HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Dialister invisus (GCA_938036385.1)

Select a Genome:
BAKTA Annotations for GCA_938036385.1
Genome Selected: Dialister invisus
ContigsBases CDSrRNA tmRNAtRNA
37 1920595 1871 0 1 47
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3869 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:4]    |    Number of Records Found: 3869 [8 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1501 CALHPR010000014.1 GCA938036385_00735 gene open 275646-276302 trmB
1502 CALHPR010000014.1 GCA938036385_00736 gene open 276378-278417
1503 CALHPR010000014.1 GCA938036385_00737 gene open 278578-279942
1504 CALHPR010000014.1 GCA938036385_00738 gene open 279952-280224
1505 CALHPR010000014.1 GCA938036385_00739 gene open 280436-281200
1506 CALHPR010000014.1 GCA938036385_00740 gene open 281254-281958
1507 CALHPR010000014.1 GCA938036385_00741 gene open 282026-282946
1508 CALHPR010000014.1 GCA938036385_00742 gene open 283006-283806
1509 CALHPR010000014.1 GCA938036385_00743 gene open 283887-284759
1510 CALHPR010000014.1 GCA938036385_00744 gene open 285218-286159
1511 CALHPR010000014.1 GCA938036385_00745 gene open 286420-287193 trpA
1512 CALHPR010000014.1 GCA938036385_00746 gene open 287204-288388 trpB
1513 CALHPR010000014.1 GCA938036385_00747 gene open 288989-289381
1514 CALHPR010000014.1 GCA938036385_00748 gene open 289467-289688
1515 CALHPR010000014.1 GCA938036385_00749 gene open 289782-290117
1516 CALHPR010000014.1 GCA938036385_00750 gene open 290175-292070
1517 CALHPR010000014.1 GCA938036385_00751 gene open 292236-292691
1518 CALHPR010000014.1 GCA938036385_00752 gene open 292706-292882 rpsU
1519 CALHPR010000014.1 GCA938036385_00753 gene open 292983-293342
1520 CALHPR010000014.1 GCA938036385_00754 gene open 293335-294678 mtaB
1521 CALHPR010000014.1 GCA938036385_00755 gene open 295252-296379
1522 CALHPR010000014.1 GCA938036385_00756 gene open 296416-296631
1523 CALHPR010000014.1 GCA938036385_00757 gene open 297051-297317
1524 CALHPR010000014.1 GCA938036385_00758 gene open 297362-297580
1525 CALHPR010000014.1 GCA938036385_00759 gene open 297954-298376
1526 CALHPR010000014.1 GCA938036385_00760 gene open 298378-298668
1527 CALHPR010000014.1 GCA938036385_00761 gene open 298665-298853
1528 CALHPR010000014.1 GCA938036385_00762 gene open 299083-299874
1529 CALHPR010000014.1 GCA938036385_00763 gene open 299986-300525
1530 CALHPR010000014.1 GCA938036385_00764 gene open 300522-300974
1531 CALHPR010000014.1 GCA938036385_00765 gene open 300975-303059
1532 CALHPR010000014.1 GCA938036385_00766 gene open 303229-303498 rpsO
1533 CALHPR010000014.1 GCA938036385_00767 gene open 303615-304403
1534 CALHPR010000014.1 GCA938036385_00768 gene open 304406-305248
1535 CALHPR010000014.1 GCA938036385_00769 gene open 305310-306317
1536 CALHPR010000014.1 GCA938036385_00770 gene open 306368-307360
1537 CALHPR010000014.1 GCA938036385_00466 gene open 57-130 trnC
1538 CALHPR010000014.1 GCA938036385_00467 gene open 158-246 trnL
1539 CALHPR010000014.1 GCA938036385_00502 gene open 40648-40724 trnI
1540 CALHPR010000014.1 GCA938036385_00542 gene open 78028-78104 trnP
1541 CALHPR010000014.1 GCA938036385_00646 gene open 182555-182643 trnS
1542 CALHPR010000014.1 GCA938036385_00466 tRNA open 57-130 trnC tRNA-Cys(gca)
1543 CALHPR010000014.1 GCA938036385_00467 tRNA open 158-246 trnL tRNA-Leu(taa)
1544 CALHPR010000014.1 GCA938036385_00502 tRNA open 40648-40724 trnI tRNA-Ile2(cat)
1545 CALHPR010000014.1 GCA938036385_00542 tRNA open 78028-78104 trnP tRNA-Pro(ggg)
1546 CALHPR010000014.1 GCA938036385_00646 tRNA open 182555-182643 trnS tRNA-Ser(cga)
1547 CALHPR010000015.1 GCA938036385_00771 CDS open 410-1303 _na     297_aa Putative membrane protein
1548 CALHPR010000015.1 GCA938036385_00772 CDS open 1387-3183 _na     598_aa lepA translation elongation factor 4
1549 CALHPR010000015.1 GCA938036385_00773 CDS open 3176-4315 _na     379_aa hemW radical SAM family heme chaperone HemW
1550 CALHPR010000015.1 GCA938036385_00774 CDS open 4423-5523 _na     366_aa alr alanine racemase
1551 CALHPR010000015.1 GCA938036385_00777 CDS open 6438-7946 _na     502_aa thrC threonine synthase
1552 CALHPR010000015.1 GCA938036385_00778 CDS open 7939-8646 _na     235_aa TVP38/TMEM64 family membrane protein
1553 CALHPR010000015.1 GCA938036385_00779 CDS open 8931-9398 _na     155_aa YhcH/YjgK/YiaL family protein
1554 CALHPR010000015.1 GCA938036385_00780 CDS open 9523-10713 _na     396_aa Efflux transporter%2C RND family%2C MFP subunit
1555 CALHPR010000015.1 GCA938036385_00781 CDS open 10723-13863 _na     1046_aa RND transporter%2C HAE1 family
1556 CALHPR010000015.1 GCA938036385_00782 CDS open 14012-14956 _na     314_aa manganese-dependent inorganic pyrophosphatase
1557 CALHPR010000015.1 GCA938036385_00783 CDS open 15029-17239 _na     736_aa pcrA DNA helicase PcrA
1558 CALHPR010000015.1 GCA938036385_00784 CDS open 17241-19250 _na     669_aa ligA NAD-dependent DNA ligase LigA
1559 CALHPR010000015.1 GCA938036385_00785 CDS open 19319-19603 _na     94_aa gatC Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC
1560 CALHPR010000015.1 GCA938036385_00786 CDS open 19615-21069 _na     484_aa gatA Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA
1561 CALHPR010000015.1 GCA938036385_00787 CDS open 21066-22511 _na     481_aa gatB Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB
1562 CALHPR010000015.1 GCA938036385_00788 CDS open 22508-22822 _na     104_aa hypothetical protein
1563 CALHPR010000015.1 GCA938036385_00789 CDS open 22953-25061 _na     702_aa uvrB excinuclease ABC subunit UvrB
1564 CALHPR010000015.1 GCA938036385_00790 CDS open 25080-27932 _na     950_aa uvrA excinuclease ABC subunit UvrA
