HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Corynebacterium accolens (GCA_943912715.1)

Select a Genome:
BAKTA Annotations for GCA_943912715.1
Genome Selected: Corynebacterium accolens
ContigsBases CDSrRNA tmRNAtRNA
163 2,234,268 2084 0 1 49
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4280 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:5]    |    Number of Records Found: 4280 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
2001 CALTVO010000032.1 GCA943912715_01007 CDS open 13573-13887 _na     104_aa hypothetical protein
2002 CALTVO010000032.1 GCA943912715_01008 CDS open 13899-14231 _na     110_aa azlD Branched-chain amino acid transport protein AzlD
2003 CALTVO010000032.1 GCA943912715_01009 CDS open 14232-14963 _na     243_aa azlC Azaleucine resistance protein AzlC
2004 CALTVO010000032.1 GCA943912715_01010 CDS open 15003-15599 _na     198_aa YqgE/AlgH family protein
2005 CALTVO010000032.1 GCA943912715_01011 CDS open 15599-17035 _na     478_aa CCA tRNA nucleotidyltransferase
2006 CALTVO010000032.1 GCA943912715_01012 CDS open 17049-17210 _na     53_aa hypothetical protein
2007 CALTVO010000032.1 GCA943912715_01013 CDS open 17226-17729 _na     167_aa NUDIX family protein
2008 CALTVO010000032.1 GCA943912715_01014 CDS open 18464-18907 _na     147_aa hypothetical protein
2009 CALTVO010000032.1 GCA943912715_00994 gene open 131-664
2010 CALTVO010000032.1 GCA943912715_00995 gene open 942-2417
2011 CALTVO010000032.1 GCA943912715_00996 gene open 2779-4305
2012 CALTVO010000032.1 GCA943912715_00997 gene open 4302-4949
2013 CALTVO010000032.1 GCA943912715_00998 gene open 4949-5968
2014 CALTVO010000032.1 GCA943912715_00999 gene open 5992-7419 trpF
2015 CALTVO010000032.1 GCA943912715_01000 gene open 7422-8624 trpB
2016 CALTVO010000032.1 GCA943912715_01001 gene open 8627-9469 trpA
2017 CALTVO010000032.1 GCA943912715_01002 gene open 9567-10778
2018 CALTVO010000032.1 GCA943912715_01003 gene open 10979-11461
2019 CALTVO010000032.1 GCA943912715_01004 gene open 11759-11983
2020 CALTVO010000032.1 GCA943912715_01005 gene open 12101-12466
2021 CALTVO010000032.1 GCA943912715_01006 gene open 12598-13572
2022 CALTVO010000032.1 GCA943912715_01007 gene open 13573-13887
2023 CALTVO010000032.1 GCA943912715_01008 gene open 13899-14231 azlD
2024 CALTVO010000032.1 GCA943912715_01009 gene open 14232-14963 azlC
2025 CALTVO010000032.1 GCA943912715_01010 gene open 15003-15599
2026 CALTVO010000032.1 GCA943912715_01011 gene open 15599-17035
2027 CALTVO010000032.1 GCA943912715_01012 gene open 17049-17210
2028 CALTVO010000032.1 GCA943912715_01013 gene open 17226-17729
2029 CALTVO010000032.1 GCA943912715_01014 gene open 18464-18907
2030 CALTVO010000033.1 GCA943912715_01015 CDS open 92-463 _na     123_aa hypothetical protein
2031 CALTVO010000033.1 GCA943912715_01016 CDS open 647-862 _na     71_aa hypothetical protein
2032 CALTVO010000033.1 GCA943912715_01017 CDS open 828-2447 _na     539_aa Solute-binding protein family 5 domain-containing protein
2033 CALTVO010000033.1 GCA943912715_01018 CDS open 2537-3193 _na     218_aa GPP34 family phosphoprotein
2034 CALTVO010000033.1 GCA943912715_01019 CDS open 3203-5113 _na     636_aa typA translational GTPase TypA
2035 CALTVO010000033.1 GCA943912715_01020 CDS open 5385-6113 _na     242_aa Secreted protein
2036 CALTVO010000033.1 GCA943912715_01021 CDS open 6113-6649 _na     178_aa DUF402 domain-containing protein
2037 CALTVO010000033.1 GCA943912715_01022 CDS open 6653-7594 _na     313_aa ABC transporter
2038 CALTVO010000033.1 GCA943912715_01023 CDS open 7596-8393 _na     265_aa zupT zinc transporter ZupT
2039 CALTVO010000033.1 GCA943912715_01024 CDS open 8429-10432 _na     667_aa Betaine/carnitine/choline transporter (BCCT) family transporter
2040 CALTVO010000033.1 GCA943912715_01025 CDS open 10596-11702 _na     368_aa hypothetical protein
2041 CALTVO010000033.1 GCA943912715_01026 CDS open 11718-13502 _na     594_aa selB selenocysteine-specific translation elongation factor
2042 CALTVO010000033.1 GCA943912715_01027 CDS open 13503-14831 _na     442_aa selA L-seryl-tRNA(Sec) selenium transferase
2043 CALTVO010000033.1 GCA943912715_01029 CDS open 16016-16597 _na     193_aa DUF3558 domain-containing protein
2044 CALTVO010000033.1 GCA943912715_01030 CDS open 16613-17728 _na     371_aa nrfD Polysulfide reductase NrfD
2045 CALTVO010000033.1 GCA943912715_01031 CDS open 17725-18783 _na     352_aa 4Fe-4S ferredoxin-type domain-containing protein
2046 CALTVO010000033.1 GCA943912715_01032 CDS open 18784-19176 _na     130_aa hypothetical protein
2047 CALTVO010000033.1 GCA943912715_01015 gene open 92-463
2048 CALTVO010000033.1 GCA943912715_01016 gene open 647-862
2049 CALTVO010000033.1 GCA943912715_01017 gene open 828-2447
2050 CALTVO010000033.1 GCA943912715_01018 gene open 2537-3193
2051 CALTVO010000033.1 GCA943912715_01019 gene open 3203-5113 typA
2052 CALTVO010000033.1 GCA943912715_01020 gene open 5385-6113
2053 CALTVO010000033.1 GCA943912715_01021 gene open 6113-6649
2054 CALTVO010000033.1 GCA943912715_01022 gene open 6653-7594
2055 CALTVO010000033.1 GCA943912715_01023 gene open 7596-8393 zupT
2056 CALTVO010000033.1 GCA943912715_01024 gene open 8429-10432
2057 CALTVO010000033.1 GCA943912715_01025 gene open 10596-11702
2058 CALTVO010000033.1 GCA943912715_01026 gene open 11718-13502 selB
2059 CALTVO010000033.1 GCA943912715_01027 gene open 13503-14831 selA
2060 CALTVO010000033.1 GCA943912715_01029 gene open 16016-16597
2061 CALTVO010000033.1 GCA943912715_01030 gene open 16613-17728 nrfD
2062 CALTVO010000033.1 GCA943912715_01031 gene open 17725-18783
2063 CALTVO010000033.1 GCA943912715_01032 gene open 18784-19176
