HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Dialister invisus (GCA_943914495.1)

Select a Genome:
BAKTA Annotations for GCA_943914495.1
Genome Selected: Dialister invisus
ContigsBases CDSrRNA tmRNAtRNA
73 1785844 1719 0 1 47
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3564 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:7]    |    Number of Records Found: 3564 [8 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
3001 CALUCG010000041.1 GCA943914495_01496 CDS open 1079-2122 _na     347_aa Tat pathway signal sequence domain protein
3002 CALUCG010000041.1 GCA943914495_01497 CDS open 2122-3057 _na     311_aa whiA DNA-binding protein WhiA
3003 CALUCG010000041.1 GCA943914495_01498 CDS open 3057-4409 _na     450_aa Putative gluconeogenesis factor
3004 CALUCG010000041.1 GCA943914495_01499 CDS open 4421-5314 _na     297_aa rapZ RNase adapter RapZ
3005 CALUCG010000041.1 GCA943914495_01500 CDS open 5318-6127 _na     269_aa Cof-like hydrolase
3006 CALUCG010000041.1 GCA943914495_01501 CDS open 6253-6993 _na     246_aa truA tRNA pseudouridine(38-40) synthase TruA
3007 CALUCG010000041.1 GCA943914495_01502 CDS open 7138-7518 _na     126_aa Tat pathway signal sequence domain protein
3008 CALUCG010000041.1 GCA943914495_01503 CDS open 7522-8796 _na     424_aa M18 family aminopeptidase
3009 CALUCG010000041.1 GCA943914495_01504 CDS open 8874-9275 _na     133_aa tsaA tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO
3010 CALUCG010000041.1 GCA943914495_01505 CDS open 9407-9544 _na     45_aa hypothetical protein
3011 CALUCG010000041.1 GCA943914495_01506 CDS open 9585-9962 _na     125_aa hypothetical protein
3012 CALUCG010000041.1 GCA943914495_01507 CDS open 9992-10234 _na     80_aa hypothetical protein
3013 CALUCG010000041.1 GCA943914495_01508 CDS open 10911-11393 _na     160_aa Acetyltransferase%2C GNAT family
3014 CALUCG010000041.1 GCA943914495_01509 CDS open 11476-13371 _na     631_aa lysS lysine--tRNA ligase
3015 CALUCG010000041.1 GCA943914495_01510 CDS open 13413-13895 _na     160_aa greA transcription elongation factor GreA
3016 CALUCG010000041.1 GCA943914495_01495 gene open 833-1072
3017 CALUCG010000041.1 GCA943914495_01496 gene open 1079-2122
3018 CALUCG010000041.1 GCA943914495_01497 gene open 2122-3057 whiA
3019 CALUCG010000041.1 GCA943914495_01498 gene open 3057-4409
3020 CALUCG010000041.1 GCA943914495_01499 gene open 4421-5314 rapZ
3021 CALUCG010000041.1 GCA943914495_01500 gene open 5318-6127
3022 CALUCG010000041.1 GCA943914495_01501 gene open 6253-6993 truA
3023 CALUCG010000041.1 GCA943914495_01502 gene open 7138-7518
3024 CALUCG010000041.1 GCA943914495_01503 gene open 7522-8796
3025 CALUCG010000041.1 GCA943914495_01504 gene open 8874-9275 tsaA
3026 CALUCG010000041.1 GCA943914495_01505 gene open 9407-9544
3027 CALUCG010000041.1 GCA943914495_01506 gene open 9585-9962
3028 CALUCG010000041.1 GCA943914495_01507 gene open 9992-10234
3029 CALUCG010000041.1 GCA943914495_01508 gene open 10911-11393
3030 CALUCG010000041.1 GCA943914495_01509 gene open 11476-13371 lysS
3031 CALUCG010000041.1 GCA943914495_01510 gene open 13413-13895 greA
3032 CALUCG010000041.1 GCA943914495_01490 gene open 241-317 trnM
3033 CALUCG010000041.1 GCA943914495_01491 gene open 319-394 trnT
3034 CALUCG010000041.1 GCA943914495_01492 gene open 422-497 trnfM
3035 CALUCG010000041.1 GCA943914495_01493 gene open 502-586 trnY
3036 CALUCG010000041.1 GCA943914495_01494 gene open 590-665 trnT
3037 CALUCG010000041.1 GCA943914495_01490 tRNA open 241-317 trnM tRNA-Met(cat)
3038 CALUCG010000041.1 GCA943914495_01491 tRNA open 319-394 trnT tRNA-Thr(ggt)
3039 CALUCG010000041.1 GCA943914495_01492 tRNA open 422-497 trnfM tRNA-fMet(cat)
3040 CALUCG010000041.1 GCA943914495_01493 tRNA open 502-586 trnY tRNA-Tyr(gta)
3041 CALUCG010000041.1 GCA943914495_01494 tRNA open 590-665 trnT tRNA-Thr(tgt)
3042 CALUCG010000042.1 GCA943914495_01511 CDS open 636-1814 _na     392_aa restriction endonuclease subunit S
3043 CALUCG010000042.1 GCA943914495_01512 CDS open 1829-2812 _na     327_aa xerA site-specific tyrosine recombinase/integron integrase
3044 CALUCG010000042.1 GCA943914495_01513 CDS open 2896-3573 _na     225_aa restriction endonuclease subunit S
3045 CALUCG010000042.1 GCA943914495_01514 CDS open 3570-4130 _na     186_aa restriction endonuclease subunit S
3046 CALUCG010000042.1 GCA943914495_01515 CDS open 4120-5652 _na     510_aa hsdM site-specific DNA-methyltransferase (adenine-specific)
3047 CALUCG010000042.1 GCA943914495_01516 CDS open 5656-5883 _na     75_aa helix-turn-helix domain-containing protein
3048 CALUCG010000042.1 GCA943914495_01517 CDS open 5950-7488 _na     512_aa guaA glutamine-hydrolyzing GMP synthase
3049 CALUCG010000042.1 GCA943914495_01518 CDS open 7659-8210 _na     183_aa Adenine phosphoribosyltransferase
3050 CALUCG010000042.1 GCA943914495_01519 CDS open 8342-9271 _na     309_aa Gram-positive signal peptide protein%2C YSIRK family
3051 CALUCG010000042.1 GCA943914495_01520 CDS open 9429-10235 _na     268_aa hypothetical protein
3052 CALUCG010000042.1 GCA943914495_01521 CDS open 10394-11212 _na     272_aa CHAD domain-containing protein
3053 CALUCG010000042.1 GCA943914495_01522 CDS open 11291-11422 _na     43_aa hypothetical protein
3054 CALUCG010000042.1 GCA943914495_01523 CDS open 11552-12013 _na     153_aa hypothetical protein
3055 CALUCG010000042.1 GCA943914495_01524 CDS open 12157-12630 _na     157_aa hypothetical protein
3056 CALUCG010000042.1 GCA943914495_01525 CDS open 12875-13435 _na     186_aa hypothetical protein
