BAKTAGenome Explorer: Fusobacterium animalis (GCA_938035375.1)
Select a Genome:
|
BAKTA Annotations for GCA_938035375.1
|
Search & Sort all 4520 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 1501 | CALHMO010000096.1 | GCA938035375_00751 | CDS | open | 1675-2493 | _na 272_aa | 3-keto-5-aminohexanoate cleavage protein | |
| 1502 | CALHMO010000096.1 | GCA938035375_00752 | CDS | open | 2512-3456 | _na 314_aa | 3-hydroxyacyl-CoA dehydrogenase | |
| 1503 | CALHMO010000096.1 | GCA938035375_00753 | CDS | open | 3479-4855 | _na 458_aa | Serine--pyruvate aminotransferase | |
| 1504 | CALHMO010000096.1 | GCA938035375_00754 | CDS | open | 4930-5913 | _na 327_aa | asnA | aspartate--ammonia ligase |
| 1505 | CALHMO010000096.1 | GCA938035375_00750 | gene | open | 154-1512 | |||
| 1506 | CALHMO010000096.1 | GCA938035375_00751 | gene | open | 1675-2493 | |||
| 1507 | CALHMO010000096.1 | GCA938035375_00752 | gene | open | 2512-3456 | |||
| 1508 | CALHMO010000096.1 | GCA938035375_00753 | gene | open | 3479-4855 | |||
| 1509 | CALHMO010000096.1 | GCA938035375_00754 | gene | open | 4930-5913 | asnA | ||
| 1510 | CALHMO010000097.1 | GCA938035375_00755 | CDS | open | 2307-3161 | _na 284_aa | dprA | DNA-processing protein DprA |
| 1511 | CALHMO010000097.1 | GCA938035375_00756 | CDS | open | 3183-3959 | _na 258_aa | Tetratricopeptide repeat protein | |
| 1512 | CALHMO010000097.1 | GCA938035375_00757 | CDS | open | 3940-5154 | _na 404_aa | xseA | exodeoxyribonuclease VII large subunit |
| 1513 | CALHMO010000097.1 | GCA938035375_00758 | CDS | open | 5284-5730 | _na 148_aa | DUF340 domain-containing protein | |
| 1514 | CALHMO010000097.1 | GCA938035375_00759 | CDS | open | 5732-6493 | _na 253_aa | DUF3100 domain-containing protein | |
| 1515 | CALHMO010000097.1 | GCA938035375_00760 | CDS | open | 6510-7262 | _na 250_aa | hypothetical protein | |
| 1516 | CALHMO010000097.1 | GCA938035375_00755 | gene | open | 2307-3161 | dprA | ||
| 1517 | CALHMO010000097.1 | GCA938035375_00756 | gene | open | 3183-3959 | |||
| 1518 | CALHMO010000097.1 | GCA938035375_00757 | gene | open | 3940-5154 | xseA | ||
| 1519 | CALHMO010000097.1 | GCA938035375_00758 | gene | open | 5284-5730 | |||
| 1520 | CALHMO010000097.1 | GCA938035375_00759 | gene | open | 5732-6493 | |||
| 1521 | CALHMO010000097.1 | GCA938035375_00760 | gene | open | 6510-7262 | |||
| 1522 | CALHMO010000098.1 | GCA938035375_00761 | CDS | open | 345-911 | _na 188_aa | ahpC | alkyl hydroperoxide reductase subunit C |
| 1523 | CALHMO010000098.1 | GCA938035375_00762 | CDS | open | 1031-2140 | _na 369_aa | Transporter | |
| 1524 | CALHMO010000098.1 | GCA938035375_00763 | CDS | open | 2339-2803 | _na 154_aa | N-acetyltransferase domain-containing protein | |
| 1525 | CALHMO010000098.1 | GCA938035375_00764 | CDS | open | 3265-3501 | _na 78_aa | hypothetical protein | |
| 1526 | CALHMO010000098.1 | GCA938035375_00765 | CDS | open | 3691-4230 | _na 179_aa | hypothetical protein | |
| 1527 | CALHMO010000098.1 | GCA938035375_00766 | CDS | open | 4416-5624 | _na 402_aa | tyrS | tyrosine--tRNA ligase |
| 1528 | CALHMO010000098.1 | GCA938035375_00767 | CDS | open | 5877-7154 | _na 425_aa | brnQ | branched-chain amino acid transport system II carrier protein |
| 1529 | CALHMO010000098.1 | GCA938035375_00761 | gene | open | 345-911 | ahpC | ||
| 1530 | CALHMO010000098.1 | GCA938035375_00762 | gene | open | 1031-2140 | |||
| 1531 | CALHMO010000098.1 | GCA938035375_00763 | gene | open | 2339-2803 | |||
| 1532 | CALHMO010000098.1 | GCA938035375_00764 | gene | open | 3265-3501 | |||
| 1533 | CALHMO010000098.1 | GCA938035375_00765 | gene | open | 3691-4230 | |||
| 1534 | CALHMO010000098.1 | GCA938035375_00766 | gene | open | 4416-5624 | tyrS | ||
| 1535 | CALHMO010000098.1 | GCA938035375_00767 | gene | open | 5877-7154 | brnQ | ||
| 1536 | CALHMO010000099.1 | GCA938035375_00768 | CDS | open | 92-796 | _na 234_aa | ygiN | ABM domain-containing protein |
| 1537 | CALHMO010000099.1 | GCA938035375_00769 | CDS | open | 851-1807 | _na 318_aa | DUF2207 domain-containing protein | |
| 1538 | CALHMO010000099.1 | GCA938035375_00770 | CDS | open | 1839-2312 | _na 157_aa | Lipoprotein | |
| 1539 | CALHMO010000099.1 | GCA938035375_00771 | CDS | open | 2465-3193 | _na 242_aa | tauB | ABC transporter domain-containing protein |
| 1540 | CALHMO010000099.1 | GCA938035375_00772 | CDS | open | 3203-4207 | _na 334_aa | tauA | SsuA/THI5-like domain-containing protein |
| 1541 | CALHMO010000099.1 | GCA938035375_00773 | CDS | open | 4194-4505 | _na 103_aa | ABC transporter permease | |
| 1542 | CALHMO010000099.1 | GCA938035375_00768 | gene | open | 92-796 | ygiN | ||
| 1543 | CALHMO010000099.1 | GCA938035375_00769 | gene | open | 851-1807 | |||
| 1544 | CALHMO010000099.1 | GCA938035375_00770 | gene | open | 1839-2312 | |||
| 1545 | CALHMO010000099.1 | GCA938035375_00771 | gene | open | 2465-3193 | tauB | ||
| 1546 | CALHMO010000099.1 | GCA938035375_00772 | gene | open | 3203-4207 | tauA | ||
| 1547 | CALHMO010000099.1 | GCA938035375_00773 | gene | open | 4194-4505 | |||
| 1548 | CALHMO010000100.1 | GCA938035375_00774 | CDS | open | 21-200 | _na 59_aa | hypothetical protein | |
| 1549 | CALHMO010000100.1 | GCA938035375_00775 | CDS | open | 252-1160 | _na 302_aa | type I restriction-modification system subunit M | |
| 1550 | CALHMO010000100.1 | GCA938035375_00776 | CDS | open | 1194-1814 | _na 206_aa | type I restriction-modification system subunit M | |
| 1551 | CALHMO010000100.1 | GCA938035375_00777 | CDS | open | 1982-2749 | _na 255_aa | hypothetical protein | |
| 1552 | CALHMO010000100.1 | GCA938035375_00774 | gene | open | 21-200 | |||
| 1553 | CALHMO010000100.1 | GCA938035375_00775 | gene | open | 252-1160 | |||
| 1554 | CALHMO010000100.1 | GCA938035375_00776 | gene | open | 1194-1814 | |||
| 1555 | CALHMO010000100.1 | GCA938035375_00777 | gene | open | 1982-2749 | |||
| 1556 | CALHMO010000101.1 | GCA938035375_00778 | CDS | open | 111-908 | _na 265_aa | minD | septum site-determining protein MinD |
| 1557 | CALHMO010000101.1 | GCA938035375_00779 | CDS | open | 911-1207 | _na 98_aa | minE | cell division topological specificity factor MinE |
| 1558 | CALHMO010000101.1 | GCA938035375_00780 | CDS | open | 1325-2293 | _na 322_aa | hypothetical protein | |
| 1559 | CALHMO010000101.1 | GCA938035375_00781 | CDS | open | 2322-4259 | _na 645_aa | hypothetical protein | |
| 1560 | CALHMO010000101.1 | GCA938035375_00782 | CDS | open | 4393-4737 | _na 114_aa | Molybdopterin oxidoreductase | |
