BAKTAGenome Explorer: Dialister invisus (GCA_938036385.1)
Select a Genome:
|
BAKTA Annotations for GCA_938036385.1
|
Search & Sort all 3869 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 2501 | CALHPR010000026.1 | GCA938036385_01242 | gene | open | 29273-29833 | |||
| 2502 | CALHPR010000026.1 | GCA938036385_01243 | gene | open | 29917-30672 | |||
| 2503 | CALHPR010000026.1 | GCA938036385_01244 | gene | open | 30819-31988 | |||
| 2504 | CALHPR010000026.1 | GCA938036385_01245 | gene | open | 32558-33541 | |||
| 2505 | CALHPR010000026.1 | GCA938036385_01247 | gene | open | 33868-34788 | |||
| 2506 | CALHPR010000026.1 | GCA938036385_01201 | gene | open | 436-527 | trnS | ||
| 2507 | CALHPR010000026.1 | GCA938036385_01202 | gene | open | 1617-1706 | trnS | ||
| 2508 | CALHPR010000026.1 | GCA938036385_01246 | gene | open | 33642-33716 | trnC | ||
| 2509 | CALHPR010000026.1 | GCA938036385_01201 | tRNA | open | 436-527 | trnS | tRNA-Ser(gga) | |
| 2510 | CALHPR010000026.1 | GCA938036385_01202 | tRNA | open | 1617-1706 | trnS | tRNA-Ser(tga) | |
| 2511 | CALHPR010000026.1 | GCA938036385_01246 | tRNA | open | 33642-33716 | trnC | tRNA-Cys(gca) | |
| 2512 | CALHPR010000027.1 | GCA938036385_01248 | CDS | open | 136-1437 | _na 433_aa | Transporter%2C DASS family | |
| 2513 | CALHPR010000027.1 | GCA938036385_01249 | CDS | open | 2101-2220 | _na 39_aa | hypothetical protein | |
| 2514 | CALHPR010000027.1 | GCA938036385_01250 | CDS | open | 2242-3084 | _na 280_aa | hypothetical protein | |
| 2515 | CALHPR010000027.1 | GCA938036385_01251 | CDS | open | 3115-3789 | _na 224_aa | TIGR02206 family protein | |
| 2516 | CALHPR010000027.1 | GCA938036385_01252 | CDS | open | 3849-4103 | _na 84_aa | Integral membrane protein | |
| 2517 | CALHPR010000027.1 | GCA938036385_01253 | CDS | open | 4480-5778 | _na 432_aa | Citrate transporter-like domain-containing protein | |
| 2518 | CALHPR010000027.1 | GCA938036385_01254 | CDS | open | 5961-6479 | _na 172_aa | Nitroreductase family protein | |
| 2519 | CALHPR010000027.1 | GCA938036385_01255 | CDS | open | 6567-7028 | _na 153_aa | eamA | EamA domain-containing protein |
| 2520 | CALHPR010000027.1 | GCA938036385_01256 | CDS | open | 7006-7416 | _na 136_aa | VOC family protein | |
| 2521 | CALHPR010000027.1 | GCA938036385_01257 | CDS | open | 7444-8190 | _na 248_aa | Type-4 uracil-DNA glycosylase | |
| 2522 | CALHPR010000027.1 | GCA938036385_01258 | CDS | open | 8222-9649 | _na 475_aa | dnaB | replicative DNA helicase |
| 2523 | CALHPR010000027.1 | GCA938036385_01259 | CDS | open | 9662-11578 | _na 638_aa | lonC | Lon family ATP-dependent protease |
| 2524 | CALHPR010000027.1 | GCA938036385_01248 | gene | open | 136-1437 | |||
| 2525 | CALHPR010000027.1 | GCA938036385_01249 | gene | open | 2101-2220 | |||
| 2526 | CALHPR010000027.1 | GCA938036385_01250 | gene | open | 2242-3084 | |||
| 2527 | CALHPR010000027.1 | GCA938036385_01251 | gene | open | 3115-3789 | |||
| 2528 | CALHPR010000027.1 | GCA938036385_01252 | gene | open | 3849-4103 | |||
| 2529 | CALHPR010000027.1 | GCA938036385_01253 | gene | open | 4480-5778 | |||
| 2530 | CALHPR010000027.1 | GCA938036385_01254 | gene | open | 5961-6479 | |||
| 2531 | CALHPR010000027.1 | GCA938036385_01255 | gene | open | 6567-7028 | eamA | ||
| 2532 | CALHPR010000027.1 | GCA938036385_01256 | gene | open | 7006-7416 | |||
| 2533 | CALHPR010000027.1 | GCA938036385_01257 | gene | open | 7444-8190 | |||
| 2534 | CALHPR010000027.1 | GCA938036385_01258 | gene | open | 8222-9649 | dnaB | ||
| 2535 | CALHPR010000027.1 | GCA938036385_01259 | gene | open | 9662-11578 | lonC | ||
| 2536 | CALHPR010000028.1 | regulatory_region | open | 9206-9377 | Cobalamin riboswitch aptamer | |||
| 2537 | CALHPR010000028.1 | GCA938036385_01260 | CDS | open | 4298-7201 | _na 967_aa | TonB-dependent receptor plug domain-containing protein | |
| 2538 | CALHPR010000028.1 | GCA938036385_01261 | CDS | open | 7265-8044 | _na 259_aa | tonB | TonB family protein |
| 2539 | CALHPR010000028.1 | GCA938036385_01262 | CDS | open | 8041-8424 | _na 127_aa | exbD | Biopolymer transporter ExbD |
| 2540 | CALHPR010000028.1 | GCA938036385_01263 | CDS | open | 8464-9078 | _na 204_aa | MotA/TolQ/ExbB proton channel family protein | |
| 2541 | CALHPR010000028.1 | GCA938036385_01264 | CDS | open | 9528-9932 | _na 134_aa | ompH | OmpH family outer membrane protein |
| 2542 | CALHPR010000028.1 | GCA938036385_01265 | CDS | open | 9978-10691 | _na 237_aa | ybjN | YbjN domain-containing protein |
| 2543 | CALHPR010000028.1 | GCA938036385_01260 | gene | open | 4298-7201 | |||
| 2544 | CALHPR010000028.1 | GCA938036385_01261 | gene | open | 7265-8044 | tonB | ||
| 2545 | CALHPR010000028.1 | GCA938036385_01262 | gene | open | 8041-8424 | exbD | ||
| 2546 | CALHPR010000028.1 | GCA938036385_01263 | gene | open | 8464-9078 | |||
| 2547 | CALHPR010000028.1 | GCA938036385_01264 | gene | open | 9528-9932 | ompH | ||
| 2548 | CALHPR010000028.1 | GCA938036385_01265 | gene | open | 9978-10691 | ybjN | ||
| 2549 | CALHPR010000029.1 | GCA938036385_01340 | gene | open | 75030-75374 | ssrA | ||
| 2550 | CALHPR010000029.1 | GCA938036385_01340 | tmRNA | open | 75030-75374 | ssrA | transfer-messenger RNA%2C SsrA | |
| 2551 | CALHPR010000029.1 | GCA938036385_01274 | gene | open | 8654-8870 | Bacteria_large_SRP | ||
| 2552 | CALHPR010000029.1 | GCA938036385_01275 | gene | open | 8694-8793 | Bacteria_small_SRP | ||
| 2553 | CALHPR010000029.1 | GCA938036385_01274 | ncRNA | open | 8654-8870 | Bacterial large signal recognition particle RNA | ||
| 2554 | CALHPR010000029.1 | GCA938036385_01275 | ncRNA | open | 8694-8793 | Bacterial small signal recognition particle RNA | ||
| 2555 | CALHPR010000029.1 | regulatory_region | open | 61534-61767 | T-box leader | |||
| 2556 | CALHPR010000029.1 | GCA938036385_01266 | CDS | open | 256-1317 | _na 353_aa | hrcA | heat-inducible transcriptional repressor HrcA |
| 2557 | CALHPR010000029.1 | GCA938036385_01267 | CDS | open | 1388-1990 | _na 200_aa | grpE | nucleotide exchange factor GrpE |
| 2558 | CALHPR010000029.1 | GCA938036385_01268 | CDS | open | 2050-3912 | _na 620_aa | dnaK | molecular chaperone DnaK |
| 2559 | CALHPR010000029.1 | GCA938036385_01269 | CDS | open | 4009-5190 | _na 393_aa | dnaJ | molecular chaperone DnaJ |
| 2560 | CALHPR010000029.1 | GCA938036385_01270 | CDS | open | 5256-5504 | _na 82_aa | bofA | Pro-sigmaK processing inhibitor BofA |
| 2561 | CALHPR010000029.1 | GCA938036385_01271 | CDS | open | 5645-6235 | _na 196_aa | recR | recombination mediator RecR |
| 2562 | CALHPR010000029.1 | GCA938036385_01272 | CDS | open | 6235-6561 | _na 108_aa | YbaB/EbfC family nucleoid-associated protein | |
| 2563 | CALHPR010000029.1 | GCA938036385_01273 | CDS | open | 6673-8589 | _na 638_aa | dnaX | DNA polymerase III subunit gamma/tau |
| 2564 | CALHPR010000029.1 | GCA938036385_01276 | CDS | open | 9013-10401 | _na 462_aa | fumC | class II fumarate hydratase |
| 2565 | CALHPR010000029.1 | GCA938036385_01277 | CDS | open | 10581-11486 | _na 301_aa | murB | UDP-N-acetylmuramate dehydrogenase |