2064 CALTVO010000033.1 GCA943912715_01028 gene open 14855-14949 trnU
2065 CALTVO010000033.1 GCA943912715_01028 tRNA open 14855-14949 trnU tRNA-SeC(tca)
2066 CALTVO010000034.1 GCA943912715_01033 CDS open 419-745 _na     108_aa hypothetical protein
2067 CALTVO010000034.1 GCA943912715_01034 CDS open 1011-2384 _na     457_aa Aldehyde dehydrogenase domain-containing protein
2068 CALTVO010000034.1 GCA943912715_01035 CDS open 2509-3714 _na     401_aa ER-bound oxygenase mpaB/mpaB'/Rubber oxygenase catalytic domain-containing protein
2069 CALTVO010000034.1 GCA943912715_01036 CDS open 3748-5124 _na     458_aa ER-bound oxygenase mpaB/mpaB'/Rubber oxygenase catalytic domain-containing protein
2070 CALTVO010000034.1 GCA943912715_01037 CDS open 5182-6495 _na     437_aa ER-bound oxygenase mpaB/mpaB'/Rubber oxygenase catalytic domain-containing protein
2071 CALTVO010000034.1 GCA943912715_01038 CDS open 6945-7997 _na     350_aa Vanillate O-demethylase oxidoreductase
2072 CALTVO010000034.1 GCA943912715_01039 CDS open 8074-8997 _na     307_aa eamA EamA domain-containing protein
2073 CALTVO010000034.1 GCA943912715_01040 CDS open 9142-10518 _na     458_aa accC acetyl-CoA carboxylase biotin carboxylase subunit
2074 CALTVO010000034.1 GCA943912715_01041 CDS open 10536-11087 _na     183_aa accB acetyl-CoA carboxylase biotin carboxyl carrier protein
2075 CALTVO010000034.1 GCA943912715_01042 CDS open 11090-12646 _na     518_aa Pyruvate carboxyltransferase domain-containing protein
2076 CALTVO010000034.1 GCA943912715_01043 CDS open 13072-14418 _na     448_aa Major facilitator superfamily (MFS) profile domain-containing protein
2077 CALTVO010000034.1 GCA943912715_01044 CDS open 14493-15134 _na     213_aa Succinyl-CoA:3-ketoacid-coenzyme A transferase subunit B
2078 CALTVO010000034.1 GCA943912715_01045 CDS open 15134-15877 _na     247_aa 3-oxoacid CoA-transferase%2C A subunit
2079 CALTVO010000034.1 GCA943912715_01046 CDS open 15994-16767 _na     257_aa Pca regulon regulatory protein
2080 CALTVO010000034.1 GCA943912715_01047 CDS open 16777-17994 _na     405_aa putative acetyl-CoA acetyltransferase
2081 CALTVO010000034.1 GCA943912715_01048 CDS open 18007-18135 _na     42_aa hypothetical protein
2082 CALTVO010000034.1 GCA943912715_01049 CDS open 18326-18607 _na     93_aa ytxH YtxH domain-containing protein
2083 CALTVO010000034.1 GCA943912715_01050 CDS open 18675-18833 _na     52_aa hypothetical protein
2084 CALTVO010000034.1 GCA943912715_01033 gene open 419-745
2085 CALTVO010000034.1 GCA943912715_01034 gene open 1011-2384
2086 CALTVO010000034.1 GCA943912715_01035 gene open 2509-3714
2087 CALTVO010000034.1 GCA943912715_01036 gene open 3748-5124
2088 CALTVO010000034.1 GCA943912715_01037 gene open 5182-6495
2089 CALTVO010000034.1 GCA943912715_01038 gene open 6945-7997
2090 CALTVO010000034.1 GCA943912715_01039 gene open 8074-8997 eamA
2091 CALTVO010000034.1 GCA943912715_01040 gene open 9142-10518 accC
2092 CALTVO010000034.1 GCA943912715_01041 gene open 10536-11087 accB
2093 CALTVO010000034.1 GCA943912715_01042 gene open 11090-12646
2094 CALTVO010000034.1 GCA943912715_01043 gene open 13072-14418
2095 CALTVO010000034.1 GCA943912715_01044 gene open 14493-15134
2096 CALTVO010000034.1 GCA943912715_01045 gene open 15134-15877
2097 CALTVO010000034.1 GCA943912715_01046 gene open 15994-16767
2098 CALTVO010000034.1 GCA943912715_01047 gene open 16777-17994
2099 CALTVO010000034.1 GCA943912715_01048 gene open 18007-18135
2100 CALTVO010000034.1 GCA943912715_01049 gene open 18326-18607 ytxH
2101 CALTVO010000034.1 GCA943912715_01050 gene open 18675-18833
2102 CALTVO010000035.1 GCA943912715_01051 CDS open 10-468 _na     152_aa hypothetical protein
2103 CALTVO010000035.1 GCA943912715_01052 CDS open 1024-1356 _na     110_aa hypothetical protein
2104 CALTVO010000035.1 GCA943912715_01053 CDS open 1582-2499 _na     305_aa Glycerophosphoryl diester phosphodiesterase membrane domain-containing protein
2105 CALTVO010000035.1 GCA943912715_01054 CDS open 2609-3556 _na     315_aa putative hydrogen peroxide-inducible genes activator
2106 CALTVO010000035.1 GCA943912715_01055 CDS open 3719-4312 _na     197_aa Alkyl hydroperoxide reductase
2107 CALTVO010000035.1 GCA943912715_01056 CDS open 4418-4942 _na     174_aa ahpD Alkyl hydroperoxide reductase AhpD
2108 CALTVO010000035.1 GCA943912715_01057 CDS open 5067-7610 _na     847_aa Helicase
2109 CALTVO010000035.1 GCA943912715_01058 CDS open 7645-8655 _na     336_aa PAC2 family protein
2110 CALTVO010000035.1 GCA943912715_01059 CDS open 9051-10001 _na     316_aa DUF4192 domain-containing protein
2111 CALTVO010000035.1 GCA943912715_01060 CDS open 10011-10994 _na     327_aa galE UDP-glucose 4-epimerase GalE
2112 CALTVO010000035.1 GCA943912715_01061 CDS open 10998-11675 _na     225_aa Diphtheria toxin repressor
2113 CALTVO010000035.1 GCA943912715_01062 CDS open 11910-12923 _na     337_aa RNA polymerase sigma factor
2114 CALTVO010000035.1 GCA943912715_01063 CDS open 13117-13881 _na     254_aa Transcriptional regulator
2115 CALTVO010000035.1 GCA943912715_01064 CDS open 14010-15383 _na     457_aa L-serine ammonia-lyase
2116 CALTVO010000035.1 GCA943912715_01065 CDS open 15422-16816 _na     464_aa Serine transporter
2117 CALTVO010000035.1 GCA943912715_01066 CDS open 17177-17620 _na     147_aa dtd D-aminoacyl-tRNA deacylase
2118 CALTVO010000035.1 GCA943912715_01067 CDS open 17652-18395 _na     247_aa hypothetical protein
2119 CALTVO010000035.1 GCA943912715_01051 gene open 10-468
2120 CALTVO010000035.1 GCA943912715_01052 gene open 1024-1356
2121 CALTVO010000035.1 GCA943912715_01053 gene open 1582-2499
2122 CALTVO010000035.1 GCA943912715_01054 gene open 2609-3556
