 28023-28781 | _na 252_aa | hypothetical protein | |
| 3554 | CALEYI010000171.1 | GCA937924985_01795 | CDS | open | 28794-29642 | _na 282_aa | Phage major capsid protein | |
| 3555 | CALEYI010000171.1 | GCA937924985_01796 | CDS | open | 29690-31054 | _na 454_aa | bppU | BppU N-terminal domain-containing protein |
| 3556 | CALEYI010000171.1 | GCA937924985_01797 | CDS | open | 31067-31564 | _na 165_aa | DUF4376 domain-containing protein | |
| 3557 | CALEYI010000171.1 | GCA937924985_01798 | CDS | open | 31755-32303 | _na 182_aa | MurNAc-LAA domain-containing protein | |
| 3558 | CALEYI010000171.1 | GCA937924985_01799 | CDS | open | 32366-32674 | _na 102_aa | Phage holin%2C LL-H family | |
| 3559 | CALEYI010000171.1 | GCA937924985_01800 | CDS | open | 32661-33185 | _na 174_aa | DUF1353 domain-containing protein | |
| 3560 | CALEYI010000171.1 | GCA937924985_01801 | CDS | open | 33345-33851 | _na 168_aa | Phage protein | |
| 3561 | CALEYI010000171.1 | GCA937924985_01802 | CDS | open | 33851-34816 | _na 321_aa | hypothetical protein | |
| 3562 | CALEYI010000171.1 | GCA937924985_01749 | gene | open | 99-722 | |||
| 3563 | CALEYI010000171.1 | GCA937924985_01750 | gene | open | 731-1654 | |||
| 3564 | CALEYI010000171.1 | GCA937924985_01751 | gene | open | 1638-3419 | |||
| 3565 | CALEYI010000171.1 | GCA937924985_01752 | gene | open | 3430-7455 | |||
| 3566 | CALEYI010000171.1 | GCA937924985_01753 | gene | open | 7484-7834 | |||
| 3567 | CALEYI010000171.1 | GCA937924985_01754 | gene | open | 7803-9407 | |||
| 3568 | CALEYI010000171.1 | GCA937924985_01755 | gene | open | 9420-9524 | |||
| 3569 | CALEYI010000171.1 | GCA937924985_01756 | gene | open | 9503-10018 | |||
| 3570 | CALEYI010000171.1 | GCA937924985_01757 | gene | open | 10018-10311 | |||
| 3571 | CALEYI010000171.1 | GCA937924985_01758 | gene | open | 10314-10772 | |||
| 3572 | CALEYI010000171.1 | GCA937924985_01759 | gene | open | 10772-11356 | |||
| 3573 | CALEYI010000171.1 | GCA937924985_01760 | gene | open | 11356-11535 | |||
| 3574 | CALEYI010000171.1 | GCA937924985_01761 | gene | open | 11535-11687 | fbpA | ||
| 3575 | CALEYI010000171.1 | GCA937924985_01762 | gene | open | 11690-12127 | |||
| 3576 | CALEYI010000171.1 | GCA937924985_01763 | gene | open | 12153-12431 | |||
| 3577 | CALEYI010000171.1 | GCA937924985_01764 | gene | open | 12432-13151 | |||
| 3578 | CALEYI010000171.1 | GCA937924985_01765 | gene | open | 13163-13417 | |||
| 3579 | CALEYI010000171.1 | GCA937924985_01766 | gene | open | 13427-13804 | |||
| 3580 | CALEYI010000171.1 | GCA937924985_01767 | gene | open | 13812-14321 | |||
| 3581 | CALEYI010000171.1 | GCA937924985_01768 | gene | open | 14334-15023 | |||
| 3582 | CALEYI010000171.1 | GCA937924985_01769 | gene | open | 15034-15138 | |||
| 3583 | CALEYI010000171.1 | GCA937924985_01770 | gene | open | 15128-15250 | |||
| 3584 | CALEYI010000171.1 | GCA937924985_01771 | gene | open | 15251-15457 | |||
| 3585 | CALEYI010000171.1 | GCA937924985_01772 | gene | open | 15458-15697 | |||
| 3586 | CALEYI010000171.1 | GCA937924985_01773 | gene | open | 15707-16081 | |||
| 3587 | CALEYI010000171.1 | GCA937924985_01774 | gene | open | 16239-16661 | |||
| 3588 | CALEYI010000171.1 | GCA937924985_01775 | gene | open | 16686-17144 | |||
| 3589 | CALEYI010000171.1 | GCA937924985_01776 | gene | open | 17302-17538 | |||
| 3590 | CALEYI010000171.1 | GCA937924985_01777 | gene | open | 17495-17596 | |||
| 3591 | CALEYI010000171.1 | GCA937924985_01778 | gene | open | 17819-18250 | |||
| 3592 | CALEYI010000171.1 | GCA937924985_01779 | gene | open | 19005-19727 | |||
| 3593 | CALEYI010000171.1 | GCA937924985_01780 | gene | open | 19729-20529 | |||
| 3594 | CALEYI010000171.1 | GCA937924985_01781 | gene | open | 20540-20713 | |||
| 3595 | CALEYI010000171.1 | GCA937924985_01782 | gene | open | 20724-21206 | |||
| 3596 | CALEYI010000171.1 | GCA937924985_01783 | gene | open | 21208-21465 | |||
| 3597 | CALEYI010000171.1 | GCA937924985_01784 | gene | open | 21477-21695 | |||
| 3598 | CALEYI010000171.1 | GCA937924985_01785 | gene | open | 21902-22315 | |||
| 3599 | CALEYI010000171.1 | GCA937924985_01786 | gene | open | 22294-22524 | |||
| 3600 | CALEYI010000171.1 | GCA937924985_01787 | gene | open | 22546-22740 | |||
| 3601 | CALEYI010000171.1 | GCA937924985_01788 | gene | open | 23113-23808 | |||
| 3602 | CALEYI010000171.1 | GCA937924985_01789 | gene | open | 23753-25165 | |||
| 3603 | CALEYI010000171.1 | GCA937924985_01790 | gene | open | 25159-25572 | |||
| 3604 | CALEYI010000171.1 | GCA937924985_01791 | gene | open | 25560-26138 | |||
| 3605 | CALEYI010000171.1 | GCA937924985_01792 | gene | open | 26142-27794 | |||
| 3606 | CALEYI010000171.1 | GCA937924985_01793 | gene | open | 27784-28020 | |||
| 3607 | CALEYI010000171.1 | GCA937924985_01794 | gene | open | 28023-28781 | |||
| 3608 | CALEYI010000171.1 | GCA937924985_01795 | gene | open | 28794-29642 | |||
| 3609 | CALEYI010000171.1 | GCA937924985_01796 | gene | open | 29690-31054 | bppU | ||
| 3610 | CALEYI010000171.1 | GCA937924985_01797 | gene | open | 31067-31564 | |||
| 3611 | CALEYI010000171.1 | GCA937924985_01798 | gene | open | 31755-32303 | |||
| 3612 | CALEYI010000171.1 | GCA937924985_01799 | gene | open | 32366-32674 | |||
| 3613 | CALEYI010000171.1 | GCA937924985_01800 | gene | open | 32661-33185 | |||
| 3614 | CALEYI010000171.1 | GCA937924985_01801 | gene | open | 33345-33851 | |||
| 3615 | CALEYI010000171.1 | GCA937924985_01802 | gene | open | 33851-34816 | |||
| 3616 | CALEYI010000172.1 | GCA937924985_01803 | CDS | open | 121-1635 | _na 504_aa | cydD | ABC transporter |
| 3617 | CALEYI010000172.1 | GCA937924985_01804 | CDS | open | 1625-3307 | _na 560_aa | mdlB | ABC transporter |
| 3618 | CALEYI010000172.1 | GCA937924985_01805 | CDS | open | 3519-4028 | _na 169_aa | fldA | Flavodoxin-like domain-containing protein |