| 2566 | CALHPR010000029.1 | GCA938036385_01278 | CDS | open | 11536-12369 | _na 277_aa | Asp23/Gls24 family envelope stress response protein | |
| 2567 | CALHPR010000029.1 | GCA938036385_01279 | CDS | open | 12466-13806 | _na 446_aa | miaB | tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB |
| 2568 | CALHPR010000029.1 | GCA938036385_01280 | CDS | open | 13812-16370 | _na 852_aa | mutS | DNA mismatch repair protein MutS |
| 2569 | CALHPR010000029.1 | GCA938036385_01281 | CDS | open | 16370-18307 | _na 645_aa | mutL | DNA mismatch repair endonuclease MutL |
| 2570 | CALHPR010000029.1 | GCA938036385_01282 | CDS | open | 18304-19080 | _na 258_aa | SAM-dependent methyltransferase | |
| 2571 | CALHPR010000029.1 | GCA938036385_01283 | CDS | open | 19077-20000 | _na 307_aa | miaA | tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA |
| 2572 | CALHPR010000029.1 | GCA938036385_01284 | CDS | open | 19985-20185 | _na 66_aa | hfq | RNA chaperone Hfq |
| 2573 | CALHPR010000029.1 | GCA938036385_01285 | CDS | open | 20195-21439 | _na 414_aa | Aluminum resistance protein | |
| 2574 | CALHPR010000029.1 | GCA938036385_01291 | CDS | open | 22403-23701 | _na 432_aa | H(+)-transporting ATPase | |
| 2575 | CALHPR010000029.1 | GCA938036385_01292 | CDS | open | 23713-24408 | _na 231_aa | trkA | TrkA N-terminal domain protein |
| 2576 | CALHPR010000029.1 | GCA938036385_01293 | CDS | open | 24571-24993 | _na 140_aa | Acyl-CoA thioester hydrolase%2C YbgC/YbaW family | |
| 2577 | CALHPR010000029.1 | GCA938036385_01294 | CDS | open | 24986-25762 | _na 258_aa | Glutamate racemase | |
| 2578 | CALHPR010000029.1 | GCA938036385_01295 | CDS | open | 25766-26323 | _na 185_aa | DUF58 domain-containing protein | |
| 2579 | CALHPR010000029.1 | GCA938036385_01296 | CDS | open | 26325-26975 | _na 216_aa | Coenzyme F420:L-glutamate ligase-like domain-containing protein | |
| 2580 | CALHPR010000029.1 | GCA938036385_01297 | CDS | open | 27083-27274 | _na 63_aa | rpmB | 50S ribosomal protein L28 |
| 2581 | CALHPR010000029.1 | GCA938036385_01298 | CDS | open | 27354-29447 | _na 697_aa | recG | ATP-dependent DNA helicase RecG |
| 2582 | CALHPR010000029.1 | GCA938036385_01299 | CDS | open | 29601-31058 | _na 485_aa | guaB | IMP dehydrogenase |
| 2583 | CALHPR010000029.1 | GCA938036385_01300 | CDS | open | 31058-31816 | _na 252_aa | Glycosyltransferase%2C WecB/TagA/CpsF family | |
| 2584 | CALHPR010000029.1 | GCA938036385_01301 | CDS | open | 31810-32463 | _na 217_aa | phosphatidylserine decarboxylase | |
| 2585 | CALHPR010000029.1 | GCA938036385_01302 | CDS | open | 32460-33170 | _na 236_aa | pssA | CDP-diacylglycerol--serine O-phosphatidyltransferase |
| 2586 | CALHPR010000029.1 | GCA938036385_01303 | CDS | open | 33172-34431 | _na 419_aa | Glycosyltransferase%2C group 2 family protein | |
| 2587 | CALHPR010000029.1 | GCA938036385_01304 | CDS | open | 34433-35209 | _na 258_aa | surE | 5'/3'-nucleotidase SurE |
| 2588 | CALHPR010000029.1 | GCA938036385_01306 | CDS | open | 35518-36768 | _na 416_aa | Amidohydrolase | |
| 2589 | CALHPR010000029.1 | GCA938036385_01307 | CDS | open | 36905-38179 | _na 424_aa | DEAD/DEAH box helicase | |
| 2590 | CALHPR010000029.1 | GCA938036385_01308 | CDS | open | 38187-39131 | _na 314_aa | Beta-carotene 15%2C15'-monooxygenase | |
| 2591 | CALHPR010000029.1 | GCA938036385_01309 | CDS | open | 39374-40051 | _na 225_aa | ECF transporter S component | |
| 2592 | CALHPR010000029.1 | GCA938036385_01310 | CDS | open | 40250-41206 | _na 318_aa | Hydrid cluster protein-associated redox disulfide domain protein | |
| 2593 | CALHPR010000029.1 | GCA938036385_01311 | CDS | open | 41389-42540 | _na 383_aa | Peptidase%2C M48 family | |
| 2594 | CALHPR010000029.1 | GCA938036385_01312 | CDS | open | 42567-43559 | _na 330_aa | Serine-type D-Ala-D-Ala carboxypeptidase | |
| 2595 | CALHPR010000029.1 | GCA938036385_01313 | CDS | open | 43529-43828 | _na 99_aa | Septum formation initiator | |
| 2596 | CALHPR010000029.1 | GCA938036385_01314 | CDS | open | 43917-44471 | _na 184_aa | S1 RNA binding domain protein | |
| 2597 | CALHPR010000029.1 | GCA938036385_01315 | CDS | open | 44619-45530 | _na 303_aa | Ppx/GppA phosphatase family protein | |
| 2598 | CALHPR010000029.1 | GCA938036385_01316 | CDS | open | 45547-46968 | _na 473_aa | tRNA(Ile)-lysidine synthase | |
| 2599 | CALHPR010000029.1 | GCA938036385_01317 | CDS | open | 46955-47506 | _na 183_aa | hpt | hypoxanthine phosphoribosyltransferase |
| 2600 | CALHPR010000029.1 | GCA938036385_01318 | CDS | open | 47652-49538 | _na 628_aa | ftsH | ATP-dependent zinc metalloprotease FtsH |
| 2601 | CALHPR010000029.1 | GCA938036385_01319 | CDS | open | 49800-50240 | _na 146_aa | rplM | 50S ribosomal protein L13 |
| 2602 | CALHPR010000029.1 | GCA938036385_01320 | CDS | open | 50256-50654 | _na 132_aa | rpsI | 30S ribosomal protein S9 |
| 2603 | CALHPR010000029.1 | GCA938036385_01321 | CDS | open | 50812-52290 | _na 492_aa | Type I restriction modification DNA specificity domain-containing protein | |
| 2604 | CALHPR010000029.1 | GCA938036385_01322 | CDS | open | 52316-52909 | _na 197_aa | XTP/dITP diphosphatase | |
| 2605 | CALHPR010000029.1 | GCA938036385_01323 | CDS | open | 53060-54271 | _na 403_aa | Malic enzyme%2C NAD binding domain protein | |
| 2606 | CALHPR010000029.1 | GCA938036385_01324 | CDS | open | 54405-55907 | _na 500_aa | tRNA nucleotidyltransferase/poly(A) polymerase family protein | |
| 2607 | CALHPR010000029.1 | GCA938036385_01325 | CDS | open | 55894-57882 | _na 662_aa | Penicillin-binding protein%2C transpeptidase domain protein | |
| 2608 | CALHPR010000029.1 | GCA938036385_01326 | CDS | open | 58017-59684 | _na 555_aa | formate--tetrahydrofolate ligase | |
| 2609 | CALHPR010000029.1 | GCA938036385_01327 | CDS | open | 59694-60539 | _na 281_aa | folD | Bifunctional protein FolD |
| 2610 | CALHPR010000029.1 | GCA938036385_01328 | CDS | open | 60571-61425 | _na 284_aa | mscS | Transporter%2C small conductance mechanosensitive ion channel MscS family protein |
| 2611 | CALHPR010000029.1 | GCA938036385_01329 | CDS | open | 61841-63328 | _na 495_aa | ABC transporter%2C ATP-binding protein | |
| 2612 | CALHPR010000029.1 | GCA938036385_01330 | CDS | open | 63321-64139 | _na 272_aa | ABC transporter%2C ATP-binding protein | |
| 2613 | CALHPR010000029.1 | GCA938036385_01331 | CDS | open | 64136-64819 | _na 227_aa | Cobalt transport protein | |
| 2614 | CALHPR010000029.1 | GCA938036385_01332 | CDS | open | 64886-65380 | _na 164_aa | queF | preQ(1) synthase |
| 2615 | CALHPR010000029.1 | GCA938036385_01333 | CDS | open | 65438-67015 | _na 525_aa | Putative exopolyphosphatase | |
| 2616 | CALHPR010000029.1 | GCA938036385_01334 | CDS | open | 67209-68765 | _na 518_aa | Ppx/GppA phosphatase family | |
| 2617 | CALHPR010000029.1 | GCA938036385_01335 | CDS | open | 68762-70948 | _na 728_aa | ppk1 | polyphosphate kinase 1 |
| 2618 | CALHPR010000029.1 | GCA938036385_01336 | CDS | open | 71577-72554 | _na 325_aa | G5 domain-containing protein | |
| 2619 | CALHPR010000029.1 | GCA938036385_01337 | CDS | open | 72670-73101 | _na 143_aa | lspA | signal peptidase II |