1565 CALHPR010000015.1 GCA938036385_00791 CDS open 27919-29796 _na     625_aa uvrC excinuclease ABC subunit UvrC
1566 CALHPR010000015.1 GCA938036385_00771 gene open 410-1303
1567 CALHPR010000015.1 GCA938036385_00772 gene open 1387-3183 lepA
1568 CALHPR010000015.1 GCA938036385_00773 gene open 3176-4315 hemW
1569 CALHPR010000015.1 GCA938036385_00774 gene open 4423-5523 alr
1570 CALHPR010000015.1 GCA938036385_00777 gene open 6438-7946 thrC
1571 CALHPR010000015.1 GCA938036385_00778 gene open 7939-8646
1572 CALHPR010000015.1 GCA938036385_00779 gene open 8931-9398
1573 CALHPR010000015.1 GCA938036385_00780 gene open 9523-10713
1574 CALHPR010000015.1 GCA938036385_00781 gene open 10723-13863
1575 CALHPR010000015.1 GCA938036385_00782 gene open 14012-14956
1576 CALHPR010000015.1 GCA938036385_00783 gene open 15029-17239 pcrA
1577 CALHPR010000015.1 GCA938036385_00784 gene open 17241-19250 ligA
1578 CALHPR010000015.1 GCA938036385_00785 gene open 19319-19603 gatC
1579 CALHPR010000015.1 GCA938036385_00786 gene open 19615-21069 gatA
1580 CALHPR010000015.1 GCA938036385_00787 gene open 21066-22511 gatB
1581 CALHPR010000015.1 GCA938036385_00788 gene open 22508-22822
1582 CALHPR010000015.1 GCA938036385_00789 gene open 22953-25061 uvrB
1583 CALHPR010000015.1 GCA938036385_00790 gene open 25080-27932 uvrA
1584 CALHPR010000015.1 GCA938036385_00791 gene open 27919-29796 uvrC
1585 CALHPR010000015.1 GCA938036385_00775 gene open 5653-5727 trnR
1586 CALHPR010000015.1 GCA938036385_00776 gene open 6171-6246 trnK
1587 CALHPR010000015.1 GCA938036385_00775 tRNA open 5653-5727 trnR tRNA-Arg(ccg)
1588 CALHPR010000015.1 GCA938036385_00776 tRNA open 6171-6246 trnK tRNA-Lys(ctt)
1589 CALHPR010000016.1 GCA938036385_00797 CDS open 917-1156 _na     79_aa DUF951 domain-containing protein
1590 CALHPR010000016.1 GCA938036385_00798 CDS open 1163-2179 _na     338_aa Tat pathway signal sequence domain protein
1591 CALHPR010000016.1 GCA938036385_00799 CDS open 2203-3141 _na     312_aa whiA DNA-binding protein WhiA
1592 CALHPR010000016.1 GCA938036385_00800 CDS open 3141-4493 _na     450_aa Putative gluconeogenesis factor
1593 CALHPR010000016.1 GCA938036385_00801 CDS open 4505-5398 _na     297_aa rapZ RNase adapter RapZ
1594 CALHPR010000016.1 GCA938036385_00802 CDS open 5402-6211 _na     269_aa Cof-like hydrolase
1595 CALHPR010000016.1 GCA938036385_00803 CDS open 6338-7078 _na     246_aa truA tRNA pseudouridine(38-40) synthase TruA
1596 CALHPR010000016.1 GCA938036385_00804 CDS open 7223-7603 _na     126_aa Tat pathway signal sequence domain protein
1597 CALHPR010000016.1 GCA938036385_00805 CDS open 7607-8881 _na     424_aa M18 family aminopeptidase
1598 CALHPR010000016.1 GCA938036385_00806 CDS open 8959-9393 _na     144_aa tsaA tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO
1599 CALHPR010000016.1 GCA938036385_00807 CDS open 9670-10047 _na     125_aa hypothetical protein
1600 CALHPR010000016.1 GCA938036385_00808 CDS open 10077-10319 _na     80_aa hypothetical protein
1601 CALHPR010000016.1 GCA938036385_00809 CDS open 11010-11492 _na     160_aa Acetyltransferase%2C GNAT family
1602 CALHPR010000016.1 GCA938036385_00810 CDS open 11575-13470 _na     631_aa lysS lysine--tRNA ligase
1603 CALHPR010000016.1 GCA938036385_00811 CDS open 13512-13994 _na     160_aa greA transcription elongation factor GreA
1604 CALHPR010000016.1 GCA938036385_00812 CDS open 14740-14943 _na     67_aa hypothetical protein
1605 CALHPR010000016.1 GCA938036385_00813 CDS open 14954-16264 _na     436_aa potE putrescine-ornithine antiporter
1606 CALHPR010000016.1 GCA938036385_00814 CDS open 16345-16962 _na     205_aa hypothetical protein
1607 CALHPR010000016.1 GCA938036385_00815 CDS open 16984-17625 _na     213_aa upp uracil phosphoribosyltransferase
1608 CALHPR010000016.1 GCA938036385_00816 CDS open 17713-18564 _na     283_aa yihY YihY family protein
1609 CALHPR010000016.1 GCA938036385_00817 CDS open 18693-20519 _na     608_aa typA translational GTPase TypA
1610 CALHPR010000016.1 GCA938036385_00818 CDS open 20762-21214 _na     150_aa Universal stress family protein
1611 CALHPR010000016.1 GCA938036385_00819 CDS open 21249-21689 _na     146_aa Universal stress family protein
1612 CALHPR010000016.1 GCA938036385_00820 CDS open 21827-22216 _na     129_aa Universal stress family protein
1613 CALHPR010000016.1 GCA938036385_00821 CDS open 22297-25347 _na     1016_aa RND transporter%2C HAE1/HME family%2C permease protein
1614 CALHPR010000016.1 GCA938036385_00822 CDS open 25344-26408 _na     354_aa Efflux transporter%2C RND family%2C MFP subunit
1615 CALHPR010000016.1 GCA938036385_00823 CDS open 26549-27145 _na     198_aa HTH tetR-type domain-containing protein
1616 CALHPR010000016.1 GCA938036385_00824 CDS open 27142-27939 _na     265_aa truA tRNA pseudouridine(38-40) synthase TruA
1617 CALHPR010000016.1 GCA938036385_00825 CDS open 28005-28811 _na     268_aa ecfT Energy-coupling factor transporter transmembrane protein EcfT
1618 CALHPR010000016.1 GCA938036385_00826 CDS open 28811-29671 _na     286_aa energy-coupling factor transporter ATPase
1619 CALHPR010000016.1 GCA938036385_00827 CDS open 29647-30510 _na     287_aa energy-coupling factor transporter ATPase
1620 CALHPR010000016.1 GCA938036385_00828 CDS open 30602-30754 _na     50_aa hypothetical protein
1621 CALHPR010000016.1 GCA938036385_00829 CDS open 30788-31549 _na     253_aa HAD hydrolase%2C family IIB
1622 CALHPR010000016.1 GCA938036385_00830 CDS open 31724-33523 _na     599_aa Sulfatase N-terminal domain-containing protein
1623 CALHPR010000016.1 GCA938036385_00831 CDS open 33757-34227 _na     156_aa lysR Transcriptional regulator%2C LysR family