| 1561 | CALHMO010000101.1 | GCA938035375_00783 | CDS | open | 4737-6002 | _na 421_aa | trxB | FAD/NAD(P)-binding domain-containing protein |
| 1562 | CALHMO010000101.1 | GCA938035375_00784 | CDS | open | 6014-7444 | _na 476_aa | nirB | Glycerol-3-phosphate dehydrogenase |
| 1563 | CALHMO010000101.1 | GCA938035375_00785 | CDS | open | 7602-8117 | _na 171_aa | hrgC | HrgC protein |
| 1564 | CALHMO010000101.1 | GCA938035375_00786 | CDS | open | 8130-8780 | _na 216_aa | hrgC | HrgC protein |
| 1565 | CALHMO010000101.1 | GCA938035375_00787 | CDS | open | 8792-9901 | _na 369_aa | hypothetical protein | |
| 1566 | CALHMO010000101.1 | GCA938035375_00788 | CDS | open | 9957-11264 | _na 435_aa | ybjD | OLD protein-like TOPRIM domain-containing protein |
| 1567 | CALHMO010000101.1 | GCA938035375_00778 | gene | open | 111-908 | minD | ||
| 1568 | CALHMO010000101.1 | GCA938035375_00779 | gene | open | 911-1207 | minE | ||
| 1569 | CALHMO010000101.1 | GCA938035375_00780 | gene | open | 1325-2293 | |||
| 1570 | CALHMO010000101.1 | GCA938035375_00781 | gene | open | 2322-4259 | |||
| 1571 | CALHMO010000101.1 | GCA938035375_00782 | gene | open | 4393-4737 | |||
| 1572 | CALHMO010000101.1 | GCA938035375_00783 | gene | open | 4737-6002 | trxB | ||
| 1573 | CALHMO010000101.1 | GCA938035375_00784 | gene | open | 6014-7444 | nirB | ||
| 1574 | CALHMO010000101.1 | GCA938035375_00785 | gene | open | 7602-8117 | hrgC | ||
| 1575 | CALHMO010000101.1 | GCA938035375_00786 | gene | open | 8130-8780 | hrgC | ||
| 1576 | CALHMO010000101.1 | GCA938035375_00787 | gene | open | 8792-9901 | |||
| 1577 | CALHMO010000101.1 | GCA938035375_00788 | gene | open | 9957-11264 | ybjD | ||
| 1578 | CALHMO010000102.1 | GCA938035375_00789 | CDS | open | 174-2057 | _na 627_aa | mnmG | tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG |
| 1579 | CALHMO010000102.1 | GCA938035375_00790 | CDS | open | 2039-2884 | _na 281_aa | hypothetical protein | |
| 1580 | CALHMO010000102.1 | GCA938035375_00789 | gene | open | 174-2057 | mnmG | ||
| 1581 | CALHMO010000102.1 | GCA938035375_00790 | gene | open | 2039-2884 | |||
| 1582 | CALHMO010000103.1 | GCA938035375_00800 | gene | open | 9621-9965 | ssrA | ||
| 1583 | CALHMO010000103.1 | GCA938035375_00800 | tmRNA | open | 9621-9965 | ssrA | transfer-messenger RNA%2C SsrA | |
| 1584 | CALHMO010000103.1 | GCA938035375_00791 | CDS | open | 319-2070 | _na 583_aa | mdlB | ABC transporter |
| 1585 | CALHMO010000103.1 | GCA938035375_00792 | CDS | open | 2067-3137 | _na 356_aa | lpxB | lipid-A-disaccharide synthase |
| 1586 | CALHMO010000103.1 | GCA938035375_00793 | CDS | open | 3147-3950 | _na 267_aa | lpxI | Septum site-determining protein MinC |
| 1587 | CALHMO010000103.1 | GCA938035375_00794 | CDS | open | 3950-4723 | _na 257_aa | lpxA | acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase |
| 1588 | CALHMO010000103.1 | GCA938035375_00795 | CDS | open | 4741-5166 | _na 141_aa | fabZ | 3-hydroxyacyl-ACP dehydratase FabZ |
| 1589 | CALHMO010000103.1 | GCA938035375_00796 | CDS | open | 5189-6022 | _na 277_aa | lpxC | UDP-3-O-acyl-N-acetylglucosamine deacetylase |
| 1590 | CALHMO010000103.1 | GCA938035375_00797 | CDS | open | 6033-8246 | _na 737_aa | uvrD | DNA 3'-5' helicase |
| 1591 | CALHMO010000103.1 | GCA938035375_00798 | CDS | open | 8476-9150 | _na 224_aa | Flavin reductase | |
| 1592 | CALHMO010000103.1 | GCA938035375_00799 | CDS | open | 9205-9477 | _na 90_aa | hypothetical protein | |
| 1593 | CALHMO010000103.1 | GCA938035375_00801 | CDS | open | 10026-10661 | _na 211_aa | 1-alkyl-2-acetylglycerophosphocholine esterase | |
| 1594 | CALHMO010000103.1 | GCA938035375_00802 | CDS | open | 10663-11229 | _na 188_aa | HAD-IIB family hydrolase | |
| 1595 | CALHMO010000103.1 | GCA938035375_00791 | gene | open | 319-2070 | mdlB | ||
| 1596 | CALHMO010000103.1 | GCA938035375_00792 | gene | open | 2067-3137 | lpxB | ||
| 1597 | CALHMO010000103.1 | GCA938035375_00793 | gene | open | 3147-3950 | lpxI | ||
| 1598 | CALHMO010000103.1 | GCA938035375_00794 | gene | open | 3950-4723 | lpxA | ||
| 1599 | CALHMO010000103.1 | GCA938035375_00795 | gene | open | 4741-5166 | fabZ | ||
| 1600 | CALHMO010000103.1 | GCA938035375_00796 | gene | open | 5189-6022 | lpxC | ||
| 1601 | CALHMO010000103.1 | GCA938035375_00797 | gene | open | 6033-8246 | uvrD | ||
| 1602 | CALHMO010000103.1 | GCA938035375_00798 | gene | open | 8476-9150 | |||
| 1603 | CALHMO010000103.1 | GCA938035375_00799 | gene | open | 9205-9477 | |||
| 1604 | CALHMO010000103.1 | GCA938035375_00801 | gene | open | 10026-10661 | |||
| 1605 | CALHMO010000103.1 | GCA938035375_00802 | gene | open | 10663-11229 | |||
| 1606 | CALHMO010000104.1 | GCA938035375_00803 | CDS | open | 213-1475 | _na 420_aa | ATPase AAA-type core domain-containing protein | |
| 1607 | CALHMO010000104.1 | GCA938035375_00804 | CDS | open | 1499-2119 | _na 206_aa | rloB | RloB domain-containing protein |
| 1608 | CALHMO010000104.1 | GCA938035375_00805 | CDS | open | 2130-3908 | _na 592_aa | ATP-dependent endonuclease | |
| 1609 | CALHMO010000104.1 | GCA938035375_00806 | CDS | open | 3892-5259 | _na 455_aa | UvrD-like helicase ATP-binding domain-containing protein | |
| 1610 | CALHMO010000104.1 | GCA938035375_00803 | gene | open | 213-1475 | |||
| 1611 | CALHMO010000104.1 | GCA938035375_00804 | gene | open | 1499-2119 | rloB | ||
| 1612 | CALHMO010000104.1 | GCA938035375_00805 | gene | open | 2130-3908 | |||
| 1613 | CALHMO010000104.1 | GCA938035375_00806 | gene | open | 3892-5259 | |||
| 1614 | CALHMO010000105.1 | GCA938035375_00807 | CDS | open | 2481-2831 | _na 116_aa | hypothetical protein | |
| 1615 | CALHMO010000105.1 | GCA938035375_00808 | CDS | open | 3237-3428 | _na 63_aa | hypothetical protein | |
| 1616 | CALHMO010000105.1 | GCA938035375_00809 | CDS | open | 5346-5573 | _na 75_aa | hypothetical protein | |
| 1617 | CALHMO010000105.1 | GCA938035375_00807 | gene | open | 2481-2831 | |||
| 1618 | CALHMO010000105.1 | GCA938035375_00808 | gene | open | 3237-3428 | |||
| 1619 | CALHMO010000105.1 | GCA938035375_00809 | gene | open | 5346-5573 | |||
| 1620 | CALHMO010000106.1 | GCA938035375_00810 | CDS | open | 159-944 | _na 261_aa | Beta-lactamase class A catalytic domain-containing protein | |
| 1621 | CALHMO010000106.1 | GCA938035375_00811 | CDS | open | 947-1279 | _na 110_aa | DUF3870 domain-containing protein | |
| 1622 | CALHMO010000106.1 | GCA938035375_00812 | CDS | open | 1283-2734 | _na 483_aa | Copper amine oxidase | |
| 1623 | CALHMO010000106.1 | GCA938035375_00813 | CDS | open | 3066-5402 | _na 778_aa | mutS2 | endonuclease MutS2 |
