BAKTAGenome Explorer: Fusobacterium animalis (GCA_938035375.1)
Select a Genome:
|
BAKTA Annotations for GCA_938035375.1
|
Search & Sort all 4520 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 3501 | CALHMO010000225.1 | GCA938035375_01749 | CDS | open | 7546-7980 | _na 144_aa | rplM | 50S ribosomal protein L13 |
| 3502 | CALHMO010000225.1 | GCA938035375_01750 | CDS | open | 8469-9815 | _na 448_aa | alsT | AGCS family alanine/glycine:sodium (Na+) symporter |
| 3503 | CALHMO010000225.1 | GCA938035375_01751 | CDS | open | 10144-10569 | _na 141_aa | infC | translation initiation factor IF-3 |
| 3504 | CALHMO010000225.1 | GCA938035375_01752 | CDS | open | 10646-10852 | _na 68_aa | rpmI | 50S ribosomal protein L35 |
| 3505 | CALHMO010000225.1 | GCA938035375_01753 | CDS | open | 10877-11227 | _na 116_aa | rplT | 50S ribosomal protein L20 |
| 3506 | CALHMO010000225.1 | GCA938035375_01756 | CDS | open | 11681-12568 | _na 295_aa | fda | fructose bisphosphate aldolase |
| 3507 | CALHMO010000225.1 | GCA938035375_01757 | CDS | open | 12962-14785 | _na 607_aa | htpG | molecular chaperone HtpG |
| 3508 | CALHMO010000225.1 | GCA938035375_01740 | gene | open | 89-544 | rseC | ||
| 3509 | CALHMO010000225.1 | GCA938035375_01741 | gene | open | 704-1024 | |||
| 3510 | CALHMO010000225.1 | GCA938035375_01742 | gene | open | 1192-2394 | |||
| 3511 | CALHMO010000225.1 | GCA938035375_01743 | gene | open | 2437-2985 | ompF | ||
| 3512 | CALHMO010000225.1 | GCA938035375_01744 | gene | open | 3077-4324 | tyrB | ||
| 3513 | CALHMO010000225.1 | GCA938035375_01745 | gene | open | 4336-4896 | glpP | ||
| 3514 | CALHMO010000225.1 | GCA938035375_01746 | gene | open | 4913-5968 | corA | ||
| 3515 | CALHMO010000225.1 | GCA938035375_01747 | gene | open | 5973-6995 | |||
| 3516 | CALHMO010000225.1 | GCA938035375_01748 | gene | open | 7129-7530 | |||
| 3517 | CALHMO010000225.1 | GCA938035375_01749 | gene | open | 7546-7980 | rplM | ||
| 3518 | CALHMO010000225.1 | GCA938035375_01750 | gene | open | 8469-9815 | alsT | ||
| 3519 | CALHMO010000225.1 | GCA938035375_01751 | gene | open | 10144-10569 | infC | ||
| 3520 | CALHMO010000225.1 | GCA938035375_01752 | gene | open | 10646-10852 | rpmI | ||
| 3521 | CALHMO010000225.1 | GCA938035375_01753 | gene | open | 10877-11227 | rplT | ||
| 3522 | CALHMO010000225.1 | GCA938035375_01756 | gene | open | 11681-12568 | fda | ||
| 3523 | CALHMO010000225.1 | GCA938035375_01757 | gene | open | 12962-14785 | htpG | ||
| 3524 | CALHMO010000225.1 | GCA938035375_01754 | gene | open | 11275-11358 | trnS | ||
| 3525 | CALHMO010000225.1 | GCA938035375_01755 | gene | open | 11381-11470 | trnS | ||
| 3526 | CALHMO010000225.1 | GCA938035375_01754 | tRNA | open | 11275-11358 | trnS | tRNA-Ser(tga) | |
| 3527 | CALHMO010000225.1 | GCA938035375_01755 | tRNA | open | 11381-11470 | trnS | tRNA-Ser(gct) | |
| 3528 | CALHMO010000226.1 | GCA938035375_01758 | CDS | open | 75-1094 | _na 339_aa | mglC | galactose/methyl galactoside ABC transporter permease MglC |
| 3529 | CALHMO010000226.1 | GCA938035375_01759 | CDS | open | 1117-2619 | _na 500_aa | mglA | galactose/methyl galactoside ABC transporter ATP-binding protein MglA |
| 3530 | CALHMO010000226.1 | GCA938035375_01760 | CDS | open | 2709-3734 | _na 341_aa | mglB | galactose/glucose ABC transporter substrate-binding protein MglB |
| 3531 | CALHMO010000226.1 | GCA938035375_01761 | CDS | open | 3931-4878 | _na 315_aa | nagC | Glucokinase |
| 3532 | CALHMO010000226.1 | GCA938035375_01762 | CDS | open | 4902-5825 | _na 307_aa | trxB | Thioredoxin reductase |
| 3533 | CALHMO010000226.1 | GCA938035375_01763 | CDS | open | 5848-6471 | _na 207_aa | Hydroxyacylglutathione hydrolase | |
| 3534 | CALHMO010000226.1 | GCA938035375_01764 | CDS | open | 6617-7198 | _na 193_aa | nadD | nicotinate (nicotinamide) nucleotide adenylyltransferase |
| 3535 | CALHMO010000226.1 | GCA938035375_01765 | CDS | open | 7189-7968 | _na 259_aa | hypothetical protein | |
| 3536 | CALHMO010000226.1 | GCA938035375_01766 | CDS | open | 7972-8976 | _na 334_aa | lpxK | tetraacyldisaccharide 4'-kinase |
| 3537 | CALHMO010000226.1 | GCA938035375_01767 | CDS | open | 9004-12555 | _na 1183_aa | smc | chromosome segregation protein SMC |
| 3538 | CALHMO010000226.1 | GCA938035375_01768 | CDS | open | 12728-14710 | _na 660_aa | dAP2 | Dipeptidyl aminopeptidase/acylaminoacyl-peptidase |
| 3539 | CALHMO010000226.1 | GCA938035375_01758 | gene | open | 75-1094 | mglC | ||
| 3540 | CALHMO010000226.1 | GCA938035375_01759 | gene | open | 1117-2619 | mglA | ||
| 3541 | CALHMO010000226.1 | GCA938035375_01760 | gene | open | 2709-3734 | mglB | ||
| 3542 | CALHMO010000226.1 | GCA938035375_01761 | gene | open | 3931-4878 | nagC | ||
| 3543 | CALHMO010000226.1 | GCA938035375_01762 | gene | open | 4902-5825 | trxB | ||
| 3544 | CALHMO010000226.1 | GCA938035375_01763 | gene | open | 5848-6471 | |||
| 3545 | CALHMO010000226.1 | GCA938035375_01764 | gene | open | 6617-7198 | nadD | ||
| 3546 | CALHMO010000226.1 | GCA938035375_01765 | gene | open | 7189-7968 | |||
| 3547 | CALHMO010000226.1 | GCA938035375_01766 | gene | open | 7972-8976 | lpxK | ||
| 3548 | CALHMO010000226.1 | GCA938035375_01767 | gene | open | 9004-12555 | smc | ||
| 3549 | CALHMO010000226.1 | GCA938035375_01768 | gene | open | 12728-14710 | dAP2 | ||
| 3550 | CALHMO010000227.1 | GCA938035375_01769 | CDS | open | 48-2993 | _na 981_aa | mfd | transcription-repair coupling factor |
| 3551 | CALHMO010000227.1 | GCA938035375_01770 | CDS | open | 3058-3222 | _na 54_aa | hypothetical protein | |
| 3552 | CALHMO010000227.1 | GCA938035375_01771 | CDS | open | 3222-3470 | _na 82_aa | Antitoxin | |
| 3553 | CALHMO010000227.1 | GCA938035375_01769 | gene | open | 48-2993 | mfd | ||
| 3554 | CALHMO010000227.1 | GCA938035375_01770 | gene | open | 3058-3222 | |||
| 3555 | CALHMO010000227.1 | GCA938035375_01771 | gene | open | 3222-3470 | |||
| 3556 | CALHMO010000228.1 | GCA938035375_01772 | CDS | open | 370-1395 | _na 341_aa | Nuclease | |
| 3557 | CALHMO010000228.1 | GCA938035375_01773 | CDS | open | 1585-2139 | _na 184_aa | DUF1877 domain-containing protein | |
| 3558 | CALHMO010000228.1 | GCA938035375_01774 | CDS | open | 2136-2825 | _na 229_aa | yqgA | DUF554 domain-containing protein |
| 3559 | CALHMO010000228.1 | GCA938035375_01772 | gene | open | 370-1395 | |||
| 3560 | CALHMO010000228.1 | GCA938035375_01773 | gene | open | 1585-2139 | |||
| 3561 | CALHMO010000228.1 | GCA938035375_01774 | gene | open | 2136-2825 | yqgA | ||
| 3562 | CALHMO010000229.1 | GCA938035375_01775 | CDS | open | 338-742 | _na 134_aa | fadA | Adhesion protein FadA |