| 3619 | CALEYI010000172.1 | GCA937924985_01806 | CDS | open | 4091-4561 | _na 156_aa | acrR | HTH tetR-type domain-containing protein |
| 3620 | CALEYI010000172.1 | GCA937924985_01807 | CDS | open | 4601-4774 | _na 57_aa | hypothetical protein | |
| 3621 | CALEYI010000172.1 | GCA937924985_01803 | gene | open | 121-1635 | cydD | ||
| 3622 | CALEYI010000172.1 | GCA937924985_01804 | gene | open | 1625-3307 | mdlB | ||
| 3623 | CALEYI010000172.1 | GCA937924985_01805 | gene | open | 3519-4028 | fldA | ||
| 3624 | CALEYI010000172.1 | GCA937924985_01806 | gene | open | 4091-4561 | acrR | ||
| 3625 | CALEYI010000172.1 | GCA937924985_01807 | gene | open | 4601-4774 | |||
| 3626 | CALEYI010000173.1 | GCA937924985_01808 | CDS | open | 491-1984 | _na 497_aa | yifB | Competence protein ComM |
| 3627 | CALEYI010000173.1 | GCA937924985_01809 | CDS | open | 2189-2731 | _na 180_aa | hypothetical protein | |
| 3628 | CALEYI010000173.1 | GCA937924985_01808 | gene | open | 491-1984 | yifB | ||
| 3629 | CALEYI010000173.1 | GCA937924985_01809 | gene | open | 2189-2731 | |||
| 3630 | CALEYI010000174.1 | GCA937924985_01810 | CDS | open | 228-1205 | _na 325_aa | cdiA | tRNA nuclease CdiA C-terminal domain-containing protein |
| 3631 | CALEYI010000174.1 | GCA937924985_01811 | CDS | open | 1218-1919 | _na 233_aa | DUF4304 domain-containing protein | |
| 3632 | CALEYI010000174.1 | GCA937924985_01810 | gene | open | 228-1205 | cdiA | ||
| 3633 | CALEYI010000174.1 | GCA937924985_01811 | gene | open | 1218-1919 | |||
| 3634 | CALEYI010000175.1 | GCA937924985_01812 | CDS | open | 342-1268 | _na 308_aa | ywqK | Toxin-antitoxin system YwqK family antitoxin |
| 3635 | CALEYI010000175.1 | GCA937924985_01813 | CDS | open | 1332-2162 | _na 276_aa | ywqK | Cytoplasmic protein |
| 3636 | CALEYI010000175.1 | GCA937924985_01814 | CDS | open | 2230-3135 | _na 301_aa | hypothetical protein | |
| 3637 | CALEYI010000175.1 | GCA937924985_01812 | gene | open | 342-1268 | ywqK | ||
| 3638 | CALEYI010000175.1 | GCA937924985_01813 | gene | open | 1332-2162 | ywqK | ||
| 3639 | CALEYI010000175.1 | GCA937924985_01814 | gene | open | 2230-3135 | |||
| 3640 | CALEYI010000176.1 | GCA937924985_01815 | CDS | open | 326-925 | _na 199_aa | hypothetical protein | |
| 3641 | CALEYI010000176.1 | GCA937924985_01816 | CDS | open | 941-1399 | _na 152_aa | rimI | Diamine acetyltransferase |
| 3642 | CALEYI010000176.1 | GCA937924985_01817 | CDS | open | 1435-2202 | _na 255_aa | DUF5673 domain-containing protein | |
| 3643 | CALEYI010000176.1 | GCA937924985_01818 | CDS | open | 2296-3573 | _na 425_aa | brnQ | branched-chain amino acid transport system II carrier protein |
| 3644 | CALEYI010000176.1 | GCA937924985_01819 | CDS | open | 3615-4379 | _na 254_aa | yfeS | MolR family transcriptional regulator |
| 3645 | CALEYI010000176.1 | GCA937924985_01820 | CDS | open | 4399-4953 | _na 184_aa | Metal-dependent hydrolase | |
| 3646 | CALEYI010000176.1 | GCA937924985_01821 | CDS | open | 4987-5769 | _na 260_aa | menH | Hydrolase |
| 3647 | CALEYI010000176.1 | GCA937924985_01822 | CDS | open | 5958-7142 | _na 394_aa | abgB | N-acyl-L-amino acid amidohydrolase |
| 3648 | CALEYI010000176.1 | GCA937924985_01823 | CDS | open | 7161-7922 | _na 253_aa | DUF3100 domain-containing protein | |
| 3649 | CALEYI010000176.1 | GCA937924985_01824 | CDS | open | 7924-8469 | _na 181_aa | hypothetical protein | |
| 3650 | CALEYI010000176.1 | GCA937924985_01825 | CDS | open | 8441-9184 | _na 247_aa | hypothetical protein | |
| 3651 | CALEYI010000176.1 | GCA937924985_01815 | gene | open | 326-925 | |||
| 3652 | CALEYI010000176.1 | GCA937924985_01816 | gene | open | 941-1399 | rimI | ||
| 3653 | CALEYI010000176.1 | GCA937924985_01817 | gene | open | 1435-2202 | |||
| 3654 | CALEYI010000176.1 | GCA937924985_01818 | gene | open | 2296-3573 | brnQ | ||
| 3655 | CALEYI010000176.1 | GCA937924985_01819 | gene | open | 3615-4379 | yfeS | ||
| 3656 | CALEYI010000176.1 | GCA937924985_01820 | gene | open | 4399-4953 | |||
| 3657 | CALEYI010000176.1 | GCA937924985_01821 | gene | open | 4987-5769 | menH | ||
| 3658 | CALEYI010000176.1 | GCA937924985_01822 | gene | open | 5958-7142 | abgB | ||
| 3659 | CALEYI010000176.1 | GCA937924985_01823 | gene | open | 7161-7922 | |||
| 3660 | CALEYI010000176.1 | GCA937924985_01824 | gene | open | 7924-8469 | |||
| 3661 | CALEYI010000176.1 | GCA937924985_01825 | gene | open | 8441-9184 | |||
| 3662 | CALEYI010000177.1 | repeat_region | open | 5287-6584 | CRISPR array with 20 repeats of length 30%2C consensus sequence CTTTAAATTCTAATATAGAAATACATAAAT and spacer length 36 | |||
| 3663 | CALEYI010000177.1 | GCA937924985_01826 | CDS | open | 1430-2626 | _na 398_aa | ackA | Acetate kinase |
| 3664 | CALEYI010000177.1 | GCA937924985_01827 | CDS | open | 2677-3681 | _na 334_aa | pta | phosphate acetyltransferase |
| 3665 | CALEYI010000177.1 | GCA937924985_01828 | CDS | open | 4548-5033 | _na 161_aa | PBECR4 domain-containing protein | |
| 3666 | CALEYI010000177.1 | GCA937924985_01829 | CDS | open | 6835-7113 | _na 92_aa | cas2 | CRISPR-associated endonuclease Cas2 |
| 3667 | CALEYI010000177.1 | GCA937924985_01830 | CDS | open | 7115-8110 | _na 331_aa | cas1b | type I-B CRISPR-associated endonuclease Cas1b |
| 3668 | CALEYI010000177.1 | GCA937924985_01831 | CDS | open | 8122-8616 | _na 164_aa | cas4 | CRISPR-associated protein Cas4 |
| 3669 | CALEYI010000177.1 | GCA937924985_01832 | CDS | open | 8659-11097 | _na 812_aa | cas3 | HD Cas3-type domain-containing protein |
| 3670 | CALEYI010000177.1 | GCA937924985_01833 | CDS | open | 11186-12286 | _na 366_aa | CRISPR-associated protein Cas5 | |
| 3671 | CALEYI010000177.1 | GCA937924985_01834 | CDS | open | 12298-13200 | _na 300_aa | cas7i | type I-B CRISPR-associated protein Cas7/Cst2/DevR |