3057 CALUCG010000042.1 GCA943914495_01526 CDS open 13552-13791 _na     79_aa hypothetical protein
3058 CALUCG010000042.1 GCA943914495_01511 gene open 636-1814
3059 CALUCG010000042.1 GCA943914495_01512 gene open 1829-2812 xerA
3060 CALUCG010000042.1 GCA943914495_01513 gene open 2896-3573
3061 CALUCG010000042.1 GCA943914495_01514 gene open 3570-4130
3062 CALUCG010000042.1 GCA943914495_01515 gene open 4120-5652 hsdM
3063 CALUCG010000042.1 GCA943914495_01516 gene open 5656-5883
3064 CALUCG010000042.1 GCA943914495_01517 gene open 5950-7488 guaA
3065 CALUCG010000042.1 GCA943914495_01518 gene open 7659-8210
3066 CALUCG010000042.1 GCA943914495_01519 gene open 8342-9271
3067 CALUCG010000042.1 GCA943914495_01520 gene open 9429-10235
3068 CALUCG010000042.1 GCA943914495_01521 gene open 10394-11212
3069 CALUCG010000042.1 GCA943914495_01522 gene open 11291-11422
3070 CALUCG010000042.1 GCA943914495_01523 gene open 11552-12013
3071 CALUCG010000042.1 GCA943914495_01524 gene open 12157-12630
3072 CALUCG010000042.1 GCA943914495_01525 gene open 12875-13435
3073 CALUCG010000042.1 GCA943914495_01526 gene open 13552-13791
3074 CALUCG010000043.1 GCA943914495_01527 CDS open 60-299 _na     79_aa hypothetical protein
3075 CALUCG010000043.1 GCA943914495_01528 CDS open 343-1071 _na     242_aa putative membrane transporter protein
3076 CALUCG010000043.1 GCA943914495_01529 CDS open 1471-3363 _na     630_aa TonB-dependent receptor
3077 CALUCG010000043.1 GCA943914495_01530 CDS open 3527-4777 _na     416_aa matC Dicarboxylate carrier MatC N-terminal domain-containing protein
3078 CALUCG010000043.1 GCA943914495_01531 CDS open 4768-4866 _na     32_aa hypothetical protein
3079 CALUCG010000043.1 GCA943914495_01532 CDS open 5209-6489 _na     426_aa uraA uracil permease
3080 CALUCG010000043.1 GCA943914495_01533 CDS open 6499-6684 _na     61_aa hypothetical protein
3081 CALUCG010000043.1 GCA943914495_01534 CDS open 6648-6755 _na     35_aa hypothetical protein
3082 CALUCG010000043.1 GCA943914495_01535 CDS open 6777-8027 _na     416_aa SGNH hydrolase-type esterase domain-containing protein
3083 CALUCG010000043.1 GCA943914495_01536 CDS open 7990-8934 _na     314_aa AP endonuclease%2C family 2
3084 CALUCG010000043.1 GCA943914495_01537 CDS open 8958-9107 _na     49_aa hypothetical protein
3085 CALUCG010000043.1 GCA943914495_01538 CDS open 9117-10118 _na     333_aa Periplasmic binding protein
3086 CALUCG010000043.1 GCA943914495_01539 CDS open 10287-10751 _na     154_aa hypothetical protein
3087 CALUCG010000043.1 GCA943914495_01540 CDS open 10753-12102 _na     449_aa CBS domain protein
3088 CALUCG010000043.1 GCA943914495_01541 CDS open 12286-12876 _na     196_aa HTH tetR-type domain-containing protein
3089 CALUCG010000043.1 GCA943914495_01527 gene open 60-299
3090 CALUCG010000043.1 GCA943914495_01528 gene open 343-1071
3091 CALUCG010000043.1 GCA943914495_01529 gene open 1471-3363
3092 CALUCG010000043.1 GCA943914495_01530 gene open 3527-4777 matC
3093 CALUCG010000043.1 GCA943914495_01531 gene open 4768-4866
3094 CALUCG010000043.1 GCA943914495_01532 gene open 5209-6489 uraA
3095 CALUCG010000043.1 GCA943914495_01533 gene open 6499-6684
3096 CALUCG010000043.1 GCA943914495_01534 gene open 6648-6755
3097 CALUCG010000043.1 GCA943914495_01535 gene open 6777-8027
3098 CALUCG010000043.1 GCA943914495_01536 gene open 7990-8934
3099 CALUCG010000043.1 GCA943914495_01537 gene open 8958-9107
3100 CALUCG010000043.1 GCA943914495_01538 gene open 9117-10118
3101 CALUCG010000043.1 GCA943914495_01539 gene open 10287-10751
3102 CALUCG010000043.1 GCA943914495_01540 gene open 10753-12102
3103 CALUCG010000043.1 GCA943914495_01541 gene open 12286-12876
3104 CALUCG010000044.1 GCA943914495_01542 CDS open 1198-1563 _na     121_aa Metal-dependent transcriptional regulator
3105 CALUCG010000044.1 GCA943914495_01543 CDS open 1579-1842 _na     87_aa ATP-binding cassette domain-containing protein
3106 CALUCG010000044.1 GCA943914495_01544 CDS open 1991-3721 _na     576_aa msbA Lipid A export ATP-binding/permease protein MsbA
3107 CALUCG010000044.1 GCA943914495_01545 CDS open 3718-5472 _na     584_aa ABC-type multidrug transport system%2C ATPase and permease components
3108 CALUCG010000044.1 GCA943914495_01546 CDS open 5474-6844 _na     456_aa mepA Multidrug export protein MepA
3109 CALUCG010000044.1 GCA943914495_01547 CDS open 6951-7892 _na     313_aa HTH araC/xylS-type domain-containing protein
3110 CALUCG010000044.1 GCA943914495_01548 CDS open 7927-9390 _na     487_aa energy-coupling factor transporter ATPase
3111 CALUCG010000044.1 GCA943914495_01549 CDS open 9387-10121 _na     244_aa Transporter
3112 CALUCG010000044.1 GCA943914495_01550 CDS open 10122-10712 _na     196_aa Trep-Strep domain-containing protein
3113 CALUCG010000044.1 GCA943914495_01551 CDS open 11187-11399 _na     70_aa hypothetical protein
3114 CALUCG010000044.1 GCA943914495_01552 CDS open 11836-12696 _na     286_aa LPD25 domain-containing protein
3115 CALUCG010000044.1 GCA943914495_01542 gene open 1198-1563
3116 CALUCG010000044.1 GCA943914495_01543 gene open 1579-1842
3117 CALUCG010000044.1 GCA943914495_01544 gene open 1991-3721 msbA
3118 CALUCG010000044.1 GCA943914495_01545 gene open 3718-5472
3119 CALUCG010000044.1 GCA943914495_01546 gene open 5474-6844 mepA
3120 CALUCG010000044.1 GCA943914495_01547 gene open 6951-7892
3121 CALUCG010000044.1 GCA943914495_01548 gene open 7927-9390
3122 CALUCG010000044.1 GCA943914495_01549 gene open 9387-10121