2123 CALTVO010000035.1 GCA943912715_01055 gene open 3719-4312
2124 CALTVO010000035.1 GCA943912715_01056 gene open 4418-4942 ahpD
2125 CALTVO010000035.1 GCA943912715_01057 gene open 5067-7610
2126 CALTVO010000035.1 GCA943912715_01058 gene open 7645-8655
2127 CALTVO010000035.1 GCA943912715_01059 gene open 9051-10001
2128 CALTVO010000035.1 GCA943912715_01060 gene open 10011-10994 galE
2129 CALTVO010000035.1 GCA943912715_01061 gene open 10998-11675
2130 CALTVO010000035.1 GCA943912715_01062 gene open 11910-12923
2131 CALTVO010000035.1 GCA943912715_01063 gene open 13117-13881
2132 CALTVO010000035.1 GCA943912715_01064 gene open 14010-15383
2133 CALTVO010000035.1 GCA943912715_01065 gene open 15422-16816
2134 CALTVO010000035.1 GCA943912715_01066 gene open 17177-17620 dtd
2135 CALTVO010000035.1 GCA943912715_01067 gene open 17652-18395
2136 CALTVO010000036.1 GCA943912715_01068 CDS open 321-1349 _na     342_aa Cytochrome oxidase assembly protein
2137 CALTVO010000036.1 GCA943912715_01069 CDS open 1420-2184 _na     254_aa ABC-2 type transporter transmembrane domain-containing protein
2138 CALTVO010000036.1 GCA943912715_01070 CDS open 2269-3198 _na     309_aa ABC transporter domain-containing protein
2139 CALTVO010000036.1 GCA943912715_01071 CDS open 3205-4929 _na     574_aa mptB polyprenol phosphomannose-dependent alpha 1%2C6 mannosyltransferase MptB
2140 CALTVO010000036.1 GCA943912715_01072 CDS open 5145-5882 _na     245_aa Helix-turn-helix type 11 domain-containing protein
2141 CALTVO010000036.1 GCA943912715_01073 CDS open 5879-7318 _na     479_aa sufB Fe-S cluster assembly protein SufB
2142 CALTVO010000036.1 GCA943912715_01074 CDS open 7323-8477 _na     384_aa sufD Fe-S cluster assembly protein SufD
2143 CALTVO010000036.1 GCA943912715_01075 CDS open 8507-9265 _na     252_aa sufC Fe-S cluster assembly ATPase SufC
2144 CALTVO010000036.1 GCA943912715_01076 CDS open 9312-10556 _na     414_aa Cysteine desulfurase
2145 CALTVO010000036.1 GCA943912715_01077 CDS open 10556-11008 _na     150_aa sufU Fe-S cluster assembly sulfur transfer protein SufU
2146 CALTVO010000036.1 GCA943912715_01078 CDS open 11009-11416 _na     135_aa MIP18 family-like domain-containing protein
2147 CALTVO010000036.1 GCA943912715_01079 CDS open 11510-13141 _na     543_aa ccmA heme ABC exporter ATP-binding protein CcmA
2148 CALTVO010000036.1 GCA943912715_01080 CDS open 13147-14475 _na     442_aa DUF2254 domain-containing protein
2149 CALTVO010000036.1 GCA943912715_01081 CDS open 14537-15901 _na     454_aa UPF0210 protein UL81_06165
2150 CALTVO010000036.1 GCA943912715_01082 CDS open 15903-16259 _na     118_aa ACT domain-containing protein
2151 CALTVO010000036.1 GCA943912715_01083 CDS open 16288-16956 _na     222_aa NAD(P)-binding domain-containing protein
2152 CALTVO010000036.1 GCA943912715_01084 CDS open 16975-17952 _na     325_aa Inosine/uridine-preferring nucleoside hydrolase domain-containing protein
2153 CALTVO010000036.1 GCA943912715_01068 gene open 321-1349
2154 CALTVO010000036.1 GCA943912715_01069 gene open 1420-2184
2155 CALTVO010000036.1 GCA943912715_01070 gene open 2269-3198
2156 CALTVO010000036.1 GCA943912715_01071 gene open 3205-4929 mptB
2157 CALTVO010000036.1 GCA943912715_01072 gene open 5145-5882
2158 CALTVO010000036.1 GCA943912715_01073 gene open 5879-7318 sufB
2159 CALTVO010000036.1 GCA943912715_01074 gene open 7323-8477 sufD
2160 CALTVO010000036.1 GCA943912715_01075 gene open 8507-9265 sufC
2161 CALTVO010000036.1 GCA943912715_01076 gene open 9312-10556
2162 CALTVO010000036.1 GCA943912715_01077 gene open 10556-11008 sufU
2163 CALTVO010000036.1 GCA943912715_01078 gene open 11009-11416
2164 CALTVO010000036.1 GCA943912715_01079 gene open 11510-13141 ccmA
2165 CALTVO010000036.1 GCA943912715_01080 gene open 13147-14475
2166 CALTVO010000036.1 GCA943912715_01081 gene open 14537-15901
2167 CALTVO010000036.1 GCA943912715_01082 gene open 15903-16259
2168 CALTVO010000036.1 GCA943912715_01083 gene open 16288-16956
2169 CALTVO010000036.1 GCA943912715_01084 gene open 16975-17952
2170 CALTVO010000037.1 GCA943912715_01085 CDS open 55-516 _na     153_aa hypothetical protein
2171 CALTVO010000037.1 GCA943912715_01086 CDS open 1027-1524 _na     165_aa rpsP 30S ribosomal protein S16
2172 CALTVO010000037.1 GCA943912715_01087 CDS open 1670-2374 _na     234_aa HTH tetR-type domain-containing protein
2173 CALTVO010000037.1 GCA943912715_01088 CDS open 2402-2827 _na     141_aa Cupin domain-containing protein
2174 CALTVO010000037.1 GCA943912715_01089 CDS open 2923-3411 _na     162_aa rimM ribosome maturation factor RimM
2175 CALTVO010000037.1 GCA943912715_01090 CDS open 3408-4298 _na     296_aa trmD tRNA (guanosine(37)-N1)-methyltransferase TrmD
2176 CALTVO010000037.1 GCA943912715_01091 CDS open 4298-4678 _na     126_aa DUF3000 domain-containing protein
2177 CALTVO010000037.1 GCA943912715_01092 CDS open 4778-5368 _na     196_aa Secreted protein
2178 CALTVO010000037.1 GCA943912715_01093 CDS open 5528-7852 _na     774_aa S1 motif domain-containing protein
2179 CALTVO010000037.1 GCA943912715_01094 CDS open 8108-10315 _na     735_aa ABC-2 type transporter transmembrane domain-containing protein
2180 CALTVO010000037.1 GCA943912715_01095 CDS open 10490-10834 _na     114_aa rplS 50S ribosomal protein L19
2181 CALTVO010000037.1 GCA943912715_01096 CDS open 11011-11775 _na     254_aa lepB signal peptidase I
2182 CALTVO010000037.1 GCA943912715_01097 CDS open 11753-12490 _na     245_aa lepB signal peptidase I
2183 CALTVO010000037.1 GCA943912715_01098 CDS open 12477-13118 _na     213_aa ribonuclease HII
2184 CALTVO010000037.1 GCA943912715_01099 CDS open 13181-13486 _na     101_aa Protein often found in Actinomycetes clustered with signal peptidase and/or RNaseHII