1624 CALHPR010000016.1 GCA938036385_00832 CDS open 34498-34617 _na     39_aa hypothetical protein
1625 CALHPR010000016.1 GCA938036385_00797 gene open 917-1156
1626 CALHPR010000016.1 GCA938036385_00798 gene open 1163-2179
1627 CALHPR010000016.1 GCA938036385_00799 gene open 2203-3141 whiA
1628 CALHPR010000016.1 GCA938036385_00800 gene open 3141-4493
1629 CALHPR010000016.1 GCA938036385_00801 gene open 4505-5398 rapZ
1630 CALHPR010000016.1 GCA938036385_00802 gene open 5402-6211
1631 CALHPR010000016.1 GCA938036385_00803 gene open 6338-7078 truA
1632 CALHPR010000016.1 GCA938036385_00804 gene open 7223-7603
1633 CALHPR010000016.1 GCA938036385_00805 gene open 7607-8881
1634 CALHPR010000016.1 GCA938036385_00806 gene open 8959-9393 tsaA
1635 CALHPR010000016.1 GCA938036385_00807 gene open 9670-10047
1636 CALHPR010000016.1 GCA938036385_00808 gene open 10077-10319
1637 CALHPR010000016.1 GCA938036385_00809 gene open 11010-11492
1638 CALHPR010000016.1 GCA938036385_00810 gene open 11575-13470 lysS
1639 CALHPR010000016.1 GCA938036385_00811 gene open 13512-13994 greA
1640 CALHPR010000016.1 GCA938036385_00812 gene open 14740-14943
1641 CALHPR010000016.1 GCA938036385_00813 gene open 14954-16264 potE
1642 CALHPR010000016.1 GCA938036385_00814 gene open 16345-16962
1643 CALHPR010000016.1 GCA938036385_00815 gene open 16984-17625 upp
1644 CALHPR010000016.1 GCA938036385_00816 gene open 17713-18564 yihY
1645 CALHPR010000016.1 GCA938036385_00817 gene open 18693-20519 typA
1646 CALHPR010000016.1 GCA938036385_00818 gene open 20762-21214
1647 CALHPR010000016.1 GCA938036385_00819 gene open 21249-21689
1648 CALHPR010000016.1 GCA938036385_00820 gene open 21827-22216
1649 CALHPR010000016.1 GCA938036385_00821 gene open 22297-25347
1650 CALHPR010000016.1 GCA938036385_00822 gene open 25344-26408
1651 CALHPR010000016.1 GCA938036385_00823 gene open 26549-27145
1652 CALHPR010000016.1 GCA938036385_00824 gene open 27142-27939 truA
1653 CALHPR010000016.1 GCA938036385_00825 gene open 28005-28811 ecfT
1654 CALHPR010000016.1 GCA938036385_00826 gene open 28811-29671
1655 CALHPR010000016.1 GCA938036385_00827 gene open 29647-30510
1656 CALHPR010000016.1 GCA938036385_00828 gene open 30602-30754
1657 CALHPR010000016.1 GCA938036385_00829 gene open 30788-31549
1658 CALHPR010000016.1 GCA938036385_00830 gene open 31724-33523
1659 CALHPR010000016.1 GCA938036385_00831 gene open 33757-34227 lysR
1660 CALHPR010000016.1 GCA938036385_00832 gene open 34498-34617
1661 CALHPR010000016.1 GCA938036385_00792 gene open 325-401 trnM
1662 CALHPR010000016.1 GCA938036385_00793 gene open 403-478 trnT
1663 CALHPR010000016.1 GCA938036385_00794 gene open 506-581 trnfM
1664 CALHPR010000016.1 GCA938036385_00795 gene open 586-670 trnY
1665 CALHPR010000016.1 GCA938036385_00796 gene open 674-749 trnT
1666 CALHPR010000016.1 GCA938036385_00792 tRNA open 325-401 trnM tRNA-Met(cat)
1667 CALHPR010000016.1 GCA938036385_00793 tRNA open 403-478 trnT tRNA-Thr(ggt)
1668 CALHPR010000016.1 GCA938036385_00794 tRNA open 506-581 trnfM tRNA-fMet(cat)
1669 CALHPR010000016.1 GCA938036385_00795 tRNA open 586-670 trnY tRNA-Tyr(gta)
1670 CALHPR010000016.1 GCA938036385_00796 tRNA open 674-749 trnT tRNA-Thr(tgt)
1671 CALHPR010000017.1 regulatory_region open 3632-3806 Cobalamin riboswitch aptamer
1672 CALHPR010000017.1 GCA938036385_00833 CDS open 671-1438 _na     255_aa hypothetical protein
1673 CALHPR010000017.1 GCA938036385_00834 CDS open 2084-2857 _na     257_aa hypothetical protein
1674 CALHPR010000017.1 GCA938036385_00835 CDS open 4099-5196 _na     365_aa Adenosylcobinamide amidohydrolase
1675 CALHPR010000017.1 GCA938036385_00836 CDS open 5193-5957 _na     254_aa CN hydrolase domain-containing protein
1676 CALHPR010000017.1 GCA938036385_00837 CDS open 6177-7604 _na     475_aa argH argininosuccinate lyase
1677 CALHPR010000017.1 GCA938036385_00838 CDS open 7601-8845 _na     414_aa argG argininosuccinate synthase
1678 CALHPR010000017.1 GCA938036385_00839 CDS open 9141-9896 _na     251_aa Methyltransferase domain protein
1679 CALHPR010000017.1 GCA938036385_00840 CDS open 10050-10670 _na     206_aa DivIVA domain protein
1680 CALHPR010000017.1 GCA938036385_00841 CDS open 10708-11499 _na     263_aa S4 domain protein
1681 CALHPR010000017.1 GCA938036385_00842 CDS open 11499-12293 _na     264_aa proC pyrroline-5-carboxylate reductase
1682 CALHPR010000017.1 GCA938036385_00843 CDS open 12290-12751 _na     153_aa sepF Cell division protein SepF
1683 CALHPR010000017.1 GCA938036385_00844 CDS open 12724-13179 _na     151_aa sepF Cell division protein SepF
1684 CALHPR010000017.1 GCA938036385_00845 CDS open 13176-13886 _na     236_aa Pyridoxal phosphate homeostasis protein
1685 CALHPR010000017.1 GCA938036385_00833 gene open 671-1438
1686 CALHPR010000017.1 GCA938036385_00834 gene open 2084-2857
1687 CALHPR010000017.1 GCA938036385_00835 gene open 4099-5196
1688 CALHPR010000017.1 GCA938036385_00836 gene open 5193-5957
1689 CALHPR010000017.1 GCA938036385_00837 gene open 6177-7604 argH
1690 CALHPR010000017.1 GCA938036385_00838 gene open 7601-8845 argG
1691 CALHPR010000017.1 GCA938036385_00839 gene open 9141-9896
1692 CALHPR010000017.1 GCA938036385_00840 gene open 10050-10670
1693 CALHPR010000017.1 GCA938036385_00841 gene open 10708-11499
1694 CALHPR010000017.1 GCA938036385_00842 gene open 11499-12293 proC
1695 CALHPR010000017.1 GCA938036385_00843 gene open 12290-12751 sepF
1696 CALHPR010000017.1 GCA938036385_00844 gene open 12724-13179 sepF
1697 CALHPR010000017.1 GCA938036385_00845 gene open 13176-13886
1698 CALHPR010000018.1 GCA938036385_00846 CDS open 773-1438 _na     221_aa metal-dependent hydrolase