| 3563 | CALHMO010000229.1 | GCA938035375_01776 | CDS | open | 895-1398 | _na 167_aa | DNA-binding protein | |
| 3564 | CALHMO010000229.1 | GCA938035375_01777 | CDS | open | 1584-2045 | _na 153_aa | HTH cro/C1-type domain-containing protein | |
| 3565 | CALHMO010000229.1 | GCA938035375_01778 | CDS | open | 1996-2421 | _na 141_aa | irrE | IrrE N-terminal-like domain-containing protein |
| 3566 | CALHMO010000229.1 | GCA938035375_01779 | CDS | open | 2437-3783 | _na 448_aa | HTH deoR-type domain-containing protein | |
| 3567 | CALHMO010000229.1 | GCA938035375_01780 | CDS | open | 3994-4440 | _na 148_aa | secB | Preprotein translocase subunit SecB |
| 3568 | CALHMO010000229.1 | GCA938035375_01781 | CDS | open | 4421-4696 | _na 91_aa | hypothetical protein | |
| 3569 | CALHMO010000229.1 | GCA938035375_01782 | CDS | open | 4693-5196 | _na 167_aa | DUF3990 domain-containing protein | |
| 3570 | CALHMO010000229.1 | GCA938035375_01783 | CDS | open | 5445-6005 | _na 186_aa | tlpA | Thiol:disulfide interchange protein TlpA |
| 3571 | CALHMO010000229.1 | GCA938035375_01784 | CDS | open | 6025-7479 | _na 484_aa | ydhJ | dGTP triphosphohydrolase |
| 3572 | CALHMO010000229.1 | GCA938035375_01785 | CDS | open | 7545-7814 | _na 89_aa | relE | Addiction module toxin RelE |
| 3573 | CALHMO010000229.1 | GCA938035375_01786 | CDS | open | 7815-8039 | _na 74_aa | relB | type II toxin-antitoxin system RelB family antitoxin |
| 3574 | CALHMO010000229.1 | GCA938035375_01787 | CDS | open | 8109-9464 | _na 451_aa | Amino acid carrier protein | |
| 3575 | CALHMO010000229.1 | GCA938035375_01788 | CDS | open | 9585-11060 | _na 491_aa | cobQ | cobyric acid synthase |
| 3576 | CALHMO010000229.1 | GCA938035375_01789 | CDS | open | 11260-11496 | _na 78_aa | hypothetical protein | |
| 3577 | CALHMO010000229.1 | GCA938035375_01790 | CDS | open | 11551-12618 | _na 355_aa | nCS2 | Guanine permease |
| 3578 | CALHMO010000229.1 | GCA938035375_01791 | CDS | open | 12631-13164 | _na 177_aa | apt | Adenine phosphoribosyltransferase |
| 3579 | CALHMO010000229.1 | GCA938035375_01792 | CDS | open | 13307-14734 | _na 475_aa | nhaC | Na+/H+ antiporter NhaC |
| 3580 | CALHMO010000229.1 | GCA938035375_01793 | CDS | open | 14924-16351 | _na 475_aa | Transposase | |
| 3581 | CALHMO010000229.1 | GCA938035375_01794 | CDS | open | 16364-16765 | _na 133_aa | tnpA | IS200/IS605 family transposase |
| 3582 | CALHMO010000229.1 | GCA938035375_01795 | CDS | open | 16936-17238 | _na 100_aa | RelB/DinJ family addiction module antitoxin | |
| 3583 | CALHMO010000229.1 | GCA938035375_01796 | CDS | open | 17277-17783 | _na 168_aa | niaR | DNA-binding transcriptional regulator |
| 3584 | CALHMO010000229.1 | GCA938035375_01797 | CDS | open | 17776-18636 | _na 286_aa | nadC | carboxylating nicotinate-nucleotide diphosphorylase |
| 3585 | CALHMO010000229.1 | GCA938035375_01798 | CDS | open | 18614-19291 | _na 225_aa | FAD-binding protein | |
| 3586 | CALHMO010000229.1 | GCA938035375_01775 | gene | open | 338-742 | fadA | ||
| 3587 | CALHMO010000229.1 | GCA938035375_01776 | gene | open | 895-1398 | |||
| 3588 | CALHMO010000229.1 | GCA938035375_01777 | gene | open | 1584-2045 | |||
| 3589 | CALHMO010000229.1 | GCA938035375_01778 | gene | open | 1996-2421 | irrE | ||
| 3590 | CALHMO010000229.1 | GCA938035375_01779 | gene | open | 2437-3783 | |||
| 3591 | CALHMO010000229.1 | GCA938035375_01780 | gene | open | 3994-4440 | secB | ||
| 3592 | CALHMO010000229.1 | GCA938035375_01781 | gene | open | 4421-4696 | |||
| 3593 | CALHMO010000229.1 | GCA938035375_01782 | gene | open | 4693-5196 | |||
| 3594 | CALHMO010000229.1 | GCA938035375_01783 | gene | open | 5445-6005 | tlpA | ||
| 3595 | CALHMO010000229.1 | GCA938035375_01784 | gene | open | 6025-7479 | ydhJ | ||
| 3596 | CALHMO010000229.1 | GCA938035375_01785 | gene | open | 7545-7814 | relE | ||
| 3597 | CALHMO010000229.1 | GCA938035375_01786 | gene | open | 7815-8039 | relB | ||
| 3598 | CALHMO010000229.1 | GCA938035375_01787 | gene | open | 8109-9464 | |||
| 3599 | CALHMO010000229.1 | GCA938035375_01788 | gene | open | 9585-11060 | cobQ | ||
| 3600 | CALHMO010000229.1 | GCA938035375_01789 | gene | open | 11260-11496 | |||
| 3601 | CALHMO010000229.1 | GCA938035375_01790 | gene | open | 11551-12618 | nCS2 | ||
| 3602 | CALHMO010000229.1 | GCA938035375_01791 | gene | open | 12631-13164 | apt | ||
| 3603 | CALHMO010000229.1 | GCA938035375_01792 | gene | open | 13307-14734 | nhaC | ||
| 3604 | CALHMO010000229.1 | GCA938035375_01793 | gene | open | 14924-16351 | |||
| 3605 | CALHMO010000229.1 | GCA938035375_01794 | gene | open | 16364-16765 | tnpA | ||
| 3606 | CALHMO010000229.1 | GCA938035375_01795 | gene | open | 16936-17238 | |||
| 3607 | CALHMO010000229.1 | GCA938035375_01796 | gene | open | 17277-17783 | niaR | ||
| 3608 | CALHMO010000229.1 | GCA938035375_01797 | gene | open | 17776-18636 | nadC | ||
| 3609 | CALHMO010000229.1 | GCA938035375_01798 | gene | open | 18614-19291 | |||
| 3610 | CALHMO010000230.1 | GCA938035375_01799 | CDS | open | 753-1427 | _na 224_aa | ompR | DNA-binding response regulator |
| 3611 | CALHMO010000230.1 | GCA938035375_01800 | CDS | open | 1458-1934 | _na 158_aa | PepSY domain-containing protein | |
| 3612 | CALHMO010000230.1 | GCA938035375_01799 | gene | open | 753-1427 | ompR | ||
| 3613 | CALHMO010000230.1 | GCA938035375_01800 | gene | open | 1458-1934 | |||
| 3614 | CALHMO010000231.1 | GCA938035375_01801 | CDS | open | 109-693 | _na 194_aa | gmhA | D-sedoheptulose 7-phosphate isomerase |
| 3615 | CALHMO010000231.1 | GCA938035375_01802 | CDS | open | 708-1595 | _na 295_aa | lysR | HTH lysR-type domain-containing protein |
| 3616 | CALHMO010000231.1 | GCA938035375_01803 | CDS | open | 1692-2534 | _na 280_aa | APC family permease | |
| 3617 | CALHMO010000231.1 | GCA938035375_01801 | gene | open | 109-693 | gmhA | ||
| 3618 | CALHMO010000231.1 | GCA938035375_01802 | gene | open | 708-1595 | lysR | ||
| 3619 | CALHMO010000231.1 | GCA938035375_01803 | gene | open | 1692-2534 | |||
| 3620 | CALHMO010000232.1 | repeat_region | open | 8-314 | CRISPR array with 5 repeats of length 30%2C consensus sequence ATTTCAAAACTTTTCAAGTTTATAGTTCAT and spacer length 36 | |||
| 3621 | CALHMO010000232.1 | GCA938035375_01804 | CDS | open | 477-761 | _na 94_aa | cas2 | CRISPR-associated endonuclease Cas2 |
| 3622 | CALHMO010000232.1 | GCA938035375_01805 | CDS | open | 780-1778 | _na 332_aa | cas1b | type I-B CRISPR-associated endonuclease Cas1b |
| 3623 | CALHMO010000232.1 | GCA938035375_01806 | CDS | open | 1790-2278 | _na 162_aa | cas4 | CRISPR-associated protein Cas4 |
| 3624 | CALHMO010000232.1 | GCA938035375_01807 | CDS | open | 2289-4826 | _na 845_aa | CRISPR-associated helicase/endonuclease Cas3 | |