| 3672 | CALEYI010000177.1 | GCA937924985_01835 | CDS | open | 13213-14757 | _na 514_aa | cas8a1 | type I CRISPR-associated protein Cas8a1/Csx8 |
| 3673 | CALEYI010000177.1 | GCA937924985_01836 | CDS | open | 14738-15499 | _na 253_aa | cas6 | CRISPR-associated endoribonuclease Cas6 |
| 3674 | CALEYI010000177.1 | GCA937924985_01837 | CDS | open | 15535-16146 | _na 203_aa | Abi family protein | |
| 3675 | CALEYI010000177.1 | GCA937924985_01838 | CDS | open | 16600-17142 | _na 180_aa | NAD-dependent protein deacylase | |
| 3676 | CALEYI010000177.1 | GCA937924985_01839 | CDS | open | 17325-17870 | _na 181_aa | hypothetical protein | |
| 3677 | CALEYI010000177.1 | GCA937924985_01826 | gene | open | 1430-2626 | ackA | ||
| 3678 | CALEYI010000177.1 | GCA937924985_01827 | gene | open | 2677-3681 | pta | ||
| 3679 | CALEYI010000177.1 | GCA937924985_01828 | gene | open | 4548-5033 | |||
| 3680 | CALEYI010000177.1 | GCA937924985_01829 | gene | open | 6835-7113 | cas2 | ||
| 3681 | CALEYI010000177.1 | GCA937924985_01830 | gene | open | 7115-8110 | cas1b | ||
| 3682 | CALEYI010000177.1 | GCA937924985_01831 | gene | open | 8122-8616 | cas4 | ||
| 3683 | CALEYI010000177.1 | GCA937924985_01832 | gene | open | 8659-11097 | cas3 | ||
| 3684 | CALEYI010000177.1 | GCA937924985_01833 | gene | open | 11186-12286 | |||
| 3685 | CALEYI010000177.1 | GCA937924985_01834 | gene | open | 12298-13200 | cas7i | ||
| 3686 | CALEYI010000177.1 | GCA937924985_01835 | gene | open | 13213-14757 | cas8a1 | ||
| 3687 | CALEYI010000177.1 | GCA937924985_01836 | gene | open | 14738-15499 | cas6 | ||
| 3688 | CALEYI010000177.1 | GCA937924985_01837 | gene | open | 15535-16146 | |||
| 3689 | CALEYI010000177.1 | GCA937924985_01838 | gene | open | 16600-17142 | |||
| 3690 | CALEYI010000177.1 | GCA937924985_01839 | gene | open | 17325-17870 | |||
| 3691 | CALEYI010000178.1 | GCA937924985_01840 | CDS | open | 61-1008 | _na 315_aa | yfdV | Malonate transporter |
| 3692 | CALEYI010000178.1 | GCA937924985_01841 | CDS | open | 1038-1691 | _na 217_aa | ogg | N-glycosylase/DNA lyase |
| 3693 | CALEYI010000178.1 | GCA937924985_01842 | CDS | open | 1910-3214 | _na 434_aa | aCH1 | 4-hydroxybutyrate CoA-transferase |
| 3694 | CALEYI010000178.1 | GCA937924985_01843 | CDS | open | 3340-4209 | _na 289_aa | mscS | Small-conductance mechanosensitive channel |
| 3695 | CALEYI010000178.1 | GCA937924985_01844 | CDS | open | 4280-5308 | _na 342_aa | potD | Spermidine/putrescine ABC transporter substrate-binding protein |
| 3696 | CALEYI010000178.1 | GCA937924985_01845 | CDS | open | 5323-6417 | _na 364_aa | dnaN | DNA polymerase III subunit beta |
| 3697 | CALEYI010000178.1 | GCA937924985_01840 | gene | open | 61-1008 | yfdV | ||
| 3698 | CALEYI010000178.1 | GCA937924985_01841 | gene | open | 1038-1691 | ogg | ||
| 3699 | CALEYI010000178.1 | GCA937924985_01842 | gene | open | 1910-3214 | aCH1 | ||
| 3700 | CALEYI010000178.1 | GCA937924985_01843 | gene | open | 3340-4209 | mscS | ||
| 3701 | CALEYI010000178.1 | GCA937924985_01844 | gene | open | 4280-5308 | potD | ||
| 3702 | CALEYI010000178.1 | GCA937924985_01845 | gene | open | 5323-6417 | dnaN | ||
| 3703 | CALEYI010000179.1 | GCA937924985_01846 | CDS | open | 11-115 | _na 34_aa | hypothetical protein | |
| 3704 | CALEYI010000179.1 | GCA937924985_01847 | CDS | open | 456-860 | _na 134_aa | hypothetical protein | |
| 3705 | CALEYI010000179.1 | GCA937924985_01848 | CDS | open | 860-1042 | _na 60_aa | N-acetylmuramoyl-L-alanine amidase | |
| 3706 | CALEYI010000179.1 | GCA937924985_01849 | CDS | open | 1229-2473 | _na 414_aa | gspE | Bacterial type II secretion system protein E domain-containing protein |
| 3707 | CALEYI010000179.1 | GCA937924985_01850 | CDS | open | 2470-3510 | _na 346_aa | gspF | Type II secretion system protein GspF domain-containing protein |
| 3708 | CALEYI010000179.1 | GCA937924985_01846 | gene | open | 11-115 | |||
| 3709 | CALEYI010000179.1 | GCA937924985_01847 | gene | open | 456-860 | |||
| 3710 | CALEYI010000179.1 | GCA937924985_01848 | gene | open | 860-1042 | |||
| 3711 | CALEYI010000179.1 | GCA937924985_01849 | gene | open | 1229-2473 | gspE | ||
| 3712 | CALEYI010000179.1 | GCA937924985_01850 | gene | open | 2470-3510 | gspF | ||
| 3713 | CALEYI010000180.1 | regulatory_region | open | 7473-7535 | S4-Fusobacteriales ribosomal protein leader | |||
| 3714 | CALEYI010000180.1 | GCA937924985_01851 | CDS | open | 100-525 | _na 141_aa | Acetyltransferase | |
| 3715 | CALEYI010000180.1 | GCA937924985_01852 | CDS | open | 608-1588 | _na 326_aa | gloB | Metallo-beta-lactamase domain-containing protein |
| 3716 | CALEYI010000180.1 | GCA937924985_01853 | CDS | open | 1810-3549 | _na 579_aa | eMpr | Serine protease |
| 3717 | CALEYI010000180.1 | GCA937924985_01854 | CDS | open | 3568-4530 | _na 320_aa | Cysteine protease | |
| 3718 | CALEYI010000180.1 | GCA937924985_01855 | CDS | open | 4587-4937 | _na 116_aa | rplQ | 50S ribosomal protein L17 |
| 3719 | CALEYI010000180.1 | GCA937924985_01856 | CDS | open | 4965-5945 | _na 326_aa | rpoA | DNA-directed RNA polymerase subunit alpha |
| 3720 | CALEYI010000180.1 | GCA937924985_01857 | CDS | open | 5974-6561 | _na 195_aa | rpsD | 30S ribosomal protein S4 |
| 3721 | CALEYI010000180.1 | GCA937924985_01858 | CDS | open | 6601-6990 | _na 129_aa | rpsK | 30S ribosomal protein S11 |
| 3722 | CALEYI010000180.1 | GCA937924985_01859 | CDS | open | 7036-7392 | _na 118_aa | rpsM | 30S ribosomal protein S13 |
| 3723 | CALEYI010000180.1 | GCA937924985_01860 | CDS | open | 7600-7713 | _na 37_aa | rpmJ | 50S ribosomal protein L36 |
| 3724 | CALEYI010000180.1 | GCA937924985_01861 | CDS | open | 7733-7954 | _na 73_aa | infA | translation initiation factor IF-1 |
| 3725 | CALEYI010000180.1 | GCA937924985_01862 | CDS | open | 8050-8568 | _na 172_aa | hypothetical protein | |
| 3726 | CALEYI010000180.1 | GCA937924985_01851 | gene | open | 100-525 | |||