| 2620 | CALHPR010000029.1 | GCA938036385_01338 | CDS | open | 73102-74028 | _na 308_aa | Pseudouridine synthase | |
| 2621 | CALHPR010000029.1 | GCA938036385_01339 | CDS | open | 74028-74984 | _na 318_aa | Peptidase family T4 | |
| 2622 | CALHPR010000029.1 | GCA938036385_01341 | CDS | open | 75510-75830 | _na 106_aa | Thioredoxin | |
| 2623 | CALHPR010000029.1 | GCA938036385_01342 | CDS | open | 75941-76753 | _na 270_aa | thiM | hydroxyethylthiazole kinase |
| 2624 | CALHPR010000029.1 | GCA938036385_01343 | CDS | open | 76743-77396 | _na 217_aa | Thiamine-phosphate synthase | |
| 2625 | CALHPR010000029.1 | GCA938036385_01266 | gene | open | 256-1317 | hrcA | ||
| 2626 | CALHPR010000029.1 | GCA938036385_01267 | gene | open | 1388-1990 | grpE | ||
| 2627 | CALHPR010000029.1 | GCA938036385_01268 | gene | open | 2050-3912 | dnaK | ||
| 2628 | CALHPR010000029.1 | GCA938036385_01269 | gene | open | 4009-5190 | dnaJ | ||
| 2629 | CALHPR010000029.1 | GCA938036385_01270 | gene | open | 5256-5504 | bofA | ||
| 2630 | CALHPR010000029.1 | GCA938036385_01271 | gene | open | 5645-6235 | recR | ||
| 2631 | CALHPR010000029.1 | GCA938036385_01272 | gene | open | 6235-6561 | |||
| 2632 | CALHPR010000029.1 | GCA938036385_01273 | gene | open | 6673-8589 | dnaX | ||
| 2633 | CALHPR010000029.1 | GCA938036385_01276 | gene | open | 9013-10401 | fumC | ||
| 2634 | CALHPR010000029.1 | GCA938036385_01277 | gene | open | 10581-11486 | murB | ||
| 2635 | CALHPR010000029.1 | GCA938036385_01278 | gene | open | 11536-12369 | |||
| 2636 | CALHPR010000029.1 | GCA938036385_01279 | gene | open | 12466-13806 | miaB | ||
| 2637 | CALHPR010000029.1 | GCA938036385_01280 | gene | open | 13812-16370 | mutS | ||
| 2638 | CALHPR010000029.1 | GCA938036385_01281 | gene | open | 16370-18307 | mutL | ||
| 2639 | CALHPR010000029.1 | GCA938036385_01282 | gene | open | 18304-19080 | |||
| 2640 | CALHPR010000029.1 | GCA938036385_01283 | gene | open | 19077-20000 | miaA | ||
| 2641 | CALHPR010000029.1 | GCA938036385_01284 | gene | open | 19985-20185 | hfq | ||
| 2642 | CALHPR010000029.1 | GCA938036385_01285 | gene | open | 20195-21439 | |||
| 2643 | CALHPR010000029.1 | GCA938036385_01291 | gene | open | 22403-23701 | |||
| 2644 | CALHPR010000029.1 | GCA938036385_01292 | gene | open | 23713-24408 | trkA | ||
| 2645 | CALHPR010000029.1 | GCA938036385_01293 | gene | open | 24571-24993 | |||
| 2646 | CALHPR010000029.1 | GCA938036385_01294 | gene | open | 24986-25762 | |||
| 2647 | CALHPR010000029.1 | GCA938036385_01295 | gene | open | 25766-26323 | |||
| 2648 | CALHPR010000029.1 | GCA938036385_01296 | gene | open | 26325-26975 | |||
| 2649 | CALHPR010000029.1 | GCA938036385_01297 | gene | open | 27083-27274 | rpmB | ||
| 2650 | CALHPR010000029.1 | GCA938036385_01298 | gene | open | 27354-29447 | recG | ||
| 2651 | CALHPR010000029.1 | GCA938036385_01299 | gene | open | 29601-31058 | guaB | ||
| 2652 | CALHPR010000029.1 | GCA938036385_01300 | gene | open | 31058-31816 | |||
| 2653 | CALHPR010000029.1 | GCA938036385_01301 | gene | open | 31810-32463 | |||
| 2654 | CALHPR010000029.1 | GCA938036385_01302 | gene | open | 32460-33170 | pssA | ||
| 2655 | CALHPR010000029.1 | GCA938036385_01303 | gene | open | 33172-34431 | |||
| 2656 | CALHPR010000029.1 | GCA938036385_01304 | gene | open | 34433-35209 | surE | ||
| 2657 | CALHPR010000029.1 | GCA938036385_01306 | gene | open | 35518-36768 | |||
| 2658 | CALHPR010000029.1 | GCA938036385_01307 | gene | open | 36905-38179 | |||
| 2659 | CALHPR010000029.1 | GCA938036385_01308 | gene | open | 38187-39131 | |||
| 2660 | CALHPR010000029.1 | GCA938036385_01309 | gene | open | 39374-40051 | |||
| 2661 | CALHPR010000029.1 | GCA938036385_01310 | gene | open | 40250-41206 | |||
| 2662 | CALHPR010000029.1 | GCA938036385_01311 | gene | open | 41389-42540 | |||
| 2663 | CALHPR010000029.1 | GCA938036385_01312 | gene | open | 42567-43559 | |||
| 2664 | CALHPR010000029.1 | GCA938036385_01313 | gene | open | 43529-43828 | |||
| 2665 | CALHPR010000029.1 | GCA938036385_01314 | gene | open | 43917-44471 | |||
| 2666 | CALHPR010000029.1 | GCA938036385_01315 | gene | open | 44619-45530 | |||
| 2667 | CALHPR010000029.1 | GCA938036385_01316 | gene | open | 45547-46968 | |||
| 2668 | CALHPR010000029.1 | GCA938036385_01317 | gene | open | 46955-47506 | hpt | ||
| 2669 | CALHPR010000029.1 | GCA938036385_01318 | gene | open | 47652-49538 | ftsH | ||
| 2670 | CALHPR010000029.1 | GCA938036385_01319 | gene | open | 49800-50240 | rplM | ||
| 2671 | CALHPR010000029.1 | GCA938036385_01320 | gene | open | 50256-50654 | rpsI | ||
| 2672 | CALHPR010000029.1 | GCA938036385_01321 | gene | open | 50812-52290 | |||
| 2673 | CALHPR010000029.1 | GCA938036385_01322 | gene | open | 52316-52909 | |||
| 2674 | CALHPR010000029.1 | GCA938036385_01323 | gene | open | 53060-54271 | |||
| 2675 | CALHPR010000029.1 | GCA938036385_01324 | gene | open | 54405-55907 | |||
| 2676 | CALHPR010000029.1 | GCA938036385_01325 | gene | open | 55894-57882 | |||
| 2677 | CALHPR010000029.1 | GCA938036385_01326 | gene | open | 58017-59684 | |||
| 2678 | CALHPR010000029.1 | GCA938036385_01327 | gene | open | 59694-60539 | folD | ||
| 2679 | CALHPR010000029.1 | GCA938036385_01328 | gene | open | 60571-61425 | mscS | ||
| 2680 | CALHPR010000029.1 | GCA938036385_01329 | gene | open | 61841-63328 | |||
| 2681 | CALHPR010000029.1 | GCA938036385_01330 | gene | open | 63321-64139 | |||
| 2682 | CALHPR010000029.1 | GCA938036385_01331 | gene | open | 64136-64819 | |||
| 2683 | CALHPR010000029.1 | GCA938036385_01332 | gene | open | 64886-65380 | queF | ||
| 2684 | CALHPR010000029.1 | GCA938036385_01333 | gene | open | 65438-67015 | |||
| 2685 | CALHPR010000029.1 | GCA938036385_01334 | gene | open | 67209-68765 | |||
| 2686 | CALHPR010000029.1 | GCA938036385_01335 | gene | open | 68762-70948 | ppk1 | ||
| 2687 | CALHPR010000029.1 | GCA938036385_01336 | gene | open | 71577-72554 | |||
| 2688 | CALHPR010000029.1 | GCA938036385_01337 | gene | open | 72670-73101 | lspA | ||
| 2689 | CALHPR010000029.1 | GCA938036385_01338 | gene | open | 73102-74028 | |||
| 2690 | CALHPR010000029.1 | GCA938036385_01339 | gene | open | 74028-74984 | |||
| 2691 | CALHPR010000029.1 | GCA938036385_01341 | gene | open | 75510-75830 | |||
| 2692 | CALHPR010000029.1 | GCA938036385_01342 | gene | open | 75941-76753 | thiM | ||
| 2693 | CALHPR010000029.1 | GCA938036385_01343 | gene | open | 76743-77396 | |||
| 2694 | CALHPR010000029.1 | GCA938036385_01286 | gene | open | 21532-21608 | trnV | ||
| 2695 | CALHPR010000029.1 | GCA938036385_01287 | gene | open | 21932-22008 | trnD | ||
| 2696 | CALHPR010000029.1 | GCA938036385_01288 | gene | open | 22016-22091 | trnF | ||
| 2697 | CALHPR010000029.1 | GCA938036385_01289 | gene | open | 22097-22181 | trnL | ||
| 2698 | CALHPR010000029.1 | GCA938036385_01290 | gene | open | 22214-22298 | trnL | ||
| 2699 | CALHPR010000029.1 | GCA938036385_01305 | gene | open | 35246-35331 | trnL | ||
| 2700 | CALHPR010000029.1 | GCA938036385_01286 | tRNA | open | 21532-21608 | trnV | tRNA-Val(gac) | |