| 1624 | CALHMO010000106.1 | GCA938035375_00814 | CDS | open | 5378-6073 | _na 231_aa | 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase | |
| 1625 | CALHMO010000106.1 | GCA938035375_00815 | CDS | open | 6092-7510 | _na 472_aa | cysS | cysteine--tRNA ligase |
| 1626 | CALHMO010000106.1 | GCA938035375_00816 | CDS | open | 7498-7887 | _na 129_aa | RNase III domain-containing protein | |
| 1627 | CALHMO010000106.1 | GCA938035375_00817 | CDS | open | 7889-8917 | _na 342_aa | mreB | Cell shape-determining protein MreB |
| 1628 | CALHMO010000106.1 | GCA938035375_00818 | CDS | open | 8919-9788 | _na 289_aa | dnaX | ATPase |
| 1629 | CALHMO010000106.1 | GCA938035375_00819 | CDS | open | 10031-10333 | _na 100_aa | GIY-YIG domain-containing protein | |
| 1630 | CALHMO010000106.1 | GCA938035375_00810 | gene | open | 159-944 | |||
| 1631 | CALHMO010000106.1 | GCA938035375_00811 | gene | open | 947-1279 | |||
| 1632 | CALHMO010000106.1 | GCA938035375_00812 | gene | open | 1283-2734 | |||
| 1633 | CALHMO010000106.1 | GCA938035375_00813 | gene | open | 3066-5402 | mutS2 | ||
| 1634 | CALHMO010000106.1 | GCA938035375_00814 | gene | open | 5378-6073 | |||
| 1635 | CALHMO010000106.1 | GCA938035375_00815 | gene | open | 6092-7510 | cysS | ||
| 1636 | CALHMO010000106.1 | GCA938035375_00816 | gene | open | 7498-7887 | |||
| 1637 | CALHMO010000106.1 | GCA938035375_00817 | gene | open | 7889-8917 | mreB | ||
| 1638 | CALHMO010000106.1 | GCA938035375_00818 | gene | open | 8919-9788 | dnaX | ||
| 1639 | CALHMO010000106.1 | GCA938035375_00819 | gene | open | 10031-10333 | |||
| 1640 | CALHMO010000106.1 | GCA938035375_00820 | gene | open | 10418-10505 | trnL | ||
| 1641 | CALHMO010000106.1 | GCA938035375_00821 | gene | open | 10513-10589 | trnfM | ||
| 1642 | CALHMO010000106.1 | GCA938035375_00820 | tRNA | open | 10418-10505 | trnL | tRNA-Leu(taa) | |
| 1643 | CALHMO010000106.1 | GCA938035375_00821 | tRNA | open | 10513-10589 | trnfM | tRNA-fMet(cat) | |
| 1644 | CALHMO010000107.1 | GCA938035375_00822 | CDS | open | 208-441 | _na 77_aa | hypothetical protein | |
| 1645 | CALHMO010000107.1 | GCA938035375_00823 | CDS | open | 943-1929 | _na 328_aa | xerD | Integrase |
| 1646 | CALHMO010000107.1 | GCA938035375_00824 | CDS | open | 1964-2260 | _na 98_aa | Stress-response A/B barrel domain-containing protein | |
| 1647 | CALHMO010000107.1 | GCA938035375_00825 | CDS | open | 2452-3321 | _na 289_aa | Lipoprotein | |
| 1648 | CALHMO010000107.1 | GCA938035375_00826 | CDS | open | 3322-4941 | _na 539_aa | Tetratricopeptide repeat protein | |
| 1649 | CALHMO010000107.1 | GCA938035375_00827 | CDS | open | 4942-6561 | _na 539_aa | Tetratricopeptide repeat protein | |
| 1650 | CALHMO010000107.1 | GCA938035375_00828 | CDS | open | 6651-7115 | _na 154_aa | sseB | SseB protein N-terminal domain-containing protein |
| 1651 | CALHMO010000107.1 | GCA938035375_00829 | CDS | open | 7416-7715 | _na 99_aa | Secreted protein | |
| 1652 | CALHMO010000107.1 | GCA938035375_00830 | CDS | open | 7775-8569 | _na 264_aa | murI | glutamate racemase |
| 1653 | CALHMO010000107.1 | GCA938035375_00831 | CDS | open | 8641-11907 | _na 1088_aa | hepA | SWF/SNF family helicase |
| 1654 | CALHMO010000107.1 | GCA938035375_00832 | CDS | open | 11971-13011 | _na 346_aa | glpX | class II fructose-bisphosphatase |
| 1655 | CALHMO010000107.1 | GCA938035375_00833 | CDS | open | 13008-13322 | _na 104_aa | Septum formation initiator subfamily | |
| 1656 | CALHMO010000107.1 | GCA938035375_00834 | CDS | open | 13315-13839 | _na 174_aa | def | peptide deformylase |
| 1657 | CALHMO010000107.1 | GCA938035375_00835 | CDS | open | 13849-16149 | _na 766_aa | Primosomal protein N' | |
| 1658 | CALHMO010000107.1 | GCA938035375_00836 | CDS | open | 16165-18339 | _na 724_aa | ftsI | PASTA domain-containing protein |
| 1659 | CALHMO010000107.1 | GCA938035375_00837 | CDS | open | 18323-19573 | _na 416_aa | brkB | YihY family protein |
| 1660 | CALHMO010000107.1 | GCA938035375_00838 | CDS | open | 19589-19918 | _na 109_aa | Aminotransferase | |
| 1661 | CALHMO010000107.1 | GCA938035375_00839 | CDS | open | 19936-21126 | _na 396_aa | aspB | Aminotransferase |
| 1662 | CALHMO010000107.1 | GCA938035375_00822 | gene | open | 208-441 | |||
| 1663 | CALHMO010000107.1 | GCA938035375_00823 | gene | open | 943-1929 | xerD | ||
| 1664 | CALHMO010000107.1 | GCA938035375_00824 | gene | open | 1964-2260 | |||
| 1665 | CALHMO010000107.1 | GCA938035375_00825 | gene | open | 2452-3321 | |||
| 1666 | CALHMO010000107.1 | GCA938035375_00826 | gene | open | 3322-4941 | |||
| 1667 | CALHMO010000107.1 | GCA938035375_00827 | gene | open | 4942-6561 | |||
| 1668 | CALHMO010000107.1 | GCA938035375_00828 | gene | open | 6651-7115 | sseB | ||
| 1669 | CALHMO010000107.1 | GCA938035375_00829 | gene | open | 7416-7715 | |||
| 1670 | CALHMO010000107.1 | GCA938035375_00830 | gene | open | 7775-8569 | murI | ||
| 1671 | CALHMO010000107.1 | GCA938035375_00831 | gene | open | 8641-11907 | hepA | ||
| 1672 | CALHMO010000107.1 | GCA938035375_00832 | gene | open | 11971-13011 | glpX | ||
| 1673 | CALHMO010000107.1 | GCA938035375_00833 | gene | open | 13008-13322 | |||
| 1674 | CALHMO010000107.1 | GCA938035375_00834 | gene | open | 13315-13839 | def | ||
| 1675 | CALHMO010000107.1 | GCA938035375_00835 | gene | open | 13849-16149 | |||
| 1676 | CALHMO010000107.1 | GCA938035375_00836 | gene | open | 16165-18339 | ftsI | ||
| 1677 | CALHMO010000107.1 | GCA938035375_00837 | gene | open | 18323-19573 | brkB | ||
| 1678 | CALHMO010000107.1 | GCA938035375_00838 | gene | open | 19589-19918 | |||
| 1679 | CALHMO010000107.1 | GCA938035375_00839 | gene | open | 19936-21126 | aspB | ||
| 1680 | CALHMO010000108.1 | GCA938035375_00840 | CDS | open | 148-330 | _na 60_aa | hypothetical protein | |
| 1681 | CALHMO010000108.1 | GCA938035375_00841 | CDS | open | 389-568 | _na 59_aa | hypothetical protein | |
| 1682 | CALHMO010000108.1 | GCA938035375_00842 | CDS | open | 561-827 | _na 88_aa | Txe/YoeB family addiction module toxin | |
| 1683 | CALHMO010000108.1 | GCA938035375_00843 | CDS | open | 853-1074 | _na 73_aa | gspE | Type II secretion system protein GspE N-terminal domain-containing protein |
| 1684 | CALHMO010000108.1 | GCA938035375_00844 | CDS | open | 1191-1847 | _na 218_aa | Recombinase | |
| 1685 | CALHMO010000108.1 | GCA938035375_00845 | CDS | open | 1859-2131 | _na 90_aa | hypothetical protein | |
| 1686 | CALHMO010000108.1 | GCA938035375_00846 | CDS | open | 2419-2679 | _na 86_aa | hypothetical protein | |
| 1687 | CALHMO010000108.1 | GCA938035375_00847 | CDS | open | 3746-4087 | _na 113_aa | hypothetical protein | |