| 3727 | CALEYI010000180.1 | GCA937924985_01852 | gene | open | 608-1588 | gloB | ||
| 3728 | CALEYI010000180.1 | GCA937924985_01853 | gene | open | 1810-3549 | eMpr | ||
| 3729 | CALEYI010000180.1 | GCA937924985_01854 | gene | open | 3568-4530 | |||
| 3730 | CALEYI010000180.1 | GCA937924985_01855 | gene | open | 4587-4937 | rplQ | ||
| 3731 | CALEYI010000180.1 | GCA937924985_01856 | gene | open | 4965-5945 | rpoA | ||
| 3732 | CALEYI010000180.1 | GCA937924985_01857 | gene | open | 5974-6561 | rpsD | ||
| 3733 | CALEYI010000180.1 | GCA937924985_01858 | gene | open | 6601-6990 | rpsK | ||
| 3734 | CALEYI010000180.1 | GCA937924985_01859 | gene | open | 7036-7392 | rpsM | ||
| 3735 | CALEYI010000180.1 | GCA937924985_01860 | gene | open | 7600-7713 | rpmJ | ||
| 3736 | CALEYI010000180.1 | GCA937924985_01861 | gene | open | 7733-7954 | infA | ||
| 3737 | CALEYI010000180.1 | GCA937924985_01862 | gene | open | 8050-8568 | |||
| 3738 | CALEYI010000181.1 | GCA937924985_01863 | CDS | open | 30-218 | _na 62_aa | Putative CoA-substrate-specific enzyme activase | |
| 3739 | CALEYI010000181.1 | GCA937924985_01864 | CDS | open | 220-1443 | _na 407_aa | 2-hydroxyglutaryl-CoA dehydratase | |
| 3740 | CALEYI010000181.1 | GCA937924985_01865 | CDS | open | 1493-2263 | _na 256_aa | focA | Formate transporter |
| 3741 | CALEYI010000181.1 | GCA937924985_01866 | CDS | open | 2579-3493 | _na 304_aa | TIGR01212 family radical SAM protein | |
| 3742 | CALEYI010000181.1 | GCA937924985_01867 | CDS | open | 3511-4335 | _na 274_aa | nagB | glucosamine-6-phosphate deaminase |
| 3743 | CALEYI010000181.1 | GCA937924985_01868 | CDS | open | 4403-4891 | _na 162_aa | hypothetical protein | |
| 3744 | CALEYI010000181.1 | GCA937924985_01863 | gene | open | 30-218 | |||
| 3745 | CALEYI010000181.1 | GCA937924985_01864 | gene | open | 220-1443 | |||
| 3746 | CALEYI010000181.1 | GCA937924985_01865 | gene | open | 1493-2263 | focA | ||
| 3747 | CALEYI010000181.1 | GCA937924985_01866 | gene | open | 2579-3493 | |||
| 3748 | CALEYI010000181.1 | GCA937924985_01867 | gene | open | 3511-4335 | nagB | ||
| 3749 | CALEYI010000181.1 | GCA937924985_01868 | gene | open | 4403-4891 | |||
| 3750 | CALEYI010000182.1 | GCA937924985_01869 | CDS | open | 37-681 | _na 214_aa | Phosphatidic acid phosphatase type 2/haloperoxidase domain-containing protein | |
| 3751 | CALEYI010000182.1 | GCA937924985_01870 | CDS | open | 851-2218 | _na 455_aa | norM | Multidrug export protein MepA |
| 3752 | CALEYI010000182.1 | GCA937924985_01871 | CDS | open | 2242-2856 | _na 204_aa | citB | Sensory Transduction Protein Kinase |
| 3753 | CALEYI010000182.1 | GCA937924985_01872 | CDS | open | 2846-4234 | _na 462_aa | baeS | histidine kinase |
| 3754 | CALEYI010000182.1 | GCA937924985_01873 | CDS | open | 4440-6179 | _na 579_aa | ggt | gamma-glutamyltransferase |
| 3755 | CALEYI010000182.1 | GCA937924985_01874 | CDS | open | 6198-6731 | _na 177_aa | DUF6305 domain-containing protein | |
| 3756 | CALEYI010000182.1 | GCA937924985_01875 | CDS | open | 6787-8058 | _na 423_aa | dctQ | C4-dicarboxylate ABC transporter permease |
| 3757 | CALEYI010000182.1 | GCA937924985_01876 | CDS | open | 8075-8221 | _na 48_aa | hypothetical protein | |
| 3758 | CALEYI010000182.1 | GCA937924985_01877 | CDS | open | 8233-9369 | _na 378_aa | Succinylglutamate desuccinylase | |
| 3759 | CALEYI010000182.1 | GCA937924985_01878 | CDS | open | 9461-10609 | _na 382_aa | pgsB | poly-gamma-glutamate synthase PgsB |
| 3760 | CALEYI010000182.1 | GCA937924985_01879 | CDS | open | 10599-11057 | _na 152_aa | pgsC | poly-gamma-glutamate biosynthesis protein PgsC |
| 3761 | CALEYI010000182.1 | GCA937924985_01880 | CDS | open | 11054-12148 | _na 364_aa | Poly-gamma-glutamate system protein | |
| 3762 | CALEYI010000182.1 | GCA937924985_01881 | CDS | open | 12143-12544 | _na 133_aa | hypothetical protein | |
| 3763 | CALEYI010000182.1 | GCA937924985_01869 | gene | open | 37-681 | |||
| 3764 | CALEYI010000182.1 | GCA937924985_01870 | gene | open | 851-2218 | norM | ||
| 3765 | CALEYI010000182.1 | GCA937924985_01871 | gene | open | 2242-2856 | citB | ||
| 3766 | CALEYI010000182.1 | GCA937924985_01872 | gene | open | 2846-4234 | baeS | ||
| 3767 | CALEYI010000182.1 | GCA937924985_01873 | gene | open | 4440-6179 | ggt | ||
| 3768 | CALEYI010000182.1 | GCA937924985_01874 | gene | open | 6198-6731 | |||
| 3769 | CALEYI010000182.1 | GCA937924985_01875 | gene | open | 6787-8058 | dctQ | ||
| 3770 | CALEYI010000182.1 | GCA937924985_01876 | gene | open | 8075-8221 | |||
| 3771 | CALEYI010000182.1 | GCA937924985_01877 | gene | open | 8233-9369 | |||
| 3772 | CALEYI010000182.1 | GCA937924985_01878 | gene | open | 9461-10609 | pgsB | ||
| 3773 | CALEYI010000182.1 | GCA937924985_01879 | gene | open | 10599-11057 | pgsC | ||
| 3774 | CALEYI010000182.1 | GCA937924985_01880 | gene | open | 11054-12148 | |||
| 3775 | CALEYI010000182.1 | GCA937924985_01881 | gene | open | 12143-12544 | |||
| 3776 | CALEYI010000183.1 | GCA937924985_01882 | CDS | open | 275-892 | _na 205_aa | hypothetical protein | |
| 3777 | CALEYI010000183.1 | GCA937924985_01883 | CDS | open | 954-1298 | _na 114_aa | rplV | 50S ribosomal protein L22 |
| 3778 | CALEYI010000183.1 | GCA937924985_01882 | gene | open | 275-892 | |||
| 3779 | CALEYI010000183.1 | GCA937924985_01883 | gene | open | 954-1298 | rplV | ||
| 3780 | CALEYI010000184.1 | GCA937924985_01884 | CDS | open | 1290-2021 | _na 243_aa | glpF | Glycerol uptake facilitator protein |
| 3781 | CALEYI010000184.1 | GCA937924985_01884 | gene | open | 1290-2021 | glpF | ||
| 3782 | CALEYI010000185.1 | GCA937924985_01885 | CDS | open | 273-1031 | _na 252_aa | sseB | Enhanced serine sensitivity protein SseB |
| 3783 | CALEYI010000185.1 | GCA937924985_01886 | CDS | open | 1194-2681 | _na 495_aa | ddpA | Solute-binding protein family 5 domain-containing protein |