| 2701 | CALHPR010000029.1 | GCA938036385_01287 | tRNA | open | 21932-22008 | trnD | tRNA-Asp(gtc) | |
| 2702 | CALHPR010000029.1 | GCA938036385_01288 | tRNA | open | 22016-22091 | trnF | tRNA-Phe(gaa) | |
| 2703 | CALHPR010000029.1 | GCA938036385_01289 | tRNA | open | 22097-22181 | trnL | tRNA-Leu(gag) | |
| 2704 | CALHPR010000029.1 | GCA938036385_01290 | tRNA | open | 22214-22298 | trnL | tRNA-Leu(cag) | |
| 2705 | CALHPR010000029.1 | GCA938036385_01305 | tRNA | open | 35246-35331 | trnL | tRNA-Leu(caa) | |
| 2706 | CALHPR010000030.1 | GCA938036385_01344 | CDS | open | 170-586 | _na 138_aa | Outer membrane protein | |
| 2707 | CALHPR010000030.1 | GCA938036385_01345 | CDS | open | 704-1126 | _na 140_aa | ytfJ | Sporulation protein YtfJ |
| 2708 | CALHPR010000030.1 | GCA938036385_01346 | CDS | open | 1119-1841 | _na 240_aa | DUF2953 domain-containing protein | |
| 2709 | CALHPR010000030.1 | GCA938036385_01347 | CDS | open | 1838-2878 | _na 346_aa | WYL domain-containing protein | |
| 2710 | CALHPR010000030.1 | GCA938036385_01348 | CDS | open | 2884-3471 | _na 195_aa | Phosphatase PAP2 family protein | |
| 2711 | CALHPR010000030.1 | GCA938036385_01349 | CDS | open | 3717-3953 | _na 78_aa | RNA helicase | |
| 2712 | CALHPR010000030.1 | GCA938036385_01350 | CDS | open | 4068-4604 | _na 178_aa | Lipoprotein | |
| 2713 | CALHPR010000030.1 | GCA938036385_01351 | CDS | open | 4673-4852 | _na 59_aa | hypothetical protein | |
| 2714 | CALHPR010000030.1 | GCA938036385_01352 | CDS | open | 4819-5580 | _na 253_aa | ABC transporter%2C ATP-binding protein | |
| 2715 | CALHPR010000030.1 | GCA938036385_01353 | CDS | open | 5577-6374 | _na 265_aa | ABC transporter%2C ATP-binding protein | |
| 2716 | CALHPR010000030.1 | GCA938036385_01354 | CDS | open | 6388-7908 | _na 506_aa | ABC transporter%2C substrate-binding protein%2C family 5 | |
| 2717 | CALHPR010000030.1 | GCA938036385_01355 | CDS | open | 7933-8757 | _na 274_aa | nikC | Nickel ABC transporter permease subunit NikC |
| 2718 | CALHPR010000030.1 | GCA938036385_01356 | CDS | open | 8766-9695 | _na 309_aa | nikB | nickel ABC transporter permease |
| 2719 | CALHPR010000030.1 | GCA938036385_01357 | CDS | open | 10749-11576 | _na 275_aa | Putative pyruvate%2C phosphate dikinase regulatory protein | |
| 2720 | CALHPR010000030.1 | GCA938036385_01358 | CDS | open | 11580-12215 | _na 211_aa | CBS domain protein | |
| 2721 | CALHPR010000030.1 | GCA938036385_01359 | CDS | open | 12302-14695 | _na 797_aa | ppsA | phosphoenolpyruvate synthase |
| 2722 | CALHPR010000030.1 | GCA938036385_01360 | CDS | open | 14995-16290 | _na 431_aa | Citrate transporter | |
| 2723 | CALHPR010000030.1 | GCA938036385_01363 | CDS | open | 16986-17606 | _na 206_aa | Formiminotransferase-cyclodeaminase | |
| 2724 | CALHPR010000030.1 | GCA938036385_01364 | CDS | open | 17653-19290 | _na 545_aa | Chloride transporter%2C ClC family | |
| 2725 | CALHPR010000030.1 | GCA938036385_01365 | CDS | open | 19335-21146 | _na 603_aa | DUF2357 domain-containing protein | |
| 2726 | CALHPR010000030.1 | GCA938036385_01366 | CDS | open | 21130-23217 | _na 695_aa | Restriction endonuclease | |
| 2727 | CALHPR010000030.1 | GCA938036385_01367 | CDS | open | 23377-23874 | _na 165_aa | Prepilin-type cleavage/methylation domain-containing protein | |
| 2728 | CALHPR010000030.1 | GCA938036385_01368 | CDS | open | 23819-24448 | _na 209_aa | prepilin peptidase | |
| 2729 | CALHPR010000030.1 | GCA938036385_01369 | CDS | open | 24583-25302 | _na 239_aa | Protein kinase domain-containing protein | |
| 2730 | CALHPR010000030.1 | GCA938036385_01370 | CDS | open | 26256-27551 | _na 431_aa | Transporter%2C DASS family | |
| 2731 | CALHPR010000030.1 | GCA938036385_01371 | CDS | open | 27666-27827 | _na 53_aa | hypothetical protein | |
| 2732 | CALHPR010000030.1 | GCA938036385_01372 | CDS | open | 28862-29047 | _na 61_aa | Toxin-antitoxin system%2C antitoxin component%2C Xre domain protein | |
| 2733 | CALHPR010000030.1 | GCA938036385_01373 | CDS | open | 29044-29205 | _na 53_aa | hypothetical protein | |
| 2734 | CALHPR010000030.1 | GCA938036385_01374 | CDS | open | 29348-30271 | _na 307_aa | lysR | Transcriptional regulator%2C LysR family |
| 2735 | CALHPR010000030.1 | GCA938036385_01375 | CDS | open | 30414-31406 | _na 330_aa | deoxyguanosinetriphosphate triphosphohydrolase | |
| 2736 | CALHPR010000030.1 | GCA938036385_01376 | CDS | open | 31451-32404 | _na 317_aa | AB hydrolase-1 domain-containing protein | |
| 2737 | CALHPR010000030.1 | GCA938036385_01377 | CDS | open | 32405-33619 | _na 404_aa | Transporter%2C major facilitator family protein | |
| 2738 | CALHPR010000030.1 | GCA938036385_01378 | CDS | open | 33800-34312 | _na 170_aa | Flavin reductase like domain-containing protein | |
| 2739 | CALHPR010000030.1 | GCA938036385_01379 | CDS | open | 34393-35874 | _na 493_aa | Aldehyde dehydrogenase (NAD) family protein | |
| 2740 | CALHPR010000030.1 | GCA938036385_01380 | CDS | open | 36215-36658 | _na 147_aa | N-acetyltransferase | |
| 2741 | CALHPR010000030.1 | GCA938036385_01381 | CDS | open | 36904-38757 | _na 617_aa | tatD | TatD family hydrolase |
| 2742 | CALHPR010000030.1 | GCA938036385_01344 | gene | open | 170-586 | |||
| 2743 | CALHPR010000030.1 | GCA938036385_01345 | gene | open | 704-1126 | ytfJ | ||
| 2744 | CALHPR010000030.1 | GCA938036385_01346 | gene | open | 1119-1841 | |||
| 2745 | CALHPR010000030.1 | GCA938036385_01347 | gene | open | 1838-2878 | |||
| 2746 | CALHPR010000030.1 | GCA938036385_01348 | gene | open | 2884-3471 | |||
| 2747 | CALHPR010000030.1 | GCA938036385_01349 | gene | open | 3717-3953 | |||
| 2748 | CALHPR010000030.1 | GCA938036385_01350 | gene | open | 4068-4604 | |||
| 2749 | CALHPR010000030.1 | GCA938036385_01351 | gene | open | 4673-4852 | |||
| 2750 | CALHPR010000030.1 | GCA938036385_01352 | gene | open | 4819-5580 | |||
| 2751 | CALHPR010000030.1 | GCA938036385_01353 | gene | open | 5577-6374 | |||
| 2752 | CALHPR010000030.1 | GCA938036385_01354 | gene | open | 6388-7908 | |||
| 2753 | CALHPR010000030.1 | GCA938036385_01355 | gene | open | 7933-8757 | nikC | ||
| 2754 | CALHPR010000030.1 | GCA938036385_01356 | gene | open | 8766-9695 | nikB | ||
| 2755 | CALHPR010000030.1 | GCA938036385_01357 | gene | open | 10749-11576 | |||
| 2756 | CALHPR010000030.1 | GCA938036385_01358 | gene | open | 11580-12215 | |||
| 2757 | CALHPR010000030.1 | GCA938036385_01359 | gene | open | 12302-14695 | ppsA | ||
| 2758 | CALHPR010000030.1 | GCA938036385_01360 | gene | open | 14995-16290 | |||
| 2759 | CALHPR010000030.1 | GCA938036385_01363 | gene | open | 16986-17606 | |||
| 2760 | CALHPR010000030.1 | GCA938036385_01364 | gene | open | 17653-19290 | |||
| 2761 | CALHPR010000030.1 | GCA938036385_01365 | gene | open | 19335-21146 | |||
| 2762 | CALHPR010000030.1 | GCA938036385_01366 | gene | open | 21130-23217 | |||
| 2763 | CALHPR010000030.1 | GCA938036385_01367 | gene | open | 23377-23874 | |||
| 2764 | CALHPR010000030.1 | GCA938036385_01368 | gene | open | 23819-24448 | |||
| 2765 | CALHPR010000030.1 | GCA938036385_01369 | gene | open | 24583-25302 | |||