| 1688 | CALHMO010000108.1 | GCA938035375_00848 | CDS | open | 5009-5254 | _na 81_aa | Helix-turn-helix type 11 domain-containing protein | |
| 1689 | CALHMO010000108.1 | GCA938035375_00840 | gene | open | 148-330 | |||
| 1690 | CALHMO010000108.1 | GCA938035375_00841 | gene | open | 389-568 | |||
| 1691 | CALHMO010000108.1 | GCA938035375_00842 | gene | open | 561-827 | |||
| 1692 | CALHMO010000108.1 | GCA938035375_00843 | gene | open | 853-1074 | gspE | ||
| 1693 | CALHMO010000108.1 | GCA938035375_00844 | gene | open | 1191-1847 | |||
| 1694 | CALHMO010000108.1 | GCA938035375_00845 | gene | open | 1859-2131 | |||
| 1695 | CALHMO010000108.1 | GCA938035375_00846 | gene | open | 2419-2679 | |||
| 1696 | CALHMO010000108.1 | GCA938035375_00847 | gene | open | 3746-4087 | |||
| 1697 | CALHMO010000108.1 | GCA938035375_00848 | gene | open | 5009-5254 | |||
| 1698 | CALHMO010000109.1 | GCA938035375_00849 | CDS | open | 38-1486 | _na 482_aa | hypothetical protein | |
| 1699 | CALHMO010000109.1 | GCA938035375_00850 | CDS | open | 1520-1735 | _na 71_aa | hypothetical protein | |
| 1700 | CALHMO010000109.1 | GCA938035375_00851 | CDS | open | 1772-2365 | _na 197_aa | Putative lipoprotein | |
| 1701 | CALHMO010000109.1 | GCA938035375_00852 | CDS | open | 2386-2781 | _na 131_aa | hypothetical protein | |
| 1702 | CALHMO010000109.1 | GCA938035375_00853 | CDS | open | 2805-3203 | _na 132_aa | hypothetical protein | |
| 1703 | CALHMO010000109.1 | GCA938035375_00854 | CDS | open | 3317-4153 | _na 278_aa | hypothetical protein | |
| 1704 | CALHMO010000109.1 | GCA938035375_00849 | gene | open | 38-1486 | |||
| 1705 | CALHMO010000109.1 | GCA938035375_00850 | gene | open | 1520-1735 | |||
| 1706 | CALHMO010000109.1 | GCA938035375_00851 | gene | open | 1772-2365 | |||
| 1707 | CALHMO010000109.1 | GCA938035375_00852 | gene | open | 2386-2781 | |||
| 1708 | CALHMO010000109.1 | GCA938035375_00853 | gene | open | 2805-3203 | |||
| 1709 | CALHMO010000109.1 | GCA938035375_00854 | gene | open | 3317-4153 | |||
| 1710 | CALHMO010000110.1 | GCA938035375_00855 | CDS | open | 1154-2452 | _na 432_aa | Nucleotide sugar dehydrogenase | |
| 1711 | CALHMO010000110.1 | GCA938035375_00856 | CDS | open | 2472-3068 | _na 198_aa | Sugar transferase | |
| 1712 | CALHMO010000110.1 | GCA938035375_00857 | CDS | open | 3068-4234 | _na 388_aa | DegT/DnrJ/EryC1/StrS family protein | |
| 1713 | CALHMO010000110.1 | GCA938035375_00858 | CDS | open | 4231-6042 | _na 603_aa | Polysaccharide biosynthesis protein | |
| 1714 | CALHMO010000110.1 | GCA938035375_00859 | CDS | open | 6059-6607 | _na 182_aa | hypothetical protein | |
| 1715 | CALHMO010000110.1 | GCA938035375_00855 | gene | open | 1154-2452 | |||
| 1716 | CALHMO010000110.1 | GCA938035375_00856 | gene | open | 2472-3068 | |||
| 1717 | CALHMO010000110.1 | GCA938035375_00857 | gene | open | 3068-4234 | |||
| 1718 | CALHMO010000110.1 | GCA938035375_00858 | gene | open | 4231-6042 | |||
| 1719 | CALHMO010000110.1 | GCA938035375_00859 | gene | open | 6059-6607 | |||
| 1720 | CALHMO010000111.1 | GCA938035375_00860 | CDS | open | 708-1604 | _na 298_aa | nadA | quinolinate synthase NadA |
| 1721 | CALHMO010000111.1 | GCA938035375_00860 | gene | open | 708-1604 | nadA | ||
| 1722 | CALHMO010000112.1 | regulatory_region | open | 23135-23247 | Fusobacteriales-1 RNA | |||
| 1723 | CALHMO010000112.1 | GCA938035375_00861 | CDS | open | 131-928 | _na 265_aa | tcmP | Tetracenomycin polyketide synthesis O-methyltransferase TcmP |
| 1724 | CALHMO010000112.1 | GCA938035375_00862 | CDS | open | 1118-1543 | _na 141_aa | Lysozyme inhibitor LprI-like N-terminal domain-containing protein | |
| 1725 | CALHMO010000112.1 | GCA938035375_00863 | CDS | open | 1612-2013 | _na 133_aa | Pyridoxamine 5'-phosphate oxidase N-terminal domain-containing protein | |
| 1726 | CALHMO010000112.1 | GCA938035375_00864 | CDS | open | 2208-3008 | _na 266_aa | Cof-like hydrolase | |
| 1727 | CALHMO010000112.1 | GCA938035375_00865 | CDS | open | 3043-3936 | _na 297_aa | ygiQ | Radical SAM core domain-containing protein |
| 1728 | CALHMO010000112.1 | GCA938035375_00866 | CDS | open | 3947-5749 | _na 600_aa | pgaB | NodB-like y domain-containing protein |
| 1729 | CALHMO010000112.1 | GCA938035375_00867 | CDS | open | 5826-6806 | _na 326_aa | Knr4/Smi1-like domain-containing protein | |
| 1730 | CALHMO010000112.1 | GCA938035375_00868 | CDS | open | 6812-7672 | _na 286_aa | rhaT | EamA domain-containing protein |
| 1731 | CALHMO010000112.1 | GCA938035375_00869 | CDS | open | 7855-9384 | _na 509_aa | ddpA | Solute-binding protein family 5 domain-containing protein |
| 1732 | CALHMO010000112.1 | GCA938035375_00870 | CDS | open | 9467-10393 | _na 308_aa | nikB | nickel ABC transporter permease |
| 1733 | CALHMO010000112.1 | GCA938035375_00871 | CDS | open | 10403-11272 | _na 289_aa | dppC | ABC transmembrane type-1 domain-containing protein |
| 1734 | CALHMO010000112.1 | GCA938035375_00872 | CDS | open | 11291-12298 | _na 335_aa | dppD | Nickel import system ATP-binding protein NikD |
| 1735 | CALHMO010000112.1 | GCA938035375_00873 | CDS | open | 12291-13265 | _na 324_aa | dppD | ABC transporter domain-containing protein |
| 1736 | CALHMO010000112.1 | GCA938035375_00874 | CDS | open | 13763-13951 | _na 62_aa | hypothetical protein | |
| 1737 | CALHMO010000112.1 | GCA938035375_00875 | CDS | open | 14103-14288 | _na 61_aa | hypothetical protein | |
| 1738 | CALHMO010000112.1 | GCA938035375_00876 | CDS | open | 14381-14629 | _na 82_aa | hypothetical protein | |
| 1739 | CALHMO010000112.1 | GCA938035375_00877 | CDS | open | 14761-14883 | _na 40_aa | hypothetical protein | |
| 1740 | CALHMO010000112.1 | GCA938035375_00878 | CDS | open | 15047-15475 | _na 142_aa | hypothetical protein | |
| 1741 | CALHMO010000112.1 | GCA938035375_00879 | CDS | open | 15662-15865 | _na 67_aa | Phage minor structural protein GP20 | |
| 1742 | CALHMO010000112.1 | GCA938035375_00880 | CDS | open | 15981-16241 | _na 86_aa | Txe/YoeB family addiction module toxin | |
| 1743 | CALHMO010000112.1 | GCA938035375_00881 | CDS | open | 16241-16507 | _na 88_aa | Damage-inducible protein J | |
| 1744 | CALHMO010000112.1 | GCA938035375_00882 | CDS | open | 16934-17275 | _na 113_aa | hypothetical protein | |
| 1745 | CALHMO010000112.1 | GCA938035375_00883 | CDS | open | 17370-17996 | _na 208_aa | hypothetical protein | |
| 1746 | CALHMO010000112.1 | GCA938035375_00884 | CDS | open | 18123-18575 | _na 150_aa | Lipoprotein | |