| 3784 | CALEYI010000185.1 | GCA937924985_01887 | CDS | open | 2691-3608 | _na 305_aa | dppB | ABC transmembrane type-1 domain-containing protein |
| 3785 | CALEYI010000185.1 | GCA937924985_01888 | CDS | open | 3608-4375 | _na 255_aa | dppC | ABC transmembrane type-1 domain-containing protein |
| 3786 | CALEYI010000185.1 | GCA937924985_01885 | gene | open | 273-1031 | sseB | ||
| 3787 | CALEYI010000185.1 | GCA937924985_01886 | gene | open | 1194-2681 | ddpA | ||
| 3788 | CALEYI010000185.1 | GCA937924985_01887 | gene | open | 2691-3608 | dppB | ||
| 3789 | CALEYI010000185.1 | GCA937924985_01888 | gene | open | 3608-4375 | dppC | ||
| 3790 | CALEYI010000186.1 | GCA937924985_01889 | CDS | open | 1140-1499 | _na 119_aa | hypothetical protein | |
| 3791 | CALEYI010000186.1 | GCA937924985_01890 | CDS | open | 1369-2511 | _na 380_aa | ABC superfamily ATP binding cassette transporter%2C membrane protein | |
| 3792 | CALEYI010000186.1 | GCA937924985_01891 | CDS | open | 2459-2692 | _na 77_aa | Export ABC transporter | |
| 3793 | CALEYI010000186.1 | GCA937924985_01892 | CDS | open | 2797-5238 | _na 813_aa | tPR | SycD/LcrH family type III secretion system chaperone |
| 3794 | CALEYI010000186.1 | GCA937924985_01893 | CDS | open | 5256-6038 | _na 260_aa | Oxidoreductase%2C short chain dehydrogenase/reductase family protein | |
| 3795 | CALEYI010000186.1 | GCA937924985_01894 | CDS | open | 6197-7348 | _na 383_aa | livK | Leucine-binding protein domain-containing protein |
| 3796 | CALEYI010000186.1 | GCA937924985_01889 | gene | open | 1140-1499 | |||
| 3797 | CALEYI010000186.1 | GCA937924985_01890 | gene | open | 1369-2511 | |||
| 3798 | CALEYI010000186.1 | GCA937924985_01891 | gene | open | 2459-2692 | |||
| 3799 | CALEYI010000186.1 | GCA937924985_01892 | gene | open | 2797-5238 | tPR | ||
| 3800 | CALEYI010000186.1 | GCA937924985_01893 | gene | open | 5256-6038 | |||
| 3801 | CALEYI010000186.1 | GCA937924985_01894 | gene | open | 6197-7348 | livK | ||
| 3802 | CALEYI010000187.1 | GCA937924985_01895 | CDS | open | 204-635 | _na 143_aa | fldA | Flavodoxin-like domain-containing protein |
| 3803 | CALEYI010000187.1 | GCA937924985_01896 | CDS | open | 677-1174 | _na 165_aa | ywqK | Toxin-antitoxin system YwqK family antitoxin |
| 3804 | CALEYI010000187.1 | GCA937924985_01897 | CDS | open | 1183-1683 | _na 166_aa | ywqK | Toxin-antitoxin system YwqK family antitoxin |
| 3805 | CALEYI010000187.1 | GCA937924985_01898 | CDS | open | 1773-2498 | _na 241_aa | ywqK | Phophatidylinositol-4-phosphate 5-kinase |
| 3806 | CALEYI010000187.1 | GCA937924985_01899 | CDS | open | 2810-4309 | _na 499_aa | yfcC | putative basic amino acid antiporter YfcC |
| 3807 | CALEYI010000187.1 | GCA937924985_01900 | CDS | open | 4439-4720 | _na 93_aa | spoVG | Putative septation protein SpoVG |
| 3808 | CALEYI010000187.1 | GCA937924985_01901 | CDS | open | 4736-5608 | _na 290_aa | ispE | 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase |
| 3809 | CALEYI010000187.1 | GCA937924985_01902 | CDS | open | 5601-5900 | _na 99_aa | hslR | RNA-binding S4 domain-containing protein |
| 3810 | CALEYI010000187.1 | GCA937924985_01903 | CDS | open | 6016-8961 | _na 981_aa | mfd | transcription-repair coupling factor |
| 3811 | CALEYI010000187.1 | GCA937924985_01904 | CDS | open | 9097-9582 | _na 161_aa | Lipoprotein | |
| 3812 | CALEYI010000187.1 | GCA937924985_01905 | CDS | open | 9633-10466 | _na 277_aa | Fido domain-containing protein | |
| 3813 | CALEYI010000187.1 | GCA937924985_01906 | CDS | open | 10989-11669 | _na 226_aa | PD-(D/E)XK nuclease superfamily protein | |
| 3814 | CALEYI010000187.1 | GCA937924985_01907 | CDS | open | 11623-11871 | _na 82_aa | hypothetical protein | |
| 3815 | CALEYI010000187.1 | GCA937924985_01908 | CDS | open | 12051-12599 | _na 182_aa | DUF1877 domain-containing protein | |
| 3816 | CALEYI010000187.1 | GCA937924985_01909 | CDS | open | 12596-13285 | _na 229_aa | yqgA | DUF554 domain-containing protein |
| 3817 | CALEYI010000187.1 | GCA937924985_01910 | CDS | open | 13439-13936 | _na 165_aa | adk | DNA topology modulation protein FLAR-related protein |
| 3818 | CALEYI010000187.1 | GCA937924985_01911 | CDS | open | 13963-14472 | _na 169_aa | niaR | DNA-binding transcriptional regulator |
| 3819 | CALEYI010000187.1 | GCA937924985_01912 | CDS | open | 14420-15277 | _na 285_aa | nadC | carboxylating nicotinate-nucleotide diphosphorylase |
| 3820 | CALEYI010000187.1 | GCA937924985_01913 | CDS | open | 15222-16595 | _na 457_aa | nadB | L-aspartate oxidase |
| 3821 | CALEYI010000187.1 | GCA937924985_01914 | CDS | open | 16597-17493 | _na 298_aa | nadA | quinolinate synthase NadA |
| 3822 | CALEYI010000187.1 | GCA937924985_01915 | CDS | open | 17679-18773 | _na 364_aa | mnmG | tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG |
| 3823 | CALEYI010000187.1 | GCA937924985_01895 | gene | open | 204-635 | fldA | ||
| 3824 | CALEYI010000187.1 | GCA937924985_01896 | gene | open | 677-1174 | ywqK | ||
| 3825 | CALEYI010000187.1 | GCA937924985_01897 | gene | open | 1183-1683 | ywqK | ||
| 3826 | CALEYI010000187.1 | GCA937924985_01898 | gene | open | 1773-2498 | ywqK | ||
| 3827 | CALEYI010000187.1 | GCA937924985_01899 | gene | open | 2810-4309 | yfcC | ||
| 3828 | CALEYI010000187.1 | GCA937924985_01900 | gene | open | 4439-4720 | spoVG | ||
| 3829 | CALEYI010000187.1 | GCA937924985_01901 | gene | open | 4736-5608 | ispE | ||
| 3830 | CALEYI010000187.1 | GCA937924985_01902 | gene | open | 5601-5900 | hslR | ||
| 3831 | CALEYI010000187.1 | GCA937924985_01903 | gene | open | 6016-8961 | mfd | ||
| 3832 | CALEYI010000187.1 | GCA937924985_01904 | gene | open | 9097-9582 | |||
| 3833 | CALEYI010000187.1 | GCA937924985_01905 | gene | open | 9633-10466 | |||
| 3834 | CALEYI010000187.1 | GCA937924985_01906 | gene | open | 10989-11669 | |||