2185 CALTVO010000037.1 GCA943912715_01100 CDS open 13669-14067 _na     132_aa yraN YraN family protein
2186 CALTVO010000037.1 GCA943912715_01101 CDS open 14054-15619 _na     521_aa yraN YraN family protein
2187 CALTVO010000037.1 GCA943912715_01102 CDS open 15616-16797 _na     393_aa dprA DNA-processing protein DprA
2188 CALTVO010000037.1 GCA943912715_01103 CDS open 16820-17737 _na     305_aa xerC Tyrosine recombinase XerC
2189 CALTVO010000037.1 GCA943912715_01085 gene open 55-516
2190 CALTVO010000037.1 GCA943912715_01086 gene open 1027-1524 rpsP
2191 CALTVO010000037.1 GCA943912715_01087 gene open 1670-2374
2192 CALTVO010000037.1 GCA943912715_01088 gene open 2402-2827
2193 CALTVO010000037.1 GCA943912715_01089 gene open 2923-3411 rimM
2194 CALTVO010000037.1 GCA943912715_01090 gene open 3408-4298 trmD
2195 CALTVO010000037.1 GCA943912715_01091 gene open 4298-4678
2196 CALTVO010000037.1 GCA943912715_01092 gene open 4778-5368
2197 CALTVO010000037.1 GCA943912715_01093 gene open 5528-7852
2198 CALTVO010000037.1 GCA943912715_01094 gene open 8108-10315
2199 CALTVO010000037.1 GCA943912715_01095 gene open 10490-10834 rplS
2200 CALTVO010000037.1 GCA943912715_01096 gene open 11011-11775 lepB
2201 CALTVO010000037.1 GCA943912715_01097 gene open 11753-12490 lepB
2202 CALTVO010000037.1 GCA943912715_01098 gene open 12477-13118
2203 CALTVO010000037.1 GCA943912715_01099 gene open 13181-13486
2204 CALTVO010000037.1 GCA943912715_01100 gene open 13669-14067 yraN
2205 CALTVO010000037.1 GCA943912715_01101 gene open 14054-15619 yraN
2206 CALTVO010000037.1 GCA943912715_01102 gene open 15616-16797 dprA
2207 CALTVO010000037.1 GCA943912715_01103 gene open 16820-17737 xerC
2208 CALTVO010000038.1 GCA943912715_01104 CDS open 88-477 _na     129_aa rplL 50S ribosomal protein L7/L12
2209 CALTVO010000038.1 GCA943912715_01105 CDS open 566-1087 _na     173_aa rplJ 50S ribosomal protein L10
2210 CALTVO010000038.1 GCA943912715_01106 CDS open 1547-2710 _na     387_aa Deoxyribodipyrimidine photo-lyase
2211 CALTVO010000038.1 GCA943912715_01107 CDS open 2822-3526 _na     234_aa rplA 50S ribosomal protein L1
2212 CALTVO010000038.1 GCA943912715_01108 CDS open 3595-4038 _na     147_aa rplK 50S ribosomal protein L11
2213 CALTVO010000038.1 GCA943912715_01109 CDS open 4209-5105 _na     298_aa nusG transcription termination/antitermination protein NusG
2214 CALTVO010000038.1 GCA943912715_01110 CDS open 5235-5567 _na     110_aa secE preprotein translocase subunit SecE
2215 CALTVO010000038.1 GCA943912715_01114 CDS open 6312-7256 _na     314_aa Sugar-binding domain-containing protein
2216 CALTVO010000038.1 GCA943912715_01115 CDS open 7370-8095 _na     241_aa deoD purine-nucleoside phosphorylase
2217 CALTVO010000038.1 GCA943912715_01116 CDS open 8111-9460 _na     449_aa Major facilitator superfamily (MFS) profile domain-containing protein
2218 CALTVO010000038.1 GCA943912715_01117 CDS open 9472-10119 _na     215_aa deoC deoxyribose-phosphate aldolase
2219 CALTVO010000038.1 GCA943912715_01118 CDS open 10123-11700 _na     525_aa Phosphomannomutase
2220 CALTVO010000038.1 GCA943912715_01119 CDS open 11866-12903 _na     345_aa Fe/B12 periplasmic-binding domain-containing protein
2221 CALTVO010000038.1 GCA943912715_01120 CDS open 12976-13992 _na     338_aa Iron ABC transporter permease
2222 CALTVO010000038.1 GCA943912715_01121 CDS open 13989-15044 _na     351_aa fepG Ferric enterobactin transport system permease fepG
2223 CALTVO010000038.1 GCA943912715_01122 CDS open 15067-15870 _na     267_aa ABC transporter domain-containing protein
2224 CALTVO010000038.1 GCA943912715_01123 CDS open 16222-16653 _na     143_aa hypothetical protein
2225 CALTVO010000038.1 GCA943912715_01124 CDS open 16722-16922 _na     66_aa GtrA-like protein domain-containing protein
2226 CALTVO010000038.1 GCA943912715_01125 CDS open 16955-17296 _na     113_aa hypothetical protein
2227 CALTVO010000038.1 GCA943912715_01104 gene open 88-477 rplL
2228 CALTVO010000038.1 GCA943912715_01105 gene open 566-1087 rplJ
2229 CALTVO010000038.1 GCA943912715_01106 gene open 1547-2710
2230 CALTVO010000038.1 GCA943912715_01107 gene open 2822-3526 rplA
2231 CALTVO010000038.1 GCA943912715_01108 gene open 3595-4038 rplK
2232 CALTVO010000038.1 GCA943912715_01109 gene open 4209-5105 nusG
2233 CALTVO010000038.1 GCA943912715_01110 gene open 5235-5567 secE
2234 CALTVO010000038.1 GCA943912715_01114 gene open 6312-7256
2235 CALTVO010000038.1 GCA943912715_01115 gene open 7370-8095 deoD
2236 CALTVO010000038.1 GCA943912715_01116 gene open 8111-9460
2237 CALTVO010000038.1 GCA943912715_01117 gene open 9472-10119 deoC
2238 CALTVO010000038.1 GCA943912715_01118 gene open 10123-11700
2239 CALTVO010000038.1 GCA943912715_01119 gene open 11866-12903
2240 CALTVO010000038.1 GCA943912715_01120 gene open 12976-13992
2241 CALTVO010000038.1 GCA943912715_01121 gene open 13989-15044 fepG
2242 CALTVO010000038.1 GCA943912715_01122 gene open 15067-15870
2243 CALTVO010000038.1 GCA943912715_01123 gene open 16222-16653
2244 CALTVO010000038.1 GCA943912715_01124 gene open 16722-16922
2245 CALTVO010000038.1 GCA943912715_01125 gene open 16955-17296
2246 CALTVO010000038.1 GCA943912715_01111 gene open 5741-5813 trnW
2247 CALTVO010000038.1 GCA943912715_01112 gene open 5951-6022 trnM
2248 CALTVO010000038.1 GCA943912715_01113 gene open 6071-6146 trnT
2249 CALTVO010000038.1 GCA943912715_01126 gene open 17554-17635 trnY
2250 CALTVO010000038.1 GCA943912715_01111 tRNA open 5741-5813 trnW tRNA-Trp(cca)
2251 CALTVO010000038.1 GCA943912715_01112 tRNA open 5951-6022 trnM tRNA-Met(cat)
2252 CALTVO010000038.1 GCA943912715_01113 tRNA open 6071-6146 trnT tRNA-Thr(ggt)