1699 CALHPR010000018.1 GCA938036385_00847 CDS open 1485-2081 _na     198_aa Response regulator receiver domain protein
1700 CALHPR010000018.1 GCA938036385_00848 CDS open 2078-3481 _na     467_aa histidine kinase
1701 CALHPR010000018.1 GCA938036385_00849 CDS open 3507-4529 _na     340_aa tsaD tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD
1702 CALHPR010000018.1 GCA938036385_00850 CDS open 4539-4997 _na     152_aa rimI ribosomal protein S18-alanine N-acetyltransferase
1703 CALHPR010000018.1 GCA938036385_00851 CDS open 4970-5662 _na     230_aa tsaB tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB
1704 CALHPR010000018.1 GCA938036385_00852 CDS open 5646-6119 _na     157_aa tsaE tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE
1705 CALHPR010000018.1 GCA938036385_00853 CDS open 6112-7023 _na     303_aa Phospholipase%2C patatin family
1706 CALHPR010000018.1 GCA938036385_00854 CDS open 7053-7814 _na     253_aa gpmA 2%2C3-diphosphoglycerate-dependent phosphoglycerate mutase
1707 CALHPR010000018.1 GCA938036385_00855 CDS open 7824-8813 _na     329_aa thiL thiamine-phosphate kinase
1708 CALHPR010000018.1 GCA938036385_00856 CDS open 8813-9367 _na     184_aa nicotinamidase
1709 CALHPR010000018.1 GCA938036385_00857 CDS open 9551-10516 _na     321_aa hypothetical protein
1710 CALHPR010000018.1 GCA938036385_00858 CDS open 10749-11408 _na     219_aa nth endonuclease III
1711 CALHPR010000018.1 GCA938036385_00859 CDS open 11410-12324 _na     304_aa Putative thioredoxin-disulfide reductase
1712 CALHPR010000018.1 GCA938036385_00860 CDS open 12390-14039 _na     549_aa Phosphoribulokinase/uridine kinase family protein
1713 CALHPR010000018.1 GCA938036385_00861 CDS open 14708-15436 _na     242_aa Phospholipase/carboxylesterase
1714 CALHPR010000018.1 GCA938036385_00862 CDS open 15436-16332 _na     298_aa Lipid A biosynthesis (KDO)2-(Lauroyl)-lipid IVA acyltransferase
1715 CALHPR010000018.1 GCA938036385_00863 CDS open 16418-17443 _na     341_aa lpxD UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase
1716 CALHPR010000018.1 GCA938036385_00864 CDS open 17452-17907 _na     151_aa Outer membrane protein
1717 CALHPR010000018.1 GCA938036385_00865 CDS open 17904-18833 _na     309_aa Outer membrane protein
1718 CALHPR010000018.1 GCA938036385_00866 CDS open 18882-19421 _na     179_aa Outer membrane protein
1719 CALHPR010000018.1 GCA938036385_00867 CDS open 19437-20735 _na     432_aa Tat pathway signal sequence
1720 CALHPR010000018.1 GCA938036385_00868 CDS open 20756-22723 _na     655_aa POTRA domain-containing protein
1721 CALHPR010000018.1 GCA938036385_00869 CDS open 22766-23266 _na     166_aa secG Preprotein translocase subunit SecG
1722 CALHPR010000018.1 GCA938036385_00870 CDS open 23408-24025 _na     205_aa RNA polymerase sigma factor
1723 CALHPR010000018.1 GCA938036385_00871 CDS open 24035-28420 _na     1461_aa AsmA-like C-terminal domain-containing protein
1724 CALHPR010000018.1 GCA938036385_00872 CDS open 28454-29935 _na     493_aa Outer membrane efflux protein
1725 CALHPR010000018.1 GCA938036385_00873 CDS open 29966-31114 _na     382_aa Mce/MlaD domain-containing protein
1726 CALHPR010000018.1 GCA938036385_00874 CDS open 31111-31872 _na     253_aa ABC transporter%2C ATP-binding protein
1727 CALHPR010000018.1 GCA938036385_00875 CDS open 31881-32642 _na     253_aa ABC transporter permease
1728 CALHPR010000018.1 GCA938036385_00876 CDS open 32734-34680 _na     648_aa SpoIVB peptidase S55
1729 CALHPR010000018.1 GCA938036385_00877 CDS open 34701-35003 _na     100_aa Biotin-requiring enzyme
1730 CALHPR010000018.1 GCA938036385_00878 CDS open 35129-36223 _na     364_aa mreB Cell shape-determining protein MreB
1731 CALHPR010000018.1 GCA938036385_00879 CDS open 36201-37460 _na     419_aa murA UDP-N-acetylglucosamine 1-carboxyvinyltransferase
1732 CALHPR010000018.1 GCA938036385_00880 CDS open 37646-38158 _na     170_aa CBS domain protein
1733 CALHPR010000018.1 GCA938036385_00881 CDS open 38260-38739 _na     159_aa rlmH 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH
1734 CALHPR010000018.1 GCA938036385_00882 CDS open 38739-39929 _na     396_aa Trypsin
1735 CALHPR010000018.1 GCA938036385_00883 CDS open 40049-41623 _na     524_aa rny ribonuclease Y
1736 CALHPR010000018.1 GCA938036385_00884 CDS open 41856-42161 _na     101_aa hypothetical protein
1737 CALHPR010000018.1 GCA938036385_00885 CDS open 42158-42865 _na     235_aa Metallo-beta-lactamase domain-containing protein
1738 CALHPR010000018.1 GCA938036385_00886 CDS open 43170-43418 _na     82_aa N-acetyltransferase domain-containing protein
1739 CALHPR010000018.1 GCA938036385_00887 CDS open 43487-44107 _na     206_aa HDIG domain protein
1740 CALHPR010000018.1 GCA938036385_00888 CDS open 44377-45726 _na     449_aa DUF697 domain-containing protein
1741 CALHPR010000018.1 GCA938036385_00889 CDS open 45846-46577 _na     243_aa Oxidoreductase%2C short chain dehydrogenase/reductase family protein
1742 CALHPR010000018.1 GCA938036385_00890 CDS open 46579-47706 _na     375_aa Divergent polysaccharide deacetylase family protein
1743 CALHPR010000018.1 GCA938036385_00891 CDS open 47813-48757 _na     314_aa 4-phosphoerythronate dehydrogenase
1744 CALHPR010000018.1 GCA938036385_00892 CDS open 48820-50025 _na     401_aa Aminotransferase%2C class I/II
1745 CALHPR010000018.1 GCA938036385_00893 CDS open 50212-51135 _na     307_aa bifunctional riboflavin kinase/FAD synthetase
1746 CALHPR010000018.1 GCA938036385_00894 CDS open 51142-51993 _na     283_aa truB tRNA pseudouridine(55) synthase TruB
1747 CALHPR010000018.1 GCA938036385_00895 CDS open 51993-52958 _na     321_aa DHHA1 domain protein