| 1747 | CALHMO010000112.1 | GCA938035375_00885 | CDS | open | 18623-20191 | _na 522_aa | hypothetical protein | |
| 1748 | CALHMO010000112.1 | GCA938035375_00886 | CDS | open | 20545-21111 | _na 188_aa | helix-turn-helix transcriptional regulator | |
| 1749 | CALHMO010000112.1 | GCA938035375_00887 | CDS | open | 21300-22355 | _na 351_aa | site-specific integrase | |
| 1750 | CALHMO010000112.1 | GCA938035375_00888 | CDS | open | 22601-23077 | _na 158_aa | Type II toxin-antitoxin system PemK/MazF family toxin | |
| 1751 | CALHMO010000112.1 | GCA938035375_00889 | CDS | open | 23431-23673 | _na 80_aa | hypothetical protein | |
| 1752 | CALHMO010000112.1 | GCA938035375_00890 | CDS | open | 23829-24266 | _na 145_aa | hypothetical protein | |
| 1753 | CALHMO010000112.1 | GCA938035375_00891 | CDS | open | 24519-24662 | _na 47_aa | hypothetical protein | |
| 1754 | CALHMO010000112.1 | GCA938035375_00892 | CDS | open | 24721-25113 | _na 130_aa | hypothetical protein | |
| 1755 | CALHMO010000112.1 | GCA938035375_00893 | CDS | open | 25140-25271 | _na 43_aa | hypothetical protein | |
| 1756 | CALHMO010000112.1 | GCA938035375_00861 | gene | open | 131-928 | tcmP | ||
| 1757 | CALHMO010000112.1 | GCA938035375_00862 | gene | open | 1118-1543 | |||
| 1758 | CALHMO010000112.1 | GCA938035375_00863 | gene | open | 1612-2013 | |||
| 1759 | CALHMO010000112.1 | GCA938035375_00864 | gene | open | 2208-3008 | |||
| 1760 | CALHMO010000112.1 | GCA938035375_00865 | gene | open | 3043-3936 | ygiQ | ||
| 1761 | CALHMO010000112.1 | GCA938035375_00866 | gene | open | 3947-5749 | pgaB | ||
| 1762 | CALHMO010000112.1 | GCA938035375_00867 | gene | open | 5826-6806 | |||
| 1763 | CALHMO010000112.1 | GCA938035375_00868 | gene | open | 6812-7672 | rhaT | ||
| 1764 | CALHMO010000112.1 | GCA938035375_00869 | gene | open | 7855-9384 | ddpA | ||
| 1765 | CALHMO010000112.1 | GCA938035375_00870 | gene | open | 9467-10393 | nikB | ||
| 1766 | CALHMO010000112.1 | GCA938035375_00871 | gene | open | 10403-11272 | dppC | ||
| 1767 | CALHMO010000112.1 | GCA938035375_00872 | gene | open | 11291-12298 | dppD | ||
| 1768 | CALHMO010000112.1 | GCA938035375_00873 | gene | open | 12291-13265 | dppD | ||
| 1769 | CALHMO010000112.1 | GCA938035375_00874 | gene | open | 13763-13951 | |||
| 1770 | CALHMO010000112.1 | GCA938035375_00875 | gene | open | 14103-14288 | |||
| 1771 | CALHMO010000112.1 | GCA938035375_00876 | gene | open | 14381-14629 | |||
| 1772 | CALHMO010000112.1 | GCA938035375_00877 | gene | open | 14761-14883 | |||
| 1773 | CALHMO010000112.1 | GCA938035375_00878 | gene | open | 15047-15475 | |||
| 1774 | CALHMO010000112.1 | GCA938035375_00879 | gene | open | 15662-15865 | |||
| 1775 | CALHMO010000112.1 | GCA938035375_00880 | gene | open | 15981-16241 | |||
| 1776 | CALHMO010000112.1 | GCA938035375_00881 | gene | open | 16241-16507 | |||
| 1777 | CALHMO010000112.1 | GCA938035375_00882 | gene | open | 16934-17275 | |||
| 1778 | CALHMO010000112.1 | GCA938035375_00883 | gene | open | 17370-17996 | |||
| 1779 | CALHMO010000112.1 | GCA938035375_00884 | gene | open | 18123-18575 | |||
| 1780 | CALHMO010000112.1 | GCA938035375_00885 | gene | open | 18623-20191 | |||
| 1781 | CALHMO010000112.1 | GCA938035375_00886 | gene | open | 20545-21111 | |||
| 1782 | CALHMO010000112.1 | GCA938035375_00887 | gene | open | 21300-22355 | |||
| 1783 | CALHMO010000112.1 | GCA938035375_00888 | gene | open | 22601-23077 | |||
| 1784 | CALHMO010000112.1 | GCA938035375_00889 | gene | open | 23431-23673 | |||
| 1785 | CALHMO010000112.1 | GCA938035375_00890 | gene | open | 23829-24266 | |||
| 1786 | CALHMO010000112.1 | GCA938035375_00891 | gene | open | 24519-24662 | |||
| 1787 | CALHMO010000112.1 | GCA938035375_00892 | gene | open | 24721-25113 | |||
| 1788 | CALHMO010000112.1 | GCA938035375_00893 | gene | open | 25140-25271 | |||
| 1789 | CALHMO010000113.1 | GCA938035375_00894 | CDS | open | 172-933 | _na 253_aa | 3-methyl-2-oxobutanoate hydroxymethyltransferase | |
| 1790 | CALHMO010000113.1 | GCA938035375_00895 | CDS | open | 930-1793 | _na 287_aa | HTH lysR-type domain-containing protein | |
| 1791 | CALHMO010000113.1 | GCA938035375_00896 | CDS | open | 1810-3162 | _na 450_aa | aconitase family protein | |
| 1792 | CALHMO010000113.1 | GCA938035375_00894 | gene | open | 172-933 | |||
| 1793 | CALHMO010000113.1 | GCA938035375_00895 | gene | open | 930-1793 | |||
| 1794 | CALHMO010000113.1 | GCA938035375_00896 | gene | open | 1810-3162 | |||
| 1795 | CALHMO010000114.1 | GCA938035375_00897 | CDS | open | 184-1512 | _na 442_aa | hgdB | R-phenyllactate dehydratase%2C medium subunit |
| 1796 | CALHMO010000114.1 | GCA938035375_00898 | CDS | open | 1534-2682 | _na 382_aa | hgdB | (R)-2-hydroxyglutaryl-CoA dehydratase beta subunit |
| 1797 | CALHMO010000114.1 | GCA938035375_00899 | CDS | open | 2693-3286 | _na 197_aa | Leucine-rich repeat domain-containing protein | |
| 1798 | CALHMO010000114.1 | GCA938035375_00897 | gene | open | 184-1512 | hgdB | ||
| 1799 | CALHMO010000114.1 | GCA938035375_00898 | gene | open | 1534-2682 | hgdB | ||
| 1800 | CALHMO010000114.1 | GCA938035375_00899 | gene | open | 2693-3286 | |||
| 1801 | CALHMO010000115.1 | GCA938035375_00901 | CDS | open | 207-305 | _na 32_aa | hypothetical protein | |
| 1802 | CALHMO010000115.1 | GCA938035375_00902 | CDS | open | 367-1680 | _na 437_aa | Radical SAM core domain-containing protein | |
| 1803 | CALHMO010000115.1 | GCA938035375_00901 | gene | open | 207-305 | |||
| 1804 | CALHMO010000115.1 | GCA938035375_00902 | gene | open | 367-1680 | |||
| 1805 | CALHMO010000115.1 | GCA938035375_00900 | gene | open | 59-134 | trnN | ||
| 1806 | CALHMO010000115.1 | GCA938035375_00900 | tRNA | open | 59-134 | trnN | tRNA-Asn(gtt) | |
| 1807 | CALHMO010000116.1 | regulatory_region | open | 8807-8912 | TPP riboswitch aptamer (THI element) | |||
| 1808 | CALHMO010000116.1 | GCA938035375_00903 | CDS | open | 101-2017 | _na 638_aa | V-type ATP synthase subunit I | |
| 1809 | CALHMO010000116.1 | GCA938035375_00904 | CDS | open | 2004-2345 | _na 113_aa | V-type sodium ATP synthase subunit G | |
| 1810 | CALHMO010000116.1 | GCA938035375_00905 | CDS | open | 2501-3121 | _na 206_aa | Thiamine-phosphate pyrophosphorylase | |
| 1811 | CALHMO010000116.1 | GCA938035375_00906 | CDS | open | 3124-4254 | _na 376_aa | thiH | 2-iminoacetate synthase ThiH |
| 1812 | CALHMO010000116.1 | GCA938035375_00907 | CDS | open | 4254-5027 | _na 257_aa | thiG | Thiazole synthase |
| 1813 | CALHMO010000116.1 | GCA938035375_00908 | CDS | open | 5074-5709 | _na 211_aa | thiF | sulfur carrier protein ThiS adenylyltransferase ThiF |