2253 CALTVO010000038.1 GCA943912715_01126 tRNA open 17554-17635 trnY tRNA-Tyr(gta)
2254 CALTVO010000039.1 GCA943912715_01127 CDS open 187-3609 _na     1140_aa pyruvate carboxylase
2255 CALTVO010000039.1 GCA943912715_01128 CDS open 4066-5226 _na     386_aa bifunctional 2-methylcitrate synthase/citrate synthase
2256 CALTVO010000039.1 GCA943912715_01129 CDS open 5240-6172 _na     310_aa prpB methylisocitrate lyase
2257 CALTVO010000039.1 GCA943912715_01130 CDS open 6172-7683 _na     503_aa prpD 2-methylcitrate dehydratase PrpD
2258 CALTVO010000039.1 GCA943912715_01131 CDS open 7849-9162 _na     437_aa HTH cro/C1-type domain-containing protein
2259 CALTVO010000039.1 GCA943912715_01132 CDS open 9172-10599 _na     475_aa NAD(P)H-quinone dehydrogenase
2260 CALTVO010000039.1 GCA943912715_01133 CDS open 10670-11860 _na     396_aa Peptidase M20 dimerisation domain-containing protein
2261 CALTVO010000039.1 GCA943912715_01134 CDS open 11939-12307 _na     122_aa HTH cro/C1-type domain-containing protein
2262 CALTVO010000039.1 GCA943912715_01135 CDS open 12356-13030 _na     224_aa upp uracil phosphoribosyltransferase
2263 CALTVO010000039.1 GCA943912715_01136 CDS open 13049-13327 _na     92_aa Chemotaxis protein
2264 CALTVO010000039.1 GCA943912715_01137 CDS open 13328-14236 _na     302_aa NlpC/P60 domain-containing protein
2265 CALTVO010000039.1 GCA943912715_01138 CDS open 14291-15529 _na     412_aa Primosomal protein
2266 CALTVO010000039.1 GCA943912715_01139 CDS open 15672-16349 _na     225_aa DJ-1/PfpI domain-containing protein
2267 CALTVO010000039.1 GCA943912715_01140 CDS open 16381-17301 _na     306_aa Adenosine deaminase domain-containing protein
2268 CALTVO010000039.1 GCA943912715_01127 gene open 187-3609
2269 CALTVO010000039.1 GCA943912715_01128 gene open 4066-5226
2270 CALTVO010000039.1 GCA943912715_01129 gene open 5240-6172 prpB
2271 CALTVO010000039.1 GCA943912715_01130 gene open 6172-7683 prpD
2272 CALTVO010000039.1 GCA943912715_01131 gene open 7849-9162
2273 CALTVO010000039.1 GCA943912715_01132 gene open 9172-10599
2274 CALTVO010000039.1 GCA943912715_01133 gene open 10670-11860
2275 CALTVO010000039.1 GCA943912715_01134 gene open 11939-12307
2276 CALTVO010000039.1 GCA943912715_01135 gene open 12356-13030 upp
2277 CALTVO010000039.1 GCA943912715_01136 gene open 13049-13327
2278 CALTVO010000039.1 GCA943912715_01137 gene open 13328-14236
2279 CALTVO010000039.1 GCA943912715_01138 gene open 14291-15529
2280 CALTVO010000039.1 GCA943912715_01139 gene open 15672-16349
2281 CALTVO010000039.1 GCA943912715_01140 gene open 16381-17301
2282 CALTVO010000040.1 GCA943912715_01141 CDS open 158-1003 _na     281_aa hypothetical protein
2283 CALTVO010000040.1 GCA943912715_01142 CDS open 1223-2302 _na     359_aa Esterase
2284 CALTVO010000040.1 GCA943912715_01143 CDS open 2937-4349 _na     470_aa lpdA dihydrolipoyl dehydrogenase
2285 CALTVO010000040.1 GCA943912715_01144 CDS open 4442-5851 _na     469_aa ramB acetate metabolism transcriptional regulator RamB
2286 CALTVO010000040.1 GCA943912715_01145 CDS open 6224-6979 _na     251_aa B558 family succinate dehydrogenase (Or fumarate reductase) cytochrome B subunit
2287 CALTVO010000040.1 GCA943912715_01146 CDS open 6995-9010 _na     671_aa Succinate dehydrogenase or fumarate reductase%2C flavoprotein subunit
2288 CALTVO010000040.1 GCA943912715_01147 CDS open 9010-9759 _na     249_aa Succinate dehydrogenase iron-sulfur subunit
2289 CALTVO010000040.1 GCA943912715_01148 CDS open 9816-10190 _na     124_aa DUF485 domain-containing protein
2290 CALTVO010000040.1 GCA943912715_01149 CDS open 10402-10686 _na     94_aa transposase
2291 CALTVO010000040.1 GCA943912715_01150 CDS open 11407-12600 _na     397_aa GIY-YIG nuclease family protein
2292 CALTVO010000040.1 GCA943912715_01151 CDS open 12606-14597 _na     663_aa DEAD/DEAH box helicase
2293 CALTVO010000040.1 GCA943912715_01152 CDS open 14607-17321 _na     904_aa DNA methyltransferase
2294 CALTVO010000040.1 GCA943912715_01141 gene open 158-1003
2295 CALTVO010000040.1 GCA943912715_01142 gene open 1223-2302
2296 CALTVO010000040.1 GCA943912715_01143 gene open 2937-4349 lpdA
2297 CALTVO010000040.1 GCA943912715_01144 gene open 4442-5851 ramB
2298 CALTVO010000040.1 GCA943912715_01145 gene open 6224-6979
2299 CALTVO010000040.1 GCA943912715_01146 gene open 6995-9010
2300 CALTVO010000040.1 GCA943912715_01147 gene open 9010-9759
2301 CALTVO010000040.1 GCA943912715_01148 gene open 9816-10190
2302 CALTVO010000040.1 GCA943912715_01149 gene open 10402-10686
2303 CALTVO010000040.1 GCA943912715_01150 gene open 11407-12600
2304 CALTVO010000040.1 GCA943912715_01151 gene open 12606-14597
2305 CALTVO010000040.1 GCA943912715_01152 gene open 14607-17321
2306 CALTVO010000041.1 GCA943912715_01153 CDS open 12-374 _na     120_aa Unannotated protein
2307 CALTVO010000041.1 GCA943912715_01154 CDS open 398-1375 _na     325_aa Putative gluconeogenesis factor
2308 CALTVO010000041.1 GCA943912715_01155 CDS open 1531-2508 _na     325_aa whiA DNA-binding protein WhiA
2309 CALTVO010000041.1 GCA943912715_01156 CDS open 2684-4330 _na     548_aa L-lactate permease
2310 CALTVO010000041.1 GCA943912715_01157 CDS open 4876-5883 _na     335_aa gap type I glyceraldehyde-3-phosphate dehydrogenase
2311 CALTVO010000041.1 GCA943912715_01158 CDS open 6013-7230 _na     405_aa Phosphoglycerate kinase
2312 CALTVO010000041.1 GCA943912715_01159 CDS open 7277-8059 _na     260_aa tpiA triose-phosphate isomerase
2313 CALTVO010000041.1 GCA943912715_01160 CDS open 8258-8494 _na     78_aa secG preprotein translocase subunit SecG
2314 CALTVO010000041.1 GCA943912715_01161 CDS open 8618-9379 _na     253_aa 6-phosphogluconolactonase