1748 CALHPR010000018.1 GCA938036385_00896 CDS open 52948-53307 _na     119_aa rbfA 30S ribosome-binding factor RbfA
1749 CALHPR010000018.1 GCA938036385_00897 CDS open 53368-55995 _na     875_aa infB translation initiation factor IF-2
1750 CALHPR010000018.1 GCA938036385_00898 CDS open 56017-56325 _na     102_aa Ribosomal protein L7Ae
1751 CALHPR010000018.1 GCA938036385_00899 CDS open 56318-56584 _na     88_aa rnpM RNase P modulator RnpM
1752 CALHPR010000018.1 GCA938036385_00900 CDS open 56581-57714 _na     377_aa nusA Transcription termination/antitermination protein NusA
1753 CALHPR010000018.1 GCA938036385_00901 CDS open 57736-58206 _na     156_aa rimP Ribosome maturation factor RimP
1754 CALHPR010000018.1 GCA938036385_00902 CDS open 58393-59127 _na     244_aa DUF4176 domain-containing protein
1755 CALHPR010000018.1 GCA938036385_00903 CDS open 59124-59720 _na     198_aa Transglycosylase SLT domain protein
1756 CALHPR010000018.1 GCA938036385_00904 CDS open 59713-60333 _na     206_aa coaE dephospho-CoA kinase
1757 CALHPR010000018.1 GCA938036385_00905 CDS open 60353-62929 _na     858_aa polA DNA polymerase I
1758 CALHPR010000018.1 GCA938036385_00906 CDS open 63061-64464 _na     467_aa ISLre2 family transposase
1759 CALHPR010000018.1 GCA938036385_00846 gene open 773-1438
1760 CALHPR010000018.1 GCA938036385_00847 gene open 1485-2081
1761 CALHPR010000018.1 GCA938036385_00848 gene open 2078-3481
1762 CALHPR010000018.1 GCA938036385_00849 gene open 3507-4529 tsaD
1763 CALHPR010000018.1 GCA938036385_00850 gene open 4539-4997 rimI
1764 CALHPR010000018.1 GCA938036385_00851 gene open 4970-5662 tsaB
1765 CALHPR010000018.1 GCA938036385_00852 gene open 5646-6119 tsaE
1766 CALHPR010000018.1 GCA938036385_00853 gene open 6112-7023
1767 CALHPR010000018.1 GCA938036385_00854 gene open 7053-7814 gpmA
1768 CALHPR010000018.1 GCA938036385_00855 gene open 7824-8813 thiL
1769 CALHPR010000018.1 GCA938036385_00856 gene open 8813-9367
1770 CALHPR010000018.1 GCA938036385_00857 gene open 9551-10516
1771 CALHPR010000018.1 GCA938036385_00858 gene open 10749-11408 nth
1772 CALHPR010000018.1 GCA938036385_00859 gene open 11410-12324
1773 CALHPR010000018.1 GCA938036385_00860 gene open 12390-14039
1774 CALHPR010000018.1 GCA938036385_00861 gene open 14708-15436
1775 CALHPR010000018.1 GCA938036385_00862 gene open 15436-16332
1776 CALHPR010000018.1 GCA938036385_00863 gene open 16418-17443 lpxD
1777 CALHPR010000018.1 GCA938036385_00864 gene open 17452-17907
1778 CALHPR010000018.1 GCA938036385_00865 gene open 17904-18833
1779 CALHPR010000018.1 GCA938036385_00866 gene open 18882-19421
1780 CALHPR010000018.1 GCA938036385_00867 gene open 19437-20735
1781 CALHPR010000018.1 GCA938036385_00868 gene open 20756-22723
1782 CALHPR010000018.1 GCA938036385_00869 gene open 22766-23266 secG
1783 CALHPR010000018.1 GCA938036385_00870 gene open 23408-24025
1784 CALHPR010000018.1 GCA938036385_00871 gene open 24035-28420
1785 CALHPR010000018.1 GCA938036385_00872 gene open 28454-29935
1786 CALHPR010000018.1 GCA938036385_00873 gene open 29966-31114
1787 CALHPR010000018.1 GCA938036385_00874 gene open 31111-31872
1788 CALHPR010000018.1 GCA938036385_00875 gene open 31881-32642
1789 CALHPR010000018.1 GCA938036385_00876 gene open 32734-34680
1790 CALHPR010000018.1 GCA938036385_00877 gene open 34701-35003
1791 CALHPR010000018.1 GCA938036385_00878 gene open 35129-36223 mreB
1792 CALHPR010000018.1 GCA938036385_00879 gene open 36201-37460 murA
1793 CALHPR010000018.1 GCA938036385_00880 gene open 37646-38158
1794 CALHPR010000018.1 GCA938036385_00881 gene open 38260-38739 rlmH
1795 CALHPR010000018.1 GCA938036385_00882 gene open 38739-39929
1796 CALHPR010000018.1 GCA938036385_00883 gene open 40049-41623 rny
1797 CALHPR010000018.1 GCA938036385_00884 gene open 41856-42161
1798 CALHPR010000018.1 GCA938036385_00885 gene open 42158-42865
1799 CALHPR010000018.1 GCA938036385_00886 gene open 43170-43418
1800 CALHPR010000018.1 GCA938036385_00887 gene open 43487-44107
1801 CALHPR010000018.1 GCA938036385_00888 gene open 44377-45726
1802 CALHPR010000018.1 GCA938036385_00889 gene open 45846-46577
1803 CALHPR010000018.1 GCA938036385_00890 gene open 46579-47706
1804 CALHPR010000018.1 GCA938036385_00891 gene open 47813-48757
1805 CALHPR010000018.1 GCA938036385_00892 gene open 48820-50025
1806 CALHPR010000018.1 GCA938036385_00893 gene open 50212-51135
1807 CALHPR010000018.1 GCA938036385_00894 gene open 51142-51993 truB
1808 CALHPR010000018.1 GCA938036385_00895 gene open 51993-52958
1809 CALHPR010000018.1 GCA938036385_00896 gene open 52948-53307 rbfA
1810 CALHPR010000018.1 GCA938036385_00897 gene open 53368-55995 infB
1811 CALHPR010000018.1 GCA938036385_00898 gene open 56017-56325
1812 CALHPR010000018.1 GCA938036385_00899 gene open 56318-56584 rnpM
1813 CALHPR010000018.1 GCA938036385_00900 gene open 56581-57714 nusA
1814 CALHPR010000018.1 GCA938036385_00901 gene open 57736-58206 rimP
1815 CALHPR010000018.1 GCA938036385_00902 gene open 58393-59127
1816 CALHPR010000018.1 GCA938036385_00903 gene open 59124-59720
1817 CALHPR010000018.1 GCA938036385_00904 gene open 59713-60333 coaE
1818 CALHPR010000018.1 GCA938036385_00905 gene open 60353-62929 polA
1819 CALHPR010000018.1 GCA938036385_00906 gene open 63061-64464
1820 CALHPR010000019.1 regulatory_region open 46503-46588 ZMP/ZTP riboswitch aptamer (pfl RNA motif)
1821 CALHPR010000019.1 regulatory_region open 61794-61993 T-box leader
1822 CALHPR010000019.1 GCA938036385_00907 CDS open 135-542 _na     135_aa hypothetical protein
1823 CALHPR010000019.1 GCA938036385_00908 CDS open 546-728 _na     60_aa ORF6N domain-containing protein
1824 CALHPR010000019.1 GCA938036385_00909 CDS open 732-821 _na     29_aa hypothetical protein