| 3625 | CALHMO010000232.1 | GCA938035375_01808 | CDS | open | 4899-5669 | _na 256_aa | cas5b | type I-B CRISPR-associated protein Cas5b |
| 3626 | CALHMO010000232.1 | GCA938035375_01809 | CDS | open | 5672-6619 | _na 315_aa | CRISPR-associated protein | |
| 3627 | CALHMO010000232.1 | GCA938035375_01810 | CDS | open | 6619-8346 | _na 575_aa | CRISPR-associated protein Csh1 | |
| 3628 | CALHMO010000232.1 | GCA938035375_01811 | CDS | open | 8361-9104 | _na 247_aa | CRISPR-associated endoribonuclease cas6 | |
| 3629 | CALHMO010000232.1 | GCA938035375_01814 | CDS | open | 10010-10705 | _na 231_aa | hypothetical protein | |
| 3630 | CALHMO010000232.1 | GCA938035375_01804 | gene | open | 477-761 | cas2 | ||
| 3631 | CALHMO010000232.1 | GCA938035375_01805 | gene | open | 780-1778 | cas1b | ||
| 3632 | CALHMO010000232.1 | GCA938035375_01806 | gene | open | 1790-2278 | cas4 | ||
| 3633 | CALHMO010000232.1 | GCA938035375_01807 | gene | open | 2289-4826 | |||
| 3634 | CALHMO010000232.1 | GCA938035375_01808 | gene | open | 4899-5669 | cas5b | ||
| 3635 | CALHMO010000232.1 | GCA938035375_01809 | gene | open | 5672-6619 | |||
| 3636 | CALHMO010000232.1 | GCA938035375_01810 | gene | open | 6619-8346 | |||
| 3637 | CALHMO010000232.1 | GCA938035375_01811 | gene | open | 8361-9104 | |||
| 3638 | CALHMO010000232.1 | GCA938035375_01814 | gene | open | 10010-10705 | |||
| 3639 | CALHMO010000232.1 | GCA938035375_01812 | gene | open | 9383-9457 | trnQ | ||
| 3640 | CALHMO010000232.1 | GCA938035375_01813 | gene | open | 9464-9540 | trnP | ||
| 3641 | CALHMO010000232.1 | GCA938035375_01812 | tRNA | open | 9383-9457 | trnQ | tRNA-Gln(ttg) | |
| 3642 | CALHMO010000232.1 | GCA938035375_01813 | tRNA | open | 9464-9540 | trnP | tRNA-Pro(tgg) | |
| 3643 | CALHMO010000233.1 | GCA938035375_01815 | CDS | open | 75-713 | _na 212_aa | ftcD | Cyclodeaminase/cyclohydrolase domain-containing protein |
| 3644 | CALHMO010000233.1 | GCA938035375_01816 | CDS | open | 735-1283 | _na 182_aa | NADAR domain-containing protein | |
| 3645 | CALHMO010000233.1 | GCA938035375_01817 | CDS | open | 1292-2533 | _na 413_aa | hutI | imidazolonepropionase |
| 3646 | CALHMO010000233.1 | GCA938035375_01818 | CDS | open | 2608-3573 | _na 321_aa | ftcD | glutamate formimidoyltransferase |
| 3647 | CALHMO010000233.1 | GCA938035375_01819 | CDS | open | 3784-4254 | _na 156_aa | DUF1456 domain-containing protein | |
| 3648 | CALHMO010000233.1 | GCA938035375_01820 | CDS | open | 4276-6783 | _na 835_aa | dinG | DNA 5'-3' helicase |
| 3649 | CALHMO010000233.1 | GCA938035375_01821 | CDS | open | 6755-8827 | _na 690_aa | pgpH | HD/PDEase domain-containing protein |
| 3650 | CALHMO010000233.1 | GCA938035375_01822 | CDS | open | 8843-9331 | _na 162_aa | ybeY | rRNA maturation RNase YbeY |
| 3651 | CALHMO010000233.1 | GCA938035375_01823 | CDS | open | 9495-10001 | _na 168_aa | hypothetical protein | |
| 3652 | CALHMO010000233.1 | GCA938035375_01815 | gene | open | 75-713 | ftcD | ||
| 3653 | CALHMO010000233.1 | GCA938035375_01816 | gene | open | 735-1283 | |||
| 3654 | CALHMO010000233.1 | GCA938035375_01817 | gene | open | 1292-2533 | hutI | ||
| 3655 | CALHMO010000233.1 | GCA938035375_01818 | gene | open | 2608-3573 | ftcD | ||
| 3656 | CALHMO010000233.1 | GCA938035375_01819 | gene | open | 3784-4254 | |||
| 3657 | CALHMO010000233.1 | GCA938035375_01820 | gene | open | 4276-6783 | dinG | ||
| 3658 | CALHMO010000233.1 | GCA938035375_01821 | gene | open | 6755-8827 | pgpH | ||
| 3659 | CALHMO010000233.1 | GCA938035375_01822 | gene | open | 8843-9331 | ybeY | ||
| 3660 | CALHMO010000233.1 | GCA938035375_01823 | gene | open | 9495-10001 | |||
| 3661 | CALHMO010000234.1 | GCA938035375_01824 | CDS | open | 93-479 | _na 128_aa | hypothetical protein | |
| 3662 | CALHMO010000234.1 | GCA938035375_01825 | CDS | open | 571-1743 | _na 390_aa | gltP | Transporter%2C dicarboxylate/amino acid:cation Na+/H+ symporter family protein |
| 3663 | CALHMO010000234.1 | GCA938035375_01826 | CDS | open | 1925-3208 | _na 427_aa | cdsB | UPF0597 protein FN1147 |
| 3664 | CALHMO010000234.1 | GCA938035375_01827 | CDS | open | 3251-4093 | _na 280_aa | pdxS | pyridoxal 5'-phosphate synthase lyase subunit PdxS |
| 3665 | CALHMO010000234.1 | GCA938035375_01828 | CDS | open | 4201-5610 | _na 469_aa | PLP-dependent aminotransferase family protein | |
| 3666 | CALHMO010000234.1 | GCA938035375_01829 | CDS | open | 5710-6477 | _na 255_aa | Lipoprotein | |
| 3667 | CALHMO010000234.1 | GCA938035375_01830 | CDS | open | 6546-7370 | _na 274_aa | nagB | glucosamine-6-phosphate deaminase |
| 3668 | CALHMO010000234.1 | GCA938035375_01831 | CDS | open | 7367-8290 | _na 307_aa | Radical SAM core domain-containing protein | |
| 3669 | CALHMO010000234.1 | GCA938035375_01832 | CDS | open | 8375-8482 | _na 35_aa | hypothetical protein | |
| 3670 | CALHMO010000234.1 | GCA938035375_01833 | CDS | open | 8607-9377 | _na 256_aa | focA | Formate transporter |
| 3671 | CALHMO010000234.1 | GCA938035375_01824 | gene | open | 93-479 | |||
| 3672 | CALHMO010000234.1 | GCA938035375_01825 | gene | open | 571-1743 | gltP | ||
| 3673 | CALHMO010000234.1 | GCA938035375_01826 | gene | open | 1925-3208 | cdsB | ||
| 3674 | CALHMO010000234.1 | GCA938035375_01827 | gene | open | 3251-4093 | pdxS | ||
| 3675 | CALHMO010000234.1 | GCA938035375_01828 | gene | open | 4201-5610 | |||
| 3676 | CALHMO010000234.1 | GCA938035375_01829 | gene | open | 5710-6477 | |||
| 3677 | CALHMO010000234.1 | GCA938035375_01830 | gene | open | 6546-7370 | nagB | ||
| 3678 | CALHMO010000234.1 | GCA938035375_01831 | gene | open | 7367-8290 | |||
| 3679 | CALHMO010000234.1 | GCA938035375_01832 | gene | open | 8375-8482 | |||
| 3680 | CALHMO010000234.1 | GCA938035375_01833 | gene | open | 8607-9377 | focA | ||
| 3681 | CALHMO010000235.1 | GCA938035375_01835 | CDS | open | 151-573 | _na 140_aa | tpp15 | FMN-binding domain-containing protein |
| 3682 | CALHMO010000235.1 | GCA938035375_01836 | CDS | open | 821-1258 | _na 145_aa | DUF4418 domain-containing protein | |
| 3683 | CALHMO010000235.1 | GCA938035375_01837 | CDS | open | 1262-2467 | _na 401_aa | lolE | ABC transporter permease |
| 3684 | CALHMO010000235.1 | GCA938035375_01838 | CDS | open | 2476-3147 | _na 223_aa | lolD | ABC transporter domain-containing protein |
| 3685 | CALHMO010000235.1 | GCA938035375_01835 | gene | open | 151-573 | tpp15 | ||
| 3686 | CALHMO010000235.1 | GCA938035375_01836 | gene | open | 821-1258 | |||
| 3687 | CALHMO010000235.1 | GCA938035375_01837 | gene | open | 1262-2467 | lolE | ||
| 3688 | CALHMO010000235.1 | GCA938035375_01838 | gene | open | 2476-3147 | lolD | ||