2315 CALTVO010000041.1 GCA943912715_01162 CDS open 9427-10362 _na     311_aa opcA Glucose-6-phosphate dehydrogenase assembly protein OpcA
2316 CALTVO010000041.1 GCA943912715_01163 CDS open 10377-11909 _na     510_aa zwf glucose-6-phosphate dehydrogenase
2317 CALTVO010000041.1 GCA943912715_01164 CDS open 12009-13094 _na     361_aa tal transaldolase
2318 CALTVO010000041.1 GCA943912715_01165 CDS open 13127-15235 _na     702_aa tkt transketolase
2319 CALTVO010000041.1 GCA943912715_01166 CDS open 15564-16508 _na     314_aa heme o synthase
2320 CALTVO010000041.1 GCA943912715_01167 CDS open 16562-17290 _na     242_aa Enoyl reductase (ER) domain-containing protein
2321 CALTVO010000041.1 GCA943912715_01153 gene open 12-374
2322 CALTVO010000041.1 GCA943912715_01154 gene open 398-1375
2323 CALTVO010000041.1 GCA943912715_01155 gene open 1531-2508 whiA
2324 CALTVO010000041.1 GCA943912715_01156 gene open 2684-4330
2325 CALTVO010000041.1 GCA943912715_01157 gene open 4876-5883 gap
2326 CALTVO010000041.1 GCA943912715_01158 gene open 6013-7230
2327 CALTVO010000041.1 GCA943912715_01159 gene open 7277-8059 tpiA
2328 CALTVO010000041.1 GCA943912715_01160 gene open 8258-8494 secG
2329 CALTVO010000041.1 GCA943912715_01161 gene open 8618-9379
2330 CALTVO010000041.1 GCA943912715_01162 gene open 9427-10362 opcA
2331 CALTVO010000041.1 GCA943912715_01163 gene open 10377-11909 zwf
2332 CALTVO010000041.1 GCA943912715_01164 gene open 12009-13094 tal
2333 CALTVO010000041.1 GCA943912715_01165 gene open 13127-15235 tkt
2334 CALTVO010000041.1 GCA943912715_01166 gene open 15564-16508
2335 CALTVO010000041.1 GCA943912715_01167 gene open 16562-17290
2336 CALTVO010000042.1 GCA943912715_01168 CDS open 23-1294 _na     423_aa adenosylmethionine--8-amino-7-oxononanoate transaminase
2337 CALTVO010000042.1 GCA943912715_01169 CDS open 1291-1965 _na     224_aa bioD dethiobiotin synthase
2338 CALTVO010000042.1 GCA943912715_01170 CDS open 1987-2973 _na     328_aa HNH nuclease domain-containing protein
2339 CALTVO010000042.1 GCA943912715_01171 CDS open 3058-3675 _na     205_aa HTH tetR-type domain-containing protein
2340 CALTVO010000042.1 GCA943912715_01172 CDS open 3680-4156 _na     158_aa bcp thioredoxin-dependent thiol peroxidase
2341 CALTVO010000042.1 GCA943912715_01173 CDS open 4245-4523 _na     92_aa DUF3618 domain-containing protein
2342 CALTVO010000042.1 GCA943912715_01174 CDS open 4651-5859 _na     402_aa glutaminase
2343 CALTVO010000042.1 GCA943912715_01175 CDS open 5943-7118 _na     391_aa Fe/B12 periplasmic-binding domain-containing protein
2344 CALTVO010000042.1 GCA943912715_01176 CDS open 7118-8173 _na     351_aa Iron-siderophore ABC transporter permease
2345 CALTVO010000042.1 GCA943912715_01177 CDS open 8164-8931 _na     255_aa ABC transporter domain-containing protein
2346 CALTVO010000042.1 GCA943912715_01179 CDS open 9318-10523 _na     401_aa L%2CD-TPase catalytic domain-containing protein
2347 CALTVO010000042.1 GCA943912715_01180 CDS open 10544-11488 _na     314_aa Luciferase-like domain-containing protein
2348 CALTVO010000042.1 GCA943912715_01182 CDS open 11642-12274 _na     210_aa orn oligoribonuclease
2349 CALTVO010000042.1 GCA943912715_01183 CDS open 12445-13989 _na     514_aa Amino acid carrier protein
2350 CALTVO010000042.1 GCA943912715_01184 CDS open 13986-14786 _na     266_aa cmrA mycolate reductase
2351 CALTVO010000042.1 GCA943912715_01186 CDS open 15596-16531 _na     311_aa HTH lysR-type domain-containing protein
2352 CALTVO010000042.1 GCA943912715_01187 CDS open 16579-17187 _na     202_aa hypothetical protein
2353 CALTVO010000042.1 GCA943912715_01168 gene open 23-1294
2354 CALTVO010000042.1 GCA943912715_01169 gene open 1291-1965 bioD
2355 CALTVO010000042.1 GCA943912715_01170 gene open 1987-2973
2356 CALTVO010000042.1 GCA943912715_01171 gene open 3058-3675
2357 CALTVO010000042.1 GCA943912715_01172 gene open 3680-4156 bcp
2358 CALTVO010000042.1 GCA943912715_01173 gene open 4245-4523
2359 CALTVO010000042.1 GCA943912715_01174 gene open 4651-5859
2360 CALTVO010000042.1 GCA943912715_01175 gene open 5943-7118
2361 CALTVO010000042.1 GCA943912715_01176 gene open 7118-8173
2362 CALTVO010000042.1 GCA943912715_01177 gene open 8164-8931
2363 CALTVO010000042.1 GCA943912715_01179 gene open 9318-10523
2364 CALTVO010000042.1 GCA943912715_01180 gene open 10544-11488
2365 CALTVO010000042.1 GCA943912715_01182 gene open 11642-12274 orn
2366 CALTVO010000042.1 GCA943912715_01183 gene open 12445-13989
2367 CALTVO010000042.1 GCA943912715_01184 gene open 13986-14786 cmrA
2368 CALTVO010000042.1 GCA943912715_01186 gene open 15596-16531
2369 CALTVO010000042.1 GCA943912715_01187 gene open 16579-17187
2370 CALTVO010000042.1 GCA943912715_01178 gene open 9036-9108 trnK
2371 CALTVO010000042.1 GCA943912715_01181 gene open 11517-11592 trnH
2372 CALTVO010000042.1 GCA943912715_01185 gene open 15482-15555 trnR
2373 CALTVO010000042.1 GCA943912715_01178 tRNA open 9036-9108 trnK tRNA-Lys(ctt)
2374 CALTVO010000042.1 GCA943912715_01181 tRNA open 11517-11592 trnH tRNA-His(gtg)
2375 CALTVO010000042.1 GCA943912715_01185 tRNA open 15482-15555 trnR tRNA-Arg(tct)
2376 CALTVO010000043.1 GCA943912715_01188 CDS open 67-549 _na     160_aa hypothetical protein
2377 CALTVO010000043.1 GCA943912715_01189 CDS open 740-2182 _na     480_aa Glycosyl hydrolase family 32 N-terminal domain-containing protein
2378 CALTVO010000043.1 GCA943912715_01190 CDS open 2442-3311 _na     289_aa Methyltransferase domain-containing protein
2379 CALTVO010000043.1 GCA943912715_01191 CDS open 3321-3488 _na     55_aa DUF3117 domain-containing protein