| 3835 | CALEYI010000187.1 | GCA937924985_01907 | gene | open | 11623-11871 | |||
| 3836 | CALEYI010000187.1 | GCA937924985_01908 | gene | open | 12051-12599 | |||
| 3837 | CALEYI010000187.1 | GCA937924985_01909 | gene | open | 12596-13285 | yqgA | ||
| 3838 | CALEYI010000187.1 | GCA937924985_01910 | gene | open | 13439-13936 | adk | ||
| 3839 | CALEYI010000187.1 | GCA937924985_01911 | gene | open | 13963-14472 | niaR | ||
| 3840 | CALEYI010000187.1 | GCA937924985_01912 | gene | open | 14420-15277 | nadC | ||
| 3841 | CALEYI010000187.1 | GCA937924985_01913 | gene | open | 15222-16595 | nadB | ||
| 3842 | CALEYI010000187.1 | GCA937924985_01914 | gene | open | 16597-17493 | nadA | ||
| 3843 | CALEYI010000187.1 | GCA937924985_01915 | gene | open | 17679-18773 | mnmG | ||
| 3844 | CALEYI010000188.1 | GCA937924985_01916 | CDS | open | 165-452 | _na 95_aa | hypothetical protein | |
| 3845 | CALEYI010000188.1 | GCA937924985_01917 | CDS | open | 477-770 | _na 97_aa | hypothetical protein | |
| 3846 | CALEYI010000188.1 | GCA937924985_01918 | CDS | open | 1086-1280 | _na 64_aa | hypothetical protein | |
| 3847 | CALEYI010000188.1 | GCA937924985_01919 | CDS | open | 1403-2134 | _na 243_aa | DUF4130 domain-containing protein | |
| 3848 | CALEYI010000188.1 | GCA937924985_01920 | CDS | open | 2147-3160 | _na 337_aa | cbiG | cobalt-precorrin 5A hydrolase |
| 3849 | CALEYI010000188.1 | GCA937924985_01921 | CDS | open | 3153-3902 | _na 249_aa | Precorrin-3B C(17)-methyltransferase | |
| 3850 | CALEYI010000188.1 | GCA937924985_01922 | CDS | open | 3874-4674 | _na 266_aa | cobK | precorrin-6A reductase |
| 3851 | CALEYI010000188.1 | GCA937924985_01916 | gene | open | 165-452 | |||
| 3852 | CALEYI010000188.1 | GCA937924985_01917 | gene | open | 477-770 | |||
| 3853 | CALEYI010000188.1 | GCA937924985_01918 | gene | open | 1086-1280 | |||
| 3854 | CALEYI010000188.1 | GCA937924985_01919 | gene | open | 1403-2134 | |||
| 3855 | CALEYI010000188.1 | GCA937924985_01920 | gene | open | 2147-3160 | cbiG | ||
| 3856 | CALEYI010000188.1 | GCA937924985_01921 | gene | open | 3153-3902 | |||
| 3857 | CALEYI010000188.1 | GCA937924985_01922 | gene | open | 3874-4674 | cobK | ||
| 3858 | CALEYI010000189.1 | GCA937924985_01923 | CDS | open | 15-110 | _na 31_aa | hypothetical protein | |
| 3859 | CALEYI010000189.1 | GCA937924985_01924 | CDS | open | 180-1289 | _na 369_aa | YibE/F family protein | |
| 3860 | CALEYI010000189.1 | GCA937924985_01925 | CDS | open | 1416-1664 | _na 82_aa | transposase | |
| 3861 | CALEYI010000189.1 | GCA937924985_01926 | CDS | open | 1661-1819 | _na 52_aa | transposase | |
| 3862 | CALEYI010000189.1 | GCA937924985_01927 | CDS | open | 2155-2319 | _na 54_aa | hypothetical protein | |
| 3863 | CALEYI010000189.1 | GCA937924985_01923 | gene | open | 15-110 | |||
| 3864 | CALEYI010000189.1 | GCA937924985_01924 | gene | open | 180-1289 | |||
| 3865 | CALEYI010000189.1 | GCA937924985_01925 | gene | open | 1416-1664 | |||
| 3866 | CALEYI010000189.1 | GCA937924985_01926 | gene | open | 1661-1819 | |||
| 3867 | CALEYI010000189.1 | GCA937924985_01927 | gene | open | 2155-2319 | |||
| 3868 | CALEYI010000190.1 | GCA937924985_01928 | CDS | open | 40-546 | _na 168_aa | hypothetical protein | |
| 3869 | CALEYI010000190.1 | GCA937924985_01929 | CDS | open | 665-1969 | _na 434_aa | trmFO | methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO |
| 3870 | CALEYI010000190.1 | GCA937924985_01930 | CDS | open | 1976-2848 | _na 290_aa | xerD | Integrase |
| 3871 | CALEYI010000190.1 | GCA937924985_01931 | CDS | open | 2845-3945 | _na 366_aa | yqeH | ribosome biogenesis GTPase YqeH |
| 3872 | CALEYI010000190.1 | GCA937924985_01932 | CDS | open | 3947-4453 | _na 168_aa | gspG | Type II secretion system protein GspG C-terminal domain-containing protein |
| 3873 | CALEYI010000190.1 | GCA937924985_01933 | CDS | open | 4470-5504 | _na 344_aa | ftsY | signal recognition particle-docking protein FtsY |
| 3874 | CALEYI010000190.1 | GCA937924985_01934 | CDS | open | 5618-6265 | _na 215_aa | Alpha/beta hydrolase | |
| 3875 | CALEYI010000190.1 | GCA937924985_01935 | CDS | open | 6280-7173 | _na 297_aa | Beta-carotene 15%2C15'-monooxygenase | |
| 3876 | CALEYI010000190.1 | GCA937924985_01936 | CDS | open | 7280-7531 | _na 83_aa | Glutaredoxin domain-containing protein | |
| 3877 | CALEYI010000190.1 | GCA937924985_01937 | CDS | open | 7729-8274 | _na 181_aa | ywqK | Toxin-antitoxin system YwqK family antitoxin |
| 3878 | CALEYI010000190.1 | GCA937924985_01938 | CDS | open | 8537-8971 | _na 144_aa | dps | Neutrophil-activating protein A |
| 3879 | CALEYI010000190.1 | GCA937924985_01939 | CDS | open | 9108-10802 | _na 564_aa | mdlB | Thiamine ABC transporter permease |
| 3880 | CALEYI010000190.1 | GCA937924985_01940 | CDS | open | 10849-11058 | _na 69_aa | hypothetical protein | |
| 3881 | CALEYI010000190.1 | GCA937924985_01941 | CDS | open | 11265-11540 | _na 91_aa | DUF340 domain-containing protein | |
| 3882 | CALEYI010000190.1 | GCA937924985_01942 | CDS | open | 11500-11688 | _na 62_aa | hypothetical protein | |
| 3883 | CALEYI010000190.1 | GCA937924985_01928 | gene | open | 40-546 | |||
| 3884 | CALEYI010000190.1 | GCA937924985_01929 | gene | open | 665-1969 | trmFO | ||
| 3885 | CALEYI010000190.1 | GCA937924985_01930 | gene | open | 1976-2848 | xerD | ||
| 3886 | CALEYI010000190.1 | GCA937924985_01931 | gene | open | 2845-3945 | yqeH | ||
| 3887 | CALEYI010000190.1 | GCA937924985_01932 | gene | open | 3947-4453 | gspG | ||
| 3888 | CALEYI010000190.1 | GCA937924985_01933 | gene | open | 4470-5504 | ftsY | ||
| 3889 | CALEYI010000190.1 | GCA937924985_01934 | gene | open | 5618-6265 | |||
| 3890 | CALEYI010000190.1 | GCA937924985_01935 | gene | open | 6280-7173 | |||
| 3891 | CALEYI010000190.1 | GCA937924985_01936 | gene | open | 7280-7531 | |||