3123 CALUCG010000044.1 GCA943914495_01550 gene open 10122-10712
3124 CALUCG010000044.1 GCA943914495_01551 gene open 11187-11399
3125 CALUCG010000044.1 GCA943914495_01552 gene open 11836-12696
3126 CALUCG010000045.1 GCA943914495_01553 CDS open 850-5427 _na     1525_aa S-layer-like y domain-containing protein
3127 CALUCG010000045.1 GCA943914495_01554 CDS open 5611-11013 _na     1800_aa ESPR-type extended signal peptide-containing protein
3128 CALUCG010000045.1 GCA943914495_01553 gene open 850-5427
3129 CALUCG010000045.1 GCA943914495_01554 gene open 5611-11013
3130 CALUCG010000046.1 GCA943914495_01555 CDS open 214-969 _na     251_aa rpsB 30S ribosomal protein S2
3131 CALUCG010000046.1 GCA943914495_01556 CDS open 1018-1893 _na     291_aa tsf translation elongation factor Ts
3132 CALUCG010000046.1 GCA943914495_01557 CDS open 1994-2722 _na     242_aa pyrH UMP kinase
3133 CALUCG010000046.1 GCA943914495_01558 CDS open 2724-3281 _na     185_aa frr ribosome recycling factor
3134 CALUCG010000046.1 GCA943914495_01559 CDS open 3278-3520 _na     80_aa hypothetical protein
3135 CALUCG010000046.1 GCA943914495_01560 CDS open 3513-4235 _na     240_aa isoprenyl transferase
3136 CALUCG010000046.1 GCA943914495_01561 CDS open 4232-5050 _na     272_aa Phosphatidate cytidylyltransferase
3137 CALUCG010000046.1 GCA943914495_01562 CDS open 5051-6214 _na     387_aa 1-deoxy-D-xylulose-5-phosphate reductoisomerase
3138 CALUCG010000046.1 GCA943914495_01563 CDS open 6208-7230 _na     340_aa rseP RIP metalloprotease RseP
3139 CALUCG010000046.1 GCA943914495_01564 CDS open 7240-8295 _na     351_aa ispG flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase
3140 CALUCG010000046.1 GCA943914495_01565 CDS open 8298-10022 _na     574_aa proline--tRNA ligase
3141 CALUCG010000046.1 GCA943914495_01566 CDS open 10038-10325 _na     95_aa Chorismate mutase domain-containing protein
3142 CALUCG010000046.1 GCA943914495_01555 gene open 214-969 rpsB
3143 CALUCG010000046.1 GCA943914495_01556 gene open 1018-1893 tsf
3144 CALUCG010000046.1 GCA943914495_01557 gene open 1994-2722 pyrH
3145 CALUCG010000046.1 GCA943914495_01558 gene open 2724-3281 frr
3146 CALUCG010000046.1 GCA943914495_01559 gene open 3278-3520
3147 CALUCG010000046.1 GCA943914495_01560 gene open 3513-4235
3148 CALUCG010000046.1 GCA943914495_01561 gene open 4232-5050
3149 CALUCG010000046.1 GCA943914495_01562 gene open 5051-6214
3150 CALUCG010000046.1 GCA943914495_01563 gene open 6208-7230 rseP
3151 CALUCG010000046.1 GCA943914495_01564 gene open 7240-8295 ispG
3152 CALUCG010000046.1 GCA943914495_01565 gene open 8298-10022
3153 CALUCG010000046.1 GCA943914495_01566 gene open 10038-10325
3154 CALUCG010000047.1 GCA943914495_01567 CDS open 162-1517 _na     451_aa Transporter
3155 CALUCG010000047.1 GCA943914495_01568 CDS open 1568-2926 _na     452_aa Transporter
3156 CALUCG010000047.1 GCA943914495_01569 CDS open 3033-4283 _na     416_aa Tat pathway signal sequence domain protein
3157 CALUCG010000047.1 GCA943914495_01570 CDS open 4437-5693 _na     418_aa Glutamate dehydrogenase
3158 CALUCG010000047.1 GCA943914495_01571 CDS open 5741-5869 _na     42_aa hypothetical protein
3159 CALUCG010000047.1 GCA943914495_01572 CDS open 5953-7320 _na     455_aa DUF2207 domain-containing protein
3160 CALUCG010000047.1 GCA943914495_01573 CDS open 7496-7942 _na     148_aa hypothetical protein
3161 CALUCG010000047.1 GCA943914495_01574 CDS open 8725-9276 _na     183_aa hypothetical protein
3162 CALUCG010000047.1 GCA943914495_01575 CDS open 9999-10763 _na     254_aa hypothetical protein
3163 CALUCG010000047.1 GCA943914495_01576 CDS open 11133-11429 _na     98_aa hypothetical protein
3164 CALUCG010000047.1 GCA943914495_01567 gene open 162-1517
3165 CALUCG010000047.1 GCA943914495_01568 gene open 1568-2926
3166 CALUCG010000047.1 GCA943914495_01569 gene open 3033-4283
3167 CALUCG010000047.1 GCA943914495_01570 gene open 4437-5693
3168 CALUCG010000047.1 GCA943914495_01571 gene open 5741-5869
3169 CALUCG010000047.1 GCA943914495_01572 gene open 5953-7320
3170 CALUCG010000047.1 GCA943914495_01573 gene open 7496-7942
3171 CALUCG010000047.1 GCA943914495_01574 gene open 8725-9276
3172 CALUCG010000047.1 GCA943914495_01575 gene open 9999-10763
3173 CALUCG010000047.1 GCA943914495_01576 gene open 11133-11429
3174 CALUCG010000048.1 GCA943914495_01577 CDS open 186-452 _na     88_aa hypothetical protein
3175 CALUCG010000048.1 GCA943914495_01578 CDS open 497-715 _na     72_aa hypothetical protein
3176 CALUCG010000048.1 GCA943914495_01579 CDS open 926-1345 _na     139_aa Replication initiator protein A domain protein
3177 CALUCG010000048.1 GCA943914495_01580 CDS open 1347-1637 _na     96_aa Helix-turn-helix type 11 domain-containing protein
3178 CALUCG010000048.1 GCA943914495_01581 CDS open 1634-1822 _na     62_aa Helix-turn-helix domain-containing protein
3179 CALUCG010000048.1 GCA943914495_01582 CDS open 2052-2843 _na     263_aa HTH cro/C1-type domain-containing protein
3180 CALUCG010000048.1 GCA943914495_01583 CDS open 2953-3492 _na     179_aa Hydrolase%2C NUDIX family
3181 CALUCG010000048.1 GCA943914495_01584 CDS open 3492-3941 _na     149_aa dUTP diphosphatase
3182 CALUCG010000048.1 GCA943914495_01585 CDS open 3942-6026 _na     694_aa polyribonucleotide nucleotidyltransferase
3183 CALUCG010000048.1 GCA943914495_01586 CDS open 6196-6465 _na     89_aa rpsO 30S ribosomal protein S15
3184 CALUCG010000048.1 GCA943914495_01587 CDS open 6582-7370 _na     262_aa ABC transporter%2C ATP-binding protein