2380 CALTVO010000043.1 GCA943912715_01192 CDS open 3500-3805 _na     101_aa DivIVA domain-containing protein
2381 CALTVO010000043.1 GCA943912715_01193 CDS open 3809-4531 _na     240_aa glucosyl-3-phosphoglycerate synthase
2382 CALTVO010000043.1 GCA943912715_01194 CDS open 4528-5358 _na     276_aa folP dihydropteroate synthase
2383 CALTVO010000043.1 GCA943912715_01195 CDS open 5355-6119 _na     254_aa Cytokinin riboside 5'-monophosphate phosphoribohydrolase
2384 CALTVO010000043.1 GCA943912715_01196 CDS open 6122-7177 _na     351_aa dapE succinyl-diaminopimelate desuccinylase
2385 CALTVO010000043.1 GCA943912715_01197 CDS open 7299-8657 _na     452_aa Amino acid permease/ SLC12A domain-containing protein
2386 CALTVO010000043.1 GCA943912715_01198 CDS open 8675-9646 _na     323_aa dapD 2%2C3%2C4%2C5-tetrahydropyridine-2%2C6-dicarboxylate N-succinyltransferase
2387 CALTVO010000043.1 GCA943912715_01199 CDS open 9748-11079 _na     443_aa Amino acid permease/ SLC12A domain-containing protein
2388 CALTVO010000043.1 GCA943912715_01200 CDS open 11489-12334 _na     281_aa DUF559 domain-containing protein
2389 CALTVO010000043.1 GCA943912715_01201 CDS open 12400-12609 _na     69_aa HTH cro/C1-type domain-containing protein
2390 CALTVO010000043.1 GCA943912715_01202 CDS open 12602-13075 _na     157_aa transcriptional regulator
2391 CALTVO010000043.1 GCA943912715_01203 CDS open 13542-14102 _na     186_aa GtrA/DPMS transmembrane domain-containing protein
2392 CALTVO010000043.1 GCA943912715_01204 CDS open 14132-14914 _na     260_aa Pseudouridine synthase RsuA/RluA-like domain-containing protein
2393 CALTVO010000043.1 GCA943912715_01205 CDS open 14973-16061 _na     362_aa dapC succinyldiaminopimelate transaminase
2394 CALTVO010000043.1 GCA943912715_01206 CDS open 16065-16388 _na     107_aa fdxA ferredoxin
2395 CALTVO010000043.1 GCA943912715_01207 CDS open 16444-16821 _na     125_aa Major facilitator superfamily (MFS) profile domain-containing protein
2396 CALTVO010000043.1 GCA943912715_01188 gene open 67-549
2397 CALTVO010000043.1 GCA943912715_01189 gene open 740-2182
2398 CALTVO010000043.1 GCA943912715_01190 gene open 2442-3311
2399 CALTVO010000043.1 GCA943912715_01191 gene open 3321-3488
2400 CALTVO010000043.1 GCA943912715_01192 gene open 3500-3805
2401 CALTVO010000043.1 GCA943912715_01193 gene open 3809-4531
2402 CALTVO010000043.1 GCA943912715_01194 gene open 4528-5358 folP
2403 CALTVO010000043.1 GCA943912715_01195 gene open 5355-6119
2404 CALTVO010000043.1 GCA943912715_01196 gene open 6122-7177 dapE
2405 CALTVO010000043.1 GCA943912715_01197 gene open 7299-8657
2406 CALTVO010000043.1 GCA943912715_01198 gene open 8675-9646 dapD
2407 CALTVO010000043.1 GCA943912715_01199 gene open 9748-11079
2408 CALTVO010000043.1 GCA943912715_01200 gene open 11489-12334
2409 CALTVO010000043.1 GCA943912715_01201 gene open 12400-12609
2410 CALTVO010000043.1 GCA943912715_01202 gene open 12602-13075
2411 CALTVO010000043.1 GCA943912715_01203 gene open 13542-14102
2412 CALTVO010000043.1 GCA943912715_01204 gene open 14132-14914
2413 CALTVO010000043.1 GCA943912715_01205 gene open 14973-16061 dapC
2414 CALTVO010000043.1 GCA943912715_01206 gene open 16065-16388 fdxA
2415 CALTVO010000043.1 GCA943912715_01207 gene open 16444-16821
2416 CALTVO010000044.1 GCA943912715_01208 CDS open 197-751 _na     184_aa terC Tellurium resistance protein TerC
2417 CALTVO010000044.1 GCA943912715_01209 CDS open 748-1668 _na     306_aa hypothetical protein
2418 CALTVO010000044.1 GCA943912715_01210 CDS open 1678-2661 _na     327_aa hemB porphobilinogen synthase
2419 CALTVO010000044.1 GCA943912715_01211 CDS open 2691-4412 _na     573_aa uroporphyrinogen-III C-methyltransferase
2420 CALTVO010000044.1 GCA943912715_01212 CDS open 4577-5473 _na     298_aa hemC hydroxymethylbilane synthase
2421 CALTVO010000044.1 GCA943912715_01213 CDS open 5474-6808 _na     444_aa glutamyl-tRNA reductase
2422 CALTVO010000044.1 GCA943912715_01214 CDS open 6885-7124 _na     79_aa Glutaredoxin family protein
2423 CALTVO010000044.1 GCA943912715_01215 CDS open 7222-8259 _na     345_aa HAD hydrolase%2C family IB
2424 CALTVO010000044.1 GCA943912715_01216 CDS open 8370-8471 _na     33_aa 30S ribosomal protein bS22
2425 CALTVO010000044.1 GCA943912715_01217 CDS open 8747-8935 _na     62_aa Helix-turn-helix domain-containing protein
2426 CALTVO010000044.1 GCA943912715_01218 CDS open 9186-9977 _na     263_aa proC pyrroline-5-carboxylate reductase
2427 CALTVO010000044.1 GCA943912715_01219 CDS open 10059-11276 _na     405_aa tctB tripartite tricarboxylate transporter TctB family protein
2428 CALTVO010000044.1 GCA943912715_01220 CDS open 11286-12131 _na     281_aa Ppx/GppA phosphatase family
2429 CALTVO010000044.1 GCA943912715_01221 CDS open 12249-13148 _na     299_aa DUF3109 domain-containing protein
2430 CALTVO010000044.1 GCA943912715_01222 CDS open 13145-13855 _na     236_aa regX3 Sensory transduction protein RegX3
2431 CALTVO010000044.1 GCA943912715_01223 CDS open 13852-15132 _na     426_aa senX3 Sensor-like histidine kinase SenX3
2432 CALTVO010000044.1 GCA943912715_01224 CDS open 15183-15929 _na     248_aa phosphoglyceromutase
2433 CALTVO010000044.1 GCA943912715_01225 CDS open 15971-16552 _na     193_aa glycosyltransferase
2434 CALTVO010000044.1 GCA943912715_01208 gene open 197-751 terC
2435 CALTVO010000044.1 GCA943912715_01209 gene open 748-1668
2436 CALTVO010000044.1 GCA943912715_01210 gene open 1678-2661 hemB
2437 CALTVO010000044.1 GCA943912715_01211 gene open 2691-4412
2438 CALTVO010000044.1 GCA943912715_01212 gene open 4577-5473 hemC
2439 CALTVO010000044.1 GCA943912715_01213 gene open 5474-6808
2440 CALTVO010000044.1 GCA943912715_01214 gene open 6885-7124