| 2766 | CALHPR010000030.1 | GCA938036385_01370 | gene | open | 26256-27551 | |||
| 2767 | CALHPR010000030.1 | GCA938036385_01371 | gene | open | 27666-27827 | |||
| 2768 | CALHPR010000030.1 | GCA938036385_01372 | gene | open | 28862-29047 | |||
| 2769 | CALHPR010000030.1 | GCA938036385_01373 | gene | open | 29044-29205 | |||
| 2770 | CALHPR010000030.1 | GCA938036385_01374 | gene | open | 29348-30271 | lysR | ||
| 2771 | CALHPR010000030.1 | GCA938036385_01375 | gene | open | 30414-31406 | |||
| 2772 | CALHPR010000030.1 | GCA938036385_01376 | gene | open | 31451-32404 | |||
| 2773 | CALHPR010000030.1 | GCA938036385_01377 | gene | open | 32405-33619 | |||
| 2774 | CALHPR010000030.1 | GCA938036385_01378 | gene | open | 33800-34312 | |||
| 2775 | CALHPR010000030.1 | GCA938036385_01379 | gene | open | 34393-35874 | |||
| 2776 | CALHPR010000030.1 | GCA938036385_01380 | gene | open | 36215-36658 | |||
| 2777 | CALHPR010000030.1 | GCA938036385_01381 | gene | open | 36904-38757 | tatD | ||
| 2778 | CALHPR010000030.1 | GCA938036385_01361 | gene | open | 16603-16676 | trnQ | ||
| 2779 | CALHPR010000030.1 | GCA938036385_01362 | gene | open | 16730-16805 | trnH | ||
| 2780 | CALHPR010000030.1 | GCA938036385_01361 | tRNA | open | 16603-16676 | trnQ | tRNA-Gln(ttg) | |
| 2781 | CALHPR010000030.1 | GCA938036385_01362 | tRNA | open | 16730-16805 | trnH | tRNA-His(gtg) | |
| 2782 | CALHPR010000031.1 | GCA938036385_01383 | CDS | open | 339-1106 | _na 255_aa | DUF111 domain-containing protein | |
| 2783 | CALHPR010000031.1 | GCA938036385_01384 | CDS | open | 1106-2128 | _na 340_aa | Nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase | |
| 2784 | CALHPR010000031.1 | GCA938036385_01385 | CDS | open | 2125-3174 | _na 349_aa | cobT | nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase |
| 2785 | CALHPR010000031.1 | GCA938036385_01386 | CDS | open | 3373-4245 | _na 290_aa | hypothetical protein | |
| 2786 | CALHPR010000031.1 | GCA938036385_01387 | CDS | open | 4416-5009 | _na 197_aa | DUF2939 domain-containing protein | |
| 2787 | CALHPR010000031.1 | GCA938036385_01388 | CDS | open | 5286-5648 | _na 120_aa | marR | Transcriptional regulator%2C MarR family |
| 2788 | CALHPR010000031.1 | GCA938036385_01389 | CDS | open | 5755-7377 | _na 540_aa | groL | chaperonin GroEL |
| 2789 | CALHPR010000031.1 | GCA938036385_01390 | CDS | open | 7411-7692 | _na 93_aa | groES | co-chaperone GroES |
| 2790 | CALHPR010000031.1 | GCA938036385_01391 | CDS | open | 7855-8781 | _na 308_aa | murB | UDP-N-acetylmuramate dehydrogenase |
| 2791 | CALHPR010000031.1 | GCA938036385_01392 | CDS | open | 8778-9131 | _na 117_aa | ylbF | YlbF family regulator |
| 2792 | CALHPR010000031.1 | GCA938036385_01393 | CDS | open | 9118-9627 | _na 169_aa | Putative tRNA (cytidine(34)-2'-O)-methyltransferase | |
| 2793 | CALHPR010000031.1 | GCA938036385_01394 | CDS | open | 9645-10046 | _na 133_aa | hypothetical protein | |
| 2794 | CALHPR010000031.1 | GCA938036385_01395 | CDS | open | 10222-10563 | _na 113_aa | rplS | 50S ribosomal protein L19 |
| 2795 | CALHPR010000031.1 | GCA938036385_01396 | CDS | open | 10713-11888 | _na 391_aa | sigA | RNA polymerase sigma factor SigA |
| 2796 | CALHPR010000031.1 | GCA938036385_01399 | CDS | open | 12350-12784 | _na 144_aa | ruvX | Holliday junction resolvase RuvX |
| 2797 | CALHPR010000031.1 | GCA938036385_01400 | CDS | open | 12781-13974 | _na 397_aa | DUF3084 domain-containing protein | |
| 2798 | CALHPR010000031.1 | GCA938036385_01401 | CDS | open | 14038-15123 | _na 361_aa | Permease%2C YjgP/YjgQ family | |
| 2799 | CALHPR010000031.1 | GCA938036385_01402 | CDS | open | 15152-15874 | _na 240_aa | lptB | LPS export ABC transporter ATP-binding protein |
| 2800 | CALHPR010000031.1 | GCA938036385_01403 | CDS | open | 15871-16719 | _na 282_aa | OstA-like protein | |
| 2801 | CALHPR010000031.1 | GCA938036385_01404 | CDS | open | 16716-17261 | _na 181_aa | lptC | LPS export ABC transporter periplasmic protein LptC |
| 2802 | CALHPR010000031.1 | GCA938036385_01405 | CDS | open | 17258-18241 | _na 327_aa | Lipid A biosynthesis (KDO)2-(Lauroyl)-lipid IVA acyltransferase | |
| 2803 | CALHPR010000031.1 | GCA938036385_01406 | CDS | open | 18282-18821 | _na 179_aa | kdsC | 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase KdsC |
| 2804 | CALHPR010000031.1 | GCA938036385_01407 | CDS | open | 18821-19792 | _na 323_aa | Sugar isomerase%2C KpsF/GutQ family | |
| 2805 | CALHPR010000031.1 | GCA938036385_01408 | CDS | open | 19933-20754 | _na 273_aa | kdsA | 3-deoxy-8-phosphooctulonate synthase |
| 2806 | CALHPR010000031.1 | GCA938036385_01409 | CDS | open | 20751-21482 | _na 243_aa | kdsB | 3-deoxy-manno-octulosonate cytidylyltransferase |
| 2807 | CALHPR010000031.1 | GCA938036385_01410 | CDS | open | 21479-22591 | _na 370_aa | lpxK | tetraacyldisaccharide 4'-kinase |
| 2808 | CALHPR010000031.1 | GCA938036385_01411 | CDS | open | 22581-23912 | _na 443_aa | 3-deoxy-D-manno-octulosonic acid transferase | |
| 2809 | CALHPR010000031.1 | GCA938036385_01412 | CDS | open | 23914-25671 | _na 585_aa | msbA | Putative lipid A export permease/ATP-binding protein MsbA |
| 2810 | CALHPR010000031.1 | GCA938036385_01413 | CDS | open | 25671-26807 | _na 378_aa | lpxB | lipid-A-disaccharide synthase |
| 2811 | CALHPR010000031.1 | GCA938036385_01414 | CDS | open | 26804-27643 | _na 279_aa | lpxI | UDP-2%2C3-diacylglucosamine diphosphatase LpxI |
| 2812 | CALHPR010000031.1 | GCA938036385_01415 | CDS | open | 27830-29083 | _na 417_aa | sstT | serine/threonine transporter SstT |
| 2813 | CALHPR010000031.1 | GCA938036385_01416 | CDS | open | 29175-29828 | _na 217_aa | recO | DNA repair protein RecO |
| 2814 | CALHPR010000031.1 | GCA938036385_01417 | CDS | open | 29821-31131 | _na 436_aa | CBS domain protein | |
| 2815 | CALHPR010000031.1 | GCA938036385_01418 | CDS | open | 31178-32080 | _na 300_aa | era | GTPase Era |
| 2816 | CALHPR010000031.1 | GCA938036385_01419 | CDS | open | 32073-32489 | _na 138_aa | cytidine deaminase | |
| 2817 | CALHPR010000031.1 | GCA938036385_01420 | CDS | open | 32476-32967 | _na 163_aa | ybeY | rRNA maturation RNase YbeY |
| 2818 | CALHPR010000031.1 | GCA938036385_01421 | CDS | open | 32951-33910 | _na 319_aa | PhoH-like protein | |
| 2819 | CALHPR010000031.1 | GCA938036385_01422 | CDS | open | 33989-34939 | _na 316_aa | TIGR01212 family radical SAM protein | |
| 2820 | CALHPR010000031.1 | GCA938036385_01423 | CDS | open | 35043-36923 | _na 626_aa | Glutamine-dependent NAD(+) synthetase | |
| 2821 | CALHPR010000031.1 | GCA938036385_01424 | CDS | open | 36973-38505 | _na 510_aa | DEAD/DEAH box helicase | |
| 2822 | CALHPR010000031.1 | GCA938036385_01383 | gene | open | 339-1106 | |||
| 2823 | CALHPR010000031.1 | GCA938036385_01384 | gene | open | 1106-2128 | |||
| 2824 | CALHPR010000031.1 | GCA938036385_01385 | gene | open | 2125-3174 | cobT | ||
| 2825 | CALHPR010000031.1 | GCA938036385_01386 | gene | open | 3373-4245 | |||
| 2826 | CALHPR010000031.1 | GCA938036385_01387 | gene | open | 4416-5009 | |||