3185 CALUCG010000048.1 GCA943914495_01588 CDS open 7373-8215 _na     280_aa Branched-chain amino acid ABC transporter%2C permease protein
3186 CALUCG010000048.1 GCA943914495_01589 CDS open 8277-9284 _na     335_aa ABC transporter substrate-binding protein
3187 CALUCG010000048.1 GCA943914495_01590 CDS open 9335-10327 _na     330_aa ABC transporter substrate binding protein
3188 CALUCG010000048.1 GCA943914495_01591 CDS open 10495-10680 _na     61_aa rpmF 50S ribosomal protein L32
3189 CALUCG010000048.1 GCA943914495_01577 gene open 186-452
3190 CALUCG010000048.1 GCA943914495_01578 gene open 497-715
3191 CALUCG010000048.1 GCA943914495_01579 gene open 926-1345
3192 CALUCG010000048.1 GCA943914495_01580 gene open 1347-1637
3193 CALUCG010000048.1 GCA943914495_01581 gene open 1634-1822
3194 CALUCG010000048.1 GCA943914495_01582 gene open 2052-2843
3195 CALUCG010000048.1 GCA943914495_01583 gene open 2953-3492
3196 CALUCG010000048.1 GCA943914495_01584 gene open 3492-3941
3197 CALUCG010000048.1 GCA943914495_01585 gene open 3942-6026
3198 CALUCG010000048.1 GCA943914495_01586 gene open 6196-6465 rpsO
3199 CALUCG010000048.1 GCA943914495_01587 gene open 6582-7370
3200 CALUCG010000048.1 GCA943914495_01588 gene open 7373-8215
3201 CALUCG010000048.1 GCA943914495_01589 gene open 8277-9284
3202 CALUCG010000048.1 GCA943914495_01590 gene open 9335-10327
3203 CALUCG010000048.1 GCA943914495_01591 gene open 10495-10680 rpmF
3204 CALUCG010000049.1 GCA943914495_01592 CDS open 266-4057 _na     1263_aa rpoB DNA-directed RNA polymerase subunit beta
3205 CALUCG010000049.1 GCA943914495_01593 CDS open 4082-8089 _na     1335_aa rpoC DNA-directed RNA polymerase subunit beta'
3206 CALUCG010000049.1 GCA943914495_01594 CDS open 8223-9002 _na     259_aa pdaC Deacetylase PdaC domain-containing protein
3207 CALUCG010000049.1 GCA943914495_01595 CDS open 8999-9733 _na     244_aa Chalcone isomerase domain-containing protein
3208 CALUCG010000049.1 GCA943914495_01596 CDS open 9977-10216 _na     79_aa POTRA domain-containing protein
3209 CALUCG010000049.1 GCA943914495_01592 gene open 266-4057 rpoB
3210 CALUCG010000049.1 GCA943914495_01593 gene open 4082-8089 rpoC
3211 CALUCG010000049.1 GCA943914495_01594 gene open 8223-9002 pdaC
3212 CALUCG010000049.1 GCA943914495_01595 gene open 8999-9733
3213 CALUCG010000049.1 GCA943914495_01596 gene open 9977-10216
3214 CALUCG010000050.1 GCA943914495_01597 CDS open 197-673 _na     158_aa hypothetical protein
3215 CALUCG010000050.1 GCA943914495_01598 CDS open 676-1209 _na     177_aa N-acetylmuramoyl-L-alanine amidase
3216 CALUCG010000050.1 GCA943914495_01599 CDS open 1190-1525 _na     111_aa hypothetical protein
3217 CALUCG010000050.1 GCA943914495_01600 CDS open 1526-1759 _na     77_aa peptidase
3218 CALUCG010000050.1 GCA943914495_01601 CDS open 1759-1884 _na     41_aa hypothetical protein
3219 CALUCG010000050.1 GCA943914495_01602 CDS open 2064-2330 _na     88_aa hypothetical protein
3220 CALUCG010000050.1 GCA943914495_01603 CDS open 2370-3299 _na     309_aa phage tail protein
3221 CALUCG010000050.1 GCA943914495_01604 CDS open 3303-3950 _na     215_aa putative phage tail protein
3222 CALUCG010000050.1 GCA943914495_01605 CDS open 3943-5040 _na     365_aa baseplate J/gp47 family protein
3223 CALUCG010000050.1 GCA943914495_01606 CDS open 5033-5455 _na     140_aa DUF2634 domain-containing protein
3224 CALUCG010000050.1 GCA943914495_01607 CDS open 5460-5867 _na     135_aa DUF2577 domain-containing protein
3225 CALUCG010000050.1 GCA943914495_01608 CDS open 5857-6855 _na     332_aa Hydrolase
3226 CALUCG010000050.1 GCA943914495_01609 CDS open 6848-7588 _na     246_aa hypothetical protein
3227 CALUCG010000050.1 GCA943914495_01610 CDS open 7585-9603 _na     672_aa tape measure protein
3228 CALUCG010000050.1 GCA943914495_01611 CDS open 9618-9764 _na     48_aa hypothetical protein
3229 CALUCG010000050.1 GCA943914495_01612 CDS open 9788-10222 _na     144_aa Phage portal protein
3230 CALUCG010000050.1 GCA943914495_01597 gene open 197-673
3231 CALUCG010000050.1 GCA943914495_01598 gene open 676-1209
3232 CALUCG010000050.1 GCA943914495_01599 gene open 1190-1525
3233 CALUCG010000050.1 GCA943914495_01600 gene open 1526-1759
3234 CALUCG010000050.1 GCA943914495_01601 gene open 1759-1884
3235 CALUCG010000050.1 GCA943914495_01602 gene open 2064-2330
3236 CALUCG010000050.1 GCA943914495_01603 gene open 2370-3299
3237 CALUCG010000050.1 GCA943914495_01604 gene open 3303-3950
3238 CALUCG010000050.1 GCA943914495_01605 gene open 3943-5040
3239 CALUCG010000050.1 GCA943914495_01606 gene open 5033-5455
3240 CALUCG010000050.1 GCA943914495_01607 gene open 5460-5867
3241 CALUCG010000050.1 GCA943914495_01608 gene open 5857-6855
3242 CALUCG010000050.1 GCA943914495_01609 gene open 6848-7588
3243 CALUCG010000050.1 GCA943914495_01610 gene open 7585-9603
3244 CALUCG010000050.1 GCA943914495_01611 gene open 9618-9764
3245 CALUCG010000050.1 GCA943914495_01612 gene open 9788-10222
3246 CALUCG010000051.1 GCA943914495_01613 CDS open 929-1174 _na     81_aa GIY-YIG catalytic domain protein
3247 CALUCG010000051.1 GCA943914495_01614 CDS open 1183-1794 _na     203_aa DUF2232 domain-containing protein
3248 CALUCG010000051.1 GCA943914495_01615 CDS open 1800-2816 _na     338_aa Glycosyltransferase 2-like domain-containing protein
3249 CALUCG010000051.1 GCA943914495_01616 CDS open 2838-4058 _na     406_aa O-antigen ligase-related domain-containing protein