| 3689 | CALHMO010000236.1 | GCA938035375_01839 | CDS | open | 80-757 | _na 225_aa | lolD | Lipoprotein-releasing system ATP-binding protein LolD |
| 3690 | CALHMO010000236.1 | GCA938035375_01840 | CDS | open | 750-1919 | _na 389_aa | lolE | ABC transporter permease |
| 3691 | CALHMO010000236.1 | GCA938035375_01841 | CDS | open | 1923-4169 | _na 748_aa | pbpC | penicillin-binding protein 1C |
| 3692 | CALHMO010000236.1 | GCA938035375_01842 | CDS | open | 4510-5181 | _na 223_aa | hypothetical protein | |
| 3693 | CALHMO010000236.1 | GCA938035375_01839 | gene | open | 80-757 | lolD | ||
| 3694 | CALHMO010000236.1 | GCA938035375_01840 | gene | open | 750-1919 | lolE | ||
| 3695 | CALHMO010000236.1 | GCA938035375_01841 | gene | open | 1923-4169 | pbpC | ||
| 3696 | CALHMO010000236.1 | GCA938035375_01842 | gene | open | 4510-5181 | |||
| 3697 | CALHMO010000237.1 | GCA938035375_01843 | CDS | open | 585-1337 | _na 250_aa | FnuDI restriction endonuclease | |
| 3698 | CALHMO010000237.1 | GCA938035375_01844 | CDS | open | 1476-2753 | _na 425_aa | purA | adenylosuccinate synthase |
| 3699 | CALHMO010000237.1 | GCA938035375_01843 | gene | open | 585-1337 | |||
| 3700 | CALHMO010000237.1 | GCA938035375_01844 | gene | open | 1476-2753 | purA | ||
| 3701 | CALHMO010000238.1 | GCA938035375_01845 | CDS | open | 83-634 | _na 183_aa | lemA | LemA protein |
| 3702 | CALHMO010000238.1 | GCA938035375_01846 | CDS | open | 653-1843 | _na 396_aa | OmpA-like domain-containing protein | |
| 3703 | CALHMO010000238.1 | GCA938035375_01847 | CDS | open | 1898-2443 | _na 181_aa | tlpA | TlpA disulfide reductase family protein |
| 3704 | CALHMO010000238.1 | GCA938035375_01848 | CDS | open | 2623-5097 | _na 824_aa | AMP-binding protein | |
| 3705 | CALHMO010000238.1 | GCA938035375_01849 | CDS | open | 5199-6719 | _na 506_aa | UPF0371 protein FN1121 | |
| 3706 | CALHMO010000238.1 | GCA938035375_01850 | CDS | open | 6857-8440 | _na 527_aa | Phosphoenolpyruvate carboxykinase (ATP) | |
| 3707 | CALHMO010000238.1 | GCA938035375_01851 | CDS | open | 8727-12293 | _na 1188_aa | nifJ | pyruvate:ferredoxin (flavodoxin) oxidoreductase |
| 3708 | CALHMO010000238.1 | GCA938035375_01852 | CDS | open | 12410-13606 | _na 398_aa | ackA | Acetate kinase |
| 3709 | CALHMO010000238.1 | GCA938035375_01845 | gene | open | 83-634 | lemA | ||
| 3710 | CALHMO010000238.1 | GCA938035375_01846 | gene | open | 653-1843 | |||
| 3711 | CALHMO010000238.1 | GCA938035375_01847 | gene | open | 1898-2443 | tlpA | ||
| 3712 | CALHMO010000238.1 | GCA938035375_01848 | gene | open | 2623-5097 | |||
| 3713 | CALHMO010000238.1 | GCA938035375_01849 | gene | open | 5199-6719 | |||
| 3714 | CALHMO010000238.1 | GCA938035375_01850 | gene | open | 6857-8440 | |||
| 3715 | CALHMO010000238.1 | GCA938035375_01851 | gene | open | 8727-12293 | nifJ | ||
| 3716 | CALHMO010000238.1 | GCA938035375_01852 | gene | open | 12410-13606 | ackA | ||
| 3717 | CALHMO010000239.1 | GCA938035375_01853 | CDS | open | 162-1334 | _na 390_aa | Peptidase M20 dimerisation domain-containing protein | |
| 3718 | CALHMO010000239.1 | GCA938035375_01854 | CDS | open | 1385-2575 | _na 396_aa | DUF819 domain-containing protein | |
| 3719 | CALHMO010000239.1 | GCA938035375_01855 | CDS | open | 2799-5537 | _na 912_aa | polA | DNA polymerase I |
| 3720 | CALHMO010000239.1 | GCA938035375_01853 | gene | open | 162-1334 | |||
| 3721 | CALHMO010000239.1 | GCA938035375_01854 | gene | open | 1385-2575 | |||
| 3722 | CALHMO010000239.1 | GCA938035375_01855 | gene | open | 2799-5537 | polA | ||
| 3723 | CALHMO010000240.1 | GCA938035375_01856 | CDS | open | 145-744 | _na 199_aa | grpE | nucleotide exchange factor GrpE |
| 3724 | CALHMO010000240.1 | GCA938035375_01857 | CDS | open | 741-1775 | _na 344_aa | hrcA | heat-inducible transcriptional repressor HrcA |
| 3725 | CALHMO010000240.1 | GCA938035375_01858 | CDS | open | 1948-2250 | _na 100_aa | DUF4298 domain-containing protein | |
| 3726 | CALHMO010000240.1 | GCA938035375_01856 | gene | open | 145-744 | grpE | ||
| 3727 | CALHMO010000240.1 | GCA938035375_01857 | gene | open | 741-1775 | hrcA | ||
| 3728 | CALHMO010000240.1 | GCA938035375_01858 | gene | open | 1948-2250 | |||
| 3729 | CALHMO010000241.1 | GCA938035375_01859 | CDS | open | 45-404 | _na 119_aa | hypothetical protein | |
| 3730 | CALHMO010000241.1 | GCA938035375_01860 | CDS | open | 406-1104 | _na 232_aa | rsmG | 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG |
| 3731 | CALHMO010000241.1 | GCA938035375_01861 | CDS | open | 1276-1410 | _na 44_aa | Polypeptide-transport-associated ShlB-type domain-containing protein | |
| 3732 | CALHMO010000241.1 | GCA938035375_01862 | CDS | open | 1407-1628 | _na 73_aa | hypothetical protein | |
| 3733 | CALHMO010000241.1 | GCA938035375_01863 | CDS | open | 1600-2127 | _na 175_aa | DUF304 domain-containing protein | |
| 3734 | CALHMO010000241.1 | GCA938035375_01859 | gene | open | 45-404 | |||
| 3735 | CALHMO010000241.1 | GCA938035375_01860 | gene | open | 406-1104 | rsmG | ||
| 3736 | CALHMO010000241.1 | GCA938035375_01861 | gene | open | 1276-1410 | |||
| 3737 | CALHMO010000241.1 | GCA938035375_01862 | gene | open | 1407-1628 | |||
| 3738 | CALHMO010000241.1 | GCA938035375_01863 | gene | open | 1600-2127 | |||
| 3739 | CALHMO010000242.1 | GCA938035375_01864 | CDS | open | 71-694 | _na 207_aa | upp | uracil phosphoribosyltransferase |
| 3740 | CALHMO010000242.1 | GCA938035375_01865 | CDS | open | 754-999 | _na 81_aa | rpmE | type B 50S ribosomal protein L31 |
| 3741 | CALHMO010000242.1 | GCA938035375_01866 | CDS | open | 1122-1520 | _na 132_aa | Adhesin | |
| 3742 | CALHMO010000242.1 | GCA938035375_01867 | CDS | open | 1537-1845 | _na 102_aa | Gram-positive signal peptide protein%2C YSIRK family | |
| 3743 | CALHMO010000242.1 | GCA938035375_01868 | CDS | open | 1847-2296 | _na 149_aa | rpoE | DNA-directed RNA polymerase sigma subunit RpoE |
| 3744 | CALHMO010000242.1 | GCA938035375_01869 | CDS | open | 2352-3416 | _na 354_aa | ispG | flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase |
| 3745 | CALHMO010000242.1 | GCA938035375_01870 | CDS | open | 3730-4830 | _na 366_aa | nlpD | LysM domain-containing protein |
| 3746 | CALHMO010000242.1 | GCA938035375_01871 | CDS | open | 4882-6123 | _na 413_aa | rho | transcription termination factor Rho |
| 3747 | CALHMO010000242.1 | GCA938035375_01872 | CDS | open | 6152-6646 | _na 164_aa | miaB | tRNA-i(6)A37 thiotransferase enzyme MiaB |
| 3748 | CALHMO010000242.1 | GCA938035375_01873 | CDS | open | 6689-7423 | _na 244_aa | Radical SAM methylthiotransferase%2C MiaB/RimO family | |