1825 CALHPR010000019.1 GCA938036385_00910 CDS open 905-1114 _na     69_aa Transcriptional regulator
1826 CALHPR010000019.1 GCA938036385_00911 CDS open 1314-2852 _na     512_aa guaA glutamine-hydrolyzing GMP synthase
1827 CALHPR010000019.1 GCA938036385_00912 CDS open 3023-3574 _na     183_aa Adenine phosphoribosyltransferase
1828 CALHPR010000019.1 GCA938036385_00913 CDS open 3706-4635 _na     309_aa Gram-positive signal peptide protein%2C YSIRK family
1829 CALHPR010000019.1 GCA938036385_00914 CDS open 4793-5599 _na     268_aa hypothetical protein
1830 CALHPR010000019.1 GCA938036385_00915 CDS open 5758-6576 _na     272_aa CHAD domain-containing protein
1831 CALHPR010000019.1 GCA938036385_00917 CDS open 7126-8112 _na     328_aa diaminopimelate dehydrogenase
1832 CALHPR010000019.1 GCA938036385_00918 CDS open 8273-8515 _na     80_aa DUF1653 domain-containing protein
1833 CALHPR010000019.1 GCA938036385_00919 CDS open 8526-9410 _na     294_aa Metallo-beta-lactamase domain protein
1834 CALHPR010000019.1 GCA938036385_00920 CDS open 9407-10933 _na     508_aa Bifunctional NAD(P)H-hydrate repair enzyme
1835 CALHPR010000019.1 GCA938036385_00921 CDS open 10930-11304 _na     124_aa Holo-[acyl-carrier-protein] synthase
1836 CALHPR010000019.1 GCA938036385_00922 CDS open 11496-11771 _na     91_aa rpsT 30S ribosomal protein S20
1837 CALHPR010000019.1 GCA938036385_00923 CDS open 11993-13273 _na     426_aa Phosphoribosylamine--glycine ligase
1838 CALHPR010000019.1 GCA938036385_00924 CDS open 13287-14828 _na     513_aa purH bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase
1839 CALHPR010000019.1 GCA938036385_00925 CDS open 14831-15448 _na     205_aa purN phosphoribosylglycinamide formyltransferase
1840 CALHPR010000019.1 GCA938036385_00926 CDS open 15441-16499 _na     352_aa Phosphoribosylformylglycinamidine cyclo-ligase
1841 CALHPR010000019.1 GCA938036385_00927 CDS open 16510-17910 _na     466_aa purF amidophosphoribosyltransferase
1842 CALHPR010000019.1 GCA938036385_00928 CDS open 17928-18791 _na     287_aa phosphoribosylaminoimidazolesuccinocarboxamide synthase
1843 CALHPR010000019.1 GCA938036385_00929 CDS open 18817-19305 _na     162_aa N5-carboxyaminoimidazole ribonucleotide mutase
1844 CALHPR010000019.1 GCA938036385_00930 CDS open 19659-20861 _na     400_aa Transporter%2C major facilitator family protein
1845 CALHPR010000019.1 GCA938036385_00931 CDS open 20874-21866 _na     330_aa dusB tRNA dihydrouridine synthase DusB
1846 CALHPR010000019.1 GCA938036385_00932 CDS open 22366-23223 _na     285_aa ABC transporter%2C substrate-binding protein%2C family 3
1847 CALHPR010000019.1 GCA938036385_00933 CDS open 23698-24216 _na     172_aa Nitroreductase family protein
1848 CALHPR010000019.1 GCA938036385_00934 CDS open 24617-25288 _na     223_aa ABC transporter%2C permease protein
1849 CALHPR010000019.1 GCA938036385_00935 CDS open 25257-25934 _na     225_aa ABC transporter%2C permease protein
1850 CALHPR010000019.1 GCA938036385_00936 CDS open 25936-26688 _na     250_aa Glutamine ABC transporter ATP-binding protein
1851 CALHPR010000019.1 GCA938036385_00937 CDS open 26704-27573 _na     289_aa ABC transporter%2C substrate-binding protein%2C family 3
1852 CALHPR010000019.1 GCA938036385_00938 CDS open 27573-27725 _na     50_aa hypothetical protein
1853 CALHPR010000019.1 GCA938036385_00939 CDS open 27712-28887 _na     391_aa cysteine-S-conjugate beta-lyase
1854 CALHPR010000019.1 GCA938036385_00940 CDS open 28933-29568 _na     211_aa Tetratricopeptide repeat protein
1855 CALHPR010000019.1 GCA938036385_00941 CDS open 29654-30415 _na     253_aa Oxidoreductase%2C short chain dehydrogenase/reductase family protein
1856 CALHPR010000019.1 GCA938036385_00943 CDS open 30677-31300 _na     207_aa Superoxide dismutase
1857 CALHPR010000019.1 GCA938036385_00944 CDS open 31654-31980 _na     108_aa bioY biotin transporter BioY
1858 CALHPR010000019.1 GCA938036385_00945 CDS open 32143-34071 _na     642_aa bifunctional 4-hydroxy-3-methylbut-2-enyl diphosphate reductase/30S ribosomal protein S1
1859 CALHPR010000019.1 GCA938036385_00946 CDS open 34142-34762 _na     206_aa 1-acyl-sn-glycerol-3-phosphate acyltransferase
1860 CALHPR010000019.1 GCA938036385_00947 CDS open 34755-35438 _na     227_aa cmk (d)CMP kinase
1861 CALHPR010000019.1 GCA938036385_00948 CDS open 35431-36690 _na     419_aa Flavoprotein family protein
1862 CALHPR010000019.1 GCA938036385_00949 CDS open 36674-37393 _na     239_aa Pseudouridine synthase
1863 CALHPR010000019.1 GCA938036385_00950 CDS open 37390-37923 _na     177_aa scpB SMC-Scp complex subunit ScpB
1864 CALHPR010000019.1 GCA938036385_00951 CDS open 37920-38630 _na     236_aa Segregation and condensation protein A
1865 CALHPR010000019.1 GCA938036385_00952 CDS open 38748-40565 _na     605_aa Orn/Lys/Arg decarboxylase%2C major domain protein
1866 CALHPR010000019.1 GCA938036385_00953 CDS open 40646-41239 _na     197_aa rpsD 30S ribosomal protein S4
1867 CALHPR010000019.1 GCA938036385_00954 CDS open 41383-42048 _na     221_aa DUF1638 domain-containing protein
1868 CALHPR010000019.1 GCA938036385_00955 CDS open 42098-43627 _na     509_aa Amino acid carrier protein
1869 CALHPR010000019.1 GCA938036385_00956 CDS open 43719-44996 _na     425_aa Aminotransferase%2C class I/II
1870 CALHPR010000019.1 GCA938036385_00957 CDS open 45177-46439 _na     420_aa Transporter%2C major facilitator family protein
1871 CALHPR010000019.1 GCA938036385_00958 CDS open 46691-48559 _na     622_aa TonB-dependent receptor plug domain protein
1872 CALHPR010000019.1 GCA938036385_00959 CDS open 48935-50875 _na     646_aa TonB-dependent receptor