3250 CALUCG010000051.1 GCA943914495_01617 CDS open 4128-5960 _na     610_aa Sulfatase N-terminal domain-containing protein
3251 CALUCG010000051.1 GCA943914495_01618 CDS open 6001-6981 _na     326_aa Heptosyltransferase
3252 CALUCG010000051.1 GCA943914495_01619 CDS open 7046-7855 _na     269_aa Chitin deacetylase
3253 CALUCG010000051.1 GCA943914495_01620 CDS open 7856-8902 _na     348_aa Glycosyltransferase family 4 protein
3254 CALUCG010000051.1 GCA943914495_01621 CDS open 9209-10102 _na     297_aa Oxidoreductase%2C aldo/keto reductase family protein
3255 CALUCG010000051.1 GCA943914495_01613 gene open 929-1174
3256 CALUCG010000051.1 GCA943914495_01614 gene open 1183-1794
3257 CALUCG010000051.1 GCA943914495_01615 gene open 1800-2816
3258 CALUCG010000051.1 GCA943914495_01616 gene open 2838-4058
3259 CALUCG010000051.1 GCA943914495_01617 gene open 4128-5960
3260 CALUCG010000051.1 GCA943914495_01618 gene open 6001-6981
3261 CALUCG010000051.1 GCA943914495_01619 gene open 7046-7855
3262 CALUCG010000051.1 GCA943914495_01620 gene open 7856-8902
3263 CALUCG010000051.1 GCA943914495_01621 gene open 9209-10102
3264 CALUCG010000052.1 GCA943914495_01622 CDS open 118-756 _na     212_aa CpXC domain-containing protein
3265 CALUCG010000052.1 GCA943914495_01623 CDS open 766-1176 _na     136_aa CpXC domain-containing protein
3266 CALUCG010000052.1 GCA943914495_01624 CDS open 1201-1425 _na     74_aa hypothetical protein
3267 CALUCG010000052.1 GCA943914495_01625 CDS open 1568-2110 _na     180_aa Nitroreductase family protein
3268 CALUCG010000052.1 GCA943914495_01626 CDS open 2242-3312 _na     356_aa Alanine racemase domain protein
3269 CALUCG010000052.1 GCA943914495_01627 CDS open 3375-4778 _na     467_aa Amino acid carrier protein
3270 CALUCG010000052.1 GCA943914495_01628 CDS open 5040-5684 _na     214_aa yigZ YigZ family protein
3271 CALUCG010000052.1 GCA943914495_01629 CDS open 5762-6820 _na     352_aa Sel1 repeat protein
3272 CALUCG010000052.1 GCA943914495_01630 CDS open 6971-7837 _na     288_aa 2-oxoglutarate ferredoxin oxidoreductase subunit beta
3273 CALUCG010000052.1 GCA943914495_01631 CDS open 7840-9585 _na     581_aa 2-oxoacid:acceptor oxidoreductase%2C alpha subunit
3274 CALUCG010000052.1 GCA943914495_01622 gene open 118-756
3275 CALUCG010000052.1 GCA943914495_01623 gene open 766-1176
3276 CALUCG010000052.1 GCA943914495_01624 gene open 1201-1425
3277 CALUCG010000052.1 GCA943914495_01625 gene open 1568-2110
3278 CALUCG010000052.1 GCA943914495_01626 gene open 2242-3312
3279 CALUCG010000052.1 GCA943914495_01627 gene open 3375-4778
3280 CALUCG010000052.1 GCA943914495_01628 gene open 5040-5684 yigZ
3281 CALUCG010000052.1 GCA943914495_01629 gene open 5762-6820
3282 CALUCG010000052.1 GCA943914495_01630 gene open 6971-7837
3283 CALUCG010000052.1 GCA943914495_01631 gene open 7840-9585
3284 CALUCG010000053.1 GCA943914495_01632 CDS open 380-946 _na     188_aa Flavin reductase like domain-containing protein
3285 CALUCG010000053.1 GCA943914495_01633 CDS open 1009-2157 _na     382_aa HAD family hydrolase
3286 CALUCG010000053.1 GCA943914495_01634 CDS open 2282-3055 _na     257_aa DUF4422 domain-containing protein
3287 CALUCG010000053.1 GCA943914495_01635 CDS open 3057-4175 _na     372_aa glf UDP-galactopyranose mutase
3288 CALUCG010000053.1 GCA943914495_01636 CDS open 4285-5439 _na     384_aa glf UDP-galactopyranose mutase
3289 CALUCG010000053.1 GCA943914495_01637 CDS open 5427-6014 _na     195_aa rfbC dTDP-4-dehydrorhamnose 3%2C5-epimerase
3290 CALUCG010000053.1 GCA943914495_01638 CDS open 5998-6927 _na     309_aa NAD-dependent epimerase/dehydratase family protein
3291 CALUCG010000053.1 GCA943914495_01639 CDS open 6924-7991 _na     355_aa rfbG CDP-glucose 4%2C6-dehydratase
3292 CALUCG010000053.1 GCA943914495_01640 CDS open 7991-8767 _na     258_aa rfbF glucose-1-phosphate cytidylyltransferase
3293 CALUCG010000053.1 GCA943914495_01641 CDS open 8792-9769 _na     325_aa DUF4422 domain-containing protein
3294 CALUCG010000053.1 GCA943914495_01632 gene open 380-946
3295 CALUCG010000053.1 GCA943914495_01633 gene open 1009-2157
3296 CALUCG010000053.1 GCA943914495_01634 gene open 2282-3055
3297 CALUCG010000053.1 GCA943914495_01635 gene open 3057-4175 glf
3298 CALUCG010000053.1 GCA943914495_01636 gene open 4285-5439 glf
3299 CALUCG010000053.1 GCA943914495_01637 gene open 5427-6014 rfbC
3300 CALUCG010000053.1 GCA943914495_01638 gene open 5998-6927
3301 CALUCG010000053.1 GCA943914495_01639 gene open 6924-7991 rfbG
3302 CALUCG010000053.1 GCA943914495_01640 gene open 7991-8767 rfbF
3303 CALUCG010000053.1 GCA943914495_01641 gene open 8792-9769
3304 CALUCG010000054.1 GCA943914495_01642 CDS open 62-310 _na     82_aa Prepilin-type cleavage/methylation N-terminal domain protein
3305 CALUCG010000054.1 GCA943914495_01643 CDS open 307-849 _na     180_aa Prepilin-type cleavage/methylation domain-containing protein
3306 CALUCG010000054.1 GCA943914495_01644 CDS open 849-1259 _na     136_aa hypothetical protein
3307 CALUCG010000054.1 GCA943914495_01645 CDS open 1256-2716 _na     486_aa Fimbrial assembly protein
3308 CALUCG010000054.1 GCA943914495_01646 CDS open 2713-3267 _na     184_aa pilN Fimbrial assembly protein PilN
3309 CALUCG010000054.1 GCA943914495_01647 CDS open 3218-3724 _na     168_aa Shikimate kinase
3310 CALUCG010000054.1 GCA943914495_01648 CDS open 3792-4154 _na     120_aa S23 ribosomal protein
3311 CALUCG010000054.1 GCA943914495_01649 CDS open 4243-5238 _na     331_aa ATP-dependent 6-phosphofructokinase