| 3749 | CALHMO010000242.1 | GCA938035375_01874 | CDS | open | 7646-10684 | _na 1012_aa | acrB | Acriflavin resistance protein |
| 3750 | CALHMO010000242.1 | GCA938035375_01875 | CDS | open | 10724-11293 | _na 189_aa | acrR | HTH tetR-type domain-containing protein |
| 3751 | CALHMO010000242.1 | GCA938035375_01876 | CDS | open | 11473-11976 | _na 167_aa | fldA | flavodoxin |
| 3752 | CALHMO010000242.1 | GCA938035375_01877 | CDS | open | 12081-13199 | _na 372_aa | abgT | AbgT family transporter |
| 3753 | CALHMO010000242.1 | GCA938035375_01864 | gene | open | 71-694 | upp | ||
| 3754 | CALHMO010000242.1 | GCA938035375_01865 | gene | open | 754-999 | rpmE | ||
| 3755 | CALHMO010000242.1 | GCA938035375_01866 | gene | open | 1122-1520 | |||
| 3756 | CALHMO010000242.1 | GCA938035375_01867 | gene | open | 1537-1845 | |||
| 3757 | CALHMO010000242.1 | GCA938035375_01868 | gene | open | 1847-2296 | rpoE | ||
| 3758 | CALHMO010000242.1 | GCA938035375_01869 | gene | open | 2352-3416 | ispG | ||
| 3759 | CALHMO010000242.1 | GCA938035375_01870 | gene | open | 3730-4830 | nlpD | ||
| 3760 | CALHMO010000242.1 | GCA938035375_01871 | gene | open | 4882-6123 | rho | ||
| 3761 | CALHMO010000242.1 | GCA938035375_01872 | gene | open | 6152-6646 | miaB | ||
| 3762 | CALHMO010000242.1 | GCA938035375_01873 | gene | open | 6689-7423 | |||
| 3763 | CALHMO010000242.1 | GCA938035375_01874 | gene | open | 7646-10684 | acrB | ||
| 3764 | CALHMO010000242.1 | GCA938035375_01875 | gene | open | 10724-11293 | acrR | ||
| 3765 | CALHMO010000242.1 | GCA938035375_01876 | gene | open | 11473-11976 | fldA | ||
| 3766 | CALHMO010000242.1 | GCA938035375_01877 | gene | open | 12081-13199 | abgT | ||
| 3767 | CALHMO010000243.1 | GCA938035375_01878 | CDS | open | 125-307 | _na 60_aa | N-acetylmuramoyl-L-alanine amidase | |
| 3768 | CALHMO010000243.1 | GCA938035375_01879 | CDS | open | 295-798 | _na 167_aa | N-terminal cleavage protein | |
| 3769 | CALHMO010000243.1 | GCA938035375_01880 | CDS | open | 1091-1315 | _na 74_aa | hypothetical protein | |
| 3770 | CALHMO010000243.1 | GCA938035375_01881 | CDS | open | 1590-2363 | _na 257_aa | mrp | Iron-sulfur cluster carrier protein |
| 3771 | CALHMO010000243.1 | GCA938035375_01882 | CDS | open | 2503-2880 | _na 125_aa | ybaN | DUF454 domain-containing protein |
| 3772 | CALHMO010000243.1 | GCA938035375_01883 | CDS | open | 2890-3681 | _na 263_aa | hypothetical protein | |
| 3773 | CALHMO010000243.1 | GCA938035375_01884 | CDS | open | 3699-4436 | _na 245_aa | hypothetical protein | |
| 3774 | CALHMO010000243.1 | GCA938035375_01885 | CDS | open | 4572-6065 | _na 497_aa | Peptidase S8/S53 domain-containing protein | |
| 3775 | CALHMO010000243.1 | GCA938035375_01886 | CDS | open | 6075-6980 | _na 301_aa | eamA | EamA domain-containing protein |
| 3776 | CALHMO010000243.1 | GCA938035375_01887 | CDS | open | 6998-8890 | _na 630_aa | abc-f | ribosomal protection-like ABC-F family protein |
| 3777 | CALHMO010000243.1 | GCA938035375_01888 | CDS | open | 9031-10008 | _na 325_aa | tctC | Recombinase RecA |
| 3778 | CALHMO010000243.1 | GCA938035375_01889 | CDS | open | 10104-10550 | _na 148_aa | DUF1468 domain-containing protein | |
| 3779 | CALHMO010000243.1 | GCA938035375_01890 | CDS | open | 10571-12055 | _na 494_aa | DUF112 domain-containing protein | |
| 3780 | CALHMO010000243.1 | GCA938035375_01891 | CDS | open | 12123-12392 | _na 89_aa | hypothetical protein | |
| 3781 | CALHMO010000243.1 | GCA938035375_01892 | CDS | open | 12696-12935 | _na 79_aa | DUF1413 domain-containing protein | |
| 3782 | CALHMO010000243.1 | GCA938035375_01878 | gene | open | 125-307 | |||
| 3783 | CALHMO010000243.1 | GCA938035375_01879 | gene | open | 295-798 | |||
| 3784 | CALHMO010000243.1 | GCA938035375_01880 | gene | open | 1091-1315 | |||
| 3785 | CALHMO010000243.1 | GCA938035375_01881 | gene | open | 1590-2363 | mrp | ||
| 3786 | CALHMO010000243.1 | GCA938035375_01882 | gene | open | 2503-2880 | ybaN | ||
| 3787 | CALHMO010000243.1 | GCA938035375_01883 | gene | open | 2890-3681 | |||
| 3788 | CALHMO010000243.1 | GCA938035375_01884 | gene | open | 3699-4436 | |||
| 3789 | CALHMO010000243.1 | GCA938035375_01885 | gene | open | 4572-6065 | |||
| 3790 | CALHMO010000243.1 | GCA938035375_01886 | gene | open | 6075-6980 | eamA | ||
| 3791 | CALHMO010000243.1 | GCA938035375_01887 | gene | open | 6998-8890 | abc-f | ||
| 3792 | CALHMO010000243.1 | GCA938035375_01888 | gene | open | 9031-10008 | tctC | ||
| 3793 | CALHMO010000243.1 | GCA938035375_01889 | gene | open | 10104-10550 | |||
| 3794 | CALHMO010000243.1 | GCA938035375_01890 | gene | open | 10571-12055 | |||
| 3795 | CALHMO010000243.1 | GCA938035375_01891 | gene | open | 12123-12392 | |||
| 3796 | CALHMO010000243.1 | GCA938035375_01892 | gene | open | 12696-12935 | |||
| 3797 | CALHMO010000244.1 | GCA938035375_01893 | CDS | open | 129-425 | _na 98_aa | sepF | Cell division protein SepF |
| 3798 | CALHMO010000244.1 | GCA938035375_01894 | CDS | open | 514-1479 | _na 321_aa | nrnA | Adhesin |
| 3799 | CALHMO010000244.1 | GCA938035375_01895 | CDS | open | 1494-3341 | _na 615_aa | hprK | HPr(Ser) kinase/phosphatase |
| 3800 | CALHMO010000244.1 | GCA938035375_01896 | CDS | open | 3362-4186 | _na 274_aa | hypothetical protein | |
| 3801 | CALHMO010000244.1 | GCA938035375_01897 | CDS | open | 4179-5414 | _na 411_aa | folC | tetrahydrofolate synthase |
| 3802 | CALHMO010000244.1 | GCA938035375_01898 | CDS | open | 5426-6127 | _na 233_aa | mtnN | 5'-methylthioadenosine/adenosylhomocysteine nucleosidase |
| 3803 | CALHMO010000244.1 | GCA938035375_01899 | CDS | open | 6247-7155 | _na 302_aa | Lauroyl acyltransferase | |
| 3804 | CALHMO010000244.1 | GCA938035375_01900 | CDS | open | 7140-7958 | _na 272_aa | Lipoprotein | |
| 3805 | CALHMO010000244.1 | GCA938035375_01901 | CDS | open | 7994-8833 | _na 279_aa | fadB | 3-hydroxybutyryl-CoA dehydrogenase |
| 3806 | CALHMO010000244.1 | GCA938035375_01902 | CDS | open | 8849-9625 | _na 258_aa | caiD | 3-hydroxybutyryl-CoA dehydratase |
| 3807 | CALHMO010000244.1 | GCA938035375_01903 | CDS | open | 9931-12519 | _na 862_aa | mgtA | calcium-translocating P-type ATPase%2C PMCA-type |
| 3808 | CALHMO010000244.1 | GCA938035375_01904 | CDS | open | 12678-13034 | _na 118_aa | HTH cro/C1-type domain-containing protein | |
| 3809 | CALHMO010000244.1 | GCA938035375_01893 | gene | open | 129-425 | sepF | ||
| 3810 | CALHMO010000244.1 | GCA938035375_01894 | gene | open | 514-1479 | nrnA | ||
| 3811 | CALHMO010000244.1 | GCA938035375_01895 | gene | open | 1494-3341 | hprK | ||
| 3812 | CALHMO010000244.1 | GCA938035375_01896 | gene | open | 3362-4186 | |||
| 3813 | CALHMO010000244.1 | GCA938035375_01897 | gene | open | 4179-5414 | folC | ||