| 1814 | CALHMO010000116.1 | GCA938035375_00909 | CDS | open | 5713-5907 | _na 64_aa | thiS | sulfur carrier protein ThiS |
| 1815 | CALHMO010000116.1 | GCA938035375_00910 | CDS | open | 5920-7221 | _na 433_aa | thiC | phosphomethylpyrimidine synthase ThiC |
| 1816 | CALHMO010000116.1 | GCA938035375_00911 | CDS | open | 7238-7858 | _na 206_aa | thiE | Thiamine-phosphate synthase |
| 1817 | CALHMO010000116.1 | GCA938035375_00912 | CDS | open | 7907-8740 | _na 277_aa | thiD | hydroxymethylpyrimidine kinase |
| 1818 | CALHMO010000116.1 | GCA938035375_00903 | gene | open | 101-2017 | |||
| 1819 | CALHMO010000116.1 | GCA938035375_00904 | gene | open | 2004-2345 | |||
| 1820 | CALHMO010000116.1 | GCA938035375_00905 | gene | open | 2501-3121 | |||
| 1821 | CALHMO010000116.1 | GCA938035375_00906 | gene | open | 3124-4254 | thiH | ||
| 1822 | CALHMO010000116.1 | GCA938035375_00907 | gene | open | 4254-5027 | thiG | ||
| 1823 | CALHMO010000116.1 | GCA938035375_00908 | gene | open | 5074-5709 | thiF | ||
| 1824 | CALHMO010000116.1 | GCA938035375_00909 | gene | open | 5713-5907 | thiS | ||
| 1825 | CALHMO010000116.1 | GCA938035375_00910 | gene | open | 5920-7221 | thiC | ||
| 1826 | CALHMO010000116.1 | GCA938035375_00911 | gene | open | 7238-7858 | thiE | ||
| 1827 | CALHMO010000116.1 | GCA938035375_00912 | gene | open | 7907-8740 | thiD | ||
| 1828 | CALHMO010000117.1 | GCA938035375_00913 | CDS | open | 5-802 | _na 265_aa | Tripartite tricarboxylate transporter substrate binding protein | |
| 1829 | CALHMO010000117.1 | GCA938035375_00914 | CDS | open | 819-1292 | _na 157_aa | tctB | Tripartite tricarboxylate transporter TctB family protein |
| 1830 | CALHMO010000117.1 | GCA938035375_00915 | CDS | open | 1303-2775 | _na 490_aa | Tat pathway signal protein | |
| 1831 | CALHMO010000117.1 | GCA938035375_00916 | CDS | open | 2818-3756 | _na 312_aa | lysR | LysR family transcriptional regulator |
| 1832 | CALHMO010000117.1 | GCA938035375_00917 | CDS | open | 3783-4619 | _na 278_aa | Regulator of ribonuclease activity-like protein | |
| 1833 | CALHMO010000117.1 | GCA938035375_00918 | CDS | open | 4636-5589 | _na 317_aa | Hydroxyacid dehydrogenase | |
| 1834 | CALHMO010000117.1 | GCA938035375_00919 | CDS | open | 6022-6378 | _na 118_aa | DUF1016 domain-containing protein | |
| 1835 | CALHMO010000117.1 | GCA938035375_00920 | CDS | open | 6382-6801 | _na 139_aa | HicB-like antitoxin of toxin-antitoxin system domain-containing protein | |
| 1836 | CALHMO010000117.1 | GCA938035375_00921 | CDS | open | 6931-7233 | _na 100_aa | DUF4298 domain-containing protein | |
| 1837 | CALHMO010000117.1 | GCA938035375_00922 | CDS | open | 7330-8595 | _na 421_aa | serS | serine--tRNA ligase |
| 1838 | CALHMO010000117.1 | GCA938035375_00923 | CDS | open | 8579-9055 | _na 158_aa | Cobalt transport protein | |
| 1839 | CALHMO010000117.1 | GCA938035375_00913 | gene | open | 5-802 | |||
| 1840 | CALHMO010000117.1 | GCA938035375_00914 | gene | open | 819-1292 | tctB | ||
| 1841 | CALHMO010000117.1 | GCA938035375_00915 | gene | open | 1303-2775 | |||
| 1842 | CALHMO010000117.1 | GCA938035375_00916 | gene | open | 2818-3756 | lysR | ||
| 1843 | CALHMO010000117.1 | GCA938035375_00917 | gene | open | 3783-4619 | |||
| 1844 | CALHMO010000117.1 | GCA938035375_00918 | gene | open | 4636-5589 | |||
| 1845 | CALHMO010000117.1 | GCA938035375_00919 | gene | open | 6022-6378 | |||
| 1846 | CALHMO010000117.1 | GCA938035375_00920 | gene | open | 6382-6801 | |||
| 1847 | CALHMO010000117.1 | GCA938035375_00921 | gene | open | 6931-7233 | |||
| 1848 | CALHMO010000117.1 | GCA938035375_00922 | gene | open | 7330-8595 | serS | ||
| 1849 | CALHMO010000117.1 | GCA938035375_00923 | gene | open | 8579-9055 | |||
| 1850 | CALHMO010000118.1 | regulatory_region | open | 5172-5345 | Cobalamin riboswitch aptamer | |||
| 1851 | CALHMO010000118.1 | GCA938035375_00924 | CDS | open | 208-981 | _na 257_aa | fepC | ABC transporter domain-containing protein |
| 1852 | CALHMO010000118.1 | GCA938035375_00925 | CDS | open | 966-2003 | _na 345_aa | fepD | Iron ABC transporter |
| 1853 | CALHMO010000118.1 | GCA938035375_00926 | CDS | open | 2003-2899 | _na 298_aa | fepB | Fe/B12 periplasmic-binding domain-containing protein |
| 1854 | CALHMO010000118.1 | GCA938035375_00927 | CDS | open | 3125-5098 | _na 657_aa | fepA | Hemin receptor |
| 1855 | CALHMO010000118.1 | GCA938035375_00928 | CDS | open | 5529-5900 | _na 123_aa | HTH merR-type domain-containing protein | |
| 1856 | CALHMO010000118.1 | GCA938035375_00929 | CDS | open | 5982-6788 | _na 268_aa | Oxidoreductase | |
| 1857 | CALHMO010000118.1 | GCA938035375_00930 | CDS | open | 6846-7223 | _na 125_aa | ridA | Reactive intermediate/imine deaminase |
| 1858 | CALHMO010000118.1 | GCA938035375_00931 | CDS | open | 7317-9101 | _na 594_aa | DUF3427 domain-containing protein | |
| 1859 | CALHMO010000118.1 | GCA938035375_00924 | gene | open | 208-981 | fepC | ||
| 1860 | CALHMO010000118.1 | GCA938035375_00925 | gene | open | 966-2003 | fepD | ||
| 1861 | CALHMO010000118.1 | GCA938035375_00926 | gene | open | 2003-2899 | fepB | ||
| 1862 | CALHMO010000118.1 | GCA938035375_00927 | gene | open | 3125-5098 | fepA | ||
| 1863 | CALHMO010000118.1 | GCA938035375_00928 | gene | open | 5529-5900 | |||
| 1864 | CALHMO010000118.1 | GCA938035375_00929 | gene | open | 5982-6788 | |||
| 1865 | CALHMO010000118.1 | GCA938035375_00930 | gene | open | 6846-7223 | ridA | ||
| 1866 | CALHMO010000118.1 | GCA938035375_00931 | gene | open | 7317-9101 | |||
| 1867 | CALHMO010000119.1 | repeat_region | open | 5477-6749 | CRISPR array with 20 repeats of length 30%2C consensus sequence ATTTCAAAACTTTTCAAGTTTTTAGTTCAT and spacer length 35 | |||
| 1868 | CALHMO010000119.1 | GCA938035375_00932 | CDS | open | 152-511 | _na 119_aa | NTP pyrophosphohydrolase MazG-like domain-containing protein | |
| 1869 | CALHMO010000119.1 | GCA938035375_00933 | CDS | open | 521-1909 | _na 462_aa | pepP | Xaa-Pro aminopeptidase |
| 1870 | CALHMO010000119.1 | GCA938035375_00934 | CDS | open | 2053-2580 | _na 175_aa | Appr-1-p processing enzyme domain protein | |
| 1871 | CALHMO010000119.1 | GCA938035375_00935 | CDS | open | 2589-3953 | _na 454_aa | Amino acid carrier protein | |
| 1872 | CALHMO010000119.1 | GCA938035375_00936 | CDS | open | 3959-4693 | _na 244_aa | GP-PDE domain-containing protein | |
| 1873 | CALHMO010000119.1 | GCA938035375_00937 | CDS | open | 4889-5143 | _na 84_aa | hypothetical protein | |
| 1874 | CALHMO010000119.1 | GCA938035375_00932 | gene | open | 152-511 | |||