3312 CALUCG010000054.1 GCA943914495_01650 CDS open 5654-5764 _na     36_aa hypothetical protein
3313 CALUCG010000054.1 GCA943914495_01651 CDS open 5968-7425 _na     485_aa wbaP Undecaprenyl-phosphate galactose phosphotransferase%2C WbaP
3314 CALUCG010000054.1 GCA943914495_01652 CDS open 7482-8324 _na     280_aa Transport permease protein
3315 CALUCG010000054.1 GCA943914495_01653 CDS open 8321-9055 _na     244_aa ABC transporter ATP-binding protein
3316 CALUCG010000054.1 GCA943914495_01642 gene open 62-310
3317 CALUCG010000054.1 GCA943914495_01643 gene open 307-849
3318 CALUCG010000054.1 GCA943914495_01644 gene open 849-1259
3319 CALUCG010000054.1 GCA943914495_01645 gene open 1256-2716
3320 CALUCG010000054.1 GCA943914495_01646 gene open 2713-3267 pilN
3321 CALUCG010000054.1 GCA943914495_01647 gene open 3218-3724
3322 CALUCG010000054.1 GCA943914495_01648 gene open 3792-4154
3323 CALUCG010000054.1 GCA943914495_01649 gene open 4243-5238
3324 CALUCG010000054.1 GCA943914495_01650 gene open 5654-5764
3325 CALUCG010000054.1 GCA943914495_01651 gene open 5968-7425 wbaP
3326 CALUCG010000054.1 GCA943914495_01652 gene open 7482-8324
3327 CALUCG010000054.1 GCA943914495_01653 gene open 8321-9055
3328 CALUCG010000055.1 GCA943914495_01654 CDS open 70-471 _na     133_aa hypothetical protein
3329 CALUCG010000055.1 GCA943914495_01655 CDS open 584-1690 _na     368_aa PIN domain protein
3330 CALUCG010000055.1 GCA943914495_01656 CDS open 1680-2858 _na     392_aa Bifunctional enzyme IspD/IspF
3331 CALUCG010000055.1 GCA943914495_01657 CDS open 2851-4311 _na     486_aa gltX glutamate--tRNA ligase
3332 CALUCG010000055.1 GCA943914495_01658 CDS open 4532-5170 _na     212_aa ABC transporter%2C permease protein
3333 CALUCG010000055.1 GCA943914495_01659 CDS open 5173-5910 _na     245_aa ABC transporter%2C ATP-binding protein
3334 CALUCG010000055.1 GCA943914495_01660 CDS open 6011-6211 _na     66_aa Cold-shock DNA-binding domain protein
3335 CALUCG010000055.1 GCA943914495_01661 CDS open 6521-7054 _na     177_aa hpf ribosome hibernation-promoting factor%2C HPF/YfiA family
3336 CALUCG010000055.1 GCA943914495_01654 gene open 70-471
3337 CALUCG010000055.1 GCA943914495_01655 gene open 584-1690
3338 CALUCG010000055.1 GCA943914495_01656 gene open 1680-2858
3339 CALUCG010000055.1 GCA943914495_01657 gene open 2851-4311 gltX
3340 CALUCG010000055.1 GCA943914495_01658 gene open 4532-5170
3341 CALUCG010000055.1 GCA943914495_01659 gene open 5173-5910
3342 CALUCG010000055.1 GCA943914495_01660 gene open 6011-6211
3343 CALUCG010000055.1 GCA943914495_01661 gene open 6521-7054 hpf
3344 CALUCG010000056.1 GCA943914495_01662 CDS open 143-655 _na     170_aa 4-hydroxy-tetrahydrodipicolinate reductase
3345 CALUCG010000056.1 GCA943914495_01663 CDS open 666-1700 _na     344_aa aspartate-semialdehyde dehydrogenase
3346 CALUCG010000056.1 GCA943914495_01664 CDS open 1741-2649 _na     302_aa dapA 4-hydroxy-tetrahydrodipicolinate synthase
3347 CALUCG010000056.1 GCA943914495_01665 CDS open 2744-4465 _na     573_aa Fibronectin-binding protein A domain protein
3348 CALUCG010000056.1 GCA943914495_01666 CDS open 4606-5433 _na     275_aa dapF diaminopimelate epimerase
3349 CALUCG010000056.1 GCA943914495_01667 CDS open 5458-6348 _na     296_aa TIGR00255 family protein
3350 CALUCG010000056.1 GCA943914495_01668 CDS open 6359-6634 _na     91_aa remA extracellular matrix/biofilm regulator RemA
3351 CALUCG010000056.1 GCA943914495_01669 CDS open 6641-7282 _na     213_aa gmk guanylate kinase
3352 CALUCG010000056.1 GCA943914495_01670 CDS open 7279-7479 _na     66_aa rpoZ DNA-directed RNA polymerase subunit omega
3353 CALUCG010000056.1 GCA943914495_01671 CDS open 7530-8729 _na     399_aa coaBC bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC
3354 CALUCG010000056.1 GCA943914495_01662 gene open 143-655
3355 CALUCG010000056.1 GCA943914495_01663 gene open 666-1700
3356 CALUCG010000056.1 GCA943914495_01664 gene open 1741-2649 dapA
3357 CALUCG010000056.1 GCA943914495_01665 gene open 2744-4465
3358 CALUCG010000056.1 GCA943914495_01666 gene open 4606-5433 dapF
3359 CALUCG010000056.1 GCA943914495_01667 gene open 5458-6348
3360 CALUCG010000056.1 GCA943914495_01668 gene open 6359-6634 remA
3361 CALUCG010000056.1 GCA943914495_01669 gene open 6641-7282 gmk
3362 CALUCG010000056.1 GCA943914495_01670 gene open 7279-7479 rpoZ
3363 CALUCG010000056.1 GCA943914495_01671 gene open 7530-8729 coaBC
3364 CALUCG010000057.1 GCA943914495_01672 CDS open 46-939 _na     297_aa murG undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase
3365 CALUCG010000057.1 GCA943914495_01673 CDS open 939-2345 _na     468_aa murC UDP-N-acetylmuramate--L-alanine ligase
3366 CALUCG010000057.1 GCA943914495_01674 CDS open 2362-3264 _na     300_aa D-alanine--D-alanine ligase
3367 CALUCG010000057.1 GCA943914495_01675 CDS open 3289-4155 _na     288_aa FtsQ-type POTRA domain-containing protein
3368 CALUCG010000057.1 GCA943914495_01676 CDS open 4231-5313 _na     360_aa ftsZ cell division protein FtsZ
3369 CALUCG010000057.1 GCA943914495_01677 CDS open 5369-5860 _na     163_aa nrdR transcriptional regulator NrdR
3370 CALUCG010000057.1 GCA943914495_01678 CDS open 5817-6422 _na     201_aa gmhA D-sedoheptulose 7-phosphate isomerase
3371 CALUCG010000057.1 GCA943914495_01679 CDS open 6425-6940 _na     171_aa D%2CD-heptose 1%2C7-bisphosphate phosphatase
3372 CALUCG010000057.1 GCA943914495_01680 CDS open 6949-7938 _na     329_aa Putative lipopolysaccharide heptosyltransferase I