| 3814 | CALHMO010000244.1 | GCA938035375_01898 | gene | open | 5426-6127 | mtnN | ||
| 3815 | CALHMO010000244.1 | GCA938035375_01899 | gene | open | 6247-7155 | |||
| 3816 | CALHMO010000244.1 | GCA938035375_01900 | gene | open | 7140-7958 | |||
| 3817 | CALHMO010000244.1 | GCA938035375_01901 | gene | open | 7994-8833 | fadB | ||
| 3818 | CALHMO010000244.1 | GCA938035375_01902 | gene | open | 8849-9625 | caiD | ||
| 3819 | CALHMO010000244.1 | GCA938035375_01903 | gene | open | 9931-12519 | mgtA | ||
| 3820 | CALHMO010000244.1 | GCA938035375_01904 | gene | open | 12678-13034 | |||
| 3821 | CALHMO010000245.1 | GCA938035375_01905 | CDS | open | 928-1305 | _na 125_aa | arsR | HTH arsR-type domain-containing protein |
| 3822 | CALHMO010000245.1 | GCA938035375_01906 | CDS | open | 1308-1529 | _na 73_aa | copZ | YvgW protein |
| 3823 | CALHMO010000245.1 | GCA938035375_01907 | CDS | open | 1597-3441 | _na 614_aa | p-ATPase superfamily P-type ATPase cadmium transporter | |
| 3824 | CALHMO010000245.1 | GCA938035375_01908 | CDS | open | 3500-5014 | _na 504_aa | yfcC | YfcC family protein |
| 3825 | CALHMO010000245.1 | GCA938035375_01909 | CDS | open | 5130-6755 | _na 541_aa | AAA-ATPase-like domain-containing protein | |
| 3826 | CALHMO010000245.1 | GCA938035375_01910 | CDS | open | 6810-12941 | _na 2043_aa | Autotransporter domain-containing protein | |
| 3827 | CALHMO010000245.1 | GCA938035375_01911 | CDS | open | 12959-13534 | _na 191_aa | OmpA-like domain-containing protein | |
| 3828 | CALHMO010000245.1 | GCA938035375_01912 | CDS | open | 13501-13749 | _na 82_aa | Lipoprotein | |
| 3829 | CALHMO010000245.1 | GCA938035375_01913 | CDS | open | 13766-14140 | _na 124_aa | fadA | Adhesion protein FadA |
| 3830 | CALHMO010000245.1 | GCA938035375_01914 | CDS | open | 14155-14709 | _na 184_aa | Stress response protein NST1 | |
| 3831 | CALHMO010000245.1 | GCA938035375_01915 | CDS | open | 14725-15129 | _na 134_aa | fadA | Adhesion protein FadA |
| 3832 | CALHMO010000245.1 | GCA938035375_01916 | CDS | open | 15382-15729 | _na 115_aa | Txe/YoeB family addiction module toxin | |
| 3833 | CALHMO010000245.1 | GCA938035375_01917 | CDS | open | 15723-15980 | _na 85_aa | Prevent-host-death protein | |
| 3834 | CALHMO010000245.1 | GCA938035375_01918 | CDS | open | 16042-16968 | _na 308_aa | ywqK | Toxin-antitoxin system YwqK family antitoxin |
| 3835 | CALHMO010000245.1 | GCA938035375_01919 | CDS | open | 17033-17863 | _na 276_aa | Cytoplasmic protein | |
| 3836 | CALHMO010000245.1 | GCA938035375_01920 | CDS | open | 17941-18483 | _na 180_aa | hypothetical protein | |
| 3837 | CALHMO010000245.1 | GCA938035375_01905 | gene | open | 928-1305 | arsR | ||
| 3838 | CALHMO010000245.1 | GCA938035375_01906 | gene | open | 1308-1529 | copZ | ||
| 3839 | CALHMO010000245.1 | GCA938035375_01907 | gene | open | 1597-3441 | |||
| 3840 | CALHMO010000245.1 | GCA938035375_01908 | gene | open | 3500-5014 | yfcC | ||
| 3841 | CALHMO010000245.1 | GCA938035375_01909 | gene | open | 5130-6755 | |||
| 3842 | CALHMO010000245.1 | GCA938035375_01910 | gene | open | 6810-12941 | |||
| 3843 | CALHMO010000245.1 | GCA938035375_01911 | gene | open | 12959-13534 | |||
| 3844 | CALHMO010000245.1 | GCA938035375_01912 | gene | open | 13501-13749 | |||
| 3845 | CALHMO010000245.1 | GCA938035375_01913 | gene | open | 13766-14140 | fadA | ||
| 3846 | CALHMO010000245.1 | GCA938035375_01914 | gene | open | 14155-14709 | |||
| 3847 | CALHMO010000245.1 | GCA938035375_01915 | gene | open | 14725-15129 | fadA | ||
| 3848 | CALHMO010000245.1 | GCA938035375_01916 | gene | open | 15382-15729 | |||
| 3849 | CALHMO010000245.1 | GCA938035375_01917 | gene | open | 15723-15980 | |||
| 3850 | CALHMO010000245.1 | GCA938035375_01918 | gene | open | 16042-16968 | ywqK | ||
| 3851 | CALHMO010000245.1 | GCA938035375_01919 | gene | open | 17033-17863 | |||
| 3852 | CALHMO010000245.1 | GCA938035375_01920 | gene | open | 17941-18483 | |||
| 3853 | CALHMO010000246.1 | GCA938035375_01921 | CDS | open | 79-1140 | _na 353_aa | hypothetical protein | |
| 3854 | CALHMO010000246.1 | GCA938035375_01922 | CDS | open | 1155-2579 | _na 474_aa | site-specific DNA-methyltransferase (adenine-specific) | |
| 3855 | CALHMO010000246.1 | GCA938035375_01923 | CDS | open | 2582-3514 | _na 310_aa | restriction endonuclease subunit S | |
| 3856 | CALHMO010000246.1 | GCA938035375_01921 | gene | open | 79-1140 | |||
| 3857 | CALHMO010000246.1 | GCA938035375_01922 | gene | open | 1155-2579 | |||
| 3858 | CALHMO010000246.1 | GCA938035375_01923 | gene | open | 2582-3514 | |||
| 3859 | CALHMO010000247.1 | GCA938035375_01924 | CDS | open | 115-1089 | _na 324_aa | pip | prolyl aminopeptidase |
| 3860 | CALHMO010000247.1 | GCA938035375_01925 | CDS | open | 1089-2099 | _na 336_aa | ansA | asparaginase |
| 3861 | CALHMO010000247.1 | GCA938035375_01926 | CDS | open | 2115-2840 | _na 241_aa | Molybdate ABC transporter substrate-binding protein | |
| 3862 | CALHMO010000247.1 | GCA938035375_01927 | CDS | open | 2858-4108 | _na 416_aa | ykuD | YkuD domain-containing protein |
| 3863 | CALHMO010000247.1 | GCA938035375_01928 | CDS | open | 4214-5572 | _na 452_aa | DUF1576 domain-containing protein | |
| 3864 | CALHMO010000247.1 | GCA938035375_01929 | CDS | open | 5560-6075 | _na 171_aa | mutT | Nudix hydrolase domain-containing protein |
| 3865 | CALHMO010000247.1 | GCA938035375_01924 | gene | open | 115-1089 | pip | ||
| 3866 | CALHMO010000247.1 | GCA938035375_01925 | gene | open | 1089-2099 | ansA | ||
| 3867 | CALHMO010000247.1 | GCA938035375_01926 | gene | open | 2115-2840 | |||
| 3868 | CALHMO010000247.1 | GCA938035375_01927 | gene | open | 2858-4108 | ykuD | ||
| 3869 | CALHMO010000247.1 | GCA938035375_01928 | gene | open | 4214-5572 | |||
| 3870 | CALHMO010000247.1 | GCA938035375_01929 | gene | open | 5560-6075 | mutT | ||
| 3871 | CALHMO010000248.1 | GCA938035375_01930 | CDS | open | 762-1352 | _na 196_aa | DUF304 domain-containing protein | |
| 3872 | CALHMO010000248.1 | GCA938035375_01931 | CDS | open | 1340-1831 | _na 163_aa | YcxB-like protein domain-containing protein | |
| 3873 | CALHMO010000248.1 | GCA938035375_01932 | CDS | open | 1851-3476 | _na 541_aa | DUF2207 domain-containing protein | |
| 3874 | CALHMO010000248.1 | GCA938035375_01933 | CDS | open | 3493-4011 | _na 172_aa | Histidine kinase | |
| 3875 | CALHMO010000248.1 | GCA938035375_01934 | CDS | open | 4022-4561 | _na 179_aa | Histidine kinase | |
| 3876 | CALHMO010000248.1 | GCA938035375_01935 | CDS | open | 4806-5333 | _na 175_aa | hypothetical protein | |
| 3877 | CALHMO010000248.1 | GCA938035375_01936 | CDS | open | 5355-5702 | _na 115_aa | hypothetical protein | |