| 3892 | CALEYI010000190.1 | GCA937924985_01937 | gene | open | 7729-8274 | ywqK | ||
| 3893 | CALEYI010000190.1 | GCA937924985_01938 | gene | open | 8537-8971 | dps | ||
| 3894 | CALEYI010000190.1 | GCA937924985_01939 | gene | open | 9108-10802 | mdlB | ||
| 3895 | CALEYI010000190.1 | GCA937924985_01940 | gene | open | 10849-11058 | |||
| 3896 | CALEYI010000190.1 | GCA937924985_01941 | gene | open | 11265-11540 | |||
| 3897 | CALEYI010000190.1 | GCA937924985_01942 | gene | open | 11500-11688 | |||
| 3898 | CALEYI010000191.1 | regulatory_region | open | 4961-5134 | Cobalamin riboswitch aptamer | |||
| 3899 | CALEYI010000191.1 | GCA937924985_01943 | CDS | open | 10-3417 | _na 1135_aa | dnaE | DNA polymerase III subunit alpha |
| 3900 | CALEYI010000191.1 | GCA937924985_01944 | CDS | open | 3459-4667 | _na 402_aa | AAA domain-containing protein | |
| 3901 | CALEYI010000191.1 | GCA937924985_01945 | CDS | open | 5267-8962 | _na 1231_aa | autotransporter | |
| 3902 | CALEYI010000191.1 | GCA937924985_01946 | CDS | open | 9018-10568 | _na 516_aa | citF | citrate lyase subunit alpha |
| 3903 | CALEYI010000191.1 | GCA937924985_01947 | CDS | open | 10571-11461 | _na 296_aa | citE | citrate (pro-3S)-lyase subunit beta |
| 3904 | CALEYI010000191.1 | GCA937924985_01948 | CDS | open | 11470-11703 | _na 77_aa | citD | citrate lyase acyl carrier protein |
| 3905 | CALEYI010000191.1 | GCA937924985_01943 | gene | open | 10-3417 | dnaE | ||
| 3906 | CALEYI010000191.1 | GCA937924985_01944 | gene | open | 3459-4667 | |||
| 3907 | CALEYI010000191.1 | GCA937924985_01945 | gene | open | 5267-8962 | |||
| 3908 | CALEYI010000191.1 | GCA937924985_01946 | gene | open | 9018-10568 | citF | ||
| 3909 | CALEYI010000191.1 | GCA937924985_01947 | gene | open | 10571-11461 | citE | ||
| 3910 | CALEYI010000191.1 | GCA937924985_01948 | gene | open | 11470-11703 | citD | ||
| 3911 | CALEYI010000192.1 | GCA937924985_01956 | gene | open | 6025-6122 | n00280 | ||
| 3912 | CALEYI010000192.1 | GCA937924985_01956 | ncRNA | open | 6025-6122 | Clostridioides difficile sRNA included into helicase gene | ||
| 3913 | CALEYI010000192.1 | GCA937924985_01949 | CDS | open | 28-348 | _na 106_aa | histidine kinase | |
| 3914 | CALEYI010000192.1 | GCA937924985_01950 | CDS | open | 484-660 | _na 58_aa | Integral membrane protein | |
| 3915 | CALEYI010000192.1 | GCA937924985_01951 | CDS | open | 690-923 | _na 77_aa | hypothetical protein | |
| 3916 | CALEYI010000192.1 | GCA937924985_01952 | CDS | open | 1001-1324 | _na 107_aa | hxlR | HTH hxlR-type domain-containing protein |
| 3917 | CALEYI010000192.1 | GCA937924985_01953 | CDS | open | 1377-2558 | _na 393_aa | abgB | N-acyl-L-amino acid amidohydrolase |
| 3918 | CALEYI010000192.1 | GCA937924985_01954 | CDS | open | 2574-4094 | _na 506_aa | abgT | AbgT transporter |
| 3919 | CALEYI010000192.1 | GCA937924985_01955 | CDS | open | 4300-6513 | _na 737_aa | uvrD | DNA 3'-5' helicase |
| 3920 | CALEYI010000192.1 | GCA937924985_01957 | CDS | open | 6524-7357 | _na 277_aa | lpxC | UDP-3-O-acyl-N-acetylglucosamine deacetylase |
| 3921 | CALEYI010000192.1 | GCA937924985_01958 | CDS | open | 7379-7804 | _na 141_aa | fabZ | 3-hydroxyacyl-ACP dehydratase FabZ |
| 3922 | CALEYI010000192.1 | GCA937924985_01959 | CDS | open | 7821-8594 | _na 257_aa | lpxA | acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase |
| 3923 | CALEYI010000192.1 | GCA937924985_01960 | CDS | open | 8594-9397 | _na 267_aa | lpxI | Septum site-determining protein MinC |
| 3924 | CALEYI010000192.1 | GCA937924985_01961 | CDS | open | 9407-10486 | _na 359_aa | lpxB | lipid-A-disaccharide synthase |
| 3925 | CALEYI010000192.1 | GCA937924985_01962 | CDS | open | 10474-12249 | _na 591_aa | mdlB | ABC transporter |
| 3926 | CALEYI010000192.1 | GCA937924985_01963 | CDS | open | 12511-13011 | _na 166_aa | Septicolysin | |
| 3927 | CALEYI010000192.1 | GCA937924985_01964 | CDS | open | 13091-13561 | _na 156_aa | ywqK | Toxin-antitoxin system YwqK family antitoxin |
| 3928 | CALEYI010000192.1 | GCA937924985_01965 | CDS | open | 13688-14398 | _na 236_aa | Phage tail protein | |
| 3929 | CALEYI010000192.1 | GCA937924985_01966 | CDS | open | 14490-15434 | _na 314_aa | lysR | Transcriptional regulatory protein%2C LYSR family |
| 3930 | CALEYI010000192.1 | GCA937924985_01967 | CDS | open | 15609-16817 | _na 402_aa | gltP | Proton/sodium-aspartate symport protein |
| 3931 | CALEYI010000192.1 | GCA937924985_01968 | CDS | open | 16845-18074 | _na 409_aa | aspB | Aspartate aminotransferase |
| 3932 | CALEYI010000192.1 | GCA937924985_01969 | CDS | open | 18053-18478 | _na 141_aa | ridA | RidA family protein |
| 3933 | CALEYI010000192.1 | GCA937924985_01970 | CDS | open | 18603-19190 | _na 195_aa | yqeK | bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK |
| 3934 | CALEYI010000192.1 | GCA937924985_01971 | CDS | open | 19181-21283 | _na 700_aa | rnr | ribonuclease R |
| 3935 | CALEYI010000192.1 | GCA937924985_01972 | CDS | open | 21300-21746 | _na 148_aa | smpB | SsrA-binding protein SmpB |
| 3936 | CALEYI010000192.1 | GCA937924985_01973 | CDS | open | 21815-25321 | _na 1168_aa | Organic solvent tolerance-like N-terminal domain-containing protein | |
| 3937 | CALEYI010000192.1 | GCA937924985_01949 | gene | open | 28-348 | |||
| 3938 | CALEYI010000192.1 | GCA937924985_01950 | gene | open | 484-660 | |||
| 3939 | CALEYI010000192.1 | GCA937924985_01951 | gene | open | 690-923 | |||
| 3940 | CALEYI010000192.1 | GCA937924985_01952 | gene | open | 1001-1324 | hxlR | ||
| 3941 | CALEYI010000192.1 | GCA937924985_01953 | gene | open | 1377-2558 | abgB | ||
| 3942 | CALEYI010000192.1 | GCA937924985_01954 | gene | open | 2574-4094 | abgT | ||
| 3943 | CALEYI010000192.1 | GCA937924985_01955 | gene | open | 4300-6513 | uvrD | ||
| 3944 | CALEYI010000192.1 | GCA937924985_01957 | gene | open | 6524-7357 | lpxC | ||