| 2827 | CALHPR010000031.1 | GCA938036385_01388 | gene | open | 5286-5648 | marR | ||
| 2828 | CALHPR010000031.1 | GCA938036385_01389 | gene | open | 5755-7377 | groL | ||
| 2829 | CALHPR010000031.1 | GCA938036385_01390 | gene | open | 7411-7692 | groES | ||
| 2830 | CALHPR010000031.1 | GCA938036385_01391 | gene | open | 7855-8781 | murB | ||
| 2831 | CALHPR010000031.1 | GCA938036385_01392 | gene | open | 8778-9131 | ylbF | ||
| 2832 | CALHPR010000031.1 | GCA938036385_01393 | gene | open | 9118-9627 | |||
| 2833 | CALHPR010000031.1 | GCA938036385_01394 | gene | open | 9645-10046 | |||
| 2834 | CALHPR010000031.1 | GCA938036385_01395 | gene | open | 10222-10563 | rplS | ||
| 2835 | CALHPR010000031.1 | GCA938036385_01396 | gene | open | 10713-11888 | sigA | ||
| 2836 | CALHPR010000031.1 | GCA938036385_01399 | gene | open | 12350-12784 | ruvX | ||
| 2837 | CALHPR010000031.1 | GCA938036385_01400 | gene | open | 12781-13974 | |||
| 2838 | CALHPR010000031.1 | GCA938036385_01401 | gene | open | 14038-15123 | |||
| 2839 | CALHPR010000031.1 | GCA938036385_01402 | gene | open | 15152-15874 | lptB | ||
| 2840 | CALHPR010000031.1 | GCA938036385_01403 | gene | open | 15871-16719 | |||
| 2841 | CALHPR010000031.1 | GCA938036385_01404 | gene | open | 16716-17261 | lptC | ||
| 2842 | CALHPR010000031.1 | GCA938036385_01405 | gene | open | 17258-18241 | |||
| 2843 | CALHPR010000031.1 | GCA938036385_01406 | gene | open | 18282-18821 | kdsC | ||
| 2844 | CALHPR010000031.1 | GCA938036385_01407 | gene | open | 18821-19792 | |||
| 2845 | CALHPR010000031.1 | GCA938036385_01408 | gene | open | 19933-20754 | kdsA | ||
| 2846 | CALHPR010000031.1 | GCA938036385_01409 | gene | open | 20751-21482 | kdsB | ||
| 2847 | CALHPR010000031.1 | GCA938036385_01410 | gene | open | 21479-22591 | lpxK | ||
| 2848 | CALHPR010000031.1 | GCA938036385_01411 | gene | open | 22581-23912 | |||
| 2849 | CALHPR010000031.1 | GCA938036385_01412 | gene | open | 23914-25671 | msbA | ||
| 2850 | CALHPR010000031.1 | GCA938036385_01413 | gene | open | 25671-26807 | lpxB | ||
| 2851 | CALHPR010000031.1 | GCA938036385_01414 | gene | open | 26804-27643 | lpxI | ||
| 2852 | CALHPR010000031.1 | GCA938036385_01415 | gene | open | 27830-29083 | sstT | ||
| 2853 | CALHPR010000031.1 | GCA938036385_01416 | gene | open | 29175-29828 | recO | ||
| 2854 | CALHPR010000031.1 | GCA938036385_01417 | gene | open | 29821-31131 | |||
| 2855 | CALHPR010000031.1 | GCA938036385_01418 | gene | open | 31178-32080 | era | ||
| 2856 | CALHPR010000031.1 | GCA938036385_01419 | gene | open | 32073-32489 | |||
| 2857 | CALHPR010000031.1 | GCA938036385_01420 | gene | open | 32476-32967 | ybeY | ||
| 2858 | CALHPR010000031.1 | GCA938036385_01421 | gene | open | 32951-33910 | |||
| 2859 | CALHPR010000031.1 | GCA938036385_01422 | gene | open | 33989-34939 | |||
| 2860 | CALHPR010000031.1 | GCA938036385_01423 | gene | open | 35043-36923 | |||
| 2861 | CALHPR010000031.1 | GCA938036385_01424 | gene | open | 36973-38505 | |||
| 2862 | CALHPR010000031.1 | GCA938036385_01382 | gene | open | 89-163 | trnG | ||
| 2863 | CALHPR010000031.1 | GCA938036385_01397 | gene | open | 12137-12213 | trnR | ||
| 2864 | CALHPR010000031.1 | GCA938036385_01398 | gene | open | 12218-12293 | trnP | ||
| 2865 | CALHPR010000031.1 | GCA938036385_01382 | tRNA | open | 89-163 | trnG | tRNA-Gly(gcc) | |
| 2866 | CALHPR010000031.1 | GCA938036385_01397 | tRNA | open | 12137-12213 | trnR | tRNA-Arg(tct) | |
| 2867 | CALHPR010000031.1 | GCA938036385_01398 | tRNA | open | 12218-12293 | trnP | tRNA-Pro(tgg) | |
| 2868 | CALHPR010000032.1 | regulatory_region | open | 50000-50124 | FMN riboswitch aptamer (RFN element) | |||
| 2869 | CALHPR010000032.1 | regulatory_region | open | 54598-54700 | folP RNA | |||
| 2870 | CALHPR010000032.1 | repeat_region | open | 735-1576 | CRISPR array with 14 repeats of length 28%2C consensus sequence GTTATCTGCCGTATAGGCAGTTTAGAAA and spacer length 32 | |||
| 2871 | CALHPR010000032.1 | GCA938036385_01425 | CDS | open | 1769-2389 | _na 206_aa | RelA/SpoT domain protein | |
| 2872 | CALHPR010000032.1 | GCA938036385_01426 | CDS | open | 2386-3060 | _na 224_aa | Response regulator receiver domain protein | |
| 2873 | CALHPR010000032.1 | GCA938036385_01427 | CDS | open | 3102-4364 | _na 420_aa | histidine kinase | |
| 2874 | CALHPR010000032.1 | GCA938036385_01428 | CDS | open | 5357-6322 | _na 321_aa | cas1f | type I-F CRISPR-associated endonuclease Cas1f |
| 2875 | CALHPR010000032.1 | GCA938036385_01429 | CDS | open | 6319-9759 | _na 1146_aa | cas3f | type I-F CRISPR-associated helicase Cas3f |
| 2876 | CALHPR010000032.1 | GCA938036385_01430 | CDS | open | 9762-10925 | _na 387_aa | Type I-F CRISPR-associated protein Csy1 | |
| 2877 | CALHPR010000032.1 | GCA938036385_01431 | CDS | open | 10922-11809 | _na 295_aa | csy2 | type I-F CRISPR-associated protein Csy2 |
| 2878 | CALHPR010000032.1 | GCA938036385_01432 | CDS | open | 11826-12845 | _na 339_aa | csy3 | type I-F CRISPR-associated protein Csy3 |
| 2879 | CALHPR010000032.1 | GCA938036385_01433 | CDS | open | 12849-13430 | _na 193_aa | cas6f | type I-F CRISPR-associated endoribonuclease Cas6/Csy4 |
| 2880 | CALHPR010000032.1 | GCA938036385_01434 | CDS | open | 17388-19943 | _na 851_aa | cas10 | type III-A CRISPR-associated protein Cas10/Csm1 |
| 2881 | CALHPR010000032.1 | GCA938036385_01435 | CDS | open | 19943-20443 | _na 166_aa | CRISPR system Cms protein Csm2 | |
| 2882 | CALHPR010000032.1 | GCA938036385_01436 | CDS | open | 20446-21165 | _na 239_aa | csm3 | type III-A CRISPR-associated RAMP protein Csm3 |
| 2883 | CALHPR010000032.1 | GCA938036385_01437 | CDS | open | 21155-22141 | _na 328_aa | csm4 | type III-A CRISPR-associated RAMP protein Csm4 |
| 2884 | CALHPR010000032.1 | GCA938036385_01438 | CDS | open | 22141-23304 | _na 387_aa | csm5 | type III-A CRISPR-associated RAMP protein Csm5 |
| 2885 | CALHPR010000032.1 | GCA938036385_01439 | CDS | open | 23298-24065 | _na 255_aa | CRISPR system precrRNA processing endoribonuclease RAMP protein Cas6 | |
| 2886 | CALHPR010000032.1 | GCA938036385_01440 | CDS | open | 24062-25015 | _na 317_aa | csm6 | type III-A CRISPR-associated CARF protein Csm6 |
| 2887 | CALHPR010000032.1 | GCA938036385_01441 | CDS | open | 25033-25425 | _na 130_aa | hypothetical protein | |
| 2888 | CALHPR010000032.1 | GCA938036385_01442 | CDS | open | 25443-26438 | _na 331_aa | cas1 | CRISPR-associated endonuclease Cas1 |
| 2889 | CALHPR010000032.1 | GCA938036385_01443 | CDS | open | 26438-26749 | _na 103_aa | cas2 | CRISPR-associated endonuclease Cas2 |
| 2890 | CALHPR010000032.1 | GCA938036385_01444 | CDS | open | 26776-26934 | _na 52_aa | hypothetical protein | |
| 2891 | CALHPR010000032.1 | GCA938036385_01445 | CDS | open | 28339-28692 | _na 117_aa | yraN | YraN family protein |
| 2892 | CALHPR010000032.1 | GCA938036385_01446 | CDS | open | 28707-30224 | _na 505_aa | ATP-dependent protease | |
| 2893 | CALHPR010000032.1 | GCA938036385_01447 | CDS | open | 30224-31312 | _na 362_aa | dprA | DNA-processing protein DprA |
| 2894 | CALHPR010000032.1 | GCA938036385_01448 | CDS | open | 31360-33759 | _na 799_aa | topA | type I DNA topoisomerase |
| 2895 | CALHPR010000032.1 | GCA938036385_01449 | CDS | open | 33759-35057 | _na 432_aa | trmFO | methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO |
| 2896 | CALHPR010000032.1 | GCA938036385_01450 | CDS | open | 35142-35675 | _na 177_aa | hslV | ATP-dependent protease subunit HslV |
| 2897 | CALHPR010000032.1 | GCA938036385_01451 | CDS | open | 35672-37033 | _na 453_aa | hslU | ATP-dependent protease ATPase subunit HslU |
| 2898 | CALHPR010000032.1 | GCA938036385_01452 | CDS | open | 37159-38148 | _na 329_aa | birA | Bifunctional ligase/repressor BirA |
| 2899 | CALHPR010000032.1 | GCA938036385_01453 | CDS | open | 38174-38737 | _na 187_aa | Biotin transporter | |
| 2900 | CALHPR010000032.1 | GCA938036385_01454 | CDS | open | 38890-39678 | _na 262_aa | type III pantothenate kinase | |
| 2901 | CALHPR010000032.1 | GCA938036385_01456 | CDS | open | 39915-40862 | _na 315_aa | Signal peptide peptidase SppA%2C 36K type | |
| 2902 | CALHPR010000032.1 | GCA938036385_01457 | CDS | open | 40872-41450 | _na 192_aa | Yip1 domain-containing protein | |
| 2903 | CALHPR010000032.1 | GCA938036385_01458 | CDS | open | 41580-43406 | _na 608_aa | glmS | glutamine--fructose-6-phosphate transaminase (isomerizing) |
| 2904 | CALHPR010000032.1 | GCA938036385_01459 | CDS | open | 43423-44418 | _na 331_aa | trpS | tryptophan--tRNA ligase |
| 2905 | CALHPR010000032.1 | GCA938036385_01460 | CDS | open | 44548-45837 | _na 429_aa | Peptidoglycan-binding protein | |
| 2906 | CALHPR010000032.1 | GCA938036385_01461 | CDS | open | 46003-47382 | _na 459_aa | glmU | bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU |
| 2907 | CALHPR010000032.1 | GCA938036385_01462 | CDS | open | 47521-48474 | _na 317_aa | Ribose-phosphate pyrophosphokinase | |
| 2908 | CALHPR010000032.1 | GCA938036385_01463 | CDS | open | 48471-49043 | _na 190_aa | pth | aminoacyl-tRNA hydrolase |
| 2909 | CALHPR010000032.1 | GCA938036385_01464 | CDS | open | 49237-49905 | _na 222_aa | Thymidylate kinase | |
| 2910 | CALHPR010000032.1 | GCA938036385_01465 | CDS | open | 50168-51472 | _na 434_aa | ribD | bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD |
| 2911 | CALHPR010000032.1 | GCA938036385_01466 | CDS | open | 51475-52125 | _na 216_aa | riboflavin synthase | |
| 2912 | CALHPR010000032.1 | GCA938036385_01467 | CDS | open | 52115-53323 | _na 402_aa | Riboflavin biosynthesis protein RibBA | |
| 2913 | CALHPR010000032.1 | GCA938036385_01468 | CDS | open | 53344-53811 | _na 155_aa | ribH | 6%2C7-dimethyl-8-ribityllumazine synthase |
| 2914 | CALHPR010000032.1 | GCA938036385_01469 | CDS | open | 53923-54537 | _na 204_aa | TIGR00153 family protein | |
| 2915 | CALHPR010000032.1 | GCA938036385_01470 | CDS | open | 54832-55671 | _na 279_aa | folP | dihydropteroate synthase |
| 2916 | CALHPR010000032.1 | GCA938036385_01471 | CDS | open | 55686-56045 | _na 119_aa | folB | dihydroneopterin aldolase |
| 2917 | CALHPR010000032.1 | GCA938036385_01472 | CDS | open | 56042-56554 | _na 170_aa | folK | 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase |
| 2918 | CALHPR010000032.1 | GCA938036385_01473 | CDS | open | 56539-59946 | _na 1135_aa | mfd | transcription-repair coupling factor |
| 2919 | CALHPR010000032.1 | GCA938036385_01474 | CDS | open | 59939-61543 | _na 534_aa | Polysaccharide biosynthesis protein | |
| 2920 | CALHPR010000032.1 | GCA938036385_01475 | CDS | open | 61601-62689 | _na 362_aa | mazG | nucleoside triphosphate pyrophosphohydrolase |
| 2921 | CALHPR010000032.1 | GCA938036385_01476 | CDS | open | 62752-63054 | _na 100_aa | DNA-binding protein HU | |
| 2922 | CALHPR010000032.1 | GCA938036385_01477 | CDS | open | 63440-65623 | _na 727_aa | Ornithine decarboxylase | |
| 2923 | CALHPR010000032.1 | GCA938036385_01478 | CDS | open | 65757-67088 | _na 443_aa | potE | putrescine-ornithine antiporter |
| 2924 | CALHPR010000032.1 | GCA938036385_01479 | CDS | open | 67200-69377 | _na 725_aa | speF | ornithine decarboxylase SpeF |
| 2925 | CALHPR010000032.1 | GCA938036385_01480 | CDS | open | 70119-71030 | _na 303_aa | lysR | LysR substrate binding domain protein |
| 2926 | CALHPR010000032.1 | GCA938036385_01481 | CDS | open | 71357-71713 | _na 118_aa | hypothetical protein | |
| 2927 | CALHPR010000032.1 | GCA938036385_01482 | CDS | open | 71936-73507 | _na 523_aa | norM | putative multidrug resistance protein NorM |
| 2928 | CALHPR010000032.1 | GCA938036385_01483 | CDS | open | 73571-74266 | _na 231_aa | Haloacid dehalogenase-like hydrolase | |
| 2929 | CALHPR010000032.1 | GCA938036385_01484 | CDS | open | 74423-76012 | _na 529_aa | Helicase HerA-like C-terminal domain-containing protein | |
| 2930 | CALHPR010000032.1 | GCA938036385_01485 | CDS | open | 76044-76430 | _na 128_aa | Rhodanese-like protein | |
| 2931 | CALHPR010000032.1 | GCA938036385_01486 | CDS | open | 76489-77739 | _na 416_aa | larA | nickel-dependent lactate racemase |
| 2932 | CALHPR010000032.1 | GCA938036385_01487 | CDS | open | 77836-78399 | _na 187_aa | Chromate transport protein | |
| 2933 | CALHPR010000032.1 | GCA938036385_01488 | CDS | open | 78396-78944 | _na 182_aa | Chromate transport protein | |
| 2934 | CALHPR010000032.1 | GCA938036385_01489 | CDS | open | 79058-80146 | _na 362_aa | citC | [citrate (pro-3S)-lyase] ligase |
| 2935 | CALHPR010000032.1 | GCA938036385_01490 | CDS | open | 80452-80736 | _na 94_aa | rpsF | 30S ribosomal protein S6 |
| 2936 | CALHPR010000032.1 | GCA938036385_01491 | CDS | open | 80755-81198 | _na 147_aa | Single-stranded DNA-binding protein | |
| 2937 | CALHPR010000032.1 | GCA938036385_01492 | CDS | open | 81220-81453 | _na 77_aa | rpsR | 30S ribosomal protein S18 |
| 2938 | CALHPR010000032.1 | GCA938036385_01493 | CDS | open | 81618-82628 | _na 336_aa | Uroporphyrinogen decarboxylase (URO-D) domain-containing protein | |
| 2939 | CALHPR010000032.1 | GCA938036385_01494 | CDS | open | 82888-83319 | _na 143_aa | GtrA-like protein | |
| 2940 | CALHPR010000032.1 | GCA938036385_01495 | CDS | open | 83375-84073 | _na 232_aa | Uracil-DNA glycosylase-like domain-containing protein | |
| 2941 | CALHPR010000032.1 | GCA938036385_01496 | CDS | open | 84074-85741 | _na 555_aa | Dolichyl-phosphate-mannose-protein mannosyltransferase | |
| 2942 | CALHPR010000032.1 | GCA938036385_01497 | CDS | open | 85761-87344 | _na 527_aa | Dolichyl-phosphate-mannose-protein mannosyltransferase | |
| 2943 | CALHPR010000032.1 | GCA938036385_01498 | CDS | open | 87334-87927 | _na 197_aa | SNARE-like domain protein | |
| 2944 | CALHPR010000032.1 | GCA938036385_01499 | CDS | open | 88160-88957 | _na 265_aa | ABC transporter%2C substrate-binding protein%2C family 3 | |
| 2945 | CALHPR010000032.1 | GCA938036385_01500 | CDS | open | 89180-90454 | _na 424_aa | lysA | diaminopimelate decarboxylase |
| 2946 | CALHPR010000032.1 | GCA938036385_01501 | CDS | open | 90521-91078 | _na 185_aa | Bacterial transferase hexapeptide repeat protein | |
| 2947 | CALHPR010000032.1 | GCA938036385_01502 | CDS | open | 91209-92159 | _na 316_aa | Putative enoyl-[acyl-carrier-protein] reductase II | |