3373 CALUCG010000057.1 GCA943914495_01681 CDS open 8605-8763 _na     52_aa hypothetical protein
3374 CALUCG010000057.1 GCA943914495_01672 gene open 46-939 murG
3375 CALUCG010000057.1 GCA943914495_01673 gene open 939-2345 murC
3376 CALUCG010000057.1 GCA943914495_01674 gene open 2362-3264
3377 CALUCG010000057.1 GCA943914495_01675 gene open 3289-4155
3378 CALUCG010000057.1 GCA943914495_01676 gene open 4231-5313 ftsZ
3379 CALUCG010000057.1 GCA943914495_01677 gene open 5369-5860 nrdR
3380 CALUCG010000057.1 GCA943914495_01678 gene open 5817-6422 gmhA
3381 CALUCG010000057.1 GCA943914495_01679 gene open 6425-6940
3382 CALUCG010000057.1 GCA943914495_01680 gene open 6949-7938
3383 CALUCG010000057.1 GCA943914495_01681 gene open 8605-8763
3384 CALUCG010000058.1 GCA943914495_01682 CDS open 3-425 _na     140_aa DNA-damage-inducible protein D family protein
3385 CALUCG010000058.1 GCA943914495_01683 CDS open 554-1363 _na     269_aa ResB-like domain-containing protein
3386 CALUCG010000058.1 GCA943914495_01684 CDS open 1450-1836 _na     128_aa DUF304 domain-containing protein
3387 CALUCG010000058.1 GCA943914495_01685 CDS open 1899-2252 _na     117_aa Bacteriocin immunity protein
3388 CALUCG010000058.1 GCA943914495_01686 CDS open 2382-2903 _na     173_aa SMI1/KNR4 family protein
3389 CALUCG010000058.1 GCA943914495_01687 CDS open 2919-3302 _na     127_aa hypothetical protein
3390 CALUCG010000058.1 GCA943914495_01688 CDS open 3509-4858 _na     449_aa Pyridine nucleotide-disulfide oxidoreductase
3391 CALUCG010000058.1 GCA943914495_01689 CDS open 4957-5193 _na     78_aa hypothetical protein
3392 CALUCG010000058.1 GCA943914495_01690 CDS open 5485-6201 _na     238_aa azlC Putative azaleucine resistance protein AzlC
3393 CALUCG010000058.1 GCA943914495_01691 CDS open 6198-6530 _na     110_aa azlD Branched-chain amino acid transport protein AzlD
3394 CALUCG010000058.1 GCA943914495_01692 CDS open 6718-7509 _na     263_aa HEAT repeat protein
3395 CALUCG010000058.1 GCA943914495_01693 CDS open 7648-7926 _na     92_aa hypothetical protein
3396 CALUCG010000058.1 GCA943914495_01682 gene open 3-425
3397 CALUCG010000058.1 GCA943914495_01683 gene open 554-1363
3398 CALUCG010000058.1 GCA943914495_01684 gene open 1450-1836
3399 CALUCG010000058.1 GCA943914495_01685 gene open 1899-2252
3400 CALUCG010000058.1 GCA943914495_01686 gene open 2382-2903
3401 CALUCG010000058.1 GCA943914495_01687 gene open 2919-3302
3402 CALUCG010000058.1 GCA943914495_01688 gene open 3509-4858
3403 CALUCG010000058.1 GCA943914495_01689 gene open 4957-5193
3404 CALUCG010000058.1 GCA943914495_01690 gene open 5485-6201 azlC
3405 CALUCG010000058.1 GCA943914495_01691 gene open 6198-6530 azlD
3406 CALUCG010000058.1 GCA943914495_01692 gene open 6718-7509
3407 CALUCG010000058.1 GCA943914495_01693 gene open 7648-7926
3408 CALUCG010000059.1 GCA943914495_01694 CDS open 6-236 _na     76_aa gabR HTH-type transcriptional regulatory protein GabR
3409 CALUCG010000059.1 GCA943914495_01695 CDS open 314-1141 _na     275_aa lpxA acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase
3410 CALUCG010000059.1 GCA943914495_01696 CDS open 1388-1912 _na     174_aa Acid-resistance membrane protein
3411 CALUCG010000059.1 GCA943914495_01697 CDS open 2032-2517 _na     161_aa fabZ 3-hydroxyacyl-ACP dehydratase FabZ
3412 CALUCG010000059.1 GCA943914495_01698 CDS open 2528-3271 _na     247_aa lpxC UDP-3-O-acyl-N-acetylglucosamine deacetylase
3413 CALUCG010000059.1 GCA943914495_01699 CDS open 3532-4338 _na     268_aa larE ATP-dependent sacrificial sulfur transferase LarE
3414 CALUCG010000059.1 GCA943914495_01700 CDS open 4340-5110 _na     256_aa larB nickel pincer cofactor biosynthesis protein LarB
3415 CALUCG010000059.1 GCA943914495_01701 CDS open 5058-6449 _na     463_aa larC nickel pincer cofactor biosynthesis protein LarC
3416 CALUCG010000059.1 GCA943914495_01702 CDS open 6552-7466 _na     304_aa rarD EamA family transporter RarD
3417 CALUCG010000059.1 GCA943914495_01694 gene open 6-236 gabR
3418 CALUCG010000059.1 GCA943914495_01695 gene open 314-1141 lpxA
3419 CALUCG010000059.1 GCA943914495_01696 gene open 1388-1912
3420 CALUCG010000059.1 GCA943914495_01697 gene open 2032-2517 fabZ
3421 CALUCG010000059.1 GCA943914495_01698 gene open 2528-3271 lpxC
3422 CALUCG010000059.1 GCA943914495_01699 gene open 3532-4338 larE
3423 CALUCG010000059.1 GCA943914495_01700 gene open 4340-5110 larB
3424 CALUCG010000059.1 GCA943914495_01701 gene open 5058-6449 larC
3425 CALUCG010000059.1 GCA943914495_01702 gene open 6552-7466 rarD
3426 CALUCG010000060.1 GCA943914495_01703 CDS open 28-489 _na     153_aa Transcriptional regulator%2C Fur family
3427 CALUCG010000060.1 GCA943914495_01704 CDS open 501-1553 _na     350_aa AI-2E family transporter
3428 CALUCG010000060.1 GCA943914495_01705 CDS open 1556-2191 _na     211_aa Metallo-beta-lactamase domain protein
3429 CALUCG010000060.1 GCA943914495_01706 CDS open 2227-2676 _na     149_aa dtd D-aminoacyl-tRNA deacylase
3430 CALUCG010000060.1 GCA943914495_01707 CDS open 2678-5056 _na     792_aa GTP diphosphokinase
3431 CALUCG010000060.1 GCA943914495_01708 CDS open 5071-7074 _na     667_aa recJ single-stranded-DNA-specific exonuclease RecJ
3432 CALUCG010000060.1 GCA943914495_01703 gene open 28-489
3433 CALUCG010000060.1 GCA943914495_01704 gene open 501-1553
3434 CALUCG010000060.1 GCA943914495_01705 gene open 1556-2191
3435 CALUCG010000060.1 GCA943914495_01706 gene open 2227-2676 dtd
3436 CALUCG010000060.1 GCA943914495_01707 gene open 2678-5056