| 1875 | CALHMO010000119.1 | GCA938035375_00933 | gene | open | 521-1909 | pepP | ||
| 1876 | CALHMO010000119.1 | GCA938035375_00934 | gene | open | 2053-2580 | |||
| 1877 | CALHMO010000119.1 | GCA938035375_00935 | gene | open | 2589-3953 | |||
| 1878 | CALHMO010000119.1 | GCA938035375_00936 | gene | open | 3959-4693 | |||
| 1879 | CALHMO010000119.1 | GCA938035375_00937 | gene | open | 4889-5143 | |||
| 1880 | CALHMO010000120.1 | GCA938035375_00938 | CDS | open | 85-1215 | _na 376_aa | NAD-dependent malic enzyme 3 family protein | |
| 1881 | CALHMO010000120.1 | GCA938035375_00939 | CDS | open | 1240-2205 | _na 321_aa | Malate permease | |
| 1882 | CALHMO010000120.1 | GCA938035375_00940 | CDS | open | 2230-2757 | _na 175_aa | nfnB | Oxygen-insensitive NAD(P)H nitroreductase |
| 1883 | CALHMO010000120.1 | GCA938035375_00941 | CDS | open | 2834-3700 | _na 288_aa | ywqG | YwqG family protein |
| 1884 | CALHMO010000120.1 | GCA938035375_00942 | CDS | open | 3841-4350 | _na 169_aa | YcxB-like protein domain-containing protein | |
| 1885 | CALHMO010000120.1 | GCA938035375_00943 | CDS | open | 4390-5310 | _na 306_aa | cysK | cysteine synthase A |
| 1886 | CALHMO010000120.1 | GCA938035375_00944 | CDS | open | 5602-6057 | _na 151_aa | hypothetical protein | |
| 1887 | CALHMO010000120.1 | GCA938035375_00938 | gene | open | 85-1215 | |||
| 1888 | CALHMO010000120.1 | GCA938035375_00939 | gene | open | 1240-2205 | |||
| 1889 | CALHMO010000120.1 | GCA938035375_00940 | gene | open | 2230-2757 | nfnB | ||
| 1890 | CALHMO010000120.1 | GCA938035375_00941 | gene | open | 2834-3700 | ywqG | ||
| 1891 | CALHMO010000120.1 | GCA938035375_00942 | gene | open | 3841-4350 | |||
| 1892 | CALHMO010000120.1 | GCA938035375_00943 | gene | open | 4390-5310 | cysK | ||
| 1893 | CALHMO010000120.1 | GCA938035375_00944 | gene | open | 5602-6057 | |||
| 1894 | CALHMO010000121.1 | GCA938035375_00945 | CDS | open | 107-1093 | _na 328_aa | dhaK | dihydroxyacetone kinase subunit DhaK |
| 1895 | CALHMO010000121.1 | GCA938035375_00946 | CDS | open | 1213-2706 | _na 497_aa | glpK | glycerol kinase GlpK |
| 1896 | CALHMO010000121.1 | GCA938035375_00947 | CDS | open | 2725-3456 | _na 243_aa | glpF | Glycerol uptake facilitator protein |
| 1897 | CALHMO010000121.1 | GCA938035375_00948 | CDS | open | 3627-5024 | _na 465_aa | Aldehyde dehydrogenase domain-containing protein | |
| 1898 | CALHMO010000121.1 | GCA938035375_00949 | CDS | open | 5040-5981 | _na 313_aa | dhaG | DhaG protein |
| 1899 | CALHMO010000121.1 | GCA938035375_00950 | CDS | open | 5991-6260 | _na 89_aa | eutN | Ethanolamine utilization protein EutN |
| 1900 | CALHMO010000121.1 | GCA938035375_00951 | CDS | open | 6276-6986 | _na 236_aa | Flavoprotein domain-containing protein | |
| 1901 | CALHMO010000121.1 | GCA938035375_00952 | CDS | open | 7000-7620 | _na 206_aa | Phosphate propanoyltransferase | |
| 1902 | CALHMO010000121.1 | GCA938035375_00953 | CDS | open | 7634-7912 | _na 92_aa | ccmK | Propanediol utilization microcompartment protein PduA |
| 1903 | CALHMO010000121.1 | GCA938035375_00954 | CDS | open | 7930-8361 | _na 143_aa | BMC domain-containing protein | |
| 1904 | CALHMO010000121.1 | GCA938035375_00955 | CDS | open | 8396-8773 | _na 125_aa | Propanediol dehydratase | |
| 1905 | CALHMO010000121.1 | GCA938035375_00956 | CDS | open | 8773-10587 | _na 604_aa | diol dehydratase reactivase subunit alpha | |
| 1906 | CALHMO010000121.1 | GCA938035375_00957 | CDS | open | 10609-11118 | _na 169_aa | Propanediol dehydratase small subunit | |
| 1907 | CALHMO010000121.1 | GCA938035375_00958 | CDS | open | 11132-11809 | _na 225_aa | Propanediol dehydratase medium subunit | |
| 1908 | CALHMO010000121.1 | GCA938035375_00959 | CDS | open | 11825-13489 | _na 554_aa | Diol/glycerol dehydratase large subunit domain-containing protein | |
| 1909 | CALHMO010000121.1 | GCA938035375_00960 | CDS | open | 13512-14318 | _na 268_aa | pduB | propanediol utilization microcompartment protein PduB |
| 1910 | CALHMO010000121.1 | GCA938035375_00945 | gene | open | 107-1093 | dhaK | ||
| 1911 | CALHMO010000121.1 | GCA938035375_00946 | gene | open | 1213-2706 | glpK | ||
| 1912 | CALHMO010000121.1 | GCA938035375_00947 | gene | open | 2725-3456 | glpF | ||
| 1913 | CALHMO010000121.1 | GCA938035375_00948 | gene | open | 3627-5024 | |||
| 1914 | CALHMO010000121.1 | GCA938035375_00949 | gene | open | 5040-5981 | dhaG | ||
| 1915 | CALHMO010000121.1 | GCA938035375_00950 | gene | open | 5991-6260 | eutN | ||
| 1916 | CALHMO010000121.1 | GCA938035375_00951 | gene | open | 6276-6986 | |||
| 1917 | CALHMO010000121.1 | GCA938035375_00952 | gene | open | 7000-7620 | |||
| 1918 | CALHMO010000121.1 | GCA938035375_00953 | gene | open | 7634-7912 | ccmK | ||
| 1919 | CALHMO010000121.1 | GCA938035375_00954 | gene | open | 7930-8361 | |||
| 1920 | CALHMO010000121.1 | GCA938035375_00955 | gene | open | 8396-8773 | |||
| 1921 | CALHMO010000121.1 | GCA938035375_00956 | gene | open | 8773-10587 | |||
| 1922 | CALHMO010000121.1 | GCA938035375_00957 | gene | open | 10609-11118 | |||
| 1923 | CALHMO010000121.1 | GCA938035375_00958 | gene | open | 11132-11809 | |||
| 1924 | CALHMO010000121.1 | GCA938035375_00959 | gene | open | 11825-13489 | |||
| 1925 | CALHMO010000121.1 | GCA938035375_00960 | gene | open | 13512-14318 | pduB | ||
| 1926 | CALHMO010000122.1 | GCA938035375_00961 | CDS | open | 366-1766 | _na 466_aa | nhaC | Na+/H+ antiporter NhaC-like C-terminal domain-containing protein |
| 1927 | CALHMO010000122.1 | GCA938035375_00961 | gene | open | 366-1766 | nhaC | ||
| 1928 | CALHMO010000123.1 | GCA938035375_00962 | CDS | open | 169-1515 | _na 448_aa | ATPase | |
| 1929 | CALHMO010000123.1 | GCA938035375_00963 | CDS | open | 1508-2047 | _na 179_aa | putative RNA 2'-phosphotransferase | |
| 1930 | CALHMO010000123.1 | GCA938035375_00964 | CDS | open | 2160-4997 | _na 945_aa | uvrA | excinuclease ABC subunit UvrA |
| 1931 | CALHMO010000123.1 | GCA938035375_00965 | CDS | open | 5145-5729 | _na 194_aa | ruvA | Holliday junction branch migration protein RuvA |
| 1932 | CALHMO010000123.1 | GCA938035375_00962 | gene | open | 169-1515 | |||
| 1933 | CALHMO010000123.1 | GCA938035375_00963 | gene | open | 1508-2047 | |||
| 1934 | CALHMO010000123.1 | GCA938035375_00964 | gene | open | 2160-4997 | uvrA | ||
| 1935 | CALHMO010000123.1 | GCA938035375_00965 | gene | open | 5145-5729 | ruvA | ||
| 1936 | CALHMO010000124.1 | GCA938035375_00966 | CDS | open | 186-1517 | _na 443_aa | norM | Multidrug-efflux transporter |