| 3945 | CALEYI010000192.1 | GCA937924985_01958 | gene | open | 7379-7804 | fabZ | ||
| 3946 | CALEYI010000192.1 | GCA937924985_01959 | gene | open | 7821-8594 | lpxA | ||
| 3947 | CALEYI010000192.1 | GCA937924985_01960 | gene | open | 8594-9397 | lpxI | ||
| 3948 | CALEYI010000192.1 | GCA937924985_01961 | gene | open | 9407-10486 | lpxB | ||
| 3949 | CALEYI010000192.1 | GCA937924985_01962 | gene | open | 10474-12249 | mdlB | ||
| 3950 | CALEYI010000192.1 | GCA937924985_01963 | gene | open | 12511-13011 | |||
| 3951 | CALEYI010000192.1 | GCA937924985_01964 | gene | open | 13091-13561 | ywqK | ||
| 3952 | CALEYI010000192.1 | GCA937924985_01965 | gene | open | 13688-14398 | |||
| 3953 | CALEYI010000192.1 | GCA937924985_01966 | gene | open | 14490-15434 | lysR | ||
| 3954 | CALEYI010000192.1 | GCA937924985_01967 | gene | open | 15609-16817 | gltP | ||
| 3955 | CALEYI010000192.1 | GCA937924985_01968 | gene | open | 16845-18074 | aspB | ||
| 3956 | CALEYI010000192.1 | GCA937924985_01969 | gene | open | 18053-18478 | ridA | ||
| 3957 | CALEYI010000192.1 | GCA937924985_01970 | gene | open | 18603-19190 | yqeK | ||
| 3958 | CALEYI010000192.1 | GCA937924985_01971 | gene | open | 19181-21283 | rnr | ||
| 3959 | CALEYI010000192.1 | GCA937924985_01972 | gene | open | 21300-21746 | smpB | ||
| 3960 | CALEYI010000192.1 | GCA937924985_01973 | gene | open | 21815-25321 | |||
| 3961 | CALEYI010000193.1 | GCA937924985_01974 | CDS | open | 140-655 | _na 171_aa | GNAT family N-acetyltransferase | |
| 3962 | CALEYI010000193.1 | GCA937924985_01975 | CDS | open | 766-1974 | _na 402_aa | tyrS | tyrosine--tRNA ligase |
| 3963 | CALEYI010000193.1 | GCA937924985_01976 | CDS | open | 2208-3482 | _na 424_aa | brnQ | branched-chain amino acid transport system II carrier protein |
| 3964 | CALEYI010000193.1 | GCA937924985_01977 | CDS | open | 3611-3973 | _na 120_aa | arsC | Arsenate reductase |
| 3965 | CALEYI010000193.1 | GCA937924985_01978 | CDS | open | 4103-5824 | _na 573_aa | Urocanate reductase | |
| 3966 | CALEYI010000193.1 | GCA937924985_01979 | CDS | open | 5983-6507 | _na 174_aa | Caldesmon (CDM) | |
| 3967 | CALEYI010000193.1 | GCA937924985_01980 | CDS | open | 6829-7587 | _na 252_aa | nagD | 4-nitrophenylphosphatase |
| 3968 | CALEYI010000193.1 | GCA937924985_01981 | CDS | open | 7634-8395 | _na 253_aa | exodeoxyribonuclease III | |
| 3969 | CALEYI010000193.1 | GCA937924985_01982 | CDS | open | 8398-8841 | _na 147_aa | aroQ | type II 3-dehydroquinate dehydratase |
| 3970 | CALEYI010000193.1 | GCA937924985_01983 | CDS | open | 8822-9127 | _na 101_aa | hypothetical protein | |
| 3971 | CALEYI010000193.1 | GCA937924985_01974 | gene | open | 140-655 | |||
| 3972 | CALEYI010000193.1 | GCA937924985_01975 | gene | open | 766-1974 | tyrS | ||
| 3973 | CALEYI010000193.1 | GCA937924985_01976 | gene | open | 2208-3482 | brnQ | ||
| 3974 | CALEYI010000193.1 | GCA937924985_01977 | gene | open | 3611-3973 | arsC | ||
| 3975 | CALEYI010000193.1 | GCA937924985_01978 | gene | open | 4103-5824 | |||
| 3976 | CALEYI010000193.1 | GCA937924985_01979 | gene | open | 5983-6507 | |||
| 3977 | CALEYI010000193.1 | GCA937924985_01980 | gene | open | 6829-7587 | nagD | ||
| 3978 | CALEYI010000193.1 | GCA937924985_01981 | gene | open | 7634-8395 | |||
| 3979 | CALEYI010000193.1 | GCA937924985_01982 | gene | open | 8398-8841 | aroQ | ||
| 3980 | CALEYI010000193.1 | GCA937924985_01983 | gene | open | 8822-9127 | |||
| 3981 | CALEYI010000194.1 | GCA937924985_01984 | CDS | open | 9-266 | _na 85_aa | Txe/YoeB family addiction module toxin | |
| 3982 | CALEYI010000194.1 | GCA937924985_01985 | CDS | open | 382-1458 | _na 358_aa | dhhP | DHH family phosphoesterase |
| 3983 | CALEYI010000194.1 | GCA937924985_01986 | CDS | open | 1478-2221 | _na 247_aa | truA | tRNA pseudouridine(38-40) synthase TruA |
| 3984 | CALEYI010000194.1 | GCA937924985_01987 | CDS | open | 2507-3013 | _na 168_aa | DUF2247 domain-containing protein | |
| 3985 | CALEYI010000194.1 | GCA937924985_01988 | CDS | open | 3138-3317 | _na 59_aa | hypothetical protein | |
| 3986 | CALEYI010000194.1 | GCA937924985_01989 | CDS | open | 3485-4060 | _na 191_aa | pth | aminoacyl-tRNA hydrolase |
| 3987 | CALEYI010000194.1 | GCA937924985_01990 | CDS | open | 4135-5442 | _na 435_aa | rsxC | electron transport complex subunit RsxC |
| 3988 | CALEYI010000194.1 | GCA937924985_01991 | CDS | open | 5468-6412 | _na 314_aa | rnfD | Ion-translocating oxidoreductase complex subunit D |
| 3989 | CALEYI010000194.1 | GCA937924985_01992 | CDS | open | 6402-6935 | _na 177_aa | rnfG | Ion-translocating oxidoreductase complex subunit G |
| 3990 | CALEYI010000194.1 | GCA937924985_01993 | CDS | open | 6935-7552 | _na 205_aa | rnfE | Ion-translocating oxidoreductase complex subunit E |
| 3991 | CALEYI010000194.1 | GCA937924985_01994 | CDS | open | 7549-8133 | _na 194_aa | rsxA | electron transport complex subunit RsxA |
| 3992 | CALEYI010000194.1 | GCA937924985_01995 | CDS | open | 8160-8870 | _na 236_aa | rnfB | Electron transporter RnfB |
| 3993 | CALEYI010000194.1 | GCA937924985_01996 | CDS | open | 9038-10288 | _na 416_aa | DUF3798 domain-containing protein | |
| 3994 | CALEYI010000194.1 | GCA937924985_01997 | CDS | open | 10347-11006 | _na 219_aa | HTH cro/C1-type domain-containing protein | |
| 3995 | CALEYI010000194.1 | GCA937924985_01998 | CDS | open | 11263-11376 | _na 37_aa | hypothetical protein | |
| 3996 | CALEYI010000194.1 | GCA937924985_01999 | CDS | open | 11545-12012 | _na 155_aa | Acetyltransferase | |
| 3997 | CALEYI010000194.1 | GCA937924985_01984 | gene | open | 9-266 | |||
| 3998 | CALEYI010000194.1 | GCA937924985_01985 | gene | open | 382-1458 | dhhP | ||
| 3999 | CALEYI010000194.1 | GCA937924985_01986 | gene | open | 1478-2221 | truA | ||
| 4000 | CALEYI010000194.1 | GCA937924985_01987 | gene | open | 2507-3013 |