1873 CALHPR010000019.1 GCA938036385_00960 CDS open 51307-52116 _na     269_aa ABC transporter%2C ATP-binding protein
1874 CALHPR010000019.1 GCA938036385_00961 CDS open 52113-52901 _na     262_aa ABC transporter%2C ATP-binding protein
1875 CALHPR010000019.1 GCA938036385_00962 CDS open 53080-54660 _na     526_aa ABC transporter%2C substrate-binding protein%2C family 5
1876 CALHPR010000019.1 GCA938036385_00963 CDS open 54765-55592 _na     275_aa nikC nickel transporter permease
1877 CALHPR010000019.1 GCA938036385_00964 CDS open 55597-56541 _na     314_aa nikB nickel ABC transporter permease
1878 CALHPR010000019.1 GCA938036385_00965 CDS open 57005-57520 _na     171_aa LUD domain-containing protein
1879 CALHPR010000019.1 GCA938036385_00966 CDS open 58249-58965 _na     238_aa ABC transporter%2C ATP-binding protein
1880 CALHPR010000019.1 GCA938036385_00967 CDS open 58965-59729 _na     254_aa ABC transporter%2C ATP-binding protein
1881 CALHPR010000019.1 GCA938036385_00968 CDS open 59729-60691 _na     320_aa Branched-chain amino acid ABC transporter%2C permease protein
1882 CALHPR010000019.1 GCA938036385_00969 CDS open 60691-61572 _na     293_aa livH Branched-chain amino acid ABC transporter permease
1883 CALHPR010000019.1 GCA938036385_00970 CDS open 62282-63787 _na     501_aa IMP dehydrogenase
1884 CALHPR010000019.1 GCA938036385_00907 gene open 135-542
1885 CALHPR010000019.1 GCA938036385_00908 gene open 546-728
1886 CALHPR010000019.1 GCA938036385_00909 gene open 732-821
1887 CALHPR010000019.1 GCA938036385_00910 gene open 905-1114
1888 CALHPR010000019.1 GCA938036385_00911 gene open 1314-2852 guaA
1889 CALHPR010000019.1 GCA938036385_00912 gene open 3023-3574
1890 CALHPR010000019.1 GCA938036385_00913 gene open 3706-4635
1891 CALHPR010000019.1 GCA938036385_00914 gene open 4793-5599
1892 CALHPR010000019.1 GCA938036385_00915 gene open 5758-6576
1893 CALHPR010000019.1 GCA938036385_00917 gene open 7126-8112
1894 CALHPR010000019.1 GCA938036385_00918 gene open 8273-8515
1895 CALHPR010000019.1 GCA938036385_00919 gene open 8526-9410
1896 CALHPR010000019.1 GCA938036385_00920 gene open 9407-10933
1897 CALHPR010000019.1 GCA938036385_00921 gene open 10930-11304
1898 CALHPR010000019.1 GCA938036385_00922 gene open 11496-11771 rpsT
1899 CALHPR010000019.1 GCA938036385_00923 gene open 11993-13273
1900 CALHPR010000019.1 GCA938036385_00924 gene open 13287-14828 purH
1901 CALHPR010000019.1 GCA938036385_00925 gene open 14831-15448 purN
1902 CALHPR010000019.1 GCA938036385_00926 gene open 15441-16499
1903 CALHPR010000019.1 GCA938036385_00927 gene open 16510-17910 purF
1904 CALHPR010000019.1 GCA938036385_00928 gene open 17928-18791
1905 CALHPR010000019.1 GCA938036385_00929 gene open 18817-19305
1906 CALHPR010000019.1 GCA938036385_00930 gene open 19659-20861
1907 CALHPR010000019.1 GCA938036385_00931 gene open 20874-21866 dusB
1908 CALHPR010000019.1 GCA938036385_00932 gene open 22366-23223
1909 CALHPR010000019.1 GCA938036385_00933 gene open 23698-24216
1910 CALHPR010000019.1 GCA938036385_00934 gene open 24617-25288
1911 CALHPR010000019.1 GCA938036385_00935 gene open 25257-25934
1912 CALHPR010000019.1 GCA938036385_00936 gene open 25936-26688
1913 CALHPR010000019.1 GCA938036385_00937 gene open 26704-27573
1914 CALHPR010000019.1 GCA938036385_00938 gene open 27573-27725
1915 CALHPR010000019.1 GCA938036385_00939 gene open 27712-28887
1916 CALHPR010000019.1 GCA938036385_00940 gene open 28933-29568
1917 CALHPR010000019.1 GCA938036385_00941 gene open 29654-30415
1918 CALHPR010000019.1 GCA938036385_00943 gene open 30677-31300
1919 CALHPR010000019.1 GCA938036385_00944 gene open 31654-31980 bioY
1920 CALHPR010000019.1 GCA938036385_00945 gene open 32143-34071
1921 CALHPR010000019.1 GCA938036385_00946 gene open 34142-34762
1922 CALHPR010000019.1 GCA938036385_00947 gene open 34755-35438 cmk
1923 CALHPR010000019.1 GCA938036385_00948 gene open 35431-36690
1924 CALHPR010000019.1 GCA938036385_00949 gene open 36674-37393
1925 CALHPR010000019.1 GCA938036385_00950 gene open 37390-37923 scpB
1926 CALHPR010000019.1 GCA938036385_00951 gene open 37920-38630
1927 CALHPR010000019.1 GCA938036385_00952 gene open 38748-40565
1928 CALHPR010000019.1 GCA938036385_00953 gene open 40646-41239 rpsD
1929 CALHPR010000019.1 GCA938036385_00954 gene open 41383-42048
1930 CALHPR010000019.1 GCA938036385_00955 gene open 42098-43627
1931 CALHPR010000019.1 GCA938036385_00956 gene open 43719-44996
1932 CALHPR010000019.1 GCA938036385_00957 gene open 45177-46439
1933 CALHPR010000019.1 GCA938036385_00958 gene open 46691-48559
1934 CALHPR010000019.1 GCA938036385_00959 gene open 48935-50875
1935 CALHPR010000019.1 GCA938036385_00960 gene open 51307-52116
1936 CALHPR010000019.1 GCA938036385_00961 gene open 52113-52901
1937 CALHPR010000019.1 GCA938036385_00962 gene open 53080-54660
1938 CALHPR010000019.1 GCA938036385_00963 gene open 54765-55592 nikC
1939 CALHPR010000019.1 GCA938036385_00964 gene open 55597-56541 nikB
1940 CALHPR010000019.1 GCA938036385_00965 gene open 57005-57520
1941 CALHPR010000019.1 GCA938036385_00966 gene open 58249-58965
1942 CALHPR010000019.1 GCA938036385_00967 gene open 58965-59729
1943 CALHPR010000019.1 GCA938036385_00968 gene open 59729-60691
1944 CALHPR010000019.1 GCA938036385_00969 gene open 60691-61572 livH
1945 CALHPR010000019.1 GCA938036385_00970 gene open 62282-63787
1946 CALHPR010000019.1 GCA938036385_00916 gene open 6975-7064 trnS
1947 CALHPR010000019.1 GCA938036385_00942 gene open 30479-30554 trnT
1948 CALHPR010000019.1 GCA938036385_00916 tRNA open 6975-7064 trnS tRNA-Ser(gct)
1949 CALHPR010000019.1 GCA938036385_00942 tRNA open 30479-30554 trnT tRNA-Thr(cgt)