3437 CALUCG010000060.1 GCA943914495_01708 gene open 5071-7074 recJ
3438 CALUCG010000061.1 GCA943914495_01709 CDS open 675-863 _na     62_aa hypothetical protein
3439 CALUCG010000061.1 GCA943914495_01710 CDS open 911-2224 _na     437_aa Sel1 repeat family protein
3440 CALUCG010000061.1 GCA943914495_01711 CDS open 2431-3210 _na     259_aa Metal cation transporter%2C ZIP family
3441 CALUCG010000061.1 GCA943914495_01712 CDS open 3344-3796 _na     150_aa DUF1934 domain-containing protein
3442 CALUCG010000061.1 GCA943914495_01713 CDS open 3775-5439 _na     554_aa argS arginine--tRNA ligase
3443 CALUCG010000061.1 GCA943914495_01714 CDS open 5450-7066 _na     538_aa CTP synthase
3444 CALUCG010000061.1 GCA943914495_01709 gene open 675-863
3445 CALUCG010000061.1 GCA943914495_01710 gene open 911-2224
3446 CALUCG010000061.1 GCA943914495_01711 gene open 2431-3210
3447 CALUCG010000061.1 GCA943914495_01712 gene open 3344-3796
3448 CALUCG010000061.1 GCA943914495_01713 gene open 3775-5439 argS
3449 CALUCG010000061.1 GCA943914495_01714 gene open 5450-7066
3450 CALUCG010000062.1 GCA943914495_01715 CDS open 67-1005 _na     312_aa nikD Nickel import system ATP-binding protein NikD
3451 CALUCG010000062.1 GCA943914495_01716 CDS open 1008-1847 _na     279_aa ABC transporter%2C permease protein
3452 CALUCG010000062.1 GCA943914495_01717 CDS open 1844-2794 _na     316_aa ABC transporter%2C permease protein
3453 CALUCG010000062.1 GCA943914495_01718 CDS open 2791-4356 _na     521_aa ABC transporter substrate-binding protein
3454 CALUCG010000062.1 GCA943914495_01719 CDS open 4438-6612 _na     724_aa TonB-dependent siderophore receptor
3455 CALUCG010000062.1 GCA943914495_01715 gene open 67-1005 nikD
3456 CALUCG010000062.1 GCA943914495_01716 gene open 1008-1847
3457 CALUCG010000062.1 GCA943914495_01717 gene open 1844-2794
3458 CALUCG010000062.1 GCA943914495_01718 gene open 2791-4356
3459 CALUCG010000062.1 GCA943914495_01719 gene open 4438-6612
3460 CALUCG010000063.1 GCA943914495_01724 gene open 3567-3911 ssrA
3461 CALUCG010000063.1 GCA943914495_01724 tmRNA open 3567-3911 ssrA transfer-messenger RNA%2C SsrA
3462 CALUCG010000063.1 GCA943914495_01720 CDS open 114-1091 _na     325_aa G5 domain-containing protein
3463 CALUCG010000063.1 GCA943914495_01721 CDS open 1207-1638 _na     143_aa lspA signal peptidase II
3464 CALUCG010000063.1 GCA943914495_01722 CDS open 1639-2565 _na     308_aa Pseudouridine synthase
3465 CALUCG010000063.1 GCA943914495_01723 CDS open 2565-3521 _na     318_aa Peptidase family T4
3466 CALUCG010000063.1 GCA943914495_01725 CDS open 4046-4366 _na     106_aa Thioredoxin
3467 CALUCG010000063.1 GCA943914495_01726 CDS open 4477-5289 _na     270_aa thiM hydroxyethylthiazole kinase
3468 CALUCG010000063.1 GCA943914495_01727 CDS open 5279-5929 _na     216_aa Thiamine-phosphate synthase
3469 CALUCG010000063.1 GCA943914495_01720 gene open 114-1091
3470 CALUCG010000063.1 GCA943914495_01721 gene open 1207-1638 lspA
3471 CALUCG010000063.1 GCA943914495_01722 gene open 1639-2565
3472 CALUCG010000063.1 GCA943914495_01723 gene open 2565-3521
3473 CALUCG010000063.1 GCA943914495_01725 gene open 4046-4366
3474 CALUCG010000063.1 GCA943914495_01726 gene open 4477-5289 thiM
3475 CALUCG010000063.1 GCA943914495_01727 gene open 5279-5929
3476 CALUCG010000064.1 repeat_region open 4188-4885 CRISPR array with 12 repeats of length 28%2C consensus sequence TTTCTAAGCTGCCTATACGGCAGATAAC and spacer length 32
3477 CALUCG010000064.1 GCA943914495_01728 CDS open 103-561 _na     152_aa tnpA IS200/IS605 family transposase
3478 CALUCG010000064.1 GCA943914495_01729 CDS open 759-1196 _na     145_aa abiV AbiV family abortive infection protein
3479 CALUCG010000064.1 GCA943914495_01730 CDS open 1382-2644 _na     420_aa histidine kinase
3480 CALUCG010000064.1 GCA943914495_01731 CDS open 2673-3347 _na     224_aa Response regulator receiver domain protein
3481 CALUCG010000064.1 GCA943914495_01732 CDS open 3344-3964 _na     206_aa RelA/SpoT domain protein
3482 CALUCG010000064.1 GCA943914495_01728 gene open 103-561 tnpA
3483 CALUCG010000064.1 GCA943914495_01729 gene open 759-1196 abiV
3484 CALUCG010000064.1 GCA943914495_01730 gene open 1382-2644
3485 CALUCG010000064.1 GCA943914495_01731 gene open 2673-3347
3486 CALUCG010000064.1 GCA943914495_01732 gene open 3344-3964
3487 CALUCG010000065.1 GCA943914495_01733 CDS open 113-382 _na     89_aa DUF1294 domain-containing protein
3488 CALUCG010000065.1 GCA943914495_01734 CDS open 671-3526 _na     951_aa ileS isoleucine--tRNA ligase
3489 CALUCG010000065.1 GCA943914495_01735 CDS open 3708-4442 _na     244_aa Cytosolic protein
3490 CALUCG010000065.1 GCA943914495_01736 CDS open 4655-5080 _na     141_aa Hsp20/alpha crystallin family protein
3491 CALUCG010000065.1 GCA943914495_01733 gene open 113-382
3492 CALUCG010000065.1 GCA943914495_01734 gene open 671-3526 ileS
3493 CALUCG010000065.1 GCA943914495_01735 gene open 3708-4442
3494 CALUCG010000065.1 GCA943914495_01736 gene open 4655-5080
3495 CALUCG010000066.1 GCA943914495_01737 CDS open 707-2263 _na     518_aa Ppx/GppA phosphatase family
3496 CALUCG010000066.1 GCA943914495_01738 CDS open 2260-4446 _na     728_aa ppk1 polyphosphate kinase 1
3497 CALUCG010000066.1 GCA943914495_01737 gene open 707-2263
3498 CALUCG010000066.1 GCA943914495_01738 gene open 2260-4446 ppk1
3499 CALUCG010000067.1 GCA943914495_01739 CDS open 426-1655 _na     409_aa SLH domain-containing protein
3500 CALUCG010000067.1 GCA943914495_01740 CDS open 1875-2093 _na     72_aa hypothetical protein