| 3878 | CALHMO010000248.1 | GCA938035375_01937 | CDS | open | 5715-5999 | _na 94_aa | CXXX repeat peptide modification system protein | |
| 3879 | CALHMO010000248.1 | GCA938035375_01938 | CDS | open | 6090-6587 | _na 165_aa | N-acetyltransferase domain-containing protein | |
| 3880 | CALHMO010000248.1 | GCA938035375_01939 | CDS | open | 6591-6704 | _na 37_aa | hypothetical protein | |
| 3881 | CALHMO010000248.1 | GCA938035375_01940 | CDS | open | 6716-7612 | _na 298_aa | N-acetylmuramoyl-L-alanine amidase | |
| 3882 | CALHMO010000248.1 | GCA938035375_01941 | CDS | open | 7714-10959 | _na 1081_aa | metH | methionine synthase |
| 3883 | CALHMO010000248.1 | GCA938035375_01930 | gene | open | 762-1352 | |||
| 3884 | CALHMO010000248.1 | GCA938035375_01931 | gene | open | 1340-1831 | |||
| 3885 | CALHMO010000248.1 | GCA938035375_01932 | gene | open | 1851-3476 | |||
| 3886 | CALHMO010000248.1 | GCA938035375_01933 | gene | open | 3493-4011 | |||
| 3887 | CALHMO010000248.1 | GCA938035375_01934 | gene | open | 4022-4561 | |||
| 3888 | CALHMO010000248.1 | GCA938035375_01935 | gene | open | 4806-5333 | |||
| 3889 | CALHMO010000248.1 | GCA938035375_01936 | gene | open | 5355-5702 | |||
| 3890 | CALHMO010000248.1 | GCA938035375_01937 | gene | open | 5715-5999 | |||
| 3891 | CALHMO010000248.1 | GCA938035375_01938 | gene | open | 6090-6587 | |||
| 3892 | CALHMO010000248.1 | GCA938035375_01939 | gene | open | 6591-6704 | |||
| 3893 | CALHMO010000248.1 | GCA938035375_01940 | gene | open | 6716-7612 | |||
| 3894 | CALHMO010000248.1 | GCA938035375_01941 | gene | open | 7714-10959 | metH | ||
| 3895 | CALHMO010000249.1 | GCA938035375_01942 | CDS | open | 93-854 | _na 253_aa | sseB | Enhanced serine sensitivity protein SseB |
| 3896 | CALHMO010000249.1 | GCA938035375_01943 | CDS | open | 1084-2370 | _na 428_aa | Membrane iron-sulfur containing protein FtrD-like domain-containing protein | |
| 3897 | CALHMO010000249.1 | GCA938035375_01944 | CDS | open | 2372-3652 | _na 426_aa | lolE | Efflux ABC transporter%2C permease protein |
| 3898 | CALHMO010000249.1 | GCA938035375_01945 | CDS | open | 3662-4864 | _na 400_aa | lolE | ABC transporter permease |
| 3899 | CALHMO010000249.1 | GCA938035375_01946 | CDS | open | 4868-5560 | _na 230_aa | lolD | ABC transporter domain-containing protein |
| 3900 | CALHMO010000249.1 | GCA938035375_01947 | CDS | open | 5779-6513 | _na 244_aa | glpR | HTH deoR-type domain-containing protein |
| 3901 | CALHMO010000249.1 | GCA938035375_01942 | gene | open | 93-854 | sseB | ||
| 3902 | CALHMO010000249.1 | GCA938035375_01943 | gene | open | 1084-2370 | |||
| 3903 | CALHMO010000249.1 | GCA938035375_01944 | gene | open | 2372-3652 | lolE | ||
| 3904 | CALHMO010000249.1 | GCA938035375_01945 | gene | open | 3662-4864 | lolE | ||
| 3905 | CALHMO010000249.1 | GCA938035375_01946 | gene | open | 4868-5560 | lolD | ||
| 3906 | CALHMO010000249.1 | GCA938035375_01947 | gene | open | 5779-6513 | glpR | ||
| 3907 | CALHMO010000250.1 | GCA938035375_01948 | CDS | open | 17-1570 | _na 517_aa | Methyltransferase | |
| 3908 | CALHMO010000250.1 | GCA938035375_01949 | CDS | open | 1602-2552 | _na 316_aa | secF | protein translocase subunit SecF |
| 3909 | CALHMO010000250.1 | GCA938035375_01950 | CDS | open | 2552-3787 | _na 411_aa | secD | Protein translocase subunit SecD |
| 3910 | CALHMO010000250.1 | GCA938035375_01951 | CDS | open | 3784-4227 | _na 147_aa | ruvX | Holliday junction resolvase RuvX |
| 3911 | CALHMO010000250.1 | GCA938035375_01952 | CDS | open | 4474-7077 | _na 867_aa | alaS | alanine--tRNA ligase |
| 3912 | CALHMO010000250.1 | GCA938035375_01953 | CDS | open | 7089-7814 | _na 241_aa | lptB | LPS export ABC transporter ATP-binding protein |
| 3913 | CALHMO010000250.1 | GCA938035375_01954 | CDS | open | 8104-10809 | _na 901_aa | lptC | LPS export ABC transporter periplasmic protein LptC |
| 3914 | CALHMO010000250.1 | GCA938035375_01955 | CDS | open | 10802-13432 | _na 876_aa | mutS | DNA mismatch repair protein MutS |
| 3915 | CALHMO010000250.1 | GCA938035375_01956 | CDS | open | 13556-14482 | _na 308_aa | dusA | tRNA-dihydrouridine synthase |
| 3916 | CALHMO010000250.1 | GCA938035375_01957 | CDS | open | 14586-15158 | _na 190_aa | Trimeric autotransporter adhesin YadA-like C-terminal membrane anchor domain-containing protein | |
| 3917 | CALHMO010000250.1 | GCA938035375_01958 | CDS | open | 15210-15722 | _na 170_aa | DUF5105 domain-containing protein | |
| 3918 | CALHMO010000250.1 | GCA938035375_01959 | CDS | open | 15793-16305 | _na 170_aa | DUF5105 domain-containing protein | |
| 3919 | CALHMO010000250.1 | GCA938035375_01960 | CDS | open | 16359-17762 | _na 467_aa | Transposase | |
| 3920 | CALHMO010000250.1 | GCA938035375_01961 | CDS | open | 17895-18188 | _na 97_aa | yhdT | DUF997 domain-containing protein |
| 3921 | CALHMO010000250.1 | GCA938035375_01962 | CDS | open | 18201-19655 | _na 484_aa | panF | sodium/pantothenate symporter |
| 3922 | CALHMO010000250.1 | GCA938035375_01963 | CDS | open | 19910-20407 | _na 165_aa | DUF697 domain-containing protein | |
| 3923 | CALHMO010000250.1 | GCA938035375_01964 | CDS | open | 20417-20809 | _na 130_aa | Cation transporter | |
| 3924 | CALHMO010000250.1 | GCA938035375_01965 | CDS | open | 20806-23013 | _na 735_aa | zntA | putative cadmium-transporting ATPase |
| 3925 | CALHMO010000250.1 | GCA938035375_01966 | CDS | open | 23026-23778 | _na 250_aa | hypothetical protein | |
| 3926 | CALHMO010000250.1 | GCA938035375_01967 | CDS | open | 23862-24134 | _na 90_aa | Tat pathway signal protein | |
| 3927 | CALHMO010000250.1 | GCA938035375_01968 | CDS | open | 24235-24474 | _na 79_aa | DUF4176 domain-containing protein | |
| 3928 | CALHMO010000250.1 | GCA938035375_01969 | CDS | open | 24505-25557 | _na 350_aa | dinB | DNA polymerase IV |
| 3929 | CALHMO010000250.1 | GCA938035375_01970 | CDS | open | 25628-25996 | _na 122_aa | hypothetical protein | |
| 3930 | CALHMO010000250.1 | GCA938035375_01971 | CDS | open | 26003-26779 | _na 258_aa | nadE | NAD+ synthase |
| 3931 | CALHMO010000250.1 | GCA938035375_01972 | CDS | open | 26792-27661 | _na 289_aa | ylqF | ribosome biogenesis GTPase YlqF |
| 3932 | CALHMO010000250.1 | GCA938035375_01973 | CDS | open | 27642-28349 | _na 235_aa | rsmI | 16S rRNA (cytidine(1402)-2'-O)-methyltransferase |
| 3933 | CALHMO010000250.1 | GCA938035375_01974 | CDS | open | 28360-29679 | _na 439_aa | ctpA | PDZ domain-containing protein |
| 3934 | CALHMO010000250.1 | GCA938035375_01975 | CDS | open | 29695-30501 | _na 268_aa | Ribosomal RNA large subunit methyltransferase J | |