1950 CALHPR010000020.1 regulatory_region open 1442-1607 Cobalamin riboswitch aptamer
1951 CALHPR010000020.1 regulatory_region open 122617-122812 T-box leader
1952 CALHPR010000020.1 repeat_region open 81922-82493 CRISPR array with 9 repeats of length 35%2C consensus sequence TTTTACCACTATCTGGAATTACATCACTCTCAAAC and spacer length 30
1953 CALHPR010000020.1 GCA938036385_00971 CDS open 77-919 _na     280_aa hypothetical protein
1954 CALHPR010000020.1 GCA938036385_00972 CDS open 1817-2800 _na     327_aa hypE hydrogenase expression/formation protein HypE
1955 CALHPR010000020.1 GCA938036385_00973 CDS open 2797-3846 _na     349_aa hypD hydrogenase formation protein HypD
1956 CALHPR010000020.1 GCA938036385_00974 CDS open 3833-4060 _na     75_aa HupF/HypC family protein
1957 CALHPR010000020.1 GCA938036385_00975 CDS open 4023-6332 _na     769_aa hypF carbamoyltransferase HypF
1958 CALHPR010000020.1 GCA938036385_00976 CDS open 6350-7000 _na     216_aa hypB hydrogenase nickel incorporation protein HypB
1959 CALHPR010000020.1 GCA938036385_00977 CDS open 6969-7352 _na     127_aa hypA Hydrogenase maturation factor HypA
1960 CALHPR010000020.1 GCA938036385_00978 CDS open 7345-8583 _na     412_aa 4Fe-4S binding domain protein
1961 CALHPR010000020.1 GCA938036385_00979 CDS open 8593-9678 _na     361_aa Respiratory-chain NADH dehydrogenase%2C 49 Kd subunit
1962 CALHPR010000020.1 GCA938036385_00980 CDS open 9671-10126 _na     151_aa Respiratory-chain NADH dehydrogenase%2C 30 Kd subunit
1963 CALHPR010000020.1 GCA938036385_00981 CDS open 10126-10596 _na     156_aa nuoB NADH-quinone oxidoreductase subunit NuoB
1964 CALHPR010000020.1 GCA938036385_00982 CDS open 10610-11485 _na     291_aa NADH dehydrogenase
1965 CALHPR010000020.1 GCA938036385_00983 CDS open 11478-13382 _na     634_aa NADH-ubiquinone/plastoquinone (Complex I) family protein
1966 CALHPR010000020.1 GCA938036385_00984 CDS open 13899-14819 _na     306_aa ABC transporter%2C ATP-binding protein
1967 CALHPR010000020.1 GCA938036385_00985 CDS open 14822-15625 _na     267_aa Transport permease protein
1968 CALHPR010000020.1 GCA938036385_00986 CDS open 15724-17346 _na     540_aa Putative alkyl hydroperoxide reductase F subunit
1969 CALHPR010000020.1 GCA938036385_00987 CDS open 17361-17924 _na     187_aa ahpC alkyl hydroperoxide reductase subunit C
1970 CALHPR010000020.1 GCA938036385_00988 CDS open 18158-21571 _na     1137_aa Putative ATP-dependent nuclease subunit B
1971 CALHPR010000020.1 GCA938036385_00989 CDS open 21568-25425 _na     1285_aa addA helicase-exonuclease AddAB subunit AddA
1972 CALHPR010000020.1 GCA938036385_00990 CDS open 25515-25835 _na     106_aa tfoX TfoX N-terminal domain protein
1973 CALHPR010000020.1 GCA938036385_00991 CDS open 25927-26724 _na     265_aa Hydrolase%2C carbon-nitrogen family
1974 CALHPR010000020.1 GCA938036385_00992 CDS open 26835-29012 _na     725_aa TonB-dependent receptor
1975 CALHPR010000020.1 GCA938036385_00993 CDS open 29183-30526 _na     447_aa Na+/H+ antiporter family protein
1976 CALHPR010000020.1 GCA938036385_00994 CDS open 30642-31208 _na     188_aa mntP Putative manganese efflux pump MntP
1977 CALHPR010000020.1 GCA938036385_00995 CDS open 31481-32542 _na     353_aa mmcQ MmcQ protein
1978 CALHPR010000020.1 GCA938036385_00996 CDS open 32632-33822 _na     396_aa Tetratricopeptide repeat protein
1979 CALHPR010000020.1 GCA938036385_00997 CDS open 33946-37692 _na     1248_aa phosphoribosylformylglycinamidine synthase
1980 CALHPR010000020.1 GCA938036385_00998 CDS open 37743-38183 _na     146_aa hypothetical protein
1981 CALHPR010000020.1 GCA938036385_00999 CDS open 38065-38511 _na     148_aa hypothetical protein
1982 CALHPR010000020.1 GCA938036385_01000 CDS open 38686-40059 _na     457_aa DUF2207 domain-containing protein
1983 CALHPR010000020.1 GCA938036385_01001 CDS open 40312-41568 _na     418_aa Glutamate dehydrogenase
1984 CALHPR010000020.1 GCA938036385_01002 CDS open 41722-42969 _na     415_aa Tat pathway signal sequence domain protein
1985 CALHPR010000020.1 GCA938036385_01003 CDS open 43076-44434 _na     452_aa Transporter
1986 CALHPR010000020.1 GCA938036385_01004 CDS open 44485-45840 _na     451_aa Transporter
1987 CALHPR010000020.1 GCA938036385_01005 CDS open 45999-46916 _na     305_aa Pseudouridine synthase
1988 CALHPR010000020.1 GCA938036385_01006 CDS open 46939-47526 _na     195_aa DUF4178 domain-containing protein
1989 CALHPR010000020.1 GCA938036385_01007 CDS open 47545-47877 _na     110_aa hypothetical protein
1990 CALHPR010000020.1 GCA938036385_01008 CDS open 47902-48498 _na     198_aa torD Cytoplasmic chaperone TorD
1991 CALHPR010000020.1 GCA938036385_01009 CDS open 48663-49220 _na     185_aa Zinc ribbon domain-containing protein
1992 CALHPR010000020.1 GCA938036385_01010 CDS open 49284-49757 _na     157_aa hypothetical protein
1993 CALHPR010000020.1 GCA938036385_01011 CDS open 49789-50397 _na     202_aa Peptidase C39-like domain-containing protein
1994 CALHPR010000020.1 GCA938036385_01012 CDS open 50502-51203 _na     233_aa thiF ThiF family protein
1995 CALHPR010000020.1 GCA938036385_01013 CDS open 51205-51573 _na     122_aa Aldoketomutase
1996 CALHPR010000020.1 GCA938036385_01014 CDS open 51755-53008 _na     417_aa tyrS tyrosine--tRNA ligase
1997 CALHPR010000020.1 GCA938036385_01015 CDS open 53198-54775 _na     525_aa Diguanylate phosphodiesterase
1998 CALHPR010000020.1 GCA938036385_01016 CDS open 54964-55641 _na     225_aa HTH tetR-type domain-containing protein
1999 CALHPR010000020.1 GCA938036385_01017 CDS open 55645-58287 _na     880_aa Nuclease SbcCD subunit C
2000 CALHPR010000020.1 GCA938036385_01018 CDS open 58287-59417 _na     376_aa Nuclease SbcCD subunit D