2441 CALTVO010000044.1 GCA943912715_01215 gene open 7222-8259
2442 CALTVO010000044.1 GCA943912715_01216 gene open 8370-8471
2443 CALTVO010000044.1 GCA943912715_01217 gene open 8747-8935
2444 CALTVO010000044.1 GCA943912715_01218 gene open 9186-9977 proC
2445 CALTVO010000044.1 GCA943912715_01219 gene open 10059-11276 tctB
2446 CALTVO010000044.1 GCA943912715_01220 gene open 11286-12131
2447 CALTVO010000044.1 GCA943912715_01221 gene open 12249-13148
2448 CALTVO010000044.1 GCA943912715_01222 gene open 13145-13855 regX3
2449 CALTVO010000044.1 GCA943912715_01223 gene open 13852-15132 senX3
2450 CALTVO010000044.1 GCA943912715_01224 gene open 15183-15929
2451 CALTVO010000044.1 GCA943912715_01225 gene open 15971-16552
2452 CALTVO010000045.1 regulatory_region open 7652-7747 TPP riboswitch aptamer (THI element)
2453 CALTVO010000045.1 GCA943912715_01226 CDS open 105-416 _na     103_aa Polyprenol-phosphate-mannose synthase
2454 CALTVO010000045.1 GCA943912715_01227 CDS open 431-1330 _na     299_aa Glycosyltransferase 2-like domain-containing protein
2455 CALTVO010000045.1 GCA943912715_01228 CDS open 1409-1786 _na     125_aa rbpA RNA polymerase-binding protein RbpA
2456 CALTVO010000045.1 GCA943912715_01229 CDS open 2259-2960 _na     233_aa Lipid/polyisoprenoid-binding YceI-like domain-containing protein
2457 CALTVO010000045.1 GCA943912715_01230 CDS open 2964-3128 _na     54_aa hypothetical protein
2458 CALTVO010000045.1 GCA943912715_01231 CDS open 3749-4666 _na     305_aa Dyp-type peroxidase
2459 CALTVO010000045.1 GCA943912715_01232 CDS open 4682-5995 _na     437_aa Class I SAM-dependent methyltransferase
2460 CALTVO010000045.1 GCA943912715_01233 CDS open 6110-7549 _na     479_aa NADH:ubiquinone reductase (non-electrogenic)
2461 CALTVO010000045.1 GCA943912715_01234 CDS open 7735-8559 _na     274_aa thiM hydroxyethylthiazole kinase
2462 CALTVO010000045.1 GCA943912715_01235 CDS open 8556-9185 _na     209_aa thiamine phosphate synthase
2463 CALTVO010000045.1 GCA943912715_01236 CDS open 9178-10713 _na     511_aa bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase
2464 CALTVO010000045.1 GCA943912715_01237 CDS open 10718-11320 _na     200_aa Methyltransferase domain protein
2465 CALTVO010000045.1 GCA943912715_01238 CDS open 11437-12510 _na     357_aa corA Magnesium transport protein CorA
2466 CALTVO010000045.1 GCA943912715_01239 CDS open 12507-12962 _na     151_aa Thioesterase domain-containing protein
2467 CALTVO010000045.1 GCA943912715_01240 CDS open 13022-14473 _na     483_aa gndA NADP-dependent phosphogluconate dehydrogenase
2468 CALTVO010000045.1 GCA943912715_01241 CDS open 14536-16065 _na     509_aa Divalent anion:Na+ symporter (DASS) family transporter
2469 CALTVO010000045.1 GCA943912715_01226 gene open 105-416
2470 CALTVO010000045.1 GCA943912715_01227 gene open 431-1330
2471 CALTVO010000045.1 GCA943912715_01228 gene open 1409-1786 rbpA
2472 CALTVO010000045.1 GCA943912715_01229 gene open 2259-2960
2473 CALTVO010000045.1 GCA943912715_01230 gene open 2964-3128
2474 CALTVO010000045.1 GCA943912715_01231 gene open 3749-4666
2475 CALTVO010000045.1 GCA943912715_01232 gene open 4682-5995
2476 CALTVO010000045.1 GCA943912715_01233 gene open 6110-7549
2477 CALTVO010000045.1 GCA943912715_01234 gene open 7735-8559 thiM
2478 CALTVO010000045.1 GCA943912715_01235 gene open 8556-9185
2479 CALTVO010000045.1 GCA943912715_01236 gene open 9178-10713
2480 CALTVO010000045.1 GCA943912715_01237 gene open 10718-11320
2481 CALTVO010000045.1 GCA943912715_01238 gene open 11437-12510 corA
2482 CALTVO010000045.1 GCA943912715_01239 gene open 12507-12962
2483 CALTVO010000045.1 GCA943912715_01240 gene open 13022-14473 gndA
2484 CALTVO010000045.1 GCA943912715_01241 gene open 14536-16065
2485 CALTVO010000046.1 repeat_region open 130-1454 CRISPR array with 15 repeats of length 36%2C consensus sequence GAAGTCTATCAGGGGTAATGAGAACTGAACCCCAGC and spacer length 55
2486 CALTVO010000046.1 repeat_region open 1026-1454 CRISPR array with 7 repeats of length 36%2C consensus sequence GAAGTCTATCAGGGGTAATGAGAACTGAACCCCAGC and spacer length 28
2487 CALTVO010000046.1 GCA943912715_01242 CDS open 1625-2086 _na     153_aa Septicolysin
2488 CALTVO010000046.1 GCA943912715_01243 CDS open 2349-3356 _na     335_aa 1%2C4-dihydroxy-2-naphthoyl-CoA synthase
2489 CALTVO010000046.1 GCA943912715_01244 CDS open 3372-3512 _na     46_aa hypothetical protein
2490 CALTVO010000046.1 GCA943912715_01245 CDS open 3579-4715 _na     378_aa menE o-succinylbenzoate--CoA ligase
2491 CALTVO010000046.1 GCA943912715_01246 CDS open 4794-5699 _na     301_aa 1%2C4-dihydroxy-2-naphthoate polyprenyltransferase
2492 CALTVO010000046.1 GCA943912715_01247 CDS open 5721-6044 _na     107_aa DUF4229 domain-containing protein
2493 CALTVO010000046.1 GCA943912715_01248 CDS open 6083-6358 _na     91_aa Secreted protein
2494 CALTVO010000046.1 GCA943912715_01249 CDS open 6355-6612 _na     85_aa HTH cro/C1-type domain-containing protein
2495 CALTVO010000046.1 GCA943912715_01250 CDS open 6613-7695 _na     360_aa ccsB c-type cytochrome biogenesis protein CcsB
2496 CALTVO010000046.1 GCA943912715_01251 CDS open 7778-9409 _na     543_aa ResB-like domain-containing protein
2497 CALTVO010000046.1 GCA943912715_01252 CDS open 9417-10220 _na     267_aa Cytochrome C biogenesis protein transmembrane domain-containing protein
2498 CALTVO010000046.1 GCA943912715_01253 CDS open 10221-10838 _na     205_aa Thioredoxin domain-containing protein
2499 CALTVO010000046.1 GCA943912715_01254 CDS open 10838-11446 _na     202_aa Phosphoglycerate mutase
2500 CALTVO010000046.1 GCA943912715_01255 CDS open 11483-12793 _na     436_aa hemL glutamate-1-semialdehyde 2%2C1-aminomutase