| 2948 | CALHPR010000032.1 | GCA938036385_01503 | CDS | open | 92673-93677 | _na 334_aa | gap | type I glyceraldehyde-3-phosphate dehydrogenase |
| 2949 | CALHPR010000032.1 | GCA938036385_01504 | CDS | open | 93696-94883 | _na 395_aa | Phosphoglycerate kinase | |
| 2950 | CALHPR010000032.1 | GCA938036385_01505 | CDS | open | 94883-95638 | _na 251_aa | tpiA | triose-phosphate isomerase |
| 2951 | CALHPR010000032.1 | GCA938036385_01506 | CDS | open | 95648-96946 | _na 432_aa | eno | phosphopyruvate hydratase |
| 2952 | CALHPR010000032.1 | GCA938036385_01507 | CDS | open | 97501-98181 | _na 226_aa | Response regulator receiver domain protein | |
| 2953 | CALHPR010000032.1 | GCA938036385_01508 | CDS | open | 98183-98734 | _na 183_aa | rnmV | ribonuclease M5 |
| 2954 | CALHPR010000032.1 | GCA938036385_01509 | CDS | open | 98721-99581 | _na 286_aa | rsmA | 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA |
| 2955 | CALHPR010000032.1 | GCA938036385_01510 | CDS | open | 99904-101208 | _na 434_aa | serS | serine--tRNA ligase |
| 2956 | CALHPR010000032.1 | GCA938036385_01511 | CDS | open | 101384-102100 | _na 238_aa | Nodulation efficiency protein D | |
| 2957 | CALHPR010000032.1 | GCA938036385_01512 | CDS | open | 102129-103106 | _na 325_aa | floA | flotillin-like protein FloA |
| 2958 | CALHPR010000032.1 | GCA938036385_01513 | CDS | open | 103116-103682 | _na 188_aa | hypothetical protein | |
| 2959 | CALHPR010000032.1 | GCA938036385_01514 | CDS | open | 103692-104165 | _na 157_aa | DUF304 domain-containing protein | |
| 2960 | CALHPR010000032.1 | GCA938036385_01515 | CDS | open | 104282-104515 | _na 77_aa | Transcriptional coactivator p15 (PC4) C-terminal domain-containing protein | |
| 2961 | CALHPR010000032.1 | GCA938036385_01516 | CDS | open | 104611-105831 | _na 406_aa | Cation diffusion facilitator family transporter | |
| 2962 | CALHPR010000032.1 | GCA938036385_01517 | CDS | open | 105979-106719 | _na 246_aa | NlpC/P60 family protein | |
| 2963 | CALHPR010000032.1 | GCA938036385_01518 | CDS | open | 106685-107596 | _na 303_aa | Hydrolase%2C carbon-nitrogen family | |
| 2964 | CALHPR010000032.1 | GCA938036385_01519 | CDS | open | 107659-110265 | _na 868_aa | alaS | alanine--tRNA ligase |
| 2965 | CALHPR010000032.1 | GCA938036385_01520 | CDS | open | 110283-110549 | _na 88_aa | ireB | IreB family regulatory phosphoprotein |
| 2966 | CALHPR010000032.1 | GCA938036385_01521 | CDS | open | 110551-110979 | _na 142_aa | ruvX | Holliday junction resolvase RuvX |
| 2967 | CALHPR010000032.1 | GCA938036385_01522 | CDS | open | 110981-111244 | _na 87_aa | DUF1292 domain-containing protein | |
| 2968 | CALHPR010000032.1 | GCA938036385_01523 | CDS | open | 111413-112678 | _na 421_aa | Ser/Thr phosphatase family protein | |
| 2969 | CALHPR010000032.1 | GCA938036385_01524 | CDS | open | 112675-115668 | _na 997_aa | yhaN | putative protein YhaN AAA domain-containing protein |
| 2970 | CALHPR010000032.1 | GCA938036385_01525 | CDS | open | 115725-116819 | _na 364_aa | Acyltransferase 3 domain-containing protein | |
| 2971 | CALHPR010000032.1 | GCA938036385_01526 | CDS | open | 117073-117828 | _na 251_aa | rpsB | 30S ribosomal protein S2 |
| 2972 | CALHPR010000032.1 | GCA938036385_01527 | CDS | open | 117877-118752 | _na 291_aa | tsf | translation elongation factor Ts |
| 2973 | CALHPR010000032.1 | GCA938036385_01528 | CDS | open | 118853-119581 | _na 242_aa | pyrH | UMP kinase |
| 2974 | CALHPR010000032.1 | GCA938036385_01529 | CDS | open | 119583-120140 | _na 185_aa | frr | ribosome recycling factor |
| 2975 | CALHPR010000032.1 | GCA938036385_01530 | CDS | open | 120137-120379 | _na 80_aa | hypothetical protein | |
| 2976 | CALHPR010000032.1 | GCA938036385_01531 | CDS | open | 120372-121094 | _na 240_aa | isoprenyl transferase | |
| 2977 | CALHPR010000032.1 | GCA938036385_01532 | CDS | open | 121091-121909 | _na 272_aa | Phosphatidate cytidylyltransferase | |
| 2978 | CALHPR010000032.1 | GCA938036385_01533 | CDS | open | 121910-123073 | _na 387_aa | 1-deoxy-D-xylulose-5-phosphate reductoisomerase | |
| 2979 | CALHPR010000032.1 | GCA938036385_01534 | CDS | open | 123067-124089 | _na 340_aa | rseP | RIP metalloprotease RseP |
| 2980 | CALHPR010000032.1 | GCA938036385_01535 | CDS | open | 124099-125154 | _na 351_aa | ispG | flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase |
| 2981 | CALHPR010000032.1 | GCA938036385_01536 | CDS | open | 125157-126881 | _na 574_aa | proline--tRNA ligase | |
| 2982 | CALHPR010000032.1 | GCA938036385_01537 | CDS | open | 126897-127184 | _na 95_aa | Chorismate mutase domain-containing protein | |
| 2983 | CALHPR010000032.1 | GCA938036385_01538 | CDS | open | 127181-129310 | _na 709_aa | recD2 | ATP-dependent RecD2 DNA helicase |
| 2984 | CALHPR010000032.1 | GCA938036385_01539 | CDS | open | 129311-129961 | _na 216_aa | comF | ComF family protein |
| 2985 | CALHPR010000032.1 | GCA938036385_01540 | CDS | open | 130024-130545 | _na 173_aa | Zinc finger/thioredoxin putative domain-containing protein | |
| 2986 | CALHPR010000032.1 | GCA938036385_01541 | CDS | open | 130601-130768 | _na 55_aa | hypothetical protein | |
| 2987 | CALHPR010000032.1 | GCA938036385_01542 | CDS | open | 130810-131667 | _na 285_aa | ylqF | ribosome biogenesis GTPase YlqF |
| 2988 | CALHPR010000032.1 | GCA938036385_01543 | CDS | open | 131664-132434 | _na 256_aa | ribonuclease HII | |
| 2989 | CALHPR010000032.1 | GCA938036385_01544 | CDS | open | 132466-132741 | _na 91_aa | csoR | Copper-sensing transcriptional repressor CsoR |
| 2990 | CALHPR010000032.1 | GCA938036385_01545 | CDS | open | 132759-133397 | _na 212_aa | precorrin-2 dehydrogenase | |
| 2991 | CALHPR010000032.1 | GCA938036385_01546 | CDS | open | 133366-134649 | _na 427_aa | hemA | glutamyl-tRNA reductase |
| 2992 | CALHPR010000032.1 | GCA938036385_01547 | CDS | open | 134639-135562 | _na 307_aa | hemC | hydroxymethylbilane synthase |
| 2993 | CALHPR010000032.1 | GCA938036385_01548 | CDS | open | 135559-137100 | _na 513_aa | uroporphyrinogen-III C-methyltransferase | |
| 2994 | CALHPR010000032.1 | GCA938036385_01549 | CDS | open | 137097-138083 | _na 328_aa | hemB | porphobilinogen synthase |
| 2995 | CALHPR010000032.1 | GCA938036385_01550 | CDS | open | 138080-139381 | _na 433_aa | hemL | glutamate-1-semialdehyde 2%2C1-aminomutase |
| 2996 | CALHPR010000032.1 | GCA938036385_01551 | CDS | open | 139983-140270 | _na 95_aa | hypothetical protein | |
| 2997 | CALHPR010000032.1 | GCA938036385_01552 | CDS | open | 140283-141893 | _na 536_aa | YgiT-type zinc finger domain protein | |
| 2998 | CALHPR010000032.1 | GCA938036385_01553 | CDS | open | 142172-143587 | _na 471_aa | Amidophosphoribosyltransferase | |
| 2999 | CALHPR010000032.1 | GCA938036385_01554 | CDS | open | 143714-143965 | _na 83_aa | Fatty acid kinase subunit A-like middle domain-containing protein | |
| 3000 | CALHPR010000032.1 | GCA938036385_01555 | CDS | open | 144094-145218 | _na 374_aa | Monogalactosyldiacylglycerol synthase%2C C-terminal domain protein |