| 1937 | CALHMO010000124.1 | GCA938035375_00967 | CDS | open | 1909-4485 | _na 858_aa | clpB | ATP-dependent chaperone ClpB |
| 1938 | CALHMO010000124.1 | GCA938035375_00968 | CDS | open | 4450-4608 | _na 52_aa | hypothetical protein | |
| 1939 | CALHMO010000124.1 | GCA938035375_00969 | CDS | open | 4731-4832 | _na 33_aa | hypothetical protein | |
| 1940 | CALHMO010000124.1 | GCA938035375_00970 | CDS | open | 4854-5207 | _na 117_aa | DUF3836 domain-containing protein | |
| 1941 | CALHMO010000124.1 | GCA938035375_00966 | gene | open | 186-1517 | norM | ||
| 1942 | CALHMO010000124.1 | GCA938035375_00967 | gene | open | 1909-4485 | clpB | ||
| 1943 | CALHMO010000124.1 | GCA938035375_00968 | gene | open | 4450-4608 | |||
| 1944 | CALHMO010000124.1 | GCA938035375_00969 | gene | open | 4731-4832 | |||
| 1945 | CALHMO010000124.1 | GCA938035375_00970 | gene | open | 4854-5207 | |||
| 1946 | CALHMO010000125.1 | GCA938035375_00971 | CDS | open | 92-544 | _na 150_aa | trmL | tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL |
| 1947 | CALHMO010000125.1 | GCA938035375_00972 | CDS | open | 555-1577 | _na 340_aa | gLY1 | Low-specificity threonine aldolase |
| 1948 | CALHMO010000125.1 | GCA938035375_00973 | CDS | open | 1591-2544 | _na 317_aa | DUF4299 domain-containing protein | |
| 1949 | CALHMO010000125.1 | GCA938035375_00974 | CDS | open | 2585-2860 | _na 91_aa | hupA | DNA-binding protein HU |
| 1950 | CALHMO010000125.1 | GCA938035375_00975 | CDS | open | 3142-5139 | _na 665_aa | bepA | Tetratricopeptide repeat family protein |
| 1951 | CALHMO010000125.1 | GCA938035375_00976 | CDS | open | 5315-5533 | _na 72_aa | Ferrous iron transporter FeoA-like domain-containing protein | |
| 1952 | CALHMO010000125.1 | GCA938035375_00977 | CDS | open | 5533-5802 | _na 89_aa | Ferrous iron transport protein A | |
| 1953 | CALHMO010000125.1 | GCA938035375_00978 | CDS | open | 5820-7964 | _na 714_aa | feoB | ferrous iron transport protein B |
| 1954 | CALHMO010000125.1 | GCA938035375_00979 | CDS | open | 7987-8139 | _na 50_aa | FeoB-associated Cys-rich membrane protein | |
| 1955 | CALHMO010000125.1 | GCA938035375_00980 | CDS | open | 8249-9634 | _na 461_aa | Multidrug-efflux transporter | |
| 1956 | CALHMO010000125.1 | GCA938035375_00981 | CDS | open | 9731-11107 | _na 458_aa | lpd | Mercuric reductase |
| 1957 | CALHMO010000125.1 | GCA938035375_00982 | CDS | open | 11206-12090 | _na 294_aa | Lipoprotein | |
| 1958 | CALHMO010000125.1 | GCA938035375_00983 | CDS | open | 12193-12711 | _na 172_aa | aroK | Shikimate kinase |
| 1959 | CALHMO010000125.1 | GCA938035375_00984 | CDS | open | 12731-14533 | _na 600_aa | hflX | GTPase HflX |
| 1960 | CALHMO010000125.1 | GCA938035375_00985 | CDS | open | 14543-15406 | _na 287_aa | yobV | WYL domain-containing protein |
| 1961 | CALHMO010000125.1 | GCA938035375_00971 | gene | open | 92-544 | trmL | ||
| 1962 | CALHMO010000125.1 | GCA938035375_00972 | gene | open | 555-1577 | gLY1 | ||
| 1963 | CALHMO010000125.1 | GCA938035375_00973 | gene | open | 1591-2544 | |||
| 1964 | CALHMO010000125.1 | GCA938035375_00974 | gene | open | 2585-2860 | hupA | ||
| 1965 | CALHMO010000125.1 | GCA938035375_00975 | gene | open | 3142-5139 | bepA | ||
| 1966 | CALHMO010000125.1 | GCA938035375_00976 | gene | open | 5315-5533 | |||
| 1967 | CALHMO010000125.1 | GCA938035375_00977 | gene | open | 5533-5802 | |||
| 1968 | CALHMO010000125.1 | GCA938035375_00978 | gene | open | 5820-7964 | feoB | ||
| 1969 | CALHMO010000125.1 | GCA938035375_00979 | gene | open | 7987-8139 | |||
| 1970 | CALHMO010000125.1 | GCA938035375_00980 | gene | open | 8249-9634 | |||
| 1971 | CALHMO010000125.1 | GCA938035375_00981 | gene | open | 9731-11107 | lpd | ||
| 1972 | CALHMO010000125.1 | GCA938035375_00982 | gene | open | 11206-12090 | |||
| 1973 | CALHMO010000125.1 | GCA938035375_00983 | gene | open | 12193-12711 | aroK | ||
| 1974 | CALHMO010000125.1 | GCA938035375_00984 | gene | open | 12731-14533 | hflX | ||
| 1975 | CALHMO010000125.1 | GCA938035375_00985 | gene | open | 14543-15406 | yobV | ||
| 1976 | CALHMO010000126.1 | GCA938035375_00986 | CDS | open | 125-379 | _na 84_aa | hypothetical protein | |
| 1977 | CALHMO010000126.1 | GCA938035375_00987 | CDS | open | 443-1390 | _na 315_aa | yfdV | Malonate transporter |
| 1978 | CALHMO010000126.1 | GCA938035375_00988 | CDS | open | 1463-2848 | _na 461_aa | Sodium/glutamate symporter | |
| 1979 | CALHMO010000126.1 | GCA938035375_00989 | CDS | open | 2866-3936 | _na 356_aa | D-isomer specific 2-hydroxyacid dehydrogenase NAD-binding domain-containing protein | |
| 1980 | CALHMO010000126.1 | GCA938035375_00986 | gene | open | 125-379 | |||
| 1981 | CALHMO010000126.1 | GCA938035375_00987 | gene | open | 443-1390 | yfdV | ||
| 1982 | CALHMO010000126.1 | GCA938035375_00988 | gene | open | 1463-2848 | |||
| 1983 | CALHMO010000126.1 | GCA938035375_00989 | gene | open | 2866-3936 | |||
| 1984 | CALHMO010000127.1 | GCA938035375_00990 | CDS | open | 624-932 | _na 102_aa | hupA | DNA-binding protein HU |
| 1985 | CALHMO010000127.1 | GCA938035375_00991 | CDS | open | 1076-2368 | _na 430_aa | nCS2 | Guanine permease |
| 1986 | CALHMO010000127.1 | GCA938035375_00990 | gene | open | 624-932 | hupA | ||
| 1987 | CALHMO010000127.1 | GCA938035375_00991 | gene | open | 1076-2368 | nCS2 | ||
| 1988 | CALHMO010000128.1 | GCA938035375_00992 | CDS | open | 34-360 | _na 108_aa | hypothetical protein | |
| 1989 | CALHMO010000128.1 | GCA938035375_00993 | CDS | open | 377-514 | _na 45_aa | hypothetical protein | |
| 1990 | CALHMO010000128.1 | GCA938035375_00994 | CDS | open | 974-1564 | _na 196_aa | hypothetical protein | |
| 1991 | CALHMO010000128.1 | GCA938035375_00995 | CDS | open | 1772-2089 | _na 105_aa | hypothetical protein | |
| 1992 | CALHMO010000128.1 | GCA938035375_00992 | gene | open | 34-360 | |||
| 1993 | CALHMO010000128.1 | GCA938035375_00993 | gene | open | 377-514 | |||
| 1994 | CALHMO010000128.1 | GCA938035375_00994 | gene | open | 974-1564 | |||
| 1995 | CALHMO010000128.1 | GCA938035375_00995 | gene | open | 1772-2089 | |||
| 1996 | CALHMO010000129.1 | GCA938035375_00996 | CDS | open | 556-1314 | _na 252_aa | DUF4198 domain-containing protein | |
| 1997 | CALHMO010000129.1 | GCA938035375_00997 | CDS | open | 1346-2980 | _na 544_aa | AAA-ATPase-like domain-containing protein | |
| 1998 | CALHMO010000129.1 | GCA938035375_00998 | CDS | open | 3125-9310 | _na 2061_aa | Autotransporter domain-containing protein | |
| 1999 | CALHMO010000129.1 | GCA938035375_00996 | gene | open | 556-1314 | |||
| 2000 | CALHMO010000129.1 | GCA938035375_00997 | gene | open | 1346-2980 |