| 3935 | CALHMO010000250.1 | GCA938035375_01976 | CDS | open | 30479-31303 | _na 274_aa | yhaM | HD domain-containing protein |
| 3936 | CALHMO010000250.1 | GCA938035375_01977 | CDS | open | 31287-33089 | _na 600_aa | dxs | 1-deoxy-D-xylulose-5-phosphate synthase |
| 3937 | CALHMO010000250.1 | GCA938035375_01978 | CDS | open | 33103-33402 | _na 99_aa | yhbY | ribosome assembly RNA-binding protein YhbY |
| 3938 | CALHMO010000250.1 | GCA938035375_01979 | CDS | open | 33679-35574 | _na 631_aa | rnjA | Ribonuclease J |
| 3939 | CALHMO010000250.1 | GCA938035375_01980 | CDS | open | 35522-37495 | _na 657_aa | mrdA | penicillin-binding protein 2 |
| 3940 | CALHMO010000250.1 | GCA938035375_01981 | CDS | open | 37485-37907 | _na 140_aa | mreD | Rod shape-determining protein MreD |
| 3941 | CALHMO010000250.1 | GCA938035375_01982 | CDS | open | 37918-38901 | _na 327_aa | LytR/CpsA/Psr regulator C-terminal domain-containing protein | |
| 3942 | CALHMO010000250.1 | GCA938035375_01983 | CDS | open | 38904-40211 | _na 435_aa | mtaB | tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB |
| 3943 | CALHMO010000250.1 | GCA938035375_01984 | CDS | open | 40198-40905 | _na 235_aa | rsmE | Ribosomal RNA small subunit methyltransferase E |
| 3944 | CALHMO010000250.1 | GCA938035375_01985 | CDS | open | 40909-41340 | _na 143_aa | iscR | RRF2 family protein |
| 3945 | CALHMO010000250.1 | GCA938035375_01986 | CDS | open | 41337-42335 | _na 332_aa | ruvB | Holliday junction branch migration DNA helicase RuvB |
| 3946 | CALHMO010000250.1 | GCA938035375_01948 | gene | open | 17-1570 | |||
| 3947 | CALHMO010000250.1 | GCA938035375_01949 | gene | open | 1602-2552 | secF | ||
| 3948 | CALHMO010000250.1 | GCA938035375_01950 | gene | open | 2552-3787 | secD | ||
| 3949 | CALHMO010000250.1 | GCA938035375_01951 | gene | open | 3784-4227 | ruvX | ||
| 3950 | CALHMO010000250.1 | GCA938035375_01952 | gene | open | 4474-7077 | alaS | ||
| 3951 | CALHMO010000250.1 | GCA938035375_01953 | gene | open | 7089-7814 | lptB | ||
| 3952 | CALHMO010000250.1 | GCA938035375_01954 | gene | open | 8104-10809 | lptC | ||
| 3953 | CALHMO010000250.1 | GCA938035375_01955 | gene | open | 10802-13432 | mutS | ||
| 3954 | CALHMO010000250.1 | GCA938035375_01956 | gene | open | 13556-14482 | dusA | ||
| 3955 | CALHMO010000250.1 | GCA938035375_01957 | gene | open | 14586-15158 | |||
| 3956 | CALHMO010000250.1 | GCA938035375_01958 | gene | open | 15210-15722 | |||
| 3957 | CALHMO010000250.1 | GCA938035375_01959 | gene | open | 15793-16305 | |||
| 3958 | CALHMO010000250.1 | GCA938035375_01960 | gene | open | 16359-17762 | |||
| 3959 | CALHMO010000250.1 | GCA938035375_01961 | gene | open | 17895-18188 | yhdT | ||
| 3960 | CALHMO010000250.1 | GCA938035375_01962 | gene | open | 18201-19655 | panF | ||
| 3961 | CALHMO010000250.1 | GCA938035375_01963 | gene | open | 19910-20407 | |||
| 3962 | CALHMO010000250.1 | GCA938035375_01964 | gene | open | 20417-20809 | |||
| 3963 | CALHMO010000250.1 | GCA938035375_01965 | gene | open | 20806-23013 | zntA | ||
| 3964 | CALHMO010000250.1 | GCA938035375_01966 | gene | open | 23026-23778 | |||
| 3965 | CALHMO010000250.1 | GCA938035375_01967 | gene | open | 23862-24134 | |||
| 3966 | CALHMO010000250.1 | GCA938035375_01968 | gene | open | 24235-24474 | |||
| 3967 | CALHMO010000250.1 | GCA938035375_01969 | gene | open | 24505-25557 | dinB | ||
| 3968 | CALHMO010000250.1 | GCA938035375_01970 | gene | open | 25628-25996 | |||
| 3969 | CALHMO010000250.1 | GCA938035375_01971 | gene | open | 26003-26779 | nadE | ||
| 3970 | CALHMO010000250.1 | GCA938035375_01972 | gene | open | 26792-27661 | ylqF | ||
| 3971 | CALHMO010000250.1 | GCA938035375_01973 | gene | open | 27642-28349 | rsmI | ||
| 3972 | CALHMO010000250.1 | GCA938035375_01974 | gene | open | 28360-29679 | ctpA | ||
| 3973 | CALHMO010000250.1 | GCA938035375_01975 | gene | open | 29695-30501 | |||
| 3974 | CALHMO010000250.1 | GCA938035375_01976 | gene | open | 30479-31303 | yhaM | ||
| 3975 | CALHMO010000250.1 | GCA938035375_01977 | gene | open | 31287-33089 | dxs | ||
| 3976 | CALHMO010000250.1 | GCA938035375_01978 | gene | open | 33103-33402 | yhbY | ||
| 3977 | CALHMO010000250.1 | GCA938035375_01979 | gene | open | 33679-35574 | rnjA | ||
| 3978 | CALHMO010000250.1 | GCA938035375_01980 | gene | open | 35522-37495 | mrdA | ||
| 3979 | CALHMO010000250.1 | GCA938035375_01981 | gene | open | 37485-37907 | mreD | ||
| 3980 | CALHMO010000250.1 | GCA938035375_01982 | gene | open | 37918-38901 | |||
| 3981 | CALHMO010000250.1 | GCA938035375_01983 | gene | open | 38904-40211 | mtaB | ||
| 3982 | CALHMO010000250.1 | GCA938035375_01984 | gene | open | 40198-40905 | rsmE | ||
| 3983 | CALHMO010000250.1 | GCA938035375_01985 | gene | open | 40909-41340 | iscR | ||
| 3984 | CALHMO010000250.1 | GCA938035375_01986 | gene | open | 41337-42335 | ruvB | ||
| 3985 | CALHMO010000251.1 | GCA938035375_01987 | CDS | open | 77-871 | _na 264_aa | HAD-IIA family hydrolase | |
| 3986 | CALHMO010000251.1 | GCA938035375_01988 | CDS | open | 940-1197 | _na 85_aa | Oxygen-insensitive NAD(P)H nitroreductase | |
| 3987 | CALHMO010000251.1 | GCA938035375_01989 | CDS | open | 1264-1467 | _na 67_aa | YMGG-like Gly-zipper domain-containing protein | |
| 3988 | CALHMO010000251.1 | GCA938035375_01990 | CDS | open | 1593-2276 | _na 227_aa | tpd | Fe2+ transport protein |
| 3989 | CALHMO010000251.1 | GCA938035375_01991 | CDS | open | 2336-3673 | _na 445_aa | FTR1 family protein | |
| 3990 | CALHMO010000251.1 | GCA938035375_01992 | CDS | open | 3859-5205 | _na 448_aa | nCS2 | Guanine permease |
| 3991 | CALHMO010000251.1 | GCA938035375_01993 | CDS | open | 5339-6472 | _na 377_aa | ADP-heptose--LPS heptosyltransferase | |
| 3992 | CALHMO010000251.1 | GCA938035375_01994 | CDS | open | 6483-7643 | _na 386_aa | Glycosyl transferase family 1 domain-containing protein | |
| 3993 | CALHMO010000251.1 | GCA938035375_01995 | CDS | open | 7751-8485 | _na 244_aa | Mutator family transposase | |
| 3994 | CALHMO010000251.1 | GCA938035375_01996 | CDS | open | 8658-8993 | _na 111_aa | IS256 family transposase | |
| 3995 | CALHMO010000251.1 | GCA938035375_01997 | CDS | open | 9205-10239 | _na 344_aa | Heptosyltransferase | |
| 3996 | CALHMO010000251.1 | GCA938035375_01998 | CDS | open | 10332-11099 | _na 255_aa | Lipopolysaccharide biosynthesis protein | |
| 3997 | CALHMO010000251.1 | GCA938035375_01999 | CDS | open | 11101-12306 | _na 401_aa | O-antigen ligase | |
| 3998 | CALHMO010000251.1 | GCA938035375_01987 | gene | open | 77-871 | |||
| 3999 | CALHMO010000251.1 | GCA938035375_01988 | gene | open | 940-1197 | |||
| 4000 | CALHMO010000251.1 | GCA938035375_01989 | gene | open | 1264-1467